Composition comprising nucleotide with 5'-untranslated region for enhanced gene expression and method therefor

Abstract

The present invention relates to a composition comprising a nucleotide with a 5'-untranslated region for enhanced gene expression and a method therefor. By utilizing the 5'-untranslated region exhibiting high translation efficiency, the present invention is expected to be applicable in designing mRNA vaccines for the prevention of various infectious diseases and mRNA therapeutics for the treatment of various diseases.

Description

Compositions and methods comprising nucleotides comprising a 5' untranslated region for enhanced gene expression

[0001] The present invention relates to compositions and methods comprising nucleotides comprising a 5' untranslated region for enhanced gene expression.

[0002] The efficacy and safety of mRNA vaccines have been proven through their widespread use during the COVID-19 pandemic, and research and development are underway in various fields, including infectious disease prevention vaccines and cancer treatments. mRNA vaccines consist of mRNA encapsulated in a lipid nanoparticle (LNP) carrier, which contains the sequence of the target antigen. After being injected into the body, the vaccine mRNA enters cells via the LNP carrier, where it is translated and produces the antigen. The induction of an immune response by this antigen is utilized to prevent and treat infectious diseases.

[0003] For mRNA vaccines to function effectively, sufficient antigen must be produced. Therefore, it is necessary to design mRNA with high translation efficiency. The mRNA structure consists of the CAP, 5' UTR, CDS, stop codon, 3' UTR, and poly-A tail, starting from the beginning of the sequence. The 5' UTR region, extending from the CAP to the start codon where translation begins, is a region characterized by various translational control mechanisms. Therefore, research is underway to create 5' UTR sequences with high translation efficiency.

[0004] The present inventors discovered an artificial 5' UTR sequence having optimal translation efficiency using an artificial intelligence model, and completed the present invention by confirming that a specific 5' UTR sequence exhibits high translation efficiency.

[0005] Accordingly, the present invention provides a polynucleotide comprising a 5' untranslated region (5' UTR) consisting of a base sequence (ATAGTTTATAGATAATTTTTTATTTATTCTTTTAGAGGAGTATGGTAATA) represented by SEQ ID NO: 12.

[0006] In addition, the present invention provides a recombinant vector comprising the polynucleotide.

[0007] In addition, the present invention provides a method for producing RNA with enhanced translation efficiency of a target gene, comprising the step of binding the polynucleotide of claim 1 to the 5'untranslated region of the target gene.

[0008] In addition, the present invention provides a coding region for mRNA expression of a target gene;

[0009] 5' untranslated region (UTR) located upstream of the coding region; and

[0010] A genetic structure comprising a 3' untranslated region (UTR) located downstream of the coding region,

[0011] The above 5' untranslated region (5' UTR) provides a genetic construct characterized by being composed of a base sequence represented by SEQ ID NO: 12.

[0012] In addition, the present invention provides a pharmaceutical composition comprising the genetic construct.

[0013] In addition, the present invention provides a vaccine composition comprising the genetic construct.

[0014] Hereinafter, the present invention will be described in detail.

[0015]

[0016] The present invention provides a polynucleotide comprising a 5' untranslated region (5' UTR) consisting of a base sequence (ATAGTTTATAGATAATTTTTTATTTATTCTTTTAGAGGAGTATGGTAATA) represented by SEQ ID NO: 12.

[0017] In this specification, the 5' untranslated region (5' UTR) is located 5' of the open reading frame (ORF). The 5' UTR starts at the transcription start site and ends at the nucleotide before the start codon of the open reading frame. The 5' UTR may include elements that regulate gene expression, such as a ribosome binding site. The 5' UTR may be post-transcriptionally modified, for example, by the addition of a 5' cap. The 5' UTR corresponds to the sequence of the mature mRNA located between the 5' cap and the start codon.

[0018] In this specification, "polynucleotide" means a DNA strand of a certain length or longer, which is a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain.

[0019] The polynucleotide according to the present invention may include a 5' untranslated region (5' UTR) consisting of a base sequence represented by SEQ ID NO: 12, and at this time, may also include a base sequence having a sequence homology of 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95%, 96%, 97%, 98% or 99% or more with the base sequence represented by SEQ ID NO: 12.

[0020] When the polynucleotide of the present invention includes a 5' untranslated region consisting of a base sequence represented by SEQ ID NO: 12, it can exhibit higher translation efficiency compared to a control group that does not include the untranslated region.

[0021]

[0022] Additionally, the present invention provides a recombinant vector comprising the polynucleotide of claim 1.

[0023] As used herein, "vector" refers to a means for expressing a target gene in a host cell. For example, the vector may include a plasmid vector, a cosmid vector, a bacteriophage vector, an adenovirus vector, a retrovirus vector, and a viral vector such as an adeno-associated virus vector.

[0024] Any vector that can be used as a recombinant vector can be used without limitation as long as it is a vector used in the art. Specifically, the vector can be produced using plasmids such as pCES208, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series, and pUC19, phages such as λgt4λB, λ-Charon, λΔz1, and M13, or viral vectors such as SV40, and for example, pCES208GFP vector can be used, but is not limited thereto.

[0025]

[0026] In addition, the present invention provides a method for producing RNA with enhanced translation efficiency of a target gene, comprising the step of binding the polynucleotide of claim 1 to the 5'untranslated region of the target gene.

[0027] In the present specification, the “binding step” does not simply mean physically binding each mRNA fragment, but includes a process of producing an RNA sequence in which a 5’UTR of a specific sequence and a 3’UTR of a specific sequence or a fragment thereof are bound to the 5’ end and the 3’ end, respectively, through transcription from a DNA molecule.

[0028] In one embodiment of the present invention, the 5' untranslated region may be composed of a base sequence (ATAGTTTATAGATAATTTTTTATTTATTCTTTTAGAGGAGTATGGTAATA) represented by SEQ ID NO: 12.

[0029] As used herein, “in vitro transcription” means DNA-dependent RNA synthesis in vitro, outside of a cell. Template DNA may be linearized with a suitable restriction enzyme prior to in vitro transcription. Reagents used for RNA in vitro transcription are typically, but are not limited to, polymerases such as bacteriophage-encoded RNA polymerases (T7, T3, SP6, or Syn5); ribonucleotide triphosphates (NTPs) for four bases (adenine, cytosine, guanine, and uracil), and optionally, cap analogs; modified nucleotides; RNase inhibitors, etc.

[0030] The present inventors have confirmed that when RNA comprising the 5'untranslated region of the present invention or a fragment thereof is synthesized in a cell via a DNA plasmid, as well as when the RNA synthesized via in vitro transcription is used, the target gene translation efficiency or target protein expression efficiency is increased, and thus the intracellular expression pattern can be regulated.

[0031]

[0032] In addition, the present invention provides a coding region for mRNA expression of a target gene;

[0033] 5' untranslated region (UTR) located upstream of the coding region; and

[0034] A genetic structure comprising a 3' untranslated region (UTR) located downstream of the coding region,

[0035] The above 5' untranslated region (5' UTR) provides a genetic construct characterized by being composed of a base sequence represented by SEQ ID NO: 12.

[0036] In this specification, the 3'UTR is a portion of an mRNA typically located between the protein coding region (i.e., open reading frame, ORF) of the mRNA and the poly(A) sequence. The 3'UTR of an mRNA is not translated into an amino acid sequence. The 3'UTR sequence is usually encoded by a gene, which is then transcribed into mRNA during gene expression. The genomic sequence is first transcribed into mRNA containing optional introns. The mRNA then undergoes steps such as 5' capping, splicing, and modification of the 3' end, such as polyadenylation of the 3' end, and optional endo- or exonuclease digestion. The 3'UTR includes the nucleotides immediately 3' to the stop codon in the protein coding region and immediately 5' to the poly(A) sequence.

[0037] It can be a sequence of several nucleotide triplets that can typically be translated into a peptide or protein. An open reading frame (ORF) preferably comprises a start codon, i.e., at its 5'-end, a combination of three subsequent nucleotides that typically encode the amino acid methionine (ATG or AUG), and a subsequent region that is usually a multiple of three nucleotides in length. The open reading frame (ORF) is preferably terminated by a stop codon (e.g., TAA, TAG, TGA). This is the only stop codon in the open reading frame (ORF). Therefore, in the context of the present invention, an open reading frame (ORF) is a nucleotide sequence consisting of a number of nucleotides that can be divided into three, preferably starting with a start codon (e.g., ATG or AUG) and preferably ending with a stop codon (e.g., TAA, TGA, or TAG, or UAA, UAG, UGA, respectively). An open reading frame (ORF) may be isolated or incorporated into a longer nucleic acid sequence, such as a vector or mRNA. An open reading frame (ORF) may also be referred to as a 'polypeptide or protein coding region'.

[0038] According to the present invention, a promoter and / or poly(A) sequence may be additionally included.

[0039] The promoter may be located upstream of the 5' untranslated region (UTR). The promoter may include elements necessary for transcription, such as an RNA polymerase promoter. It may include a phage RNA polymerase promoter, such as SP6 or T7, preferably a T7 promoter encoding an mRNA sequence.

[0040] The length of the poly(A) sequence can vary. For example, the poly(A) sequence can have a length of from about 20 adenine nucleotides to about 300 adenine nucleotides, preferably from about 40 to about 200 adenine nucleotides, more preferably from about 50 to about 100 adenine nucleotides, such as from about 60, 70, 80, 90, or 100 adenine nucleotides.

[0041] The poly(A) sequence may be located downstream of the 3' untranslated region (UTR). For example, the poly(A) sequence may be linked directly or via a linker, for example, via a linker of 1-50, preferably 1-20 nucleotides, or via a stretch of nucleotides, such as 2, 4, 6, 8, 10, 20, etc. nucleotides.

[0042]

[0043] The present invention also provides a pharmaceutical composition comprising the genetic construct. In one embodiment of the present invention, the pharmaceutical composition may be used for the prevention or treatment of an infectious disease.

[0044]

[0045] Additionally, the present invention provides a vaccine composition comprising the genetic construct. In one embodiment of the present invention, the vaccine composition may be used to prevent an infectious disease.

[0046] In one embodiment of the present invention, the genetic construct includes the 5' untranslated region of the present invention, thereby increasing the expression of the target gene of the coding region, thereby exhibiting an excellent preventive and therapeutic effect on infectious diseases.

[0047] In this specification, “prevention” means any act of suppressing or delaying the onset of an infectious disease by administering a pharmaceutical composition according to the present invention.

[0048] In this specification, “treatment” means any action by which the symptoms of an infectious disease are improved or beneficially changed by administration of a pharmaceutical composition according to the present invention.

[0049] In one embodiment of the present invention, the composition may include a delivery means for delivering a target gene (mRNA, etc.) expressed in the composition.

[0050] In one embodiment of the present invention, the expressed mRNA may be delivered via nanoparticles. For example, the delivery may be via gold nanoparticles, DNA nanostructures, exosomes, or liposomes.

[0051] In one embodiment of the present invention, a peptide may be used for the mRNA delivery. The peptide must have a cationic charge to electrostatically interact with the anionic phosphate group of the nucleic acid, and may include a positively charged amino acid to electrostatically interact with the phosphate group.

[0052] The content and administration method of the active ingredients, etc. included in the composition of the present invention can be determined by a person skilled in the art based on the symptoms and severity of the disease of a typical patient. Furthermore, the composition can be formulated in various forms, such as powders, tablets, capsules, liquids, injections, ointments, and syrups, and can also be provided in unit-dose or multi-dose containers, such as sealed ampoules and bottles.

[0053] The composition of the invention can be administered orally or parenterally. The route of administration of the composition according to the present invention is not limited to these, but includes, but is not limited to, intrabronchial, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, enteral, sublingual, or topical administration. The dosage of the composition according to the present invention varies depending on the patient's weight, age, sex, health condition, diet, administration time, method, excretion rate, or disease severity, and can be easily determined by a person skilled in the art. In addition, the composition of the present invention can be formulated into a suitable dosage form using known techniques for clinical administration.

[0054]

[0055] In addition, the present invention provides a method for preventing or treating an infectious disease, comprising administering to a subject a pharmaceutical composition comprising, as an active ingredient, a genetic construct comprising a 5' untranslated region (5' UTR) consisting of a base sequence represented by SEQ ID NO: 12.

[0056] In the present invention, the term "subject" means a subject requiring treatment for a disease, and more specifically, a mammal such as a human or non-human primate, mouse, rat, dog, cat, horse, or cow.

[0057] In addition, the present invention provides a composition comprising, as an active ingredient, a genetic construct comprising a 5' untranslated region (5' UTR) consisting of a base sequence represented by SEQ ID NO: 12, for use in preventing or treating an infectious disease.

[0058]

[0059] As used herein, "nucleic acid" preferably refers to DNA or RNA. In relation to the nucleic acid, the terms "polynucleotide," "nucleotide," "nucleotide sequence," and "oligonucleotide" are used interchangeably. Polynucleotides may comprise polymeric forms of nucleotides of any length, deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure and may perform any function, known or unknown. Polynucleotides may include one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. Modifications to the nucleotide structure may occur before or after polymer assembly.

[0060] Preferably, a nucleic acid is a polymer comprising or consisting of nucleotide monomers covalently linked to each other by phosphodiester bonds in a sugar / phosphate backbone. "Nucleic acid" includes modified nucleic acids, such as base-modified, sugar-modified, or backbone-modified DNA or RNA molecules.

[0061] The above DNA is an abbreviation for deoxyribonucleic acid. It is a polymer made of nucleic acid molecules, or nucleotides. These nucleotides are usually monomers of deoxyadenosine monophosphate, deoxythymidine monophosphate, deoxyguanosine monophosphate, and deoxycytidine monophosphate, and are composed of a sugar (deoxyribose), a base, and a phosphate, and are polymerized by a unique backbone structure. The backbone structure is typically formed by the sugar moiety of the first nucleotide, the deoxyribose, and the phosphate moiety of the second nucleotide, and the phosphodiester bond between adjacent monomers. The specific order of the monomers, i.e., the order of the bases linked to the sugar / phosphate backbone, is called the DNA sequence. DNA can be single-stranded or double-stranded. In double-stranded form, nucleotides of the first strand typically hybridize with nucleotides of the second strand, for example, by A / T base pairing and G / C base pairing.

[0062] RNA includes, for example, mRNA. RNA is usually an abbreviation for ribonucleic acid. It is a polymer composed of nucleic acid molecules, or nucleotides. Nucleotides are usually monomers of adenosine monophosphate, uridine monophosphate, guanosine monophosphate, and cytidine monophosphate, linked together by a so-called backbone. The backbone is formed first by a sugar, such as ribose, and second by phosphodiester bonds between adjacent monomers, the phosphate moieties. The specific sequence of monomers is called an RNA sequence. RNA can usually be obtained by transcription of a DNA sequence, for example, within a cell. In eukaryotic cells, transcription typically occurs in the nucleus or mitochondria. In the body, DNA transcription can usually be processed into mRNA, messenger RNA. For example, RNA processing within eukaryotic cells involves various post-transcriptional modifications, such as splicing, 5'-capping, polyadenylation, and export from the nucleus or mitochondria. Messenger RNA (MRNA) typically provides a nucleotide sequence that can be translated into the amino acid sequence of a specific peptide or protein. Typically, mRNA contains a 5'-cap, a 5'UTR, an open reading frame (ORF), a 3'UTR, and a poly(A) sequence. Aside from messenger RNA, several non-coding forms of RNA exist that can be involved in the regulation of transcription and / or translation.

[0063] The 5' UTR sequence of the present invention exhibits high translation efficiency and can be used in the design of mRNA vaccines for preventing various infectious diseases and mRNA therapeutics for treating various diseases.

[0064] Figure 1 is a schematic diagram showing a method for confirming a candidate sequence.

[0065] Figure 2 is a diagram showing the results of confirming the protein expression ability of IVT mRNAs having different 5'-UTR sequences for 6 hours.

[0066] Figure 3 is a diagram showing the results of confirming the protein expression ability of IVT mRNAs having different 5'-UTR sequences for 24 hours.

[0067] Figure 4 is a diagram showing the results of confirming the protein expression ability of IVT mRNAs having different 5'-UTR sequences for 48 hours.

[0068] Figure 5 shows the P values ​​for the protein expression ability of IVT mRNAs with different 5'-UTR sequences at 6 and 24 hours. (*p < 0.05; **p < 0.01; ***p < 0.001)

[0069] Hereinafter, preferred experimental examples and examples are presented to aid in understanding the present invention. However, the following examples are provided solely to facilitate a better understanding of the present invention and are not intended to limit the scope of the present invention.

[0070]

[0071] Experimental examples and examples

[0072] Example 1. Preparation of DNA template for IVT using pDNA as a template

[0073] A DNA template for in vitro transcription (IVT) was synthesized by PCR using a DNA vector containing an open reading frame (ORF) encoding a model protein (red fluorescent protein; dsRed) and different 5'-UTR sequences. The forward primer (FP) was attached upstream of the T7 promoter, and the reverse primer (RP) was attached to the end of the 3'-UTR and contained a 120-nt T for introduction of a poly(A) tail.

[0074] The sequences of the primers and PCR products (DNA templates for IVT) used in the present examples and experimental examples are shown in Table 1 below. In addition, the 5'-UTR sequences are shown in Table 2 below.

[0075]

[0076] Name Sequence Sequence Number 9 to 1AGTCCCTACGGCGCATAAGAGTTCCACATCTGACGAAGAACCACC91 to 25GGCATCACTTAAACAATATAACCATTGACGGACAACGGTACCACC10147 to 105CTCTTATATTTCTTCTTACTCTTCTTTTTCTCTCTTATTTCCCACC11Epoc40ATAGTTTATAGATAATTTTTTATTTATTCTTTTAGAGGAGTATGGTAATA12BNTGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC13MdnGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACC14

[0077]

[0078] PCR was performed using TOPsimple™ PCR DryMIX-Forte (enzynomics, Korea), and the specific PCR conditions are shown in Tables 3 and 4 below. The amplified PCR reaction products were purified using AccuPrep® PCR Purification Kit (Bioneer, Korea).

[0079]

[0080]

[0081]

[0082] Example 2. Production of IVT mRNA using DNA as a template

[0083] In vitro transcription (IVT) was performed using the DNA template prepared in the above example to synthesize IVT mRNA. Specifically, the DNA template was mixed with T7 RNA polymerase, rATP, rCTP, rGTP, rUTP, and a cap analogue and incubated at 37°C for 2 hours to perform in vitro transcription. After the reaction was completed, 1 μl of Turbo DNase I was added and the mixture was incubated at 37°C for 15 minutes to remove the template DNA, and only the synthesized mRNA was purified using the RNeasy Mini Kit (Qiagen, USA). All components, volumes, and concentrations of the reaction solution are as shown in Table 5 below. The mRNA synthesized through this method includes a 5'-cap at the 5' end, which is produced by adding a cap analogue to the transcription reaction.

[0084]

[0085]

[0086] Experimental Example 1. Evaluation of the protein expression ability of IVT mRNA.

[0087] (1) 6 hours and 24 hours

[0088] The protein expression ability of IVT mRNAs with different 5'-UTR sequences prepared in the above examples was confirmed at 6 and 24 hours. Specifically, HEK 293T cells were seeded at 2.0 x 10 per well in a 96-well plate. 4 Cells were seeded in a 5 × 10 cell culture dish and transfected with IVT mRNA at a dose of 100 ng mRNA / well using a transfection reagent (Lipofectamine™ 2000, Invitrogen, USA). After transfection, intracellular RFP expression efficiency was measured over time using a microplate reader.

[0089] As a result, the 5' UTR sequence generated from the generator of the Epoch 40 model showed higher expression efficiency than the sequences of Mdn and BNT. Specifically, when compared with Epoch 40, the P value was 0.0317 for BNT and 0.0187 for Mdn at 6 hours (h), and 0.0037 for BNT and 0.0053 for Mdn at 24 hours (see Figures 2 and 3).

[0090] (2) 48 hours

[0091] The protein expression ability of IVT mRNAs with different 5'-UTR sequences prepared in the above examples was confirmed at 48 hours. Specifically, HEK 293T cells were seeded at 1.0 x 10 per well in a 96-well plate. 4 Cells were seeded and transfected with IVT mRNA at a dose of 100 ng mRNA / well using a transfection reagent (Lipofectamine™ 2000, Invitrogen, USA). After aspiration, no washing was performed, and 100 μl of lysis buffer was used. The intracellular RFP expression efficiency was measured over time using a microplate reader.

[0092] As a result, the 5' UTR sequence generated from the Epoch 40 model generator showed expression levels similar to those of Mdn and BNT. This suggests that the 5' UTR sequence generated from the Epoch 40 model generator can maintain protein expression levels comparable to those of BNT and Mdn.

[0093]

[0094] Comprehensively considering the protein expression levels at 6, 24, and 48 hours from the above results, it can be confirmed that the protein expression level is high when the 5' UTR sequence generated from the Epoch 40 model generator of the present invention is included. This is expected to be utilized in the design of various infectious disease and cancer prevention vaccines and treatments.

Claims

1. A polynucleotide comprising a 5' untranslated region (5' UTR) consisting of the base sequence (ATAGTTTATAGATAATTTTTTATTTATTCTTTTAGAGGAGTATGGTAATA) represented by sequence number 12.

2. A recombinant vector comprising the polynucleotide of claim 1.

3. A method for producing RNA with enhanced translation efficiency of a target gene, comprising the step of binding the polynucleotide of claim 1 to the 5'untranslated region of the target gene.

4. A method for producing RNA with enhanced translation efficiency of a target gene, wherein the RNA is produced through in vitro transcription in claim 3.

5. Coding region for mRNA expression of the target gene; 5' untranslated region (UTR) located upstream of the coding region; and A genetic structure comprising a 3' untranslated region (UTR) located downstream of the coding region, A genetic construct characterized in that the above 5' untranslated region (5' UTR) is composed of a base sequence represented by sequence number 12.

6. A pharmaceutical composition comprising the genetic construct of claim 5.

7. The pharmaceutical composition of claim 6 is a composition for preventing or treating an infectious disease.

8. A vaccine composition comprising the genetic construct of claim 5.

9. The vaccine composition of claim 8 is a composition for preventing infectious diseases.

10. A method for preventing or treating an infectious disease, comprising administering to a subject a pharmaceutical composition comprising, as an active ingredient, a genetic construct comprising a 5' untranslated region (5' UTR) consisting of a base sequence represented by sequence number 12.

11. Use of a composition for the prevention or treatment of an infectious disease, comprising as an active ingredient a genetic construct comprising a 5' untranslated region (5' UTR) consisting of a base sequence represented by sequence number 12.

Images