Probiotic animal feed compositions

Abstract

The present invention provides improved probiotic animal feed and feed additive compositions incorporating a microbe in combination with mannanase, and methods of treating animals with the improved probiotic animal feed and feed additive compositions. Also provided are methods for improving the performance of a subject or for improving digestibility of a raw material in a feed, improving feed conversion ratio, improving weight gain in a subject, improving feed efficiency in a subject, improving the immune response of the subject, promoting the growth of beneficial bacteria in the gastrointestinal tract of a subject, reducing populations of pathogenic bacteria in the gastrointestinal tract of a subject, and reducing nutrient excretion in feces, comprising administering to a subject a microbe in combination with mannanase.

Description

PROBIOTIC ANIMAL FEED COMPOSITIONSFIELD OF THE INVENTION

[0001] The present invention relates to improved probiotic animal feed and feed additive compositions incorporating a microbe in combination with an enzyme, and to methods of treating animals with the improved probiotic animal feed and feed additive compositions.BACKGROUND

[0002] Supplemental enzymes are used as additives in animal feed to improve nutrient utilization and production performance characteristics. The concept of probiotics involves the feeding of beneficial microbes to animals such as livestock when they are undergoing periods of stress including disease, ration changes, and environmental or production challenges. Probiotics have been shown to improve animal performance in controlled studies. Although combinations of probiotics with enzymes have been contemplated, the interaction between probiotics and enzymes in animal feed compositions has never been fully understood. The present invention relates to novel specific combinations of probiotics and enzymes which surprisingly significantly improve growth performance, intestinal barrier function, and gut microbiota characteristics of animals.SUMMARY OF THE INVENTION

[0003] A seminal finding of the present invention is that a microbe in combination with β-mannanase has significant beneficial effects on the performance of an animal.

[0004] In particular, a seminal finding of the present invention is that Bacillus subtilis in combination with β-mannanase has significant beneficial effects on the performance of an animal, including improving one or more of the following: improved growth performance, intestinal barrier function, and microbial balance in an animal.

[0005] In one aspect, the present invention provides a feed additive composition comprising (or consisting essentially of or consisting of) a Bacillus subtilis microbe in combination with a β-mannanase.

[0006] In another aspect, the present invention provides a method for improving the performance of a subject or for improving digestibility of a raw material in a feed (e.g. nutrient digestibility) , or for improving feed conversion ratio (FCR) or for improving weight gain in a subject or for improving feed efficiency in a subject or for modulating (e.g. improving) the immune response of the subject or for promoting the growth of beneficial bacteria in the gastrointestinal tract of a subject, or for reducing populations of pathogenic bacteria in the gastrointestinal tract of a subject, or for reducing nutrient excretion in feces, which method comprising administering to a subject a Bacillus subtilis microbe in combination with a β-mannanase.

[0007] A further aspect of the present invention is use of a Bacillus subtilis microbe in combination with a β-mannanase for improving the performance of a subject or for improving digestibility of a raw material in a feed (e.g. nutrient digestibility, or for improving feed conversion ratio (FCR) , or for improving weight gain in a subject or for improving feed efficiency in a subject, or for modulating (e.g. improving) the immune response of the subject, or for promoting the growth of beneficial bacteria in the gastrointestinal tract of a subject, or for reducing populations of pathogenic bacteria in the gastrointestinal tract of a subject, or for reducing nutrient excretion in feces.

[0008] In a further aspect, the present invention provides a kit comprising a Bacillus subtilis microbe, a β-mannanase (and optionally at least one vitamin and / or optionally at least one mineral) , and instructions for administration.

[0009] In another aspect, the present invention provides a method of preparing a feed additive composition, comprising admixing a Bacillus subtilis microbe with a β-mannanase and (optionally) packaging.

[0010] In a yet further aspect, the present invention provides feed or feedstuff comprising a feed additive composition comprising (or consisting essentially of or consisting of) a Bacillus subtilis microbe in combination with a β-mannanase.

[0011] In another aspect, the present invention provides a premix comprising a feed additive composition comprising (or consisting essentially of or consisting of) a Bacillus subtilis microbe in combination with a β-mannanase, and at least one mineral and / or at least one vitamin.

[0012] In another aspect, the present invention provides a method of preparing a feedstuff comprising admixing a feed component with a feed additive composition comprising (or consisting essentially of or consisting of) a Bacillus subtilis microbe in combination with a β-mannanase.

[0013] Other objects and features will be in part apparent and in part pointed out hereinafter.BRIEF DESCRIPTION OF THE DRAWINGS

[0014] FIG. 1 shows the effects of dietary Bacillus subtilis QST713 and β-mannanase supplementation on Escherichia coli and Clostridium perfringens levels in weaned piglets (n =16) . Different lower-case letters indicate significant differences in treatment groups (P < 0.05) . A Escherichia coli data on different days; B Clostridium perfringens data on different days.

[0015] FIG. 2 shows the effects of dietary Bacillus subtilis QST713 and β-mannanase supplementation on β-diversity levels in weaned piglets (n = 16) . A, B, and C show principal component analysis score plots for gut microbiota on days 1, 21, and 42, respectively.

[0016] FIG. 3 shows linear discriminant analysis effect-size (LEfSe) of gut microbiota (n = 16) . A, B, and C show cladogram plots of LEfSe analyses on days 1, 21, and 42, respectively. D and F show histograms of linear discriminant analysis (LDA) scores (threshold: 2.0) on days 21 and 42, respectively.

[0017] FIG. 4 shows the effects of dietary Bacillus subtilis QST713 and β-mannanase supplementation on Bacillus subtilis QST713 levels in weaned piglets. Data were expressed as the mean ± standard error of the mean (n = 16) , *P < 0.05.DETAILED DESCRIPTION

[0018] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 20 ED., John Wiley and Sons, New York (1994) , and Hale &Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, N. Y. (1991) provide one of skill with a general dictionary of many of the terms used in this disclosure.

[0019] This disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of this disclosure. Numeric ranges are inclusive of the numbers defining the range.

[0020] The headings provided herein are not limitations of the various aspects or embodiments of this disclosure. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

[0021] Other definitions of terms may appear throughout the specification. Before the exemplary embodiments are described in more detail, this disclosure is not limited to particular embodiments described, and as such, may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.

[0022] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within this disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within this disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in this disclosure.

[0023] It must be noted that as used herein and in the appended claims, the singular forms “a” , “an” , and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “an enzyme” includes a plurality of such candidate agents and reference to “the feed” includes reference to one or more feeds and equivalents thereof known to those skilled in the art, and so forth.

[0024] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that such publications constitute prior art to the claims appended hereto.

[0025] The enzymes for use in the present invention can be produced either by solid or submerged culture, including batch, fed-batch and continuous-flow processes. Culturing is accomplished in a growth medium comprising an aqueous mineral salts medium, organic growth factors, the carbon and energy source material, molecular oxygen, and, of course, a starting inoculum of one or more particular microorganism species to be employed.

[0026] Microbes

[0027] The term “microbe” herein is used interchangeably with “microorganism” .

[0028] In one preferred embodiment the microbe comprises a viable bacteria.

[0029] The term “viable microorganism” means a microorganism which is metabolically active or able to differentiate.

[0030] The microorganism may be a naturally occurring microorganism or it may be a transformed microorganism. The microorganism may also be a combination of suitable microorganisms.

[0031] Preferably, the microbe according to the present invention is a probiotic microorganism.

[0032] Preferably, the microbe is a combination comprising two or more bacteria, e.g., three or more or four or more; or the microbe is a combination comprising two or more bacterial strains, e.g., three or more or four or more.

[0033] Preferably, the bacterium or bacteria is or are isolated.

[0034] In one embodiment, the microbe may be selected from the following Bacillus spp: Bacillus subtilis, Bacillus cereus, Bacillus licheniformis and Bacillus amyloliquefaciens.

[0035] In one embodiment, the microbe may be a combination comprising two or more Bacillus strains.

[0036] In one embodiment, the microbe may be B. subtilis QST713 (Baymix Grobig BS; Elanco, Shanghai, China) . This strain is publically available from the Agricultural Research Service Culture Collection (NRRL) .

[0037] Preferably, the microbe to be used in accordance with the present invention is a microorganism which is generally recognised as safe and, which is preferably GRAS approved.

[0038] A skilled person will readily be aware of specific species and or strains of microorganisms from within the genera described herein which are used in the food and / or agricultural industries and which are generally considered suitable for animal consumption.

[0039] Preferably, the microbe used in accordance with the present invention is one which is suitable for animal consumption.

[0040] Advantageously, where the product is a feed or feed additive composition, the viable microbe should remain effective through the normal “sell-by” or “expiration” date of the product during which the feed or feed additive composition is offered for sale by the retailer. The desired lengths of time and normal shelf life will vary from feedstuff to feedstuff and those of ordinary skill in the art will recognise that shelf-life times will vary upon the type of feedstuff, the size of the feedstuff, storage temperatures, processing conditions, packaging material and packaging equipment.

[0041] In some embodiments, the microbe is tolerant to heat, i.e., is thermotolerant. This is particularly the case where the feed is pelleted. Therefore, in one embodiment the microbe may be a thermotolerant microorganism, such as a thermotolerant bacteria.

[0042] In some embodiments, it may be preferable that the microbe is a spore producing bacteria, such as Bacilli, e.g., Bacillus spp. Bacilli are able to from stable endospores when conditions for growth are unfavorable and are very resistant to heat, pH, moisture and disinfectants.

[0043] In one embodiment, the microbe may decrease or prevent intestinal establishment of pathogenic microorganism (such as Clostridium perfringens and / or E. coli. ) .

[0044] In one embodiment, the microbe as used here is a composition comprising one or more microbes as described herein. The composition may additionally comprise an enzyme of the present invention. The composition can be fed to an animal as a direct-fed microbe. One or more carrier (s) or other ingredients can be added to the microbe. The microbe may be presented in various physical forms, for example, as a top dress, as a water-soluble concentrate for use as a liquid drench or to be added to a milk replacer, gelatin capsule, or gels. In one embodiment of the top dress form, freeze-dried fermentation product is added to a carrier, such as whey, maltodextrin, sucrose, dextrose, limestone (calcium carbonate) , rice hulls, yeast culture, dried starch, and / or sodium silico aluminate. In one embodiment of the water soluble concentrate for a liquid drench or milk replacer supplement, freeze-dried fermentation product is added to a water soluble carrier, such as whey, maltodextrin, sucrose, dextrose, dried starch, sodium silico aluminate, and a liquid is added to form the drench or the supplement is added to milk or a milk replacer. In one embodiment of the gelatin capsule form, freeze-dried fermentation product is added to a carrier, such as whey, maltodextrin, sugar, limestone (calcium carbonate) , rice hulls, yeast culture dried starch, and / or sodium silico aluminate. In one embodiment, the bacteria and carrier are enclosed in a degradable gelatin capsule. In one embodiment of the gels form, freeze-dried fermentation product is added to a carrier, such as vegetable oil, sucrose, silicon dioxide, polysorbate 80, propylene glycol, butylated hydroxyanisole, citric acid, ethoxyquin, and / or artificial coloring to form the gel.

[0045] The microbe (s) may optionally be admixed with a dry formulation of additives including but not limited to growth substrates, enzymes, sugars, carbohydrates, extracts and growth promoting micro-ingredients. The sugars could include the following: lactose; maltose; dextrose; maltodextrin; glucose; fructose; mannose; tagatose; sorbose; raffinose; and galactose. The sugars range from 50-95%by weight, either individually or in combination. The extracts could include yeast or dried yeast fermentation solubles ranging from 5-50%by weight. The growth substrates could include: trypticase, ranging from 5-25%by weight; sodium lactate, ranging from 5-30%by weight; and, Tween 80, ranging from 1-5%by weight. The carbohydrates could include mannitol, sorbitol, adonitol and arabitol. The carbohydrates range from 5-50%by weight individually or in combination. The micro-ingredients could include the following: calcium carbonate, ranging from 0.5-5.0%by weight; calcium chloride, ranging from 0.5-5.0%by weight; dipotassium phosphate, ranging from 0.5-5.0%by weight; calcium phosphate, ranging from 0.5-5.0%by weight; manganese proteinate, ranging from 0.25-1.00%by weight; and, manganese, ranging from 0.25-1.0%weight.

[0046] To prepare microbe (s) described herein, the culture (s) and carrier (s) (where used) can be added to a ribbon or paddle mixer and mixed for about 15 minutes, although the timing can be increased or decreased. The components are blended such that a uniform mixture of the cultures and carriers result. The final product is preferably a dry, flowable powder. The microbe (s) or composition comprising same can then be added to animal feed or a feed premix, added to an animal's water, or administered in other ways known in the art (preferably simultaneously with the enzymes of the present invention) . A feed for an animal can be supplemented with one or more microbe (s) described herein or with a composition described herein.

[0047] The microbe may be dosed appropriately.

[0048] Suitably dosages of microbe in the feed may be between about 1×103 CFU / g feed to about 1×109 CFU / g feed, suitably between about 1×104 CFU / g feed to about 1×108 CFU / g feed, suitably between about 7.5×104 CFU / g feed to about 1×107 CFU / g feed.

[0049] In one embodiment, the microbe is dosed in the feedstuff at more than about 1×103 CFU / g feed, suitably more than about 1×104 CFU / g feed, suitably more than about 7.5×104 CFU / g feed.

[0050] Suitably dosages of microbe in the feed additive composition may be between about 1×105 CFU / g composition to about 1×1013 CFU / g composition, suitably between about 1×106 CFU / g composition to about 1×1012 CFU / g composition, suitably between about 3.75×107 CFU / g composition to about 1×1011 CFU / g composition.

[0051] In one embodiment, the microbe is dosed in the feed additive composition at more than about 1×105 CFU / g composition, suitably more than about 1×106 CFU / g composition, suitably more than about 3.75×107 CFU / g composition.

[0052] In one embodiment the microbe is dosed in the feed additive composition at more than about 2×105 CFU / g composition, suitably more than about 2×106 CFU / g composition, suitably more than about 3.75×107 CFU / g composition.

[0053] As used herein the term “CFU” means colony forming units and is a measure of viable cells in which a colony represents an aggregate of cells derived from a single progenitor cell.

[0054] Mannanase

[0055] Mannanase is the name given to a class of enzymes which degrade the polysaccharides made from mannose, which is a simple sugar.

[0056] The mannanase for use in the present invention may be any commercially available mannanase.

[0057] Suitably the mannanase may be a β-mannanase.

[0058] One embodiment of the present invention relates to a microbe in combination with a mannanase, e.g., β-mannanase.

[0059] Suitably, the mannanase for use in the present invention may be a mannanase from Bacillus, Trichoderma, Thermomyces, Aspergillus and Penicillium.

[0060] In one embodiment the mannanase may be a β-mannanase available commercially as Hemicell XT, made by Elanco, Shanghai, China.

[0061] Preferably, the mannanase is present in the feedstuff in range of about 500 U / kg to about 16,000 U / kg feed, more preferably about 750 U / kg feed to about 8000 U / kg feed, and even more preferably about 1000 U / kg feed to about 4000 U / kg feed.

[0062] In one embodiment the mannanse is present in the feedstuff at more than about 500 U / kg feed, suitably more than about 600 U / kg feed, suitably more than about 700 U / kg feed, suitably more than about 800 U / kg feed, suitably more than about 900 U / kg feed, suitably more than about 1000 U / kg feed.

[0063] In one embodiment the mannanase is present in the feedstuff at less than about 16,000 U / kg feed, suitably less than about 8000 U / kg feed, suitably less than about 7000 U / kg feed, suitably less than about 6000 U / kg feed, suitably less than about 5000 U / kg feed, suitably less than about 4000 U / kg feed.

[0064] Preferably, the mannanase is present in the feed additive composition in range of about 100 U / g to about 320,000 U / g composition, more preferably about 300 U / g composition to about 160,000 U / g composition, and even more preferably about 500 U / g composition to about 50,000 U / g composition, and even more preferably about 500 U / g composition to about 40,000 U / g composition.

[0065] In one embodiment the mannanase is present in the feed additive composition at more than about 100 U / g composition, suitably more than about 200 U / g composition, suitably more than about 300 U / g composition, suitably more than about 400 U / g composition, suitably more than about 500 U / g composition.

[0066] In one embodiment the mannanase is present in the feed additive composition at less than about 300,000 U / g composition, suitably less than about 150,000 U / g composition, suitably less than about 50,000 U / g composition, suitably less than about 40,000 U / g composition, suitably less than about 30000 U / g composition.

[0067] Formulations

[0068] The microbe and the enzymes may be formulated in any suitable way to ensure that the formulation comprises viable microbe (s) and active enzymes.

[0069] In one embodiment the microbe and enzymes may be formulated as a liquid, a dry powder or a granule.

[0070] The dry powder or granules may be prepared by means known to those skilled in the art, such as, in top-spray fluid bed coater, in a buttom spray Wurster or by drum granulation (e.g., high sheer granulation) , extrusion, pan coating or in a microingredients mixer.

[0071] For some embodiments the microbe and / or the enzyme (s) may be coated, for example encapsulated. Suitably the microbe and enzymes may be formulated within the same coating or encapsulated within the same capsule. Alternatively one or two or three or four of the enzymes may be formulated within the same coating or encapsulated within the same capsule and the microbe could be formulated in a coating separate to the one or more or all of the enzymes. In some embodiments, such as where the microbe is capable of producing endospores, the microbe may be provided without any coating. In such circumstances, the microbe endospores may be simply admixed with one or two or three or four enzymes. In the latter case, the enzymes may be coated, e.g., encapsulated, for instance one or more or all of the enzymes may be coated, e.g. encapsulated. The enzymes may be encapsulated as mixtures (i.e., comprising one or more, two or more, three or more or all) of enzymes or they may be encapsulated separately, e.g., as single enzymes. In one preferred embodiment all four enzymes may be coated, e.g., encapsulated, together. In one embodiment the coating protects the enzymes from heat and may be considered a thermoprotectant.

[0072] In one embodiment the feed additive composition may be formulated to a granule for feed compositions comprising: a core; an active agent; and at least one coating, the active agent of the granule retaining at least 50%activity, at least 60%activity, at least 70%activity, at least 80%activity after conditions selected from one or more of a) a feed pelleting process, b) steam-heated feed pretreatment process, c) storage, d) storage as an ingredient in an unpelleted mixture, and e) storage as an ingredient in a feed base mix or a feed premix comprising at least one compound selected from trace minerals, organic acids, reducing sugars, vitamins, choline chloride, and compounds which result in an acidic or a basic feed base mix or feed premix.

[0073] With regard to the granule at least one coating may comprise a moisture hydrating material that constitutes at least 55%w / w of the granule; and / or at least one coating may comprise two coatings. The two coatings may be a moisture hydrating coating and a moisture barrier coating. In some embodiments, the moisture hydrating coating may be between 25%and 60%w / w of the granule and the moisture barrier coating may be between 2%and 15%w / w of the granule. The moisture hydrating coating may be selected from inorganic salts, sucrose, starch, and maltodextrin and the moisture barrier coating may be selected from polymers, gums, whey and starch.

[0074] The granule may be produced using a feed pelleting process and the feed pretreatment process may be conducted between 70℃. and 95℃. for up to several minutes, such as between 85℃. and 95℃.

[0075] In one embodiment the feed additive composition may be formulated to a granule for animal feed comprising: a core; an active agent, the active agent of the granule retaining at least 80%activity after storage and after a steam-heated pelleting process where the granule is an ingredient; a moisture barrier coating; and a moisture hydrating coating that is at least 25%w / w of the granule, the granule having a water activity of less than 0.5 prior to the steam-heated pelleting process.

[0076] The granule may have a moisture barrier coating selected from polymers and gums and the moisture hydrating material may be an inorganic salt. The moisture hydrating coating may be between 25%and 45%w / w of the granule and the moisture barrier coating may be between 2%and 10%w / w of the granule.

[0077] The granule may be produced using a steam-heated pelleting process which may be conducted between 85℃. and 95℃., for up to several minutes.

[0078] In some embodiments the microbe may be diluted using a diluent, such as starch powder, lime stone or the like.

[0079] In one embodiment, the composition is in a liquid formulation suitable for consumption preferably such liquid consumption contains one or more of the following: a buffer, salt, sorbitol and / or glycerol.

[0080] In another embodiment the feed additive composition may be formulated by applying, e.g., spraying, the enzyme (s) onto a carrier substrate, such as ground wheat for example.

[0081] In one embodiment the feed additive composition according to the present invention may be formulated as a premix. By way of example only the premix may comprise one or more feed components, such as one or more minerals and / or one or more vitamins.

[0082] In one embodiment the microbe and / or enzymes for use in the present invention are formulated with at least one physiologically acceptable carrier selected from at least one of maltodextrin, limestone (calcium carbonate) , cyclodextrin, wheat or a wheat component, sucrose, starch, Na2SO4, Talc, PVA, sorbitol, benzoate, sorbiate, glycerol, sucrose, propylene glycol, 1, 3-propane diol, glucose, parabens, sodium chloride, citrate, acetate, phosphate, calcium, metabisulfite, formate and mixtures thereof.

[0083] Packaging

[0084] In one embodiment the feed additive composition and / or premix and / or feed or feedstuff according to the present invention is packaged.

[0085] In one preferred embodiment the feed additive composition and / or premix and / or feed or feedstuff is packaged in a bag, such as a paper bag.

[0086] In an alternative embodiment the feed additive composition and / or premix and / or feed or feedstuff may be sealed in a container. Any suitable container may be used.

[0087] Feed

[0088] [Rectified under Rule 91, 13.11.2023]The feed additive composition of the present invention may be used as-or in the preparation of-a feed.

[0089] The term “feed” is used synonymously herein with “feedstuff” .

[0090] The feed may be in the form of a solution or as a solid, depending on the use and / or the mode of application and / or the mode of administration.

[0091] [Rectified under Rule 91, 13.11.2023]When used as-or in the preparation of-a feed-such as functional feed-the composition of the present invention may be used in conjunction with one or more of: a nutritionally acceptable carrier, a nutritionally acceptable diluent, a nutritionally acceptable excipient, a nutritionally acceptable adjuvant, a nutritionally active ingredient.

[0092] In a preferred embodiment the feed additive composition of the present invention is admixed with a feed component to form a feedstuff.

[0093] The term “feed component” as used herein means all or part of the feedstuff. Part of the feedstuff may mean one constituent of the feedstuff or more than one constituent of the feedstuff, e.g., 2 or 3 or 4. In one embodiment the term “feed component” encompasses a premix or premix constituents.

[0094] Preferably the feed may be a fodder, or a premix thereof, a compound feed, or a premix thereof. In one embodiment the feed additive composition according to the present invention may be admixed with a compound feed, a compound feed component or to a premix of a compound feed or to a fodder, a fodder component, or a premix of a fodder.

[0095] The term “fodder” as used herein means any food which is provided to an animal (rather than the animal having to forage for it themselves) . Fodder encompasses plants that have been cut.

[0096] The term fodder includes hay, straw, silage, compressed and pelleted feeds, oils and mixed rations, and also sprouted grains and legumes.

[0097] Fodder may be obtained from one or more of the plants selected from: alfalfa (lucerne) , barley, birdsfoot trefoil, brassicas, Chau moellier, kale, rapeseed (canola) , rutabaga (swede) , turnip, clover, alsike clover, red clover, subterranean clover, white clover, grass, false oat grass, fescue, Bermuda grass, brome, heath grass, meadow grasses (from naturally mixed grassland swards, orchard grass, rye grass, Timothy-grass, corn (maize) , millet, oats, sorghum, soybeans, trees (pollard tree shoots for tree-hay) , wheat, and legumes.

[0098] The term “compound feed” means a commercial feed in the form of a meal, a pellet, nuts, cake or a crumble. Compound feeds may be blended from various raw materials and additives. These blends are formulated according to the specific requirements of the target animal.

[0099] Compound feeds can be complete feeds that provide all the daily required nutrients, concentrates that provide a part of the ration (protein, energy) or supplements that only provide additional micronutrients, such as minerals and vitamins.

[0100] The main ingredients used in compound feed are the feed grains, which include corn, soybeans, sorghum, oats, and barley.

[0101] Suitably a premix as referred to herein may be a composition composed of microingredients such as vitamins, minerals, chemical preservatives, antibiotics, fermentation products, and other essential ingredients. Premixes are usually compositions suitable for blending into commercial rations.

[0102] Any feedstuff of the present invention may comprise one or more feed materials selected from the group comprising a) cereals, such as small grains (e.g., wheat, barley, rye, oats and combinations thereof) and / or large grains such as maize or sorghum; b) by products from cereals, such as corn gluten meal, Distillers Dried Grain Solubles (DDGS) , wheat bran, wheat middlings, wheat shorts, rice bran, rice hulls, oat hulls, palm kernel, and citrus pulp; c) protein obtained from sources such as soya, sunflower, peanut, lupin, peas, fava beans, cotton, canola, fish meal, dried plasma protein, meat and bone meal, potato protein, whey, copra, sesame; d) oils and fats obtained from vegetable and animal sources; e) minerals and vitamins.

[0103] A feedstuff of the present invention may contain at least 30%, at least 40%, at least 50%or at least 60%by weight corn and soybean meal or corn and full fat soy, or wheat meal or sunflower meal.

[0104] In addition, or in the alternative, a feedstuff of the present invention may comprise at least one high fiber feed material and / or at least one by-product of the at least one high fiber feed material to provide a high fiber feedstuff. Examples of high fiber feed materials include: wheat, barley, rye, oats, by products from cereals, such as corn gluten meal, Distillers Dried Grain Solubles (DDGS) , wheat bran, wheat middlings, wheat shorts, rice bran, rice hulls, oat hulls, palm kernel, and citrus pulp. Some protein sources may also be regarded as high fiber: protein obtained from sources such as sunflower, lupin, fava beans and cotton.

[0105] In the present invention the feed may be one or more of the following: a compound feed and premix, including pellets, nuts or (cattle) cake; a crop or crop residue: corn, soybeans, sorghum, oats, barley, corn stover, copra, straw, chaff, sugar beet waste; fish meal; freshly cut grass and other forage plants; meat and bone meal; molasses; oil cake and press cake; oligosaccharides; conserved forage plants: hay and silage; seaweed; seeds and grains, either whole or prepared by crushing, milling etc.; sprouted grains and legumes; yeast extract.

[0106] As used herein the term “contacted” refers to the indirect or direct application of the composition of the present invention to the product (e.g., the feed) . Examples of the application methods which may be used, include, but are not limited to, treating the product in a material comprising the feed additive composition, direct application by mixing the feed additive composition with the product, spraying the feed additive composition onto the product surface or dipping the product into a preparation of the feed additive composition.

[0107] In one embodiment the feed additive composition of the present invention is preferably admixed with the product (e.g., feedstuff) . Alternatively, the feed additive composition may be included in the emulsion or raw ingredients of a feedstuff.

[0108] For some applications, it is important that the composition is made available on or to the surface of a product to be affected / treated. This allows the composition to impart one or more of the following favorable characteristics: performance benefits.

[0109] The feed additive compositions of the present invention may be applied to intersperse, coat and / or impregnate a product (e.g., feedstuff or raw ingredients of a feedstuff) with a controlled amount of microbe and enzyme.

[0110] The microbe and enzyme may be used simultaneously (e.g., when they are in admixture together or even when they are delivered by different routes) or sequentially (e.g., they may be delivered by different routes) . In one embodiment preferably the microbe and enzyme are applied simultaneously. Preferably the microbe and enzyme are admixed prior to being delivered to a feedstuff or to a raw ingredient of a feedstuff.

[0111] The microbe in feed additive compositions according to the present invention-can be added in suitable concentrations-such as for example in concentrations in the final feed product which offer a daily dose of between about 2×105 CFU to about 2×1011 CFU, suitably between about 2×106 to about 1×1010, suitably between about 3.75×107 CFU to about 1×1010 CFU.

[0112] Preferably, the feed additive composition of the present invention will be thermally stable to heat treatment up to about 70℃.; up to about 85℃.; or up to about 95℃. The heat treatment may be performed for up to about 1 minute; up to about 5 minutes; up to about 10 minutes; up to about 30 minutes; up to about 60 minutes. The term thermally stable means that at least about 75%of the enzyme components and / or microbe that were present / active in the additive before heating to the specified temperature are still present / active after it cools to room temperature. Preferably, at least about 80%of the enzyme components and / or MICROBE that were present and active in the additive before heating to the specified temperature are still present and active after it cools to room temperature.

[0113] In a particularly preferred embodiment, the feed additive composition is homogenized to produce a powder.

[0114] In another preferred embodiment when the feed additive composition is formulated into granules the granules comprise a hydrated barrier salt coated over the protein core. The advantage of such salt coating is improved thermo-tolerance, improved storage stability and protection against other feed additives otherwise having adverse effect on the enzyme and / or microbe.

[0115] The method of preparing a feed additive composition may also comprise the further step of pelleting the powder. The powder may be mixed with other components known in the art. The powder, or mixture comprising the powder, may be forced through a die and the resulting strands are cut into suitable pellets of variable length.

[0116] It will be understood that the feed additive composition of the present invention is suitable for addition to any appropriate feed material.

[0117] As used herein, the term feed material refers to the basic feed material to be consumed by an animal. It will be further understood that this may comprise, for example, at least one or more unprocessed grains, and / or processed plant and / or animal material such as soybean meal or bone meal.

[0118] As used herein, the term “feedstuff” refers to a feed material to which one or more feed additive compositions have been added.

[0119] It will be understood by the skilled person that different animals require different feedstuffs, and even the same animal may require different feedstuffs, depending upon the purpose for which the animal is reared.

[0120] Preferably, the feedstuff may comprise feed materials comprising maize or corn, wheat, barley, triticale, rye, rice, tapioca, sorghum, and / or any of the by-products, as well as protein rich components like soybean mean, rape seed meal, canola meal, cotton seed meal, sunflower seed mean, animal-by-product meals and mixtures thereof. More preferably, the feedstuff may comprise animal fats and / or vegetable oils.

[0121] Optionally, the feedstuff may also contain additional minerals such as, for example, calcium and / or additional vitamins.

[0122] Preferably, the feedstuff is a corn soybean meal mix.

[0123] In one embodiment, preferably the feed is not pet food.

[0124] In another aspect there is provided a method for producing a feedstuff. Feedstuff is typically produced in feed mills in which raw materials are first ground to a suitable particle size and then mixed with appropriate additives. The feedstuff may then be produced as a mash or pellets; the latter typically involves a method by which the temperature is raised to a target level and then the feed is passed through a die to produce pellets of a particular size. The pellets are allowed to cool. Subsequently liquid additives such as fat and enzyme may be added. Production of feedstuff may also involve an additional step that includes extrusion or expansion prior to pelleting; in particular by suitable techniques that may include at least the use of steam.

[0125] Forms

[0126] The feed additive composition of the present invention and other components and / or the feedstuff comprising same may be used in any suitable form.

[0127] The feed additive composition of the present invention may be used in the form of solid or liquid preparations or alternatives thereof. Examples of solid preparations include powders, pastes, boluses, capsules, pellets, tablets, dusts, and granules which may be wettable, spray-dried or freeze-dried. Examples of liquid preparations include, but are not limited to, aqueous, organic or aqueous-organic solutions, suspensions and emulsions.

[0128] In some applications, microbe or feed additive compositions of the present invention may be mixed with feed or administered in the drinking water. In one embodiment the dosage range for inclusion into water is about 1×103 CFU / animal / day to about 1×1010 CFU / animal / day, and more preferably about 1×107 CFU / animal / day.

[0129] Suitable examples of forms include one or more of: powders, pastes, boluses, pellets, tablets, pills, capsules, ovules, solutions or suspensions, which may contain flavoring or colouring agents, for immediate-, delayed-, modified-, sustained-, pulsed-or controlled-release applications.

[0130] By way of example, if the composition of the present invention is used in a solid, e.g. pelleted form, it may also contain one or more of: excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine; disintegrants such as starch (preferably corn, potato or tapioca starch) , sodium starch glycollate, croscarmellose sodium and certain complex silicates; granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC) , hydroxypropylcellulose (HPC) , sucrose, gelatin and acacia; lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.

[0131] Examples of nutritionally acceptable carriers for use in preparing the forms include, for example, water, salt solutions, alcohol, silicone, waxes, petroleum jelly, vegetable oils, polyethylene glycols, propylene glycol, liposomes, sugars, gelatin, lactose, amylose, magnesium stearate, talc, surfactants, silicic acid, viscous paraffin, perfume oil, fatty acid monoglycerides and diglycerides, petroethral fatty acid esters, hydroxymethyl-cellulose, polyvinylpyrrolidone, and the like.

[0132] Preferred excipients for the forms include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols.

[0133] For aqueous suspensions and / or elixirs, the composition of the present invention may be combined with various sweetening or flavoring agents, colouring matter or dyes, with emulsifying and / or suspending agents and with diluents such as water, propylene glycol and glycerin, and combinations thereof.

[0134] Dosing

[0135] The microbe and / or feed additive composition according to the present invention may be designed for one-time dosing or may be designed for feeding on a daily basis.

[0136] The optimum amount of the composition (and each component therein) to be used in the combination of the present invention will depend on the product to be treated and / or the method of contacting the product with the composition and / or the intended use for the same.

[0137] The amount of microbe and enzymes used in the compositions should be a sufficient amount to be effective and to remain sufficiently effective in improving the performance of the animal fed feed products containing said composition. This length of time for effectiveness should extend up to at least the time of utilization of the product (e.g., feed additive composition or feed containing same) .

[0138] The microbe and enzyme combination according to the present invention may optionally be administered on a daily basis, twice per day, every second day, on a weekly basis, or at the frequency of feeding. In some embodiments, the composition comprising the nickel chelator is administered at least once per day. The total (daily) amount of the nickel chelator may be administered optionally in one single dose or distributed over several doses, e.g., one dose in the morning and one dose in the evening. In other embodiments, the composition is administered once over a period of about 1, about 2, about 3, about 4, about 5, or about 6 months.

[0139] In embodiments, a microbe and enzyme according to the present invention is orally administered to a subject for a suitable period of time, for example 1 or more days. In embodiments, the dosing period may be any number of days between 1 and 100 days. For example, the dosing period may be at least 1 day, at least 10 days, at least 20 days, at least 30 days, at least 40 days, at least 50 days, at least 60 days, at least 70 days, at least 80 days, at least 90 days, or at least 100 days. The dosing period may, for example, fall within the last 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 days immediately prior to slaughter.

[0140] Dosage levels of the microbe and enzyme in feed compositions of this disclosure can be varied to obtain an amount of microbe and / or enzyme that is effective to achieve the desired results, composition, and mode of administration, without being toxic to the subject. The selected dosage level will depend upon a variety of factors including the activity of the microbe and enzyme, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other and / or materials used in combination with the nickel chelator, the age, sex, weight, condition, and general health of the subject, and like factors well known in the art.

[0141] The ratio of microbe to enzyme in the feed can be in the ranges given below:

[0142] In one embodiment preferably the feedstuff comprises the following: a mannanase at least 4000 U / kg of feed; and a microbe at least 75,000 CFU / g to 150,000 CFU / g of feed.

[0143] In another embodiment the feedstuff comprises the following: a mannanase at 2000 U / kg of feed; and a microbe at 37, 500 CFU / g to 75,000 CFU / g of feed.

[0144] Combination with Other Components

[0145] The microbe (s) and enzyme (s) for use in the present invention may be used in combination with other components. Thus, the present invention also relates to combinations. The microbe in combination with a mannanase may be referred to herein as “the feed additive composition of the present invention” .

[0146] The combination of the present invention comprises the feed additive composition of the present invention (or one or more of the constituents thereof) and another component which is suitable for animal consumption and is capable of providing a medical or physiological benefit to the consumer.

[0147] In one embodiment preferably the “another component” is not a further enzyme or a further microbe.

[0148] The components may be prebiotics. Prebiotics are typically non-digestible carbohydrate (oligo-or polysaccharides) or a sugar alcohol which is not degraded or absorbed in the upper digestive tract. Known prebiotics used in commercial products and useful in accordance with the present invention include inulin (fructo-oligosaccharide, or FOS) and transgalacto-oligosaccharides (GOS or TOS) . Suitable prebiotics include palatinoseoligosaccharide, soybean oligosaccharide, alginate, xanthan, pectin, locust bean gum (LBG) , inulin, guar gum, galacto-oligosaccharide (GOS) , fructo-oligosaccharide (FOS) , non-degradable starch, lactosaccharose, lactulose, lactitol, maltitol, maltodextrin, polydextrose (i.e.  ) , lactitol, lactosucrose, soybean oligosaccharides, palatinose, isomalto-oligosaccharides, gluco-oligosaccharides and xylo-oligosaccharides, pectin fragments, dietary fibers, mannan-oligosaccharides.

[0149] Dietary fibers may include non-starch polysaccharides, such as arabinoxylans, cellulose and many other plant components, such as resistant dextrins, inulin, lignin, waxes, chitins, pectins, beta-glucans and oligosaccharides.

[0150] In one embodiment the present invention relates to the combination of the feed additive composition (or one or more of the constituents thereof) according to the present invention with a prebiotic. In another embodiment the present invention relates to a feed additive composition comprising (or consisting essentially of or consisting of) a microbe in combination with a mannanase and prebiotic.

[0151] The prebiotic may be administered simultaneously with (e.g., in admixture together with or delivered simultaneously by the same or different routes) or sequentially to (e.g., by the same or different routes) the feed additive composition (or constituents thereof) according to the present invention.

[0152] [Rectified under Rule 91, 13.11.2023]Other components of the combinations of the present invention include polydextrose, such as and / or a maltodextrin and / or lactitol. These other components may be optionally added to the feed additive composition to assist the drying process and help the survival of microbe.

[0153] Further examples of other suitable components include one or more of: thickeners, gelling agents, emulsifiers, binders, crystal modifiers, sweeteners (including artificial sweeteners) , rheology modifiers, stabilizers, antioxidants, dyes, enzymes, carriers, vehicles, excipients, diluents, lubricating agents, flavoring agents, colouring matter, suspending agents, disintegrants, granulation binders etc. These other components may be natural. These other components may be prepared by use of chemical and / or enzymatic techniques.

[0154] In one embodiment the microbe and / or enzymes may be encapsulated. In one embodiment the feed additive composition and / or microbe and / or enzymes is / are formulated as a dry powder or granule.

[0155] In one preferred embodiment the microbe and / or enzymes for use in the present invention may be used in combination with one or more lipids.

[0156] For example, the microbe and / or enzymes for use in the present invention may be used in combination with one or more lipid micelles. The lipid micelle may be a simple lipid micelle or a complex lipid micelle.

[0157] The lipid micelle may be an aggregate of orientated molecules of amphipathic substances, such as a lipid and / or an oil.

[0158] As used herein the term “thickener or gelling agent” refers to a product that prevents separation by slowing or preventing the movement of particles, either droplets of immiscible liquids, air or insoluble solids. Thickening occurs when individual hydrated molecules cause an increase in viscosity, slowing the separation. Gelation occurs when the hydrated molecules link to form a three-dimensional network that traps the particles, thereby immobilizing them.

[0159] The term “stabilizer” as used here is defined as an ingredient or combination of ingredients that keeps a product (e.g., a feed product) from changing over time.

[0160] The term “emulsifier” as used herein refers to an ingredient (e.g., a feed ingredient) that prevents the separation of emulsions. Emulsions are two immiscible substances, one present in droplet form, contained within the other. Emulsions can consist of oil-in-water, where the droplet or dispersed phase is oil and the continuous phase is water; or water-in-oil, where the water becomes the dispersed phase and the continuous phase is oil. Foams, which are gas-in-liquid, and suspensions, which are solid-in-liquid, can also be stabilized through the use of emulsifiers.

[0161] As used herein the term “binder” refers to an ingredient (e.g., a feed ingredient) that binds the product together through a physical or chemical reaction. During “gelation” for instance, water is absorbed, providing a binding effect. However, binders can absorb other liquids, such as oils, holding them within the product. In the context of the present invention binders would typically be used in solid or low-moisture products for instance baking products: pastries, doughnuts, bread and others.

[0162] “Carriers” or “vehicles” mean materials suitable for administration of the microbe and / or enzymes and include any such material known in the art such as, for example, any liquid, gel, solvent, liquid diluent, solubilizer, or the like, which is non-toxic and which does not interact with any components of the composition in a deleterious manner.

[0163] The present invention provides a method for preparing a feed additive composition comprising admixing a microbe and a mannanase with at least one physiologically acceptable carrier selected from at least one of maltodextrin, limestone (calcium carbonate) , cyclodextrin, wheat or a wheat component, sucrose, starch, Na2SO4, Talc, PVA, sorbitol, benzoate, sorbiate, glycerol, sucrose, propylene glycol, 1, 3-propane diol, glucose, parabens, sodium chloride, citrate, acetate, phosphate, calcium, metabisulfite, formate and mixtures thereof.

[0164] Examples of excipients include one or more of: microcrystalline cellulose and other celluloses, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate, glycine, starch, milk sugar and high molecular weight polyethylene glycols.

[0165] Examples of disintegrants include one or more of: starch (preferably corn, potato or tapioca starch) , sodium starch glycollate, croscarmellose sodium and certain complex silicates.

[0166] Examples of granulation binders include one or more of: polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC) , hydroxypropylcellulose (HPC) , sucrose, maltose, gelatin and acacia.

[0167] Examples of lubricating agents include one or more of: magnesium stearate, stearic acid, glyceryl behenate and talc.

[0168] Examples of diluents include one or more of: water, ethanol, propylene glycol and glycerin, and combinations thereof.

[0169] The other components may be used simultaneously (e.g., when they are in admixture together or even when they are delivered by different routes) or sequentially (e.g., they may be delivered by different routes) .

[0170] Preferably, when the feed additive composition of the present invention is admixed with another component (s) , the microbe remains viable.

[0171] In one embodiment preferably the feed additive composition according to the present invention does not comprise chromium or organic chromium.

[0172] In one embodiment preferably the feed additive according to the present invention does not contain glucanase.

[0173] In one embodiment preferably the feed additive according to the present invention does not contain sorbic acid.

[0174] Subject

[0175] The term “subject” , as used herein, means an animal that is to be or has been administered with a feed additive composition according to the present invention or a feedstuff comprising said feed additive composition according to the present invention.

[0176] The term “subject” , as used herein, means an animal. Preferably, the subject is a livestock or a domesticated animal.

[0177] In one embodiment, the “subject” is livestock.

[0178] The term “livestock” , as used herein refers to any farmed animal. Preferably, livestock is one or more of cows or bulls (including calves) , poultry, pigs (including piglets) , poultry (including broilers, chickens and turkeys) , horses, and sheep.

[0179] In one embodiment, the subject may be challenged by an enteric pathogen.

[0180] Performance

[0181] As used herein, “animal performance” may be determined by the feed efficiency and / or weight gain of the animal and / or by the feed conversion ratio and / or by the digestibility of a nutrient in a feed (e.g. amino acid digestibility) and / or digestible energy or metabolizable energy in a feed and / or by nitrogen retention and / or by animals ability to avoid the negative effects of necrotic enteritis and / or by the immune response of the subject.

[0182] Preferably “animal performance” is determined by feed efficiency and / or weight gain of the animal and / or by the feed conversion ratio.

[0183] By “improved animal performance” it is meant that there is increased feed efficiency, and / or increased weight gain and / or reduced feed conversion ratio and / or improved digestibility of nutrients or energy in a feed and / or by improved nitrogen retention and / or by improved ability to avoid the negative effects of necrotic enteritis and / or by an improved immune response in the subject resulting from the use of feed additive composition of the present invention in feed in comparison to feed which does not comprise said feed additive composition.

[0184] Preferably, by “improved animal performance” it is meant that there is increased feed efficiency and / or increased weight gain and / or reduced feed conversion ratio.

[0185] As used herein, the term “feed efficiency” refers to the amount of weight gain in an animal that occurs when the animal is fed ad-libitum or a specified amount of food during a period of time.

[0186] By “increased feed efficiency” it is meant that the use of a feed additive composition according the present invention in feed results in an increased weight gain per unit of feed intake compared with an animal fed without said feed additive composition being present.

[0187] Feed Conversion Ratio (FCR)

[0188] As used herein, the term “feed conversion ratio” refers to the amount of feed fed to an animal to increase the weight of the animal by a specified amount.

[0189] An improved feed conversion ratio means a lower feed conversion ratio.

[0190] By “lower feed conversion ratio” or “improved feed conversion ratio” it is meant that the use of a feed additive composition in feed results in a lower amount of feed being required to be fed to an animal to increase the weight of the animal by a specified amount compared to the amount of feed required to increase the weight of the animal by the same amount when the feed does not comprise said feed additive composition.

[0191] Nutrient Digestibility

[0192] Nutrient digestibility as used herein means the fraction of a nutrient that disappears from the gastro-intestinal tract or a specified segment of the gastro-intestinal tract, e.g., the small intestine. Nutrient digestibility may be measured as the difference between what is administered to the subject and what comes out in the feces of the subject, or between what is administered to the subject and what remains in the digesta on a specified segment of the gastrointestinal tract, e.g., the ileum.

[0193] Nutrient digestibility as used herein may be measured by the difference between the intake of a nutrient and the excreted nutrient by means of the total collection of excreta during a period of time; or with the use of an inert marker that is not absorbed by the animal, and allows the researcher calculating the amount of nutrient that disappeared in the entire gastro-intestinal tract or a segment of the gastro-intestinal tract. Such an inert marker may be titanium dioxide, chromic oxide or acid insoluble ash. Digestibility may be expressed as a percentage of the nutrient in the feed, or as mass units of digestible nutrient per mass units of nutrient in the feed.

[0194] Nutrient digestibility as used herein encompasses starch digestibility, fat digestibility, protein digestibility, and amino acid digestibility.

[0195] Energy digestibility as used herein means the gross energy of the feed consumed minus the gross energy of the feces or the gross energy of the feed consumed minus the gross energy of the remaining digesta on a specified segment of the gastro-intestinal tract of the animal, e.g., the ileum. Metabolizable energy as used herein refers to apparent metabolizable energy and means the gross energy of the feed consumed minus the gross energy contained in the feces, urine, and gaseous products of digestion. Energy digestibility and metabolizable energy may be measured as the difference between the intake of gross energy and the gross energy excreted in the feces or the digesta present in specified segment of the gastro-intestinal tract using the same methods to measure the digestibility of nutrients, with appropriate corrections for nitrogen excretion to calculate metabolizable energy of feed.

[0196] Weight Gain

[0197] The present invention further provides a method of increasing weight gain in a subject, comprising feeding said subject a feedstuff comprising a feed additive composition according to the present invention.

[0198] An “increased weight gain” refers to an animal having increased body weight on being fed feed comprising a feed additive composition compared with an animal being fed a feed without said feed additive composition being present.

[0199] Immune Response

[0200] Immune response as used herein means one of the multiple ways in which microbes modulate the immune system of animals, including increased antibody production, up-regulation of cell mediated immunity, up-regulation of pro-inflammatory cytokines, and augmented toll-like receptor signaling. It is understood that immuno-stimulation of the gastrointestinal tract by microbe (s) may be advantageous to protect the host against disease, and that immuno-suppression of the gastrointestinal tract may be advantageous to the host because less nutrients and energy are used to support the immune function.

[0201] Preferably, the immune response is a cellular immune response.

[0202] Preferably, immune response is measured by looking at immune markers.

[0203] Pathogenic Bacteria

[0204] The term “pathogenic bacteria” as used herein means for example toxigenic clostridia species, e.g., Clostridium perfringens and / or Escherichia coli.

[0205] The present invention may reduce populations of pathogenic bacteria in the gastrointestinal tract of a subject.

[0206] Probiotic

[0207] For some applications, it is believed that the microbe in the composition of the present invention can exert a probiotic culture effect. It is also within the scope of the present invention to add to the composition of the present invention further probiotic and / or prebiotics.

[0208] [Rectified under Rule 91, 13.11.2023]Here, a prebiotic is: “a non-digestible food ingredient that beneficially affects the host by selectively stimulating the growth and / or the activity of one or a limited number of beneficial bacteria” .

[0209] The term “probiotic culture” as used herein defines live microorganisms (including bacteria or yeasts for example) which, when for example ingested or locally applied in sufficient numbers, beneficially affects the host organism, i.e., by conferring one or more demonstrable health benefits on the host organism. Probiotics may improve the microbial balance in one or more mucosal surfaces. For example, the mucosal surface may be the intestine, the urinary tract, the respiratory tract or the skin. The term “probiotic” as used herein also encompasses live microorganisms that can stimulate the beneficial branches of the immune system and at the same time decrease the inflammatory reactions in a mucosal surface, for example the gut.

[0210] Whilst there are no lower or upper limits for probiotic intake, it has been suggested that at least 106-1012, preferably at least 106-1010, preferably 108-109, cfu as a daily dose will be effective to achieve the beneficial health effects in a subject.

[0211] In one aspect, suitably the enzyme or microbe used in the present invention may be in an isolated form. The term “isolated” means that the enzyme or microbe is at least substantially free from at least one other component with which the enzyme or microbe is naturally associated in nature and as found in nature. The enzyme or microbe of the present invention may be provided in a form that is substantially free of one or more contaminants with which the substance might otherwise be associated. Thus, for example it may be substantially free of one or more potentially contaminating polypeptides and / or nucleic acid molecules.

[0212] In one aspect, preferably the enzyme and / or microbe according to the present invention is in a purified form. The term “purified” means that the enzyme and / or microbe is present at a high level. The enzyme and / or microbe is desirably the predominant component present in a composition. Preferably, it is present at a level of at least about 90%, or at least about 95%or at least about 98%, said level being determined on a dry weight / dry weight basis with respect to the total composition under consideration.

[0213] It is envisaged within the scope of the present invention that the embodiments of the invention can be combined such that combinations of any of the features described herein are included within the scope of the present invention. In particular, it is envisaged within the scope of the present invention that any of the therapeutic effects of the bacteria may be exhibited concomitantly.

[0214] The words “preferred” and “preferably” refer to embodiments of the disclosure that may afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful and is not intended to exclude other embodiments from the scope of the disclosure.

[0215] By “consisting of” is meant including, and limited to, whatever follows the phrase “consisting of” . Thus, the phrase “consisting of” indicates that the listed elements are required or mandatory, and that no other elements may be present. By “consisting essentially of” is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase “consisting essentially of” indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present depending on whether they materially affect the activity or action of the listed elements.

[0216] Also herein, the recitations of numerical ranges by endpoints include all numbers within that range (for example, 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc. ) .

[0217] For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. Also, as appropriate, any combination of two or more steps may be conducted simultaneously.

[0218] Reference throughout this specification to “one embodiment, ” “an embodiment, ” “certain embodiments, ” or “some embodiments, ” etc., means that a particular feature, configuration, composition, or characteristic described in connection with the embodiment is included in at least one embodiment of the disclosure. Thus, the appearances of such phrases in various places throughout this specification are not necessarily referring to the same embodiment of the disclosure.

[0219] Furthermore, the particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more embodiments.

[0220] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

[0221] EXAMPLES

[0222] Materials and Methods

[0223] [Rectified under Rule 91, 13.11.2023]In total, 320 healthy crossbred piglets (Duroc × Landrace × Yorkshire, body weight (BW) = 7.00 ± 0.50 kg) were weaned at 25 days old and fed a corn-soybean meal based diet. After a 3-day adaptation period, piglets were randomly assigned to one of four groups: 1) control group (basal diet) , 2) BS100 group (basal diet plus 100 mg / kg B. subtilis QST713 (Baymix Grobig BS; Elanco, Shanghai, China) , 3) BS200 group (basal diet plus 200 mg / kg B. subtilis QST713) , and 4) a BS100XT group (basal diet plus 100 mg / kg B. subtilis QST713 and 150 mg / kg β-mannanase (Hemicell XT; Elanco, Shanghai, China) . Groups contained eight replicates with ten piglets / replicate. The study lasted 42 days. Pigs were fed over two phases (Phase 1, d 28-49 and Phase 2, d 50-71) . Basal diet composition and nutrient levels met nutritional requirements for weaned piglets, which were established by the National Research Council (Tables 1 and 2) . The nutrient content per kg of feed in the four groups were similar in both phases. In Phase 1, the control group had a net energy (NE) content of 2463 kcal / kg, while the enzyme-treated group had a NE content of 2448 kcal / kg, which equated to a 15 kcal / kg reduction. In Phase 2, the control group had an NE content of 2452 kcal / kg, while the enzyme-treated group had an NE content of 2412 kcal / kg, equating to a 40 kcal / kg reduction. As indicated (Table 3) , replacing expensive protein sources and reducing NE effectively reduced feed costs. In Phase 1, feed costs decreased by 26.24 RMB / ton, while in Phase 2, costs decreased by 67.84 RMB / ton. The Baymix Grobig BS and Hemicell XT feeds used in this study were provided by Elanco Animal Health (Shanghai, China) . Baymix Grobig BS dry material contained B. subtilis at 1.0×1010 CFU / g, while Hemicell XT dry material contained β-mannanase at 3.60×108 U / kg.

[0224] [Rectified under Rule 91, 13.11.2023]Throughout the study, individual piglet weights were recorded on days 1, 21, and 42, and feed consumption was monitored daily in all pens. At 1-21, 22-42, and 1-42 day periods, we calculated ADG, average daily feed intake (ADFI) , and feed conversion ratios (FCR; feed consumed / weight gain) . Piglet health status was evaluated using a three-grade fecal consistency scoring system; 1 indicated firm and dry feces, 2 indicated thick and fluid feces, and 3 indicated watery feces. Diarrhea rates (DR) (%) were calculated by dividing the total number of piglets with diarrhea (during specific periods) by the number of piglets (in specific periods) and multiplying by 100.

[0225] On days 1, 21, and 42, two piglets from each replicate were selected for fresh fecal sampling. Fresh feces were placed into storage tubes pre-filled with RNALater (Beyotime, Shanghai, China) buffer and tubes filled with STE (Solarbio, Beijing, China) and glycerol (20%) buffer. RNALater tubes were stored overnight at 4℃, transferred to -20℃, and finally moved to -80℃ for long-term storage. Tubes containing STE and glycerol (20%) buffer were stored in liquid nitrogen and transferred to -80℃ for long-term storage.

[0226] Microbial genomic DNA was extracted from samples using a Soil DNA Kit (OmegaBio tek, Norcross, GA, U.S. ) following manufacturer’s instructions. DNA concentrations and quality were determined using a Nano-Drop 2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA) and DNAs stored at -80℃ until required. Forward 338F (ACTCCTACGGGAGGCAGCAG) and reverse 806R (GGACTACHVGGGTWTCTAAT) primers were used to amplify the V3-V4 region of bacterial 16S rRNA. Paired-end reads from Illumina sequencing (Illumina, San Diego, CA, USA) were initially assembled based on overlap relationships and then sequence quality controlled and filtered. After distinguishing samples, sequences underwent operational taxonomic unit (OTU) clustering analysis at 97%similarity thresholds, followed by taxonomic classification analyses.

[0227] [Rectified under Rule 91, 13.11.2023]E-cadherin, occludin, and zonula occludens-1 (ZO-1) expression levels were quantified using primers from previous studies. Total RNA was isolated from fecal samples using the Gene JET RNA Purification Kit (ThermoFisher) . RNA concentrations and quality were measured using a Nano-Drop 2000 spectrophotometer (ThermoFisher Scientific) . After concentration normalization, RNA was reverse transcribed to cDNA using the All in One First Strand cDNA Synthesis SuperMix kit for qPCR (TransGen Biotech, China) and samples stored at -20℃. Target genes were detected using fluorescence quantitative PCR using GoTaq q-PCR Master Mix (Promega, Madison, WI, USA) . Amplification primers are listed (Table 4) . β-actin was used as a housekeeping gene and relative target gene expression was calculated using the 2-ΔΔCt method.

[0228] After thawing, samples were homogenized and approximately 0.3 g added to a 2 mL centrifuge tube. Then, 1.2 mL ultra-pure water was added, the mixture incubated for 30 min, and then centrifuged at 10000 g for 15 min. Next, 1 mL supernatant was mixed with 0.2 mL of 25% (w / v) metaphosphoric acid solution and 23.3 μL of 210 mmol / L crotonate solution and incubated at 4℃ for 30 min. Tubes were then centrifuged at 8000 g for 10 min, after which, 0.3 mL supernatant was added to 0.9 mL of a chromatogen-methanol mixture (1: 3 dilution) and recentrifuged at 8000 g for 5 min. Finally, the supernatant was filtered through a 0.22 μm filter membrane into a 1.5 mL tube. SCFAs were analyzed by gas chromatography (Agilent Inc., Palo Alto, CA, USA) using 1 μL of supernatant.

[0229] Total microbial DNA was extracted and purified using the Soil DNA kit (OmegaBio tek) and DNAs stored at -80℃. A B. subtilis QST713 gene sequences was cloned into a pUC57 vector (Sangon Biotech, Shanghai, China) and used to generate a standard curve. The QST713 primer, recommended in previous studies (Table 4) (Mendis et al., 2018) , was used to quantify general microbial DNA from feces and specific DNA from plasmids.

[0230] A 1 g fecal sample was suspended in 9 mL distilled water and centrifuged for 10 min at 12,000 g at 4℃. The supernatant was multiply diluted and inoculated onto Escherichia coli chromogenic media (Hopebio, Qingdao, China) , Salmonella chromogenic media (Hopebio, Qingdao, China) , and Clostridium Perfringens assay media (Hopebio, Qingdao, China) . Plates were incubated at 37 ± 1℃ for 24 h and E. coli and Salmonella colonies counted, while C. perfringens plates were anaerobically incubated at 37 ± 1℃ for 24 h and colonies counted.

[0231] Growth performance, SCFA, fecal gene expression, and B. subtilis QST713 quantification data were analyzed using one-way analysis of variance in SPSS 24.0 software (SPSS, Inc., Chicago, IL, USA) . Multiple comparisons were conducted using Tukey tests and a P < 0.05 value was considered statistically significant. Microbial counts, α-diversity indices, and the relative species abundance of gut microbial communities were analyzed using Kruskal-Wallis tests, while β-diversity was analyzed using principal coordinates analysis (PCoA) based on Bray-Curtis distances at OTU levels. Differential bacterial taxa across groups were identified using linear discriminant analysis (LDA) and linear discriminant analysis effect-size (LEfSe) approaches.

[0232] Results

[0233] [Rectified under Rule 91, 13.11.2023]Growth performance: The effects of B. subtilis QST713 and β-mannanase supplementation on growth performance in weaned piglets are shown (Table 5) . On day 21, piglets in the BS100 group had a higher (P < 0.05) ADFI when compared with controls. During the overall study period (1-42 days) , FCR was lower (P < 0.05) in the BS100XT group when compared with controls. Furthermore, on days 1-21, piglets in BS100 and BS200 groups had lower (P < 0.05) DRs when compared with controls, as did piglets in the BS100 and BS200 groups on days 1-42.

[0234] Fecal SCFAs: The effects of B. subtilis QST713 and β-mannanase supplementation on fecal SCFA concentrations are shown (Table 6) . On day 1, no significant differences in acetate, propionate, butyrate, valerate, or total SCFA levels were observed across treatments. On day 21, the BS100 group had lower butyrate levels when compared with controls (P < 0.05) , while the BS100XT group had lower propionate, butyrate, valerate, and total SCFA levels when compared with controls (P < 0.05) . On day 42, the BS100 group had lower acetate, butyrate, valerate, and total SCFA levels when compared with controls (P < 0.05) , and the BS200 group had lower acetate and total SCFA levels when compared with controls (P < 0.05) . The BS100XT group had lower valerate levels when compared with controls (P < 0.05) .

[0235] Fecal microbial counts: The effects of B. subtilis QST713 and β-mannanase supplementation on E. coli and C. perfringens are shown (Figure 1) . On days 1 and 42, no significant differences in bacterial levels were identified between treatments. However, on day 21, a significant decrease (P < 0.05) in bacterial levels was observed in the BS100XT group when compared with controls. Additionally, no Salmonella was detected in any treatment group during the study period.

[0236] Fecal microbiota composition: Community richness was evaluated using ACE and Chao1 indices, while community diversity was evaluated using Shannon and Simpson indices (Table 7) . We observed no significant differences in α-diversity indices across groups during the study. β-diversity indices among groups were represented by PCoA based on Bray-Curtis distances (Figure 2) and compared using ANOSIM (Table 8) . We observed no significant differences between groups on day 1, however, on day 21, the BS100XT group (P = 0.008) showed a distinct cluster that was markedly separated from controls. Similarly, on day 42, BS100 (P = 0.086) , BS200 (P = 0.008) , and BS100XT groups (P = 0.071) formed clusters distinct to controls. Next, microbial composition was assessed in weaned piglets (Tables 9 and 10) and observed that p_Firmicutes and p_Bacteroidetes were dominant in the fecal microbiome over the study duration, and constituted 90%of the total bacteria in piglets. Dietary B. subtilis QST713 and β-mannanase supplementation had limited effects on these populations. On day 42, relative p_Actinobacteriota abundance increased in the BS200 group when compared with controls (P <0.05) . At the family level, f_Muribaculaceae in the BS100XT group was significantly lower when compared with the BS100 group on day 21. To further investigate differences among groups, we identified key species as putative microbiological markers at different levels in groups using LefSe (Figure 3) . Lower p_Desulfobacterota, g_Lachnospiraceae_NK4B4_group, and g_Chlamydia proportions were observed in BS100 and BS100XT groups when compared with controls. Moreover, g_Paludicola was significantly expanded in the BS100XT group, while g_Erysipelotrichaceae_UCG-009 and g_Olsenella were significantly expanded in the BS100 group.

[0237] Fecal gene expression: The effects of B. subtilis QST713 and β-mannanase supplementation on fecal barrier gene expression in weaned piglets are shown (Table 11) . On day 21, the BS100XT group showed significantly up-regulated (P < 0.05) ZO-1 and E-cadherin levels, while the BS100 group exhibited significantly up-regulated (P < 0.05) ZO-1 levels when compared with controls. On day 42, the BS100 group showed significantly up-regulated (P < 0.05) occludin levels, while the BS100XT group exhibited significantly up-regulated (P < 0.05) E-cadherin levels when compared with controls.

[0238] Fecal B. subtilis QST713 quantities: As indicated (Figure 4) , no experimental groups showed detectable B. subtilis QST713 levels on day 1, similar to controls. On day 21, significantly higher B. subtilis QST713 levels were observed in BS200 group feces when compared with BS100 and BS100XT groups (P < 0.05) . On day 42, BS100, BS200, and BS100XT groups showed no significant differences with respect to B. subtilis QST713 levels (P > 0.05) .

[0239] [Rectified under Rule 91, 13.11.2023]Table 1. Composition and nutritional levels in study diets a Premix is provided per kg of diet: vitamin A (11000 IU) , vitamin D3 (2500 IU) , vitamin E (40 IU) , vitamin K3 (4 mg) , vitamin B1 (2 mg) , vitamin B2 (6 mg) , vitamin B12 (0.05 mg) , biotin (0.2 mg) , niacin (50 mg) , pantothenic acid (20 mg) , iron (100 mg as ferrous sulfate) , copper (150 mg as copper sulphate) , manganese (60 mg as manganese oxide) , zinc (100 mg as zinc oxide) , iodine (0.3 mg as potassium iodide) , and selenium (0.3 mg as sodium selenite) .b Hemicell XT dry feed contains β-mannanase at 3.60×108 U / kg.c Baymix Grobig BS dry feed contains Bacillus subtilis at 1.0×1010 CFU / g.

[0240] [Rectified under Rule 91, 13.11.2023]Table 2. Nutritional level in study diets a SID -standardized ileal digestible.b Hemicell XT dry feed contains β-mannanase at 3.60×108 U / kg.

[0241] [Rectified under Rule 91, 13.11.2023]Table 3. Feed price (RMB / ton) across treatment groups

[0242] [Rectified under Rule 91, 13.11.2023]Table 4. Study primers a ZO-1 (zonula occludens-1) .

[0243] [Rectified under Rule 91, 13.11.2023]Table 5. The effect of dietary Bacillus subtilis QST713 and β-mannanase supplementation on growth performance in weaned piglets

[0244] [Rectified under Rule 91, 13.11.2023]Data were expressed as the mean ± standard error of the mean (SEM) (n = 8) . Mean values with different letters indicate significant differences (P < 0.05) . BW (body weight) , ADG (average daily gain) , ADFI (average daily feed intake) , FCR (feed conversion ratio) , and DR (diarrhea rate) .

[0245] [Rectified under Rule 91, 13.11.2023]Table 6. The effects of dietary Bacillus subtilis QST713 and β-mannanase supplementation on fecal short chain fatty acids (mg / g) in weaned piglets

[0246] [Rectified under Rule 91, 13.11.2023]Data were expressed as the mean ± standard error of the mean (SEM) (n = 16) . Mean values with different letters indicate significant differences (P < 0.05) .

[0247] [Rectified under Rule 91, 13.11.2023]Table 7. The effects of dietary Bacillus subtilis QST713 and β-mannanase supplementation on α-diversity levels in weaned piglets.

[0248] [Rectified under Rule 91, 13.11.2023]Data were expressed as the mean ± standard deviation (SD) (n = 16) . Mean values with different letters indicate significant differences (P < 0.05) .

[0249] [Rectified under Rule 91, 13.11.2023]Table 8. Inter-group β-diversity comparisons using ANOSIM

[0250] [Rectified under Rule 91, 13.11.2023]Table 9. The effects of dietary Bacillus subtilis QST713 and β-mannanase supplementation on phylum levels (top five / period) in weaned piglets.

[0251] [Rectified under Rule 91, 13.11.2023]Data were expressed as the mean ± standard deviation (SD) n = 16. Mean values with different letters indicate significant differences (P < 0.05) .

[0252] [Rectified under Rule 91, 13.11.2023]Table 10. The effects of dietary Bacillus subtilis QST713 and β-mannanase supplementation on bacterial family levels (top five / period) in weaned piglets.

[0253] [Rectified under Rule 91, 13.11.2023]Data were expressed as the mean ± standard deviation (SD) (n = 16) . Mean values with different letters indicate significant differences (P < 0.05) .

[0254] [Rectified under Rule 91, 13.11.2023]Table 11. The effects of dietary Bacillus subtilis QST713 and β-mannanase supplementation on fecal barrier gene expression in weaned piglets

[0255] [Rectified under Rule 91, 13.11.2023]Data were expressed as the mean ± standard error of the mean (SEM) (n = 16) . Mean values with different letters indicate significant differences (P < 0.05) .

[0256] [Rectified under Rule 91, 13.11.2023]

[0257] [Rectified under Rule 91, 13.11.2023]

[0258] [Rectified under Rule 91, 13.11.2023]

[0259] [Rectified under Rule 91, 13.11.2023]

[0260] [Rectified under Rule 91, 13.11.2023]

[0261] [Rectified under Rule 91, 13.11.2023]

[0262] [Rectified under Rule 91, 13.11.2023]

Claims

1.A feed additive composition comprising a microbe in combination with mannanase.2.A feed additive composition according to claim 1 wherein the microbe comprises a bacterium from Bacillus.3.A feed additive composition according to claim 1 or 2, wherein the microbe comprises a bacterium from Bacillus subtilis.4.A feed additive composition according to any one of the preceding claims wherein the direct microbe is Bacillus subtilis QST713.5.A feed additive composition according to any one of the preceding claims wherein the mannanase is a β-mannanase.6.A feed additive composition according to any one of the preceding claims wherein the mannanase is present at a dosage of between 50 AU / g feed additive composition and 20000 AU / g feed additive composition.7.A feed additive composition according to any one of the preceding claims wherein the microbe is present at a dosage of 3.75×107 CFU / g feed additive composition and 1×1011 CFU / g feed additive composition.8.A method for improving the performance of a subject or for improving digestibility of a raw material in a feed, or for improving feed conversion ratio (FCR) , or for improving body weight gain in a subject, or for improving feed efficiency in a subject, or for improving the immune response of the subject, or for promoting the growth of beneficial bacteria in the gastrointestinal tract of a subject, or for reducing populations of pathogenic bacteria in the gastrointestinal tract of a subject, or for reducing nutrient excretion in feces, comprising administering to a subject a microbe in combination with a mannanase.9.A method according to claim 8 comprising administering the feed additive composition according to any one of claims 1-7.10.Use of a microbe in combination with a mannanase for improving the performance of a subject or for improving digestibility of a raw material in a feed, or for improving feed conversion ratio (FCR) , or for improving body weight gain in a subject, or for improving feed efficiency in a subject, or for improving the immune response of the subject, or for promoting the growth of beneficial bacteria in the gastrointestinal tract of a subject, or for reducing populations of pathogenic bacteria in the gastrointestinal tract of a subject, or for reducing nutrient excretion in feces.11.Use according to claim 10 wherein the feed additive composition according to any one of claims 1-7 is used.12.A kit comprising a microbe, a mannanase, and instructions for administration.13.A kit according to claim 12 wherein said kit comprises the feed additive composition according to any one of claims 1-7.14.A method of preparing a feed additive composition, comprising admixing a microbe with a mannanase and optionally packaging.15.The method according to claim 14, wherein the microbe comprises a bacterium from Bacillus.16.The method according to claims 14 or 15, wherein the microbe comprises a bacterium from Bacillus subtilis.17.The method according to any one of claims 14-16, wherein the microbe is Bacillus subtilis QST713.18.The method according to any one of claims 14-17 wherein the mannanase is a β-mannanase.19.A feed comprising a feed additive composition according to any one of claims 1-7.20.A feed according to claim 19, wherein the mannanase is present at a dosage of between 100 FTU / kg feed and 2000 FTU / kg feed.21.A feed according to claim 19 or claim 20 wherein the microbe is present at a dosage of 7.5×104 CFU / kg feed and 1×107 CFU / kg feed.22.A method of preparing a feedstuff comprising admixing a feed component with a feed additive composition according to any one of claims 1-7.23.A premix comprising a feed additive composition comprising a microbe in combination with a mannanase, and at least one mineral and / or at least one vitamin.24.A premix comprising a feed additive composition according to any one of claims 1-7 in combination with at least one mineral and / or at least one vitamin.25.A feed additive composition according to any one of claims 1-7 for preventing and / or treating Escherichia coli infection in a subject.26.A feed additive composition according to any one of claims 1-7 for preventing and / or treating Clostridium perfringens infection in a subject.27.A method of preventing and / or treating an Escherichia coli infection wherein an effective amount of a feed additive composition according to any one of claims 1-7 is administered to a subject.28.A method of preventing and / or treating a Clostridium perfringens infection wherein an effective amount of a feed additive composition according to any one of claims 1-7 is administered to a subject.

Images