Tumor-infiltrating lymphocyte with knockout of roquin-1 and / or regnase-1 genes and use thereof

Abstract

Provided are a tumor-infiltrating lymphocyte with knockout of Roquin-1 and / or Regnase-1 genes and the use thereof. By means of knocking out the Roquin-1 and / or Regnase-1 genes in the tumor infiltrating lymphocyte, the proliferation ability and the anti-tumor ability of the tumor infiltrating lymphocyte are improved.

Description

Tumor-infiltrating lymphocytes with knockout of Roquin-1 and / or Regnase-1 genes and applications thereof Technical Field

[0001] The present invention relates to the field of cell therapy, and in particular to modified tumor-infiltrating lymphocytes and applications thereof. Background Art

[0002] Cell therapy is currently a hot area in tumor immunotherapy. Numerous cell therapy drugs are currently on the market, with CAR-T cells being the most popular. In addition, TCR-T, NK, CAR-M, and TIL therapies are also products that numerous pharmaceutical and biotechnology companies are vying to develop. However, despite some progress in clinical practice, CAR-T and TCR-T therapies remain limited in their efficacy against solid tumors, particularly in overcoming the tumor microenvironment, promoting proliferation, reducing exhaustion, and enhancing sustained tumor killing.

[0003] Tumor infiltrating lymphocytes (TIL) therapy is a new type of cellular immunotherapy. These lymphocytes are typically obtained through two main steps. First, tumor tissue fragments obtained from the patient are cultured in a medium containing a high concentration of interleukin-2 (IL-2), allowing T cells to crawl out of the tumor tissue, thereby obtaining a small amount of TIL. The cells are then co-cultured with human PBMC trophoblasts to significantly expand the TILs, thereby obtaining a sufficient number of TILs for clinical use. These cells have a natural homing ability, allowing them to effectively infiltrate tumor tissue.

[0004] Compared to CAR-T cells and TCR-T cells, which express specific antigen recognition domains and can only recognize a single or fixed set of two or three antigens, TILs rely on T cell surface receptors to simultaneously recognize multiple antigens, effectively overcoming the lack of efficacy caused by tumor heterogeneity and reducing tumor antigen escape. Furthermore, CAR-T and TCR-T therapies typically involve isolating T cells from a patient's peripheral blood and then using viral transduction to generate engineered CAR-T and TCR-T cells, whereas TILs are T cells isolated directly from tumor tissue. These T cells are highly resistant to tumor antigens and possess improved homing and infiltration capabilities. In terms of efficacy and safety, current clinical reports suggest that CAR-Ts are less effective against solid tumors, are prone to relapse, and are prone to serious adverse events, including cytokine release syndrome and neurotoxicity. TILs, on the other hand, have generally shown better efficacy against solid tumors, with no reports of serious adverse events to date. Because TILs are typically engineered using non-viral vectors, the safety risks associated with viral vectors are lower.

[0005] RNA-binding proteins (RBPs) are a class of immunomodulators that have been understudied. Specifically, Regnase-1 and Roquin-1 are RBPs that act as negative immunomodulators, orchestrating the fine-tuning and restriction of inflammatory gene expression. Studies have shown that Regnase-1 knockout enhances the function of mouse OT-1 cells, Pmel TCR-T cells, and CD19-CAR CD8+ T cells (Wei et al. (2019) Nature. 576(7787):471-476). Knockout of Regnase-1, Roquin-1, and -2, or all three genes, increases the expression of IL-2 and interferon-γ (IFN-γ) mRNA in human Jurkat T cells stimulated with nonphysiological stimuli such as PMA and ionomycin, thereby bypassing the TCR complex (Cui et al. (2017) J Immunol. 199:4066-4077). The existing patent (WO2023070080A1) also involves knocking out Regnase-1 and / or Roquin-1 to enhance CAR-T cell activity, but does not involve the treatment of TIL cells.

[0006] The use of adoptive transfer of TILs to treat large, refractory tumors is an effective method for treating patients with poor prognosis (Gattinoni et al., Nat. Rev. Immunol., 2006, 6, 383-393). Successful immunotherapy requires large amounts of TILs, and commercialization requires robust and reliable methods. Therefore, there is still a need for improved TIL cell therapy in this area.

[0007] Summary of the Invention

[0008] The present invention uses tumor-infiltrating lymphocytes as a research model, obtains ovarian cancer samples from subject tissues, and obtains a certain amount of TILs through in vitro culture. CRISPR-Cas9 technology is then used to knock out the Roquin-1 and / or Regnase-1 genes in the TILs. It was observed that knocking out the Roquin-1 and / or Regnase-1 genes can promote TIL proliferation and cytokine secretion, and significantly reduce the dependence on IL-2 during in vitro expansion.

[0009] Furthermore, the present invention also demonstrated, using in vitro killing models of P815 cells and primary tumor cell lines, that TILs with knockout of the Roquin-1 and / or Regnase-1 genes exhibited enhanced tumor cell cytotoxicity. Furthermore, the inventors discovered that knockout of Roquin-1 and / or Regnase-1 promoted an increase in central memory T cells (TCMs) within the TIL subset, suggesting that these genetically modified TILs may possess enhanced sustained anti-tumor activity in vivo.

[0010] Therefore, this invention aims to reveal a novel TIL regulatory target combination, targeting the Roquin-1 and Regnase-1 genes. These modified TILs exhibit enhanced proliferation and anti-tumor activity, potentially addressing the challenges of CAR-T and TCR-T cell exhaustion, poor sustainability, and recurrence in the fight against solid tumors, providing a superior immunotherapy product for patients.

[0011] Specifically, the first aspect of the present invention provides a modified tumor-infiltrating lymphocyte.

[0012] The modified TIL provided by the present invention does not contain the Roquin-1 gene and / or the Regnase-1 gene, or the biological functions of the Roquin-1 gene product and / or the Regnase-1 gene product of the modified TIL are reduced or eliminated.

[0013] The Roquin-1 gene is also called the Rc3h1 gene, and its gene ID in the human genome is 149041 (updated on August 18, 2023); the Regnase-1 gene is also called the Zc3h12a gene, and its gene ID in the human genome is 80149 (updated on August 18, 2023).

[0014] In some embodiments, the expression and / or function of the Roquin-1 and / or Regnase-1 genes or their gene products of the above-mentioned TILs are reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100%, respectively, compared to unmodified or control TILs.

[0015] In some embodiments, the properties of the TILs are improved compared to unmodified or control TILs.

[0016] In some embodiments, the improved TIL properties include one or more selected from the following groups: increased TIL cell proliferation ability, increased cytokine secretion ability, increased granzyme secretion ability, increased central memory T cell (TCM) ratio, reduced IL-2 dependence, and increased tumor cell killing ability.

[0017] On the other hand, the present invention provides a method for preparing the modified TIL, comprising treating the Roquin-1 gene and the Regnase-1 gene in the TIL using gene editing technology, RNA interference technology, PROTAC technology, antibodies or small molecule inhibitors.

[0018] In some embodiments, the gene editing technology includes CRISPR / Cas technology, transcription activator-like effector nuclease (TALEN) technology, zinc finger nuclease (ZFN) technology, single or multi-base mutation, lead editing or site-directed knock-in.

[0019] In some embodiments, the Cas types include: Cas9, Cas12a, Cas3, Cas13, Cas14, Cas7, Cas8, Cas10, and Cas11.

[0020] In some embodiments, the Cas9 types include: SpCas9, SaCas9, SpCas9-HF, eSpCas9, xCas9, cpf1.

[0021] In some preferred embodiments, the Roquin-1 and / or Regnase-1 genes are disrupted and / or knocked out by CRISPR / Cas methods.

[0022] In some preferred embodiments, the Roquin-1 and / or Regnase-1 genes are disrupted and / or knocked out by CRISPR / Cas9.

[0023] In some embodiments, the CRISPR / Cas9 technology comprises introducing a CRISPR / Cas9 system containing both a single-stranded guide RNA (sgRNA) targeting a target gene and a Cas9 nuclease into the TIL.

[0024] In some embodiments, the sgRNA includes an sgRNA targeting the Roquin-1 gene and an sgRNA targeting the Regnase-1 gene.

[0025] In some embodiments, the CRISPR / Cas9 technology can use sgRNA targeting the Roquin-1 gene and sgRNA targeting the Regnase-1 gene separately or simultaneously.

[0026] The present invention provides a guide RNA (gRNA) that directs a site-directed modifying polypeptide to a specific target nucleic acid sequence. The gRNA comprises a nucleic acid targeting segment and a protein binding segment. The nucleic acid targeting segment of the gRNA comprises a nucleotide sequence that is complementary to a sequence in the target nucleic acid sequence. Therefore, the nucleic acid targeting segment of the gRNA interacts with the target nucleic acid in a sequence-specific manner via hybridization (i.e., base pairing), and the nucleotide sequence of the nucleic acid targeting segment determines the position in the target nucleic acid to which the gRNA will bind. The nucleic acid targeting segment of the gRNA can be modified (e.g., by genetic engineering) to hybridize with any desired sequence in the target nucleic acid sequence.

[0027] The protein binding segment of the guide RNA interacts with the site-directed modified polypeptide (e.g., Cas protein) to form a complex. The guide RNA guides the bound polypeptide to a specific nucleotide sequence in the target nucleic acid through the above-mentioned nucleic acid targeting segment. The protein binding segment of the guide RNA comprises two nucleotide fragments that complement each other and form a double-stranded RNA duplex.

[0028] In some embodiments, the gRNA comprises two separate RNA molecules. In such embodiments, each of the two RNA molecules comprises a stretch of nucleotides that are complementary to each other, such that the complementary nucleotides of the two RNA molecules hybridize to form a double-stranded RNA duplex of the protein-binding segment. In some embodiments, the gRNA comprises a single-stranded RNA molecule (sgRNA), wherein the ends of the sequences forming the complementary regions in the two RNA molecules are linked to form the sgRNA.

[0029] The specificity of the gRNA for the target locus is mediated by the sequence of the nucleic acid-binding segment, which comprises 20 nucleotides that are complementary to the target nucleic acid sequence within the target locus.

[0030] In some embodiments, the present invention provides an sgRNA targeting the Roquin-1 gene, wherein the targeting sequence is CCTGAATAAACTCCACCGCA (SEQ ID NO: 1) or a sequence having at least 85%, 90%, or 95% identity to SEQ ID NO: 1; the targeting sequence of the sgRNA targeting the Regnase-1 gene is GTGGACTTCTTCCGGAAGCT (SEQ ID NO: 2) or a sequence having at least 85%, 90%, or 95% identity to SEQ ID NO: 2.

[0031] In some embodiments, the Cas9-sgRNA RNP complex or a vector containing Cas9 protein and sgRNA expression elements is introduced into the above-mentioned TIL by chemical transfection, electroporation or vector delivery.

[0032] The above-mentioned vector delivery method includes delivery using viral vectors, virus-like vectors or non-viral vectors, including but not limited to viral vectors based on the following: vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus and mammary tumor virus), etc. Suitable non-viral vectors are selected from plasmids, transposons, lipid nanoparticles, liposomes, exosomes, attenuated bacteria or virus-like particles.

[0033] In some preferred embodiments, the Cas9-sgRNA RNP complex is introduced into the above-mentioned TIL by electroporation.

[0034] Another aspect of the present invention provides a method for producing the modified TIL, comprising the following steps:

[0035] (1) processing a tumor sample obtained from a subject into multiple tumor fragments to obtain a TIL population;

[0036] (2) expanding the obtained TIL population in vitro in a culture medium containing T cell growth factors to obtain a pre-rep TIL population;

[0037] (3) Treating the Pre-rep TIL population using the preparation method described in any of the above embodiments and expanding the culture in a culture medium containing trophoblast cells so that the expression and / or function of the Roquin-1 and / or Regnase-1 genes are reduced or eliminated.

[0038] In some embodiments, the T cell growth factor is selected from one or more of IL-2, IL-7, IL-15, and IL-21, preferably IL-2.

[0039] In some embodiments, the final concentration of the T cell growth factor in step (2) above is about 750-6000 IU / mL, preferably 6000 IU / mL.

[0040] In some embodiments, the final concentration of the T cell growth factor in step (3) above is about 750-6000 IU / mL, preferably 3000 IU / mL.

[0041] In some embodiments, the above-described TILs can be used for autologous TIL therapy of a subject.

[0042] Another aspect of the present invention provides a pharmaceutical composition comprising the TIL according to any one of the above embodiments or the TIL treated by the method according to any one of the above embodiments and optionally a pharmaceutically acceptable carrier.

[0043] Another aspect of the present invention provides use of the TIL described in any of the above embodiments, or the TIL treated by the method described in any of the above embodiments, or the above pharmaceutical composition in the preparation of a drug for preventing and / or treating tumors.

[0044] In some embodiments, the tumor is a solid tumor.

[0045] In some preferred embodiments, the tumor is selected from one or more of the following groups: melanoma, ovarian cancer, cervical cancer, lung cancer, bladder cancer, breast cancer, head and neck cancer, pancreatic cancer, liver cancer, gastric cancer, colorectal cancer and kidney cancer.

[0046] Another aspect of the present invention provides a method for treating a tumor in a subject in need thereof, comprising administering to the subject the TIL according to any one of the above embodiments, or the TIL treated by the method according to any one of the above embodiments, or the pharmaceutical composition described above.

[0047] In some embodiments, the tumor is a solid tumor.

[0048] In some preferred embodiments, the tumor is selected from one or more of the following groups: melanoma, ovarian cancer, cervical cancer, lung cancer, bladder cancer, breast cancer, head and neck cancer, pancreatic cancer, liver cancer, gastric cancer, colorectal cancer and kidney cancer.

[0049] On the other hand, the present invention provides a method for reducing or eliminating the expression and / or function of Roquin-1 and / or Regnase-1 genes in TIL, wherein the method includes improving TIL cell proliferation ability, improving cytokine secretion ability, improving granzyme secretion ability, increasing the proportion of central memory T cells (TCM), reducing IL-2 dependence, and improving tumor cell killing ability.

[0050] Experiments of the present invention have shown that the present invention improves the properties of TIL by knocking out the Roquin-1 and / or Regnase-1 genes in TIL, and has a series of advantages compared with unmodified TIL:

[0051] 1) It can promote TIL cell proliferation, reduce TIL exhaustion in the body, and play a better anti-tumor effect;

[0052] 2) It can reduce the dependence on IL-2 during TIL expansion, thereby reducing the use of IL-2 in clinical applications, thereby improving clinical safety and reducing costs;

[0053] 3) It can promote the increase of TCM proportion in TIL subsets, thereby increasing the persistence of TIL in the body, reducing tumor recurrence, and overcoming the shortcomings of CAR-T and TCR-T therapies in the treatment of solid tumors;

[0054] 4) It can promote TIL cells to secrete more cytokines and granzymes, and have better anti-tumor activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1: Detection of Roquin-1 and / or Regnase-1 gene knockout efficiency.

[0056] Figure 2: Roquin-1 and / or Regnase-1 gene knockout significantly promotes TIL proliferation. Data are presented as mean ± SEM, n ≥ 2, analyzed by two-way ANOVA, ns, p > 0.05; *, p < 0.05; **, p < 0.01.

[0057] Figure 3: Roquin-1 and / or Regnase-1 gene knockout significantly reduced the dependence of TIL expansion on IL-2. Data are presented as mean ± SEM, n ≥ 2, analyzed by two-way ANOVA, ns, p > 0.05; *, p < 0.05; **, p < 0.01.

[0058] Figure 4: Roquin-1 and / or Regnase-1 gene knockout significantly promoted interferon-γ secretion by TILs at an effector-target ratio of 5:1. Data are presented as mean ± SEM, n ≥ 2, using a two-tailed unpaired T-test, ns, p > 0.05; *, p < 0.05; **, p < 0.01; ***, p < 0.001.

[0059] Figure 5: At an effector-target ratio of 10:1, knockdown of Roquin-1 and / or Regnase-1 significantly promoted TIL secretion of granzyme B. Data are presented as mean ± SEM, n ≥ 4, analyzed by one-way ANOVA, ns, p > 0.05; *, p < 0.05; **, p < 0.01; ***, p < 0.001.

[0060] Figure 6: Roquin-1 and / or Regnase-1 knockdown enhances TIL cytotoxicity against P815 cells at different effector-target ratios. Data are presented as mean ± SEM, n ≥ 2, using two-tailed paired T-test. ns, p > 0.05; *, p < 0.05.

[0061] Figure 7: Roquin-1 and / or Regnase-1 knockdown enhances TIL cytotoxicity against primary ovarian cancer cells at an effector-target ratio of 10:1. n ≥ 3, two-way ANOVA, ns, p > 0.05; *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001.

[0062] Figure 8: Roquin-1 and / or Regnase-1 gene knockout promotes an increase in the proportion of TCMs in TILs.

[0063] Figure 9: Roquin-1 and / or Regnase-1 gene knockout slightly increases the proportion of CD4+ T cells in TILs. DETAILED DESCRIPTION

[0064] Although the present invention can be implemented in many different forms, what is disclosed here is its specific illustrative embodiment that proves the principle of the present invention. It should be emphasized that the present invention is not limited to the specific embodiment illustrated. In addition, any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0065] Unless otherwise defined herein, the scientific and technical terms used in conjunction with the present invention will have the meanings commonly understood by those of ordinary skill in the art. In addition, unless the context requires otherwise, terms in the singular should include plural forms, and terms in the plural should include singular forms. More specifically, as used in this specification and the appended claims, unless the context clearly indicates otherwise, the singular forms "a", "an" and "the" include plural indicators. In this application, unless otherwise stated, "or" is used to mean "and / or". In addition, the use of the term "comprising" and other forms (such as "including" and "containing") is not restrictive. In addition, the range provided in the specification and the appended claims includes endpoints and all values ​​between the endpoints.

[0066] Generally, terms relating to, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art. Unless otherwise indicated, the methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout this specification. See, e.g., Sambrook J. & Russell D. Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2000); Abbas et al., Cellular and Molecular Immunology, 6th ed., WB Saunders Company (2010); Harlow and Lane Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, John & Sons, Inc. (2002); and Coligan et al., Short Protocols in Protein Science, Wiley, John & Sons, Inc. (2003). The nomenclature used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and pharmaceutical and medicinal chemistry described herein are those well known and commonly used in the art. Additionally, any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0067] definition

[0068] For a better understanding of the present invention, definitions and explanations of relevant terms are provided below.

[0069] As used herein, the term "tumor infiltrating lymphocytes" or "TIL" refers to a cell population initially obtained as leukocytes that has left the subject's bloodstream and migrated to a tumor. TIL includes, but is not limited to, CD8+ cytotoxic T cells (lymphocytes), Th1 and Th17CD4+ T cells, natural killer cells, dendritic cells, and M1 macrophages. TIL includes primary TIL and secondary TIL. "Primary TIL" is those obtained from a patient's tissue sample (sometimes referred to as "freshly harvested"), and "secondary TIL" is any TIL cell population that has been expanded or propagated, including but not limited to a large amount of TIL (bulk TIL) and amplified TIL ("REP TIL" or "post-REP TIL"). TIL cell populations may include genetically modified TIL.

[0070] As used herein, the term "Roquin-1" refers to a gene or protein that encodes a protein containing a ring finger domain and a zinc finger domain. This protein controls T cell activation and differentiation by regulating gene expression, playing a key role in adaptive immune responses. The NCBI gene ID for Roquin-1 is 149041. In the present invention, Roquin-1 can encompass unprocessed Roquin-1, any processed form of Roquin-1, Roquin-1 variants, or substances comprising functionally active fragments of Roquin-1.

[0071] As used herein, the term "Regnase-1" refers to a gene or protein that encodes a zinc finger domain-containing protein that mediates downstream signaling and plays a key role in the growth, development, and differentiation of cells and tissues. The NCBI gene ID for Regnase-1 is 80149. In the present invention, Regnase-1 encompasses unprocessed Regnase-1, any processed Regnase-1, Regnase-1 variants, and substances comprising functionally active fragments of Regnase-1.

[0072] As used herein, the term "TIL properties" refers to the improved properties of TIL cells after modification by the preparation methods of the present invention. Changes in TIL properties may include: increased TIL proliferation capacity, increased TIL cell number, increased survival capacity, improved T cell subset ratios, increased cytokine secretion capacity, increased tumor cell killing ability, or any combination thereof. Changes in the present invention may be either increases or decreases.

[0073] As used herein, the term "TCR-T" refers to T cell receptor therapy.

[0074] As used herein, the term "CAR-T" refers to chimeric antigen receptor T cell therapy.

[0075] As used herein, the terms "peripheral blood mononuclear cells" and "PBMCs" refer to peripheral blood cells with round nuclei, including lymphocytes (T cells, B cells, NK cells) and monocytes. Preferably, the peripheral blood mononuclear cells are irradiated allogeneic peripheral blood mononuclear cells. PBMCs are antigen presenting cells.

[0076] As used herein, the term "RNA interference" or "RNAi" refers to RNA-dependent silencing of gene expression initiated by double-stranded RNA (dsRNA) molecules in the cytoplasm of cells. dsRNA molecules reduce or inhibit the accumulation of transcripts of target nucleic acid sequences, thereby silencing the gene or reducing the expression of the gene.

[0077] As used herein, the term "ZFN" stands for zinc-finger nucleases, which consist of a DNA recognition domain and a nonspecific endonuclease. The DNA recognition domain is composed of a series of Cys2-His2 zinc finger proteins (typically 3-4), each of which recognizes and binds to a specific triplet of bases. Researchers can modify the zinc finger DNA binding domain of ZFNs to target different DNA sequences, allowing ZFNs to bind to target sequences in complex genomes and perform specific cleavage using the DNA cleavage domain. Furthermore, by combining zinc finger nuclease technology with intracellular DNA repair mechanisms, researchers can also easily edit genomes in vivo. Currently, ZFN technology has been widely used to target gene mutations in a wide range of species, including plants, fruit flies, zebrafish, frogs, mice, rats, and cattle. By artificially modifying genomic information, new species with modified genetic backgrounds can be generated. This technology also has significant value in the medical field, with potential implications for gene therapy of diseases and a wide range of application prospects.

[0078] As used herein, the term "TALEN" refers to transcription activator-like effector nucleases, a new gene editing tool. TALE protein is a natural protein derived from the plant pathogen Xanthomonas, which also contains a DNA binding domain. The DNA binding domain in the TALE protein is composed of a series of 33 to 35 amino acid repeat domains, each of which can recognize a base. The DNA binding specificity of TALE nucleases is mainly determined by two highly variable amino acids. Scientists call these two key amino acids repeat-variable di-residues (RVDs). Like the zinc finger domain, this TALE repeat module can also be connected in series to recognize a long string of DNA sequences. However, cloning such a large segment of the repeat coding sequence of the TALE protein DNA sequence recognition domain is also a considerable challenge. To solve this problem, scientists have come up with many solutions. There are now several solutions that allow researchers to quickly assemble any combination of TALE protein DNA sequence recognition domains. Several large-scale, systematic research projects using various assembly strategies have shown that TALE repeat recognition modules can be assembled together to recognize any DNA sequence. Since the official invention of TALEN technology in 2010, many research groups around the world have verified the specific cutting activity of TALEN using in vitro cultured cells, yeast, Arabidopsis, rice, fruit flies, zebrafish and other animal and plant systems.

[0079] As used herein, the term "CRISPR" refers to a bacterial immune system that has been transformed by scientists into the hottest gene editing tool in recent years. CRISPR (Clusters of Regularly Interspaced Short Palindromic Repeats) technology was jointly discovered by scientists from the Massachusetts Institute of Technology and the University of California, Berkeley in 2012. It is a double-stranded DNA endonuclease tool mediated by RNA sequences. It consists of two parts, one of which is a sgRNA of about 100bp, which is used to target and recognize the target double-stranded DNA, and the other part is the 1369 amino acid Cas9 protein, which can bind to the sgRNA and has DNA enzyme activity. The artificially designed sgRNA and Cas9 protein form a complex that can specifically cut the target DNA. When the cutting causes mismatch repair, it causes gene frameshift and achieves the purpose of knockout. When a repair DNA sequence is added, targeted editing will be performed.

[0080] Preferably, the Roquin-1 and Regnase-1 genes are knocked out by TALEN, ZFN, RNAi or CRISPR / Cas gene editing systems, wherein the CRISPR / Cas gene editing system includes CRISPR / Cas9, CRISPR / Cas12a, CRISPR / Cas13 and CRISPR / Cas14. In one embodiment of the present invention, TIL cells with knockout of Roquin-1 and Regnase-1 genes are successfully obtained using the CRISPR / Cas9 system, which has the advantages of being safer and more reliable than the existing technology. Similarly, other gene editing technologies including TALEN, ZFN, and RNAi also have their advantages, and knockout of Roquin-1 and Regnase-1 genes in immune cells can also be performed by such gene editing methods. As for the CRISPR / Cas gene editing system, in addition to CRISPR / Cas9, similar CRISPR / Cas12a, CRISPR / Cas13 and CRISPR / Cas14 can also be used for gene editing to knock out Roquin-1 and Regnase-1 genes.

[0081] As used herein, the term "sgRNA," or single-stranded guide RNA, is used to anchor targeted DNA in CRISPR-Cas9 technology.

[0082] In some embodiments, sgRNA design follows the principle of an NGG PAM sequence near the CDS region, using software such as http: / / crispr.mit.edu and http: / / zifit.partners.org / ZiFiT / . In some embodiments, chemically modified sgRNAs have (i) methylation modifications within the first and last 1-10 bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases); (ii) simultaneous methylation and phosphorylation modifications; or (iii) other modifications that stabilize the sgRNA. Synthetic modified sgRNAs are provided by professional suppliers.

[0083] As used herein, the term "RNP" refers to the Cas9:sgRNA ribonucleoprotein (RNP) complex. The RNP method involves forming an RNP complex with Cas9 protein and sgRNA in vitro, and then delivering the RNP into T cells via electroporation. Its advantages are high knockout efficiency and low off-target rate (Cas9 protein and sgRNA are completely degraded by T cells within 24 hours). Its disadvantages are that absolutely endotoxin-free Cas9 protein is difficult to obtain and has relatively high requirements for reagents and instruments.

[0084] In some embodiments, the Cas9-sgRNA RNP complex is introduced into the activated TIL cells by electroporation 2-5 days after TIL cell activation.

[0085] As used herein, “CD4+ cells” refer to CD4-positive cells, such as T cells. The terms “CD4+ cells” and “CD4-positive cells” can be used synonymously. These cells can be identified by methods known in the art, such as by staining the cells with fluorescently labeled antibodies against CD4 and using fluorescence-activated cell sorting. For example, existing data can show that an increase in the proportion of CD4+ cells can increase the ability of the cell population to secrete IFN-γ and / or TNF, and can increase the effect of the T cell population in promoting tumor suppression. For example, see Tay, RE, Richardson, EK et al. (2020). Cancer Gene Therapy, 1-13. However, the art lacks a method for increasing the proportion of CD4+ cells, and the present application can provide a method for affecting the proportion of CD4+ cells.

[0086] As used herein, the term "central memory T cells" refers to T cells that have long-term memory and are capable of antigen restimulation. Central memory T cells may have a CD45RA-CCR7+ phenotype, for example, they may be identified by being CD45RA- and CCR7+. Central memory T cells may have a stronger ability to fight tumor growth than standard T cells.

[0087] As used herein, the term "solid tumor" refers to an abnormal tissue mass that does not typically contain a cyst or fluid area. Solid tumors can be benign or malignant. The term solid tumor cancer refers to a malignant, neoplastic, or cancerous solid tumor. Solid tumor cancers include, but are not limited to, melanoma, ovarian cancer, cervical cancer, lung cancer, bladder cancer, breast cancer, head and neck cancer, pancreatic cancer, liver cancer, gastric cancer, colorectal cancer, and renal cancer. The tissue structure of a solid tumor includes interdependent tissue compartments, including substance (cancer cells) and supporting stromal cells (cancer cells are dispersed therein and can provide a supporting microenvironment).

[0088] As used herein, the term "effective amount" or "therapeutically effective amount" refers to an amount of a compound or combination of compounds as described herein that is sufficient to achieve the intended application, including but not limited to disease treatment. The therapeutically effective amount may vary depending on the intended application (in vitro or in vivo) or the subject and disease condition being treated (e.g., the subject's weight, age, and sex), the severity of the disease condition, or the mode of administration. The term also applies to a dose that will induce a specific response in the target cell (e.g., a decrease in platelet adhesion and / or cell migration). The specific dose will depend on the specific compound selected, the administration regimen to be followed, whether the compound is administered in combination with other compounds, the time of administration, the administration tissue, and the physical delivery system carrying the compound.

[0089] As used herein, the terms "treatment," "treating," "treat," and the like refer to obtaining a desired pharmacological and / or physiological effect. The effect may be prophylactic in terms of completely or partially preventing a disease or its symptoms, and / or therapeutic in terms of partially or completely curing a disease and / or an adverse reaction caused by the disease. As used herein, "treatment" includes any treatment of a disease in mammals, particularly humans, including: (a) preventing the occurrence of a disease in a subject who may be susceptible to the disease but has not yet been diagnosed as having the disease; (b) inhibiting the disease, i.e., arresting its development or progression; and (c) alleviating the disease, i.e., causing regression of the disease and / or alleviating one or more symptoms of the disease. "Treatment" is also meant to include the delivery of an agent to provide a pharmacological effect, even in the absence of the disease or condition. For example, "treatment" includes the delivery of a composition that can elicit an immune response or confer immunity in the absence of the disease, such as in the case of a vaccine.

[0090] As used herein, the term "subject" can be a human or non-human animal, preferably a human, suffering from, for example, cancer.

[0091] As used herein, the term "autologous" refers to any material, eg, TIL, derived from the same individual that is later reintroduced into the individual, eg, during treatment.

[0092] As used herein, the term "pharmaceutical composition" refers to a preparation that allows the biological activity of the active ingredient to be effective and does not contain additional components that are unacceptably toxic to the subject to whom the preparation is administered. Such preparations are sterile. "Pharmaceutically acceptable" excipients (carriers, additives) are those that can be reasonably administered to a subject to provide an effective dose of the active ingredient used.

[0093] As used herein, the term "pharmaceutically acceptable" means that the vehicle, diluent, excipient and / or salt thereof is chemically and / or physically compatible with the other ingredients of the formulation and physiologically compatible with the recipient.

[0094] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and inert ingredients, which are well known in the art (see, e.g., Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th edition, Pennsylvania: Mack Publishing Company, 1995). The use of such pharmaceutically acceptable carriers or pharmaceutically acceptable excipients for active pharmaceutical ingredients is well known in the art. Unless any conventional pharmaceutically acceptable carrier or pharmaceutically acceptable excipient is incompatible with the active pharmaceutical ingredient, its use in the therapeutic compositions of the present invention is contemplated. Other active pharmaceutical ingredients (e.g., other drugs) may also be incorporated into the compositions and methods.

[0095] Example

[0096] The invention generally described herein will be more readily understood by reference to the following examples, and those skilled in the art may refer to the contents herein and appropriately modify the process parameters for implementation. It is particularly important to note that all similar substitutions and modifications will be apparent to those skilled in the art and are considered to be within the scope of protection of the present invention. The following examples are provided by way of illustration and are not intended to limit the present invention. These examples are not intended to represent that the experiments below are all or only the experiments performed.

[0097] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0098] Example 1: Preparation of tumor-infiltrating lymphocytes with knockout of Roquin-1 and / or Regnase-1 genes

[0099] Culture medium preparation

[0100] 50 mL of cell culture medium was prepared with the following ingredients:

[0101] Table 1: Culture medium components

[0102] Cryopreservation medium: 75% CS10 cell freezing medium (Biolife solutions, 210102), 2% human serum albumin (Jetbelin, Switzerland, S20170005), 100 IU / mL recombinant human interleukin-2 injection (Shuanglu Pharmaceutical, S20040008), and normal saline.

[0103] Isolation and expansion of TILs

[0104] 1. Tumor tissue was isolated from ovarian cancer patients; the tissue was obtained from Shanghai Renji Hospital or Shanghai First Hospital.

[0105] 2. Wash the tumor tissue with PBS and then cut the tumor tissue into pieces of about 3x3x3mm in size using sterile scissors. 3 The tissue blocks were placed in a 6-well plate containing an appropriate amount of TCM-60 culture medium, with 5 blocks per well.

[0106] 3. After 14 days of continuous culture, pre-rep TILs were obtained and frozen in freezing medium.

[0107] Knockout of Roquin-1 and / or Regnase-1 genes in TIL cells

[0108] 1. Resuscitate pre-rep TIL in BCM-2 medium and perform gene knockout after overnight recovery.

[0109] 2. Resuspend the lyophilized sgRNA (sequence as shown in either SEQ ID NO: 1 or 2) in RNase-free / DNase-free pyrogen-free water to a final concentration of 100 μM (100 pmol / μL).

[0110] 3. Mix Nucleofector in a ratio of 4.5:1 TM The solution and supplement were prepared into Lonza electroporation Buffer P3 (Lonza, 4XP-3024), with 100 μL per reaction. Incubate at room temperature.

[0111] 4. Place 15.0 μL of Lonza electroporation Buffer P3, 9.0 μL of sgRNA, and 10.0 μL of Cas9 protein (Thermofisher, A36499) into a sterile, RNase / DNase-free centrifuge tube and incubate at room temperature for 10 min to form an RNP mixture.

[0112] 5. Select Lonza 4D-Nucleofector TM EH115 program for T cell electroporation in the X Electroporation Module.

[0113] 6. Preheat T25 culture flasks, each containing 7.0 mL of TCM-60 medium. Take an appropriate amount of TCM-0 medium (800 μL per reaction) and pre-incubate in a 37°C incubator with 5% CO2.

[0114] 7. Centrifuge the recovered Pre-rep TIL culture at 300 x g for 8 minutes, discard the supernatant, and resuspend the recovered TIL in DPBS buffer.

[0115] 8. Count and collect cells (5x10 per reaction) 6 The required number of cells were centrifuged at 300×g for 8 minutes and the supernatant was discarded.

[0116] 9. Resuspend the cells again in 6.0 mL of pre-warmed DPBS buffer, centrifuge at 300 x g for 8 minutes, and completely remove the supernatant.

[0117] 10. Gently resuspend the cells in Lonza electroporation Buffer P3 (70 μL per reaction).

[0118] 11. Carefully add 70 μL of cell suspension to the RNP mixture and mix by gently pipetting 2 to 3 times.

[0119] 12. Transfer the mixture into the electrode cup. Be careful to avoid bubbles in the well to prevent sparks.

[0120] 13. Gently tap the side of the electrode cup to ensure that the sample covers the bottom of the electrode cup. If the liquid does not cover the entire bottom of the test tube, an error will be reported during the electrotransfer process.

[0121] 14. Place the electrode cup with lid into the 4D-Nucleofector TM In the X-Electrotransfer Module, check the correct orientation of the electrode cup.

[0122] 15. By pressing 4D-Nucleofector TM Start Nucleofection by clicking "Start" on the Core Unit display TM program.

[0123] 16. Immediately after the run is complete, carefully remove the electrode cup from the holder and add 800 μL of pre-warmed TCM-0 medium to each well, avoiding pipetting and mixing. Incubate in a 37°C incubator with 5% CO2 for 1 hour.

[0124] 17. After standing, transfer the cells to a T25 flask containing 7.0 mL of pre-warmed TCM-60 medium and culture in a 37°C incubator with 5% CO2.

[0125] Harvesting and identifying TIL cells with knockout of Roquin-1 and / or Regnase-1 genes

[0126] 1. Pre-rep TIL electroporation 48h after taking 5x10 4 The cells were mixed with trophoblast cells at a ratio of 1:200 in BCM-2 medium and cultured statically for 4 days.

[0127] 2. After 4 days, TILs were rapidly expanded in BCM-3 medium and reached the end point of culture after 9 days. During this period, the cells were resuspended every other day to record the cell density and the culture system was adjusted according to the cell density to ensure the viable cell density was (1-3) x10 6 pieces / mL.

[0128] 3. Take 1x10 at the end of culture 6 Genomes were extracted from more than 100 cells, and PCR was performed using the sequencing primers shown in SEQ ID NO: 3 to SEQ ID NO: 6. The knockout efficiency was then tested by next-generation sequencing. Sequencing experiments were performed by GeneWeizhi or GenScript Biotech Co., Ltd.

[0129] 4. The remaining TILs at the end of the culture were frozen in freezing medium with a cell density of 2x10 per tube. 7 The cells were cooled at -80℃ for 24h and then transferred into liquid nitrogen tank.

[0130] The gene knockout results are shown in FIG1 , indicating that the sgRNA of the present invention has good knockout efficiency.

[0131] Table 2: sgRNA and sequencing primer sequences used in this example

[0132] Example 2: Knockout of Roquin-1 and / or Regnase-1 genes promotes TIL proliferation

[0133] The TILs obtained in Example 1 were mixed and cultured with trophoblast cells in BCM-2 medium for 4 days and rapidly expanded in BCM-3 medium. The culture endpoint was reached after 9 days. During this period, the cells were resuspended every other day to record the cell density and cell viability. The culture system was adjusted according to the cell density to ensure that the viable cell density was (1-3) x10 6 The cell expansion times during the rapid expansion period were recorded.

[0134] The cell expansion folds during the rapid expansion period are shown in Figure 2, where Ctrl represents the control TIL without knockout. It can be seen that the cell expansion folds of TIL cells with knockout of Roquin-1 and / or Regnase-1 genes were significantly higher than those of the control group, indicating that knockout of Roquin-1 and / or Regnase-1 genes can promote TIL proliferation.

[0135] Example 3: Knockout of Roquin-1 and / or Regnase-1 genes reduces TIL expansion dependence on IL-2

[0136] The TILs frozen at the end of culture in Example 1 were revived and cultured for another 4 days using TCM-0 medium. The cells were resuspended every other day to record the cell density and cell viability, and the culture system was adjusted according to the cell density to ensure that the viable cell density was (1-3) x10 6 Count the total number of cells / mL.

[0137] The results are shown in Figure 3. It can be seen that in the absence of IL-2, the number of TIL cells in which the Roquin-1 and / or Regnase-1 gene was knocked out was significantly higher than that in the control group, indicating that knocking out the Roquin-1 and / or Regnase-1 gene can reduce the dependence of TIL expansion on IL-2.

[0138] Example 4: Knockout of Roquin-1 and / or Regnase-1 genes can promote TIL secretion of IFN-γ and Granzyme B

[0139] After 24 h of thawing the frozen TILs at the end of culture in Example 1, the TILs were added to a culture medium containing P815-GFP cells (3×10 4 Cells were cultured in wells (100 cells / well), each containing 0.5 μg / mL anti-CD3 antibody (OKT3). The basal culture medium used for co-incubation was TCM-0. A control group lacking anti-CD3 served as the control. After 24 hours of co-incubation, the cell culture plates were removed and centrifuged at 400 x g for 5 minutes. The cell supernatant was collected and diluted 100-fold (for Granzyme B detection) and 20-fold (for IFN-γ detection) respectively. The supernatant was then assayed according to the instructions of the Human Granzyme B ELISA kit (Invitrogen, BMS2027-2) and the Human IFN gamma ELISA kit (Sigma, RAB0222).

[0140] The results are shown in Figures 4 and 5. It can be seen that at an effector-target ratio of 5:1, the concentration of IFN-γ secreted by TILs with dual knockout of Roquin-1 and Regnase-1 genes was significantly higher than that of the control group; at an effector-target ratio of 10:1, the concentration of granzyme B secreted by TILs with single knockout of Regnase-1 gene or dual knockout of Roquin-1 and Regnase-1 genes was significantly higher than that of the control group, indicating that knockout of Roquin-1 and / or Regnase-1 genes can promote the secretion of IFN-γ and granzyme B by TILs.

[0141] Example 5: Knockout of Roquin-1 and / or Regnase-1 genes can promote the killing function of TIL on P815 cells

[0142] TILs from sample RC22 were gene-edited, rapidly amplified, and cryopreserved according to the method described in Example 1. After 24 h of recovery, TILs were added to a culture medium containing P815-GFP cells (3×10 4 Each well was incubated with culture medium containing 0.5 μg / mL anti-CD3 antibody (OKT3) and TCM-0 as the basal medium. A control group lacking anti-CD3 was used. After incubation at room temperature for 20 minutes, the cells were placed in an Incucyte instrument. Green fluorescence signals were collected every 4 hours for a total of 48 hours, and statistical data were analyzed using the Incucyte Basic analysis module.

[0143] The results are shown in Figure 6. It can be seen that the killing rate of TIL against P815 cells in which Roquin-1 and / or Regnase-1 genes were knocked out was higher than that in the control group, indicating that knockout of Roquin-1 and / or Regnase-1 genes can promote the killing function of TIL against P815 cells.

[0144] Example 6: Knockout of Roquin-1 and / or Regnase-1 genes can promote the killing function of TIL against primary ovarian cancer tumor cells

[0145] The primary ovarian cancer cells from the sample RC22 were pre-stained with red fluorescent dye. After labeling with Cytolight Rapid Red Dye (Sartorius Cat. No. 4706) at 7°C for 20 min, 1×10 4 The cells were seeded at a density of 1000 / well in a 96-well plate for later use.

[0146] The TILs from the frozen sample RC22 in Example 5 were revived using SuperView TMTILs were labeled with the 488Caspase-3 Live Cell Assay Kit (US Everbright, S6007L) and co-incubated with primary ovarian cancer cells in TCM-0 medium at an effector-target ratio of 20:1, 10:1, or 5:1. After standing at room temperature for 20 minutes, the cells were placed in an Incucyte device. Green and red fluorescence signals were collected every 4 hours for a total of 48 hours. Statistical data were analyzed using the Incucyte Basic analysis module.

[0147] The results are shown in Figure 7. It can be seen that the killing rate of primary tumor cells by TILs with Roquin-1 and / or Regnase-1 gene knockout was higher than that of the control group, indicating that knockout of Roquin-1 and / or Regnase-1 genes can promote the killing function of TILs against primary tumor cells.

[0148] Example 7: Knockout of Roquin-1 and / or Regnase-1 genes can promote the increase of TIL central memory cell TCM subsets

[0149] [Corrected 26.10.2023 according to Rule 91] Gene-edit TILs were cultured for 48 h according to the method described in Example 1 to obtain Edited Pre-rep TILs. 5x10 4 Edited pre-rep TILs were mixed with trophoblast cells at a ratio of 1:200 and cultured in BCM-2 medium containing three different concentrations of IL-2 (750 IU / mL, 1500 IU / mL, and 3000 IU / mL) for 4 days. After 7 days, the medium was changed to BCM-3 medium containing three different concentrations of IL-2 (750 IU / mL, 1500 IU / mL, and 3000 IU / mL) and cultured for another 9 days. During this period, the cells were resuspended every other day and the cell density and cell viability were recorded. The culture system was adjusted according to the cell density to ensure that the viable cell density was (1-3) x10 6 / mL. 1x10 6 After washing the cells with PBS containing 2% FBS, the cells were incubated with antibodies at 4°C for 30 min. The antibodies are shown in Table 3. After washing the cells twice, the cells were detected using a Miltenyi MACS Quant Analyzer 16 fully automated multicolor flow cytometer.

[0150] Table 3: Flow cytometry antibody information

[0151] Figure 8 shows that knockout of Roquin-1 and / or Regnase-1 can increase the proportion of TCMs under stimulation with different IL2 concentrations. This suggests that TILs with target knockout may have better persistence (Role of memory T cell subsets for adoptive immunotherapy, Dirk H Busch et al. 2016). TEFF represents terminal effector T cells. T denotes early T cells, TCM central memory T cells, and TEM effector memory T cells.

[0152] Example 8: Knockout of Roquin-1 and / or Regnase-1 genes can slightly increase the proportion of CD4+ cells in TILs

[0153] [Corrected 26.10.2023 according to Rule 91] Gene-edit TILs were cultured for 48 h according to the method described in Example 1 to obtain Edited Pre-rep TILs. 5x10 4 Edited pre-rep TILs were mixed with trophoblast cells at a ratio of 1:200 and cultured in BCM-2 complete culture medium for 4 days. After 7 days, TIL cells were cultured in BCM-3 rapid culture medium for 9 days. During this period, the cells were resuspended every other day to record the cell density and cell viability. The culture system was adjusted according to the cell density to ensure that the viable cell density was (1-3) x10 6 / mL. 1x10 6 After washing the cells with PBS containing 2% FBS, the cells were incubated with antibodies at 4°C for 30 min. The antibodies are shown in Table 3. After washing the cells twice, the cells were detected using a Miltenyi MACS Quant Analyzer 16 fully automated multicolor flow cytometer.

[0154] Figure 9 shows that knockout of Roquin-1 and / or Regnase-1 genes can slightly increase the proportion of CD4+ cells in TILs, suggesting that target knockout TILs may have stronger cytotoxic function (CD4+T cells in cancer, Daniel E. Speiser et al. 2023; Revisiting the role of CD4+T cells in cancer immunotherapy—new insights into old paradigms, Rong En Tay et al. 2020; Multiple roles for CD4+T cells in anti-tumor immune responses, Richard Kennedy et al. 2008; Adoptive cell therapy with CD4+T helper 1 cells and CD8+cytotoxic T cells enhances complete rejection of an established tumor, leading to generation of endogenous memory responses to non-targeted tumor epitopes, Kunyu Li, et al. 2017).

[0155] It should be understood that although the present invention has been described illustratively based on its preferred embodiments, it should not be limited to the above embodiments. For those skilled in the art, various modifications and variations of the present invention are possible. The selection and application of specific antibodies can be adjusted and modified accordingly according to specific needs. Therefore, for those skilled in the art, several simple substitutions can be made without departing from the concept and principles of the present invention, and these should all be included in the scope of protection of the present invention.

Claims

1. A modified tumor infiltrating lymphocyte (TIL), wherein the expression and / or function of the Roquin-1 gene or its gene product is reduced or eliminated.

2. A modified tumor-infiltrating lymphocyte, wherein the expression and / or function of Roquin-1 and Regnase-1 genes or their gene products are reduced or eliminated.

3. The modified TIL according to any one of claims 1 or 2, wherein the expression and / or function of the Roquin-1 and / or Regnase-1 gene or its gene product of the TIL is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100%, respectively, compared to unmodified or control TIL.

4. The modified TIL according to any one of claims 1 to 3, wherein the properties of the TIL are improved compared to unmodified or control TIL.

5. According to the modified TIL of claim 4, the improved TIL properties include one or more selected from the following groups: improved TIL cell proliferation ability, improved cytokine secretion ability, improved granzyme secretion ability, increased central memory T cell (Central Memory T cell, TCM) ratio, reduced IL-2 dependence, and improved tumor cell killing ability.

6. A method for preparing the modified TIL according to any one of claims 1 to 5, wherein the Roquin-1 and / or Regnase-1 gene or its gene product is treated by one or more of the following methods: gene editing technology, RNA interference technology, PROTAC technology, antibodies or small molecule inhibitors.

7. The preparation method according to claim 6, wherein the gene editing technology adopts one or more of the following methods: CRISPR / Cas technology, transcription activator-like effector nuclease (TALEN) technology, zinc finger nuclease (Zinc-finger nuclease, ZFN) technology, single or multi-base mutation, guide editing or site-directed knock-in.

8. The CRISPR / Cas technology according to claim 7, wherein the Cas types include: Cas9, Cas12a, Cas3, Cas13, Cas14, Cas7, Cas8, Cas10, and Cas11.

9. The CRISPR / Cas9 technology according to claim 8, wherein the Cas9 types include: SpCas9, SaCas9, SpCas9-HF, eSpCas9, xCas9 and cpf1.

10. The preparation method according to any one of claims 6 to 9, wherein the Roquin-1 and / or Regnase-1 genes are disrupted and / or knocked out by CRISPR / Cas technology.

11. The preparation method according to any one of claims 6 to 10, wherein the Roquin-1 and / or Regnase-1 genes are disrupted and / or knocked out by CRISPR / Cas9 technology.

12. The preparation method according to any one of claims 6 to 11, wherein the CRISPR / Cas9 technology comprises introducing a CRISPR / Cas9 system containing both a single-stranded guide RNA (sgRNA) targeting a target gene and a Cas9 nuclease into the TIL according to any one of claims 1 to 5.

13. The preparation method according to any one of claims 6 to 12, wherein the sgRNA comprises an sgRNA targeting the Roquin-1 gene and an sgRNA targeting the Regnase-1 gene.

14. The preparation method according to any one of claims 6 to 13, wherein the CRISPR / Cas9 technology can use sgRNA targeting the Roquin-1 gene and sgRNA targeting the Regnase-1 gene separately or simultaneously.

15. The preparation method according to any one of claims 6 to 14, wherein the targeting sequence in the sgRNA targeting the Roquin-1 gene is CCTGAATAAACTCCACCGCA (SEQ ID NO: 1) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO: 1; the targeting sequence of the sgRNA targeting the Regnase-1 gene is GTGGACTTCTTCCGGAAGCT (SEQ ID NO: 2) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO:

2.

16. The preparation method according to any one of claims 6 to 15, wherein the method for introducing the CRISPR / Cas9 system into the TIL comprises introducing a Cas9-sgRNA ribonucleoprotein (RNP) complex or a vector containing a Cas9 protein and an sgRNA expression element into the TIL according to any one of claims 1 to 5 by chemical transfection, electroporation or vector delivery.

17. The preparation method according to any one of claims 6 to 16, wherein the Cas9-sgRNA RNP complex is introduced into the TIL according to any one of claims 1 to 5 by electroporation.

18. A method for producing the TIL according to any one of claims 1 to 5, comprising the following steps: (1) processing a tumor sample obtained from a subject into multiple tumor fragments to obtain a TIL population; (2) expanding the obtained TIL population in vitro in a culture medium containing T cell growth factors to obtain a Pre-rep TIL population; (3) The Pre-REP TIL population is treated using the preparation method according to any one of claims 6 to 17, and co-cultured with trophoblast cells in a culture medium containing T cell growth factors, so that the expression and / or function of the Roquin-1 and / or Regnase-1 genes are reduced or eliminated.

19. The preparation method according to claim 18, wherein the T cell growth factor is selected from one or more of IL-2, IL-7, IL-15, and IL-21.

20. The preparation method according to any one of claims 18 or 19, wherein the T cell growth factor is IL-2.

21. The preparation method according to claim 18, wherein the final concentration of the T cell growth factor in step (2) is about 750-6000 IU / mL.

22. The preparation method according to claim 18, wherein the final concentration of the T cell growth factor in step (2) is 6000 IU / mL.

23. The preparation method according to claim 18, wherein the final concentration of the T cell growth factor in step (3) is about 750-6000 IU / mL.

24. The preparation method according to claim 18, wherein the final concentration of the T cell growth factor in step (3) is 3000 IU / mL.

25. The preparation method according to claim 18, wherein the TIL is autologous TIL for the subject.

26. A pharmaceutical composition comprising the TIL according to any one of claims 1 to 5 or the TIL treated by the method according to any one of claims 6 to 25 and optionally a pharmaceutically acceptable carrier.

27. Use of the TIL according to any one of claims 1 to 5, or the TIL treated by the method according to any one of claims 6 to 25, or the pharmaceutical composition according to claim 26 in the preparation of a drug for preventing and / or treating tumors.

28. The use according to claim 27, wherein the tumor is a solid tumor.

29. The use according to any one of claims 27 or 28, wherein the solid tumor is selected from one or more of the following groups: melanoma, ovarian cancer, cervical cancer, lung cancer, bladder cancer, breast cancer, head and neck cancer, pancreatic cancer, liver cancer, gastric cancer, colorectal cancer and kidney cancer.

30. A method for treating a tumor in a subject in need thereof, the method comprising administering to the subject the TIL according to any one of claims 1 to 5, or the TIL treated by the method according to any one of claims 6 to 25, or the pharmaceutical composition according to claim 26.

31. The method of claim 30, wherein the tumor is a solid tumor.

32. The method of claim 30 or 31, wherein the solid tumor is selected from one or more of the following groups: melanoma, ovarian cancer, cervical cancer, lung cancer, bladder cancer, breast cancer, head and neck cancer, pancreatic cancer, liver cancer, gastric cancer, colorectal cancer and renal cancer.

33. A method of reducing or eliminating the expression and / or function of Roquin-1 and / or Regnase-1 genes in TIL, the method comprising increasing TIL cell proliferation ability, increasing cytokine secretion ability, increasing granzyme secretion ability, increasing the proportion of central memory T cells (TCM), reducing IL-2 dependence, and increasing tumor cell killing ability; the TIL is the TIL described in any one of claims 1 to 5 or the TIL treated by the method described in any one of claims 6 to 25.

Images