Method for producing regulatory t cells

Abstract

The present disclosure provides: a method for producing regulatory T (Treg) cells, the method including a step for suppressing the activity of RBPJ in conventional T (Tconv) cells; and Treg cells produced by the method. The present disclosure also provides a drug for inducing Treg cells that can be used in the method of the present disclosure. The present disclosure further provides a drug for immunosuppression, comprising Treg cells produced by the method of the present disclosure or a drug for inducing Treg cells. Drugs for immunosuppression of the present disclosure are useful in the treatment of autoimmune diseases and tissue transplant patients.

Description

Method for producing regulatory T cells

[0001] The present application relates to a method for producing regulatory T (Treg) cells.

[0002] An important feature of CD25+CD4+ regulatory T cells in the immune system is their specific expression of the transcription factor FoxP3. Deficiency or mutation of FoxP3 can impair the development and differentiation of regulatory T cells, as well as their suppressive function. Experimental results have shown that ectopic expression of FoxP3 in normal T cells exerts immunosuppressive function, suggesting that the FoxP3 gene is a master gene for the development and function of regulatory T cells. Furthermore, it has been reported that mutations in the FoxP3 gene in humans inhibit the development of regulatory T cells in most cases, resulting in abnormal control of immune responses to self and non-self antigens.

[0003] In recent years, it has also been reported that CD8-positive cells expressing FoxP3 play a major role in regulating immune responses.

[0004] By stimulating mouse CD4+ T cells with antigen in the presence of TGFβ, it is possible to experimentally generate induced regulatory T cells that resemble endogenous regulatory T cells in function and phenotype through the induction of FoxP3 expression. However, the expression of FoxP3 in induced regulatory T cells is unstable, and the immunosuppressive function cannot be stably maintained, making it difficult to apply induced regulatory T cells clinically.

[0005] Recent studies have demonstrated that the instability of FoxP3 expression in induced regulatory T cells is primarily due to differences in epigenetic regulation of the FoxP3 gene. Epigenetics is defined as changes in gene expression or phenotype that are inherited across cell division without changes in DNA base sequence. Epigenetic regulation of gene expression refers to the control of gene expression through modifications of DNA or chromatin without changes in DNA sequence. Recent studies have revealed that lineage-specific gene expression depends on both transcription factor regulation and epigenetic control. One example of epigenetic regulation in regulatory T cells is the differential demethylation of expression control regions of genes encoding various regulatory T cell-specific functional proteins, including FoxP3, in regulatory T cells. Previous findings suggest that the instability of regulatory T cell-specific genes, including the FoxP3 gene, in induced regulatory T cells is due to the persistence of methylation in the regulatory T cell-specific demethylated regions. It is hoped that a method can be developed to generate functionally stable regulatory T cells, as well as stable FoxP3 expression, by introducing epigenetic modifications specific to regulatory T cells.

[0006] Non-Patent Document 1 shows that FoxP3-positive cells induced in vitro with a mixture of IL-2, TGF-β, retinoic acid, rapamycin, and butyric acid exhibit immunosuppressive activity, although the induced FoxP3 expression is unstable in this experimental system.

[0007] Non-Patent Document 2 reports the generation of regulatory T cells from peripheral T cells in vitro using TGF-β and rapamycin. Furthermore, Non-Patent Document 2 proposes the introduction of the obtained regulatory T cells into the body to suppress or treat graft-versus-host disease (GVHD) in transplants.

[0008] Non-Patent Document 3 reports that continuous administration of rapamycin to humanized mice into which peripheral blood-derived T cells had been transferred suppresses T cell division through regulatory T cells and apoptosis. This document also explains the side effects of rapamycin.

[0009] Schmidt A, Eriksson M et al. Comparative analysis of protocols to induce human CD4+FoxP3+ Regulatory T cells by combinations of IL-2, TGF-beta, retinoic acid, rapamycin and butyrate. PloS One. 11(2): e0148474, 2016. Hippen KL, Merkel SC et al. Generation and large-scale expansion of human inducible regulatory T cells that suppress graft-versus-host disease. Am J Transplant. 11(6): 1148-57, 2011. Hester J, Schiopu A et al. Low-dose rapamycin treatment increases the ability of human regulatory T cells to inhibit transplant arteriosclerosis in vivo. Am J Transplant. 12(8): 2008-2016, 2012.

[0010] The present application aims to provide a method for producing regulatory T cells. The regulatory T cells produced by the method of the present application have immunosuppressive ability and are stable.

[0011] The present inventors have found for the first time that, when producing regulatory T cells from conventional T cells, stable regulatory T cells can be produced by suppressing RBPJ activity in conventional T cells.

[0012] The present application provides a method for producing regulatory T (Treg) cells, which comprises the step of suppressing RBPJ activity in conventional T (Tconv) cells.

[0013] The present application also provides an agent for inducing Treg cells, which comprises, as an active ingredient, a compound that suppresses the activity of RBPJ.

[0014] The present application also provides an agent for inducing Treg cells, which comprises, as an active ingredient, Tconv cells in which RBPJ activity is suppressed.

[0015] The present application also provides Treg cells produced by the methods of the present application.

[0016] The present application also provides a drug for immunosuppression, comprising any one of the following (a) to (c) as an active ingredient: (a) Treg cells produced by the method of the present application, (b) a compound that suppresses RBPJ activity, or (c) Tconv cells in which RBPJ activity is suppressed.

[0017] The present application also provides a method for screening drugs for immunosuppression, the method comprising the step of selecting a compound that inhibits the activity of RBPJ.

[0018] The method of the present application makes it possible to produce stable regulatory T (Treg) cells that have immunosuppressive ability.

[0019] Figure 1 shows the FoxP3 positivity rate and FoxP3 expression level when FoxP3 expression was induced in vitro in negative control and RBPJ gene knockout PBMC-derived conventional CD4+ T cells. Figure 2 shows the FoxP3 positivity rate and FoxP3 expression level when FoxP3 expression was induced in vitro in negative control and RBPJ gene knockout PBMC-derived conventional CD4+ T cells. Figure 3 shows the demethylation rate of conserved non-translated region 2 (CNS2) at the FoxP3 locus when FoxP3 expression was induced in vitro in negative control and RBPJ gene knockout PBMC-derived conventional CD4+ T cells. Figure 4 shows the suppression of cell division of CD4+ and CD8+ T cells in PBMCs as a percentage of the negative control. FoxP3 expression was induced in vitro in negative control and RBPJ gene-knockout PBMC-derived conventional CD4+ T cells, and then cocultured with PBMCs for 3 days at the indicated ratios. Figure 5 shows the survival rate of NSG mice transplanted with PBMCs alone, or with endogenous regulatory T cells, negative control, or RBPJ gene-knockout induced regulatory T cells. Figure 6 shows the FoxP3 positivity rate and FoxP3 expression level in the spleen and peripheral blood 5 days after administration of negative control and RBPJ gene-knockout PBMC-derived conventional CD4+ T cells to NSG mice after FoxP3 expression was induced in vitro. Figure 7 shows the FoxP3 expression levels when FoxP3 expression was induced in vitro in PBMC-derived conventional CD4+ T cells (negative control (NTC) and GPS2-, NCOR2-, and HDAC3-knockout) and Figure 8 shows the FoxP3 positivity rate and FoxP3 expression levels when FoxP3 expression was induced in vitro in PBMC-derived conventional CD4+ T cells infected with lentiviruses expressing GFP alone, wild-type RBPJ, or mutant RBPJ.Figure 9 shows the FoxP3 positivity rate and FoxP3 expression level when FoxP3 expression was induced in vitro after HDAC3 gene knockout in PBMC-derived normal CD4+ T cells infected with lentiviruses overexpressing either wild-type RBPJ or mutant RBPJ. Figure 10 shows the average peak signal of histone H3 acetylation around the FoxP3 locus when FoxP3 expression was induced in vitro in negative control and RBPJ gene-knockout PBMC-derived normal CD4+ T cells. Figure 11 shows the peak signal of histone H3 acetylation around the FoxP3 locus in the FoxP3-positive cell fraction when FoxP3 expression was induced in vitro in PBMC-derived normal CD4+ T cells overexpressing GFP alone or the RBPJ gene.

[0020] Method for Producing Regulatory T Cells The present application provides a method for producing regulatory T (Treg) cells, which includes the step of suppressing RBPJ activity in conventional T (Tconv) cells.

[0021] As used herein, "conventional T (Tconv) cells" refer to T cells other than regulatory T cells, such as CD4 + cells, and CD8 + Examples of cells that can be targeted to suppress RBPJ activity include CD4 + cells, CD8 + cells, CD4 + CD25 - cells, CD4 + CD25 - cells, CD4 + CD25 - CD45RA + cells (naive Th cells), and CD4 + CD25 - / low CD45RA - Tconv cells can be FoxP3 negative. Tconv cells can be, for example, CD4 + cells, CD8 + cells, CD4 + CD25 - cells, or CD4+ CD25 - CD45RA + It is a cell.

[0022] In the present application, the animal from which Tconv cells are derived is not limited, and examples thereof include mammals such as mice, rats, hamsters, guinea pigs, cows, horses, pigs, sheep, monkeys, orangutans, chimpanzees, dogs, cats, and humans, preferably primates, more preferably humans. In one embodiment, the Tconv cells are human Tconv cells, and the Treg cells are human Treg cells.

[0023] As used herein, the term "regulatory T (Treg) cells" refers to cells that are positive for at least CD4, CD25, and FoxP3. Examples of Treg cells include inducible Treg (iTreg) cells. iTreg cells are Treg cells induced to differentiate from Tconv cells in the presence of TGF-β.

[0024] In this specification, "CD4 positive" or "CD4 + Unless otherwise specified, "CD4 positive CD8 negative CD4 single positive cells" refers to "CD8 positive" or "CD8 + " refers to CD4-negative CD8-positive CD8 single-positive cells unless otherwise specified.

[0025] The step of suppressing RBPJ activity can be, for example, a step of suppressing the expression of the RBPJ gene or a step of suppressing the function of the RBPJ protein.

[0026] In one embodiment, the step of suppressing RBPJ activity is a step of suppressing expression of the RBPJ gene. The suppression of gene expression can be carried out by a method known per se. The step of suppressing expression of the RBPJ gene is, for example, a step of knocking out the RBPJ gene or a step of knocking down the RBPJ gene.

[0027] Gene knockout refers to the disruption or mutation of all or part of a gene so that it does not perform its intended function. A gene may be disrupted or mutated so that one allele on the genome is nonfunctional. Alternatively, multiple alleles may be disrupted or mutated. Knockout can be performed by known methods, such as introducing a DNA construct designed to undergo genetic recombination with the target gene into cells, or by using genome editing technologies such as the CRISPR-Cas system, TALEN, and ZFN to insert, delete, or replace bases. Common genome editing techniques use a targeting vector containing the gene of interest, and exogenous DNA can be inserted into a specific genomic site in a cell using homologous recombination repair (HDR) after site-specific DNA cleavage with a nuclease or similar. Gene introduction into cells using genome editing techniques may be performed using commercially available genome editing kits, enzymes, vectors, etc.

[0028] In the CRISPR system, endonucleases such as Cas9 or Cpf1 recognize a specific base sequence, the PAM sequence, and cleave the double strand of the target DNA through endonucleolytic action. If the endonuclease is Cas9, it cleaves approximately 3–4 bases upstream of the PAM sequence. Examples of endonucleases include Cas9 from S. pyogenes, S. aureus, N. meningitidis, S. thermophilus, or T. denticola, and Cpfl from L. bacterium ND2006 or Acidaminococcus sp. BV3L6. The PAM sequence depends on the endonuclease; for example, the PAM sequence for S. pyogenes Cas9 is NGG. The gRNA contains a sequence (target sequence) or its complement approximately 20 bases upstream of the PAM sequence at its 5' end and serves to recruit the endonuclease to the target sequence. The sequence of the gRNA other than the target sequence can be determined appropriately by those skilled in the art depending on the endonuclease used. The gRNA may contain a crRNA (CRISPR RNA) that contains the target sequence or a sequence complementary to it and is responsible for the sequence specificity of the gRNA, and a tracrRNA (Trans-activating crRNA) that forms a double strand and contributes to complex formation with Cas9. The crRNA and tracrRNA may exist as separate molecules. When the endonuclease is Cpf1, the crRNA alone functions as the gRNA. The gRNA sequence can be determined using tools available for target sequence selection and gRNA design, such as CRISPRdirect (https: / / crispr.dbcls.jp / ).

[0029] A vector containing a nucleic acid sequence encoding a gRNA and a nucleic acid sequence encoding an endonuclease may be introduced into a cell, or an exogenously produced gRNA and endonuclease protein may be introduced into a cell. The nucleic acid sequence encoding the gRNA and the nucleic acid sequence encoding the endonuclease may be present on separate vectors. Various methods can be used to introduce the vector, gRNA, and endonuclease, including lipofection, liposome, electroporation, nucleofection, calcium phosphate coprecipitation, DEAE-dextran, microinjection, and gene gun.

[0030] Gene knockdown can be carried out by known methods, such as methods of knocking down genes using siRNA, shRNA, antisense nucleic acids that can suppress gene expression, or expression vectors that can express these nucleic acid molecules.

[0031] siRNA is typically a double-stranded oligo-RNA consisting of an RNA strand (antisense strand) having a sequence complementary to the nucleotide sequence or a partial sequence of the mRNA of a target gene and its complementary strand (sense strand). The nucleotide sequences of these RNAs can be appropriately designed by those skilled in the art based on the sequence information of the gene whose expression is to be suppressed. The antisense strand does not need to be completely complementary to the target gene as long as it can inhibit the expression of the target mRNA.

[0032] shRNA is a single-stranded RNA in which an RNA strand (antisense strand) having a sequence complementary to the nucleotide sequence or a partial sequence of the mRNA of a target gene and its complementary strand (sense strand) are linked by a short spacer sequence. The nucleotide sequence of shRNA can be appropriately designed by those skilled in the art based on the sequence information of the gene whose expression is to be suppressed. The antisense strand does not need to be completely complementary to the target gene as long as it can inhibit the expression of the target mRNA.

[0033] Antisense nucleic acid refers to a nucleic acid that contains a nucleotide sequence capable of specifically hybridizing with target mRNA (mature mRNA or initial transcription product) under the physiological conditions of cells expressing the target mRNA, and that, when hybridized, can inhibit the translation of the polypeptide encoded by the target mRNA. The type of antisense nucleic acid may be DNA or RNA, or may be a chimera of DNA and RNA.

[0034] An example of the mRNA sequence of the human RBPJ gene is the nucleotide sequence shown in NM_015874.6. RBPJ siRNA, RBPJ shRNA, and antisense nucleic acids for the RBPJ gene can be designed and synthesized by standard methods based on the nucleotide sequence shown in NM_015874.6. Commercially available antisense nucleic acids for the RBPJ gene include CGGACTGTGAATTCTT (SEQ ID NO: 1; Qiagen) and GTTGCCATAGAACATC (SEQ ID NO: 2; Qiagen).

[0035] Nucleotide molecules constituting siRNA, shRNA, and antisense nucleic acids may contain various chemical modifications to improve stability and activity. For example, to prevent degradation by hydrolases such as nucleases, phosphate residues may be substituted with chemically modified phosphate residues such as phosphorothioate (PS), methylphosphonate, and phosphorodithioate. Furthermore, at least a portion of the nucleotides may be composed of nucleic acid analogs such as peptide nucleic acids (PNA).

[0036] Known methods can be used to introduce siRNA, shRNA, miRNA, antisense nucleic acids, or expression vectors capable of expressing these nucleic acid molecules into cells. Examples include lipofection, electroporation, microinjection, particle gun, and transduction using viruses or plasmids as expression vectors. The type of expression vector is not particularly limited, and known expression vectors can be used. Examples of expression vectors include episomal vectors, artificial chromosome vectors, viral vectors, and plasmid vectors.

[0037] RBPJ gene expression may be suppressed using compounds known to suppress RBPJ gene expression, such as compounds that suppress the transcription and transcription products of the RBPJ gene.

[0038] Gene expression can be confirmed by methods well known in the art. For example, mRNA expression can be confirmed by quantitative PCR (qPCR), RT-PCR, real-time RT-PCR, microarray, or Northern blotting, and protein expression can be confirmed by flow cytometry, ELISA, antibody immunoprecipitation, Western blotting, or mass spectrometry.

[0039] In another embodiment, the step of inhibiting RBPJ activity is a step of inhibiting the function of the RBPJ protein. Inhibition of protein function can be carried out by methods known per se. For example, protein function may be inhibited by inhibiting the transcriptional activity of the protein. It is believed that RBPJ protein regulates FoxP3 expression by forming a complex with SHARP protein, NCoR1 or NCoR2 protein, GPS2 protein, and HDAC3 protein. Therefore, RBPJ protein function may be inhibited by inhibiting the formation of a complex consisting of RBPJ protein, SHARP protein, NCoR1 or NCoR2 protein, GPS2 protein, and HDAC3 protein. The step of inhibiting RBPJ protein function is, for example, a step of inhibiting the transcriptional activity of the RBPJ protein or a step of inhibiting the formation of a complex consisting of RBPJ protein, SHARP protein, NCoR1 or NCoR2 protein, GPS2 protein, and HDAC3 protein.

[0040] Examples of inhibition of the transcription activity of RBPJ protein include, but are not limited to, the use of a compound that inhibits the binding of RBPJ protein to target DNA.

[0041] The formation of a complex consisting of RBPJ protein, SHARP protein, NCoR1 or NCoR2 protein, GPS2 protein, and HDAC3 protein can be inhibited by a method known per se. For example, the GPS2 gene, NCoR2 gene, or HDAC3 gene may be knocked out using genome editing technology such as the CRISPR-Cas system. Alternatively, the gene may be knocked down using siRNA, shRNA, miRNA, stRNA, or antisense nucleic acid targeting the GPS2 gene, NCoR2 gene, or HDAC3 gene, or an expression vector capable of expressing these nucleic acid molecules.

[0042] An example of the mRNA sequence of the human SHARP gene is the nucleotide sequence shown in NM_015001.3. SHARP siRNA, SHARP shRNA, and antisense nucleic acids of the SHARP gene can be designed and synthesized by conventional methods based on the nucleotide sequence shown in NM_015001.3, for example.

[0043] An example of the mRNA sequence of the human NCoR1 gene is the nucleotide sequence shown in NM_006311.4. NCoR1 siRNA, NCoR1 shRNA, and antisense nucleic acids of the NCoR1 gene can be designed and synthesized by standard methods based on the nucleotide sequence shown in NM_006311.4, for example.

[0044] An example of the mRNA sequence of the human NCoR2 gene is the nucleotide sequence shown in NM_006312.6. NCoR2 siRNA, NCoR2 shRNA, and antisense nucleic acids of the NCoR2 gene can be designed and synthesized by conventional methods based on the nucleotide sequence shown in NM_006312.6, for example.

[0045] An example of the mRNA sequence of the human GPS2 gene is the nucleotide sequence shown in NM_004489.5. GPS2 siRNA, GPS2 shRNA, and antisense nucleic acids of the GPS2 gene can be designed and synthesized by conventional methods based on the nucleotide sequence shown in NM_004489.5, for example.

[0046] An example of the mRNA sequence of the human HDAC3 gene is the nucleotide sequence shown in NM_003883.4. HDAC3 siRNA, HDAC3 shRNA, and antisense nucleic acids of the HDAC3 gene can be designed and synthesized by conventional methods based on the nucleotide sequence shown in NM_003883.4, for example.

[0047] Compounds known to inhibit the expression of the GPS2 gene, NCoR2 gene, or HDAC3 gene may be used. For example, compounds that inhibit the transcription and transcription products of the GPS2 gene, NCoR2 gene, or HDAC3 gene may be used.

[0048] The methods of the present application can be performed in vivo or in vitro. In some embodiments, the methods of the present application can be performed in vivo. In this embodiment, the methods of the present application can include administering to a subject a compound that inhibits the activity of RBPJ.

[0049] Compounds that inhibit RBPJ activity include, for example, compounds that inhibit the expression of RBPJ or compounds that inhibit the function of RBPJ protein.Compounds that inhibit RBPJ expression are as described above, but include, for example, vectors containing gRNA and endonuclease targeting the RBPJ gene or nucleic acid sequences encoding them; siRNA, shRNA, miRNA, antisense nucleic acid targeting the RBPJ gene or expression vectors that can express these nucleic acid molecules; and compounds known to inhibit the expression of RBPJ gene.Compounds that inhibit the function of RBPJ protein are as described above, but include, for example, compounds that inhibit the binding of RBPJ to target DNA; compounds that inhibit the formation of a complex consisting of RBPJ protein, SHARP protein, NCoR1 or NCoR2 protein, GPS2 protein, and HDAC3 protein; and siRNA, shRNA, miRNA, stRNA, antisense nucleic acid targeting the GPS2 gene, NCoR2 gene, or HDAC3 gene or expression vectors that can express these nucleic acid molecules.

[0050] In another embodiment, the method can be performed in vitro. Tconv cells can be isolated from peripheral blood mononuclear cells of animals, including humans, by isolating them with CD4 + fraction or CD8 + fraction, preferably CD4 + CD25 - fraction or CD8 + The T cells can be obtained by separating the fractions using flow cytometry or the like. Tconv cells with the desired antigen specificity may be selected or induced and used. Alternatively, Tconv cells may be Tconv cells induced from pluripotent stem cells derived from animals, including humans, such as ES cells or iPS cells. Methods for inducing T cells from pluripotent stem cells are known. Examples of methods for inducing T cells with the desired antigen specificity from pluripotent stem cells include WO 2016 / 010148, WO 2016 / 010153, WO 2016 / 010154, WO 2016 / 010155, WO 2017 / 159087, WO 2017 / 159088, and WO 2017 / 179720. Any of the above methods may be used to suppress RBPJ expression in vitro.

[0051] In this embodiment, the method of the present application may further comprise the step of inducing regulatory T (Treg) cells from Tconv cells. Known techniques can be used to induce regulatory T (Treg) cells from Tconv cells. For example, Treg cells can be induced by reacting Tconv cells with IL-2 and TGF-β. This step can be performed after the step of suppressing RBPJ activity in Tconv cells. This step can also be performed in parallel with the step of suppressing RBPJ activity in Tconv cells.

[0052] The step of inducing Treg cells from Tconv cells is, for example, a step of reacting Tconv cells with IL-2 and TGF-β, for example, by adding IL-2 and TGF-β to a medium containing Tconv cells.

[0053] In the method of the present application, a medium prepared by adding necessary factors to a basal medium for animal cell culture is used for cell culture. Examples of basal media for animal cell culture that can be used in the present application include RPMI 1640 medium, Iscove's modified Eagle's Medium medium, Ham's F12 medium, MEM Zinc Option medium, IMEM Zinc Option medium, IMDM medium, Medium 199 medium, Eagle's Minimum Essential Medium (EMEM) medium, αMEM medium, Dulbecco's modified Eagle's Medium (DMEM) medium, Fischer's medium, and mixtures thereof.

[0054] The basal medium may contain serum (e.g., fetal bovine serum (FBS)) or may be serum-free. The serum-free medium may optionally contain one or more serum substitutes, such as albumin, bovine serum albumin (BSA), transferrin, apotransferrin, KnockOut Serum Replacement (KSR) (a serum substitute for ES cell culture) (Invitrogen), N2 supplement (Invitrogen), B27 supplement (Invitrogen), fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, 3'-thiolglycerol, or monothioglycerol. The basal medium may also contain one or more substances such as lipids (e.g., chemically defined lipid concentrate), amino acids, L-glutamine, GlutaMAX (Invitrogen), non-essential amino acids (NEAA), vitamins (e.g., nicotinamide, ascorbic acid), growth factors, antibiotics (e.g., penicillin and streptomycin), antioxidants, pyruvate, buffers, inorganic salts, and the like. An example of the basal medium is RPMI 1640 medium.

[0055] Known examples of TGFβ include TGFβ1, TGFβ2, and TGFβ3. An example of TGFβ is TGFβ1. The concentration of TGFβ can be determined appropriately by those skilled in the art and is not particularly limited. The concentration of TGFβ in the medium is not limited, but may be about 5 pg / mL to about 500 ng / mL, about 50 pg / mL to about 500 ng / mL, or about 500 pg / mL to about 50 ng / mL, for example, about 5 ng / mL.

[0056] The concentration of IL-2 is not particularly limited and can be determined appropriately by those skilled in the art. The concentration of IL-2 in the medium is not limited, but may be about 500 mIU / mL to about 50 kU / mL, about 5 IU / mL to about 50 kU / mL, or about 50 IU / mL to about 5 kU / mL, for example, about 500 IU / mL.

[0057] The medium may further contain ascorbic acid and / or retinoic acid. The concentration of ascorbic acid is not limited, but may be about 10 mg / mL to about 1 mg / mL, about 100 ng / mL to about 1 mg / mL, or about 1 μg / mL to about 100 μg / mL, for example, about 10 μg / mL. The concentration of retinoic acid in the medium is not limited, but may be about 10 pM to about 1 μM, about 100 pM to about 1 μM, or about 1 nM to about 100 nM, for example, about 10 nM.

[0058] In the method of the present application, cells may be cultured under general animal cell culture conditions. The culture period is not particularly limited, but may be 1 to 10 days or 2 to 5 days, for example, about 3 days. The culture temperature is not particularly limited, but is about 30 to 40°C, preferably about 37°C. The culture is preferably carried out in an atmosphere of CO2-containing air, with the CO2 concentration preferably being about 2 to 5%.

[0059] Tconv cells can be cultured, for example, in suspension. In this application, "suspension culture" refers to culturing cells in a non-adherent state on a culture dish. While not particularly limited, culture dishes that have not been artificially treated to improve cell adhesion (e.g., culture dishes not coated with extracellular matrix, etc.) or culture dishes that have been artificially treated to suppress adhesion (e.g., culture dishes coated with polyhydroxyethyl methacrylate (poly-HEMA) or 2-methacryloyloxyethyl phosphorylcholine polymer (Lipidure)) can be used.

[0060] Treg cells produced by the method of the present application may exhibit any of the following characteristics compared to Treg cells produced from Tconv cells in which RBPJ activity is not suppressed: (i) a higher expression level of FoxP3, (ii) a more stable expression level of FoxP3, (iii) more enhanced demethylation in the Conserved non-coding sequence 2 (CNS2) region of the FoxP3 gene, (iv) a stronger immunosuppressive ability of Treg cells, and (v) a more stable immunosuppressive ability of Treg cells.

[0061] The expression level of FoxP3 can be confirmed by quantitative PCR (qPCR), RT-PCR, real-time RT-PCR, microarray, or Northern blotting of FoxP3 mRNA, or by flow cytometry, ELISA, antibody immunoprecipitation, Western blotting, or mass spectrometry. The expression level of FoxP3 can be confirmed, for example, by flow cytometry.

[0062] "Stable FoxP3 expression levels" refers to the maintenance of FoxP3 expression in Treg cells over a longer period of time. Previous studies have shown that FoxP3 expression in induced regulatory T cells is unstable, preventing stable maintenance of immunosuppressive function, which is thought to hinder the clinical application of induced regulatory T cells. The stability of FoxP3 expression levels can be confirmed by standard methods. For example, human Treg cells can be administered to mice, and the FoxP3 positivity rate of human T cells in samples collected after a certain period of time has elapsed can be determined.

[0063] Gene demethylation can be confirmed by methods well known in the art, such as bisulfite sequencing. Enhanced demethylation in the CNS2 region of the FoxP3 gene can be confirmed by finding that the percentage of demethylated sites in the CNS2 region of the FoxP3 gene in Treg cells produced by the method of the present application is higher than the percentage of demethylated sites in the CNS2 region of the FoxP3 gene in Treg cells produced from Tconv cells in which RBPJ activity is not suppressed.

[0064] The immunosuppressive ability of Treg cells can be confirmed by methods well known in the art, for example, by evaluating the ability of Treg cells to suppress T cell proliferation. The ability to suppress T cell proliferation can be confirmed, for example, by comparing the dividing cell rate of T cells co-cultured with Treg cells with the dividing cell rate of T cells cultured alone. The ability to suppress T cell proliferation can be calculated, for example, using the following formula: (T cell proliferation suppressive ability) = 100 × {(dividing cell rate of T cells cultured alone) - (dividing cell rate of T cells co-cultured with Treg cells)} / (dividing cell rate of T cells cultured alone). The culture period is not particularly limited, but can be 1 to 10 days or 2 to 5 days, for example, about 3 days.

[0065] "The immunosuppressive ability of Treg cells is stable" means that the immunosuppressive ability of Treg cells is maintained for a longer period of time. The stability of the immunosuppressive ability can be confirmed by a conventional method. For example, the stability of the immunosuppressive ability can be evaluated by measuring the ability of the Treg cells to suppress T cell proliferation by the above-mentioned method after a certain period of time has passed since the induction of Treg cells.

[0066] The present application also provides Treg cells produced by the method of the present application. For example, the RBPJ gene is knocked out or knocked down in the Treg cells produced by the method of the present application. Compared with Treg cells produced from Tconv cells in which RBPJ activity is not suppressed, the Treg cells produced by the method of the present application may exhibit any of the following characteristics (i) to (v): (i) a higher FoxP3 expression level, (ii) a more stable FoxP3 expression level, (iii) increased demethylation in the conserved non-coding sequence 2 (CNS2) region of the FoxP3 gene, (iv) a stronger immunosuppressive ability of the Treg cells, and (v) a more stable immunosuppressive ability of the Treg cells.

[0067] The present application also provides a drug for inducing Treg cells, comprising a compound that inhibits RBPJ activity as an active ingredient. Examples of compounds that inhibit RBPJ activity include compounds that inhibit RBPJ expression or RBPJ protein function. Examples of compounds that inhibit RBPJ expression and RBPJ protein function are as described above.

[0068] The present application also provides an agent for inducing Treg cells, which comprises, as an active ingredient, Tconv cells in which RBPJ activity is suppressed.

[0069] The present application also provides a drug for immunosuppression comprising any one of the following (a) to (c) as an active ingredient: (a) Treg cells produced by the method of the present application, (b) a compound that suppresses RBPJ activity, and (c) Tconv cells in which RBPJ activity is suppressed.

[0070] The medicament of the present application can be used to treat patients with autoimmune diseases, such as Addison's disease, ankylosing spondylitis, autoimmune hepatitis, dermatitis, Goodpasture's syndrome, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, hemolytic anemia, juvenile arthritis, juvenile myositis, Kawasaki disease, inflammatory bowel disease (such as Crohn's disease and ulcerative colitis), polymyositis, pulmonary alveolar proteinosis, multiple sclerosis, myasthenia gravis, neuromyelitis optica, psoriasis vulgaris, psoriatic arthritis, rheumatoid arthritis, Sjögren's syndrome, systemic sclerosis, systemic sclerosis, systemic lupus erythematosus, thrombocytopenic purpura (TTP), type I diabetes, uveitis, vasculitis, and vitiligo vulgaris. The agents of the present application may also be used to treat tissue transplant patients, for example to inhibit transplant rejection and / or graft-versus-host disease (GVHD) in tissue transplant patients.

[0071] The agent of the present application may be frozen. Known methods can be used to freeze and thaw compounds that suppress RBPJ activity, Tconv cells, and Treg cells. When the agent of the present application contains Tconv cells or Treg cells, the agent of the present application may contain a cryoprotectant such as DMSO, glycerol, polyvinylpyrrolidone, polyethylene glycol, albumin, dextran, or sucrose.

[0072] The pharmaceutical agent of the present application may contain a pharmaceutically acceptable carrier or additive. Examples of such carriers or additives include isotonicity agents, thickeners, sugars, preservatives, pH adjusters, stabilizers, gel bases, humectants, suspending agents, excipients, buffers, and antioxidants. Specific carriers or additives include, but are not limited to, water for injection, physiological saline, 5% glucose solution, Ringer's solution, lactated Ringer's solution, acetated Ringer's solution, bicarbonate Ringer's solution, and amino acid solution. One or more pharmaceutically acceptable carriers or additives may be used, or two or more may be mixed together.

[0073] The pharmaceutical agent of the present application may be, for example, an injection, a liquid, an oral agent, a patch, a preparation for implantation, or a gel preparation.

[0074] Examples of routes of administration of the drug of the present application include intravenous administration, subcutaneous administration, intramuscular administration, intra-arterial administration, lymphatic administration, intrathecal administration, intraperitoneal administration, rectal administration, vaginal administration, transdermal administration, implantation, direct administration to an organ, and local transplantation.

[0075] The dosage and frequency of administration of the agent of the present application can be appropriately determined by those skilled in the art depending on the animal species, health condition, age, body weight, route of administration, and dosage form of the subject, so that an effective amount of the active ingredient is administered to the subject. For example, the agent of the present application can be administered once to several times a day, or once to several times a day or every few days, or once a week or every few weeks, for example, once every 1 to 4 weeks, but is not limited thereto. The effective amount in a given situation can be easily determined by routine experimentation and is within the skill and judgment of an ordinary clinician. For example, when the agent of the present application contains cells as an active ingredient, an effective amount is, but is not limited to, for example, about 10 cells in terms of the number of cells. ４ pieces / kg weight ~ approx. 10 ７ It can be per kg body weight.

[0076] As used herein, "treat" or "treatment" means reducing or eliminating the cause of a disease, slowing or halting its progression, and / or reducing, alleviating, ameliorating or eliminating its symptoms in a subject with the disease.

[0077] Subjects for disease treatment include mammals such as mice, rats, hamsters, guinea pigs, cows, horses, pigs, sheep, monkeys, orangutans, chimpanzees, dogs, cats, and humans, preferably primates, and more preferably humans.

[0078] The present composition can be used alone or in combination with one or more additional active ingredients, particularly active ingredients for the treatment or prevention of diseases. The term "combined use" of ingredients refers not only to the use of a dosage form containing all of the ingredients or the use of a combination of dosage forms containing each ingredient separately, but also to the simultaneous, sequential, or delayed administration of each ingredient, as long as they are used for the treatment and / or prevention of diseases. Two or more additional active ingredients can also be used in combination. Suitable active ingredients for combination use include, for example, anti-inflammatory agents, antibacterial agents, antifungal agents, antiviral agents, immunosuppressants, molecular targeting drugs, etc.

[0079]

[0001] The present application also provides a method for screening a drug for immunosuppression, the method comprising the step of selecting a compound that inhibits RBPJ activity. The screening method of the present application comprises, for example, the following steps: (a) measuring RBPJ activity in the presence and absence of a test compound, and (b) selecting the compound if the RBPJ activity is inhibited in the presence of the test compound compared to in the absence of the test compound. The measurement in step (a) is carried out, for example, using cells that express RBPJ.

[0080] The "test compound" may be any compound that can be a candidate for an immunosuppressive compound, and its type is not particularly limited. The test compound may be, for example, an organic compound, an inorganic compound, a nucleic acid (e.g., siRNA, shRNA, miRNA, antisense, decoy, aptamer, ribozyme), a protein (e.g., antibody), a peptide (linear peptide, cyclic peptide), a sugar chain, a lipid, or a combination thereof.

[0081] RBPJ activity can be measured, for example, by a reporter gene assay using an RBPJ-binding sequence. Specifically, a luciferase gene expression vector for reporter gene assays is constructed by extracting the transcription start region of the FoxP3 locus and inserting it upstream of the luciferase gene. The transcription start region of the FoxP3 locus contains an RBPJ-binding sequence. After introducing the expression vector into cells, if luciferase gene expression can be detected, RBPJ activity can be measured using this assay system.

[0082] The present application also provides a kit for inducing Treg cells, comprising a compound that inhibits RBPJ activity. Compounds that inhibit RBPJ activity include, for example, compounds that inhibit RBPJ expression or RBPJ protein function. Examples of compounds that inhibit RBPJ expression and RBPJ protein function are as described above. The kit of the present application may further include a buffer solution, a reaction vessel, an instruction manual, and the like.

[0083] The present application also provides a method for treating an autoimmune disease, comprising administering to a subject in need thereof Treg cells, compounds that inhibit RBPJ activity, and / or Tconv cells with inhibited RBPJ activity produced by the methods of the present application. The present application also provides use of Treg cells, compounds that inhibit RBPJ activity, and / or Tconv cells with inhibited RBPJ activity produced by the methods of the present application for the manufacture of a medicament for treating an autoimmune disease. The present application also provides Treg cells, compounds that inhibit RBPJ activity, and / or Tconv cells with inhibited RBPJ activity produced by the methods of the present application for use in treating an autoimmune disease. Examples of autoimmune diseases and compounds that inhibit RBPJ activity are described above.

[0084] Prevention Methods The present application also provides a method for preventing autoimmune diseases, comprising administering Treg cells, compounds that inhibit RBPJ activity, and / or Tconv cells with inhibited RBPJ activity produced by the methods of the present application to a subject in need thereof. The present application also provides use of Treg cells, compounds that inhibit RBPJ activity, and / or Tconv cells with inhibited RBPJ activity produced by the methods of the present application for the manufacture of a medicament for preventing autoimmune diseases. The present application also provides Treg cells, compounds that inhibit RBPJ activity, and / or Tconv cells with inhibited RBPJ activity produced by the methods of the present application for use in preventing autoimmune diseases. Examples of autoimmune diseases and compounds that inhibit RBPJ activity are as described above.

[0085] The present invention will be explained in more detail below by showing examples, but the present invention is not limited to these examples in any way.

[0086] Example 1. Increased FoxP3 expression by knockout of the RBPJ gene. Human-derived PBMCs (Peripheral Blood Mononuclear Cell, Cellular Technology Ltd.) were frozen and thawed, and CD4 +CD4+ T cells were enriched using a T Cell Isolation Kit (Miltenyi Biotec). After treatment, cells were stained with anti-CD4 (RPA-T4, Biolegend), anti-CD25 (M-A251, BD Pharmigen), anti-CD45RA (HI100, Biolegend), and anti-CD127 (HIL-7R-M21, BD Bioscience) antibodies at 4°C for 30 minutes. CD4+CD25-CD45RA+ naive conventional T (Tconv) cells were isolated by flow cytometry using a FACS Aria Fusion (BD). The isolated naive conventional T cells were cultured at a cell density of 1 × 10 in RPMI 1640 (Nacalai Tesque) containing 500 IU / ml interleukin 2 (IL-2, R&D Systems), 10% FBS (Cytiva), 2 mM of GlutaMAX, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 55 μM β-mercaptoethanol, 100 U / ml penicillin, 100 μg / ml streptomycin, and 10 mM of HEPES (Gibco) (hereafter referred to as T cell medium). 6 The cells were suspended at 1000 cells / mL and mixed with Dynabeads Human T-Activator CD3 / CD28 (hereafter referred to as CD3 / CD28 Dynabeads, Thermo Fisher Scientific) at a 1:1 ratio and cultured at 37°C in a 5% CO2 incubator for 3 days. After culture, the CD3 / CD28 Dynabeads were removed and the cells were cultured under the same conditions for an additional 6–8 days. During the culture period, an equal volume of fresh T cell medium supplemented with 1000 IU / mL IL-2 was added every day.

[0087] Ribonucleoproteins (RNPs) for RBPJ gene knockout were prepared by mixing 400 μM crRNA (GAAGAATTCACAGTCCGAGA (SEQ ID NO: 3), AGATACTTGCATGTAGAAGG (SEQ ID NO: 4), IDT) with 400 μM tracrRNA (IDT) at a 1:1 (v / v) ratio, incubating at 95°C for 5 minutes, and then warming to room temperature. 2.7 μL of the 200 μM gRNA complex was then mixed with 30 μg of Cas9 protein (Takara Bio Inc.) and incubated at room temperature for at least 15 minutes. For negative controls, Alt-R CRISPR-Cas9 Negative Control crRNAs #1 and #2 (both IDT) were used as crRNAs. Unless otherwise specified, two RNPs targeting the same target were mixed in equal amounts, with 30 μg of Cas9 used.

[0088] After culture, naive conventional T cells were cultured at 1-2 × 10 in P2 Primary Cell Nucleofector Solution (Lonza). 6 The cells were suspended at a concentration of 20 μL and mixed with the prepared RNP. The mixture was transferred to a 16-well Nucleocuvette strip, and the RNP was introduced into the cells by electroporation using a 4D Nucleofector (Program EH-100, Lonza). The treated cell suspension was diluted to 1 × 10 cells in T cell medium. 6 The cells were suspended at 1000 cells / mL and cultured at 37°C in a 5% CO2 incubator for 6-8 days. Half of the medium was replaced daily with fresh T cell medium supplemented with 1000 IU / mL IL-2.

[0089] After the culture, dead cells were removed using the EasySep Dead Cell Removal (Annexin V) Kit (STEMCELL Technologies), and 1 × 10 cells were cultured in T cell medium containing Dynabeads CD3 / CD28 (1:1 ratio), 500 IU / mL IL-2, 5 ng / mL transforming growth factor-β (TGF-β, R&D Systems), 10 μg / mL ascorbic acid (Sigma-Aldrich), 10 nM all-trans retinoic acid (ATRA, Sigma-Aldrich), 5 μg / mL anti-interferon-γ antibody, anti-interleukin-4 antibody, anti-interleukin-6 antibody, anti-tumor necrosis factor-α antibody, and anti-Fas ligand antibody (all BioLegend). 6 The cells were suspended at 1000 cells / mL and cultured at 37°C in a 5% CO2 incubator for 3 days to induce FoxP3 expression.

[0090] After FoxP3 induction, cells were stained with the Foxp3 / Transcription Factor Staining Buffer Set (eBioscience) according to the manufacturer's instructions, the Zombie-NIR Fixable Viability Kit (BioLegend), and anti-FoxP3 antibody (236A / E7, eBioscience) for 30 minutes at 4°C. Stained cells were analyzed by flow cytometry using a FACS Celesta (BD).

[0091] These results confirmed that knockout of the RBPJ gene resulted in a higher FoxP3 positivity rate and higher FoxP3 expression (Figure 1). This suggests that knockout of the RBPJ gene leads to more efficient generation of induced regulatory T (Treg) cells. Furthermore, the high expression of FoxP3, a central transcription factor in regulatory T cells, suggests that these cells may be functionally similar to endogenous regulatory T cells.

[0092] Example 2. Enhancement of FoxP3 Expression by RBPJ Gene Knockdown Naive conventional T cells prepared as in Example 1 were induced for FoxP3 expression on the day of preparation using the same method as in Example 1. Knockdown of the RBPJ gene was achieved by adding 2 μM antisense oligonucleotides (CGGACTGTGAATTCTT (SEQ ID NO: 1), GTTGCCATAGAACATC (SEQ ID NO: 2), Qiagen) in addition to the FoxP3 expression-inducing stimulus. Negative control A Antisense LNA GapmeR (Qiagen) was used as a negative control. After FoxP3 induction, the cells were analyzed by flow cytometry as in Example 1.

[0093] These results confirmed that knockdown of the RBPJ gene resulted in a higher FoxP3 positivity rate and higher FoxP3 expression (Figure 2). This indicates that knockdown of the RBPJ gene leads to more efficient generation of induced regulatory T cells. Furthermore, the high expression of FoxP3, a central transcription factor in regulatory T cells, suggests that these cells may be functionally similar to endogenous regulatory T cells.

[0094] Example 3. Enhanced demethylation of FoxP3 conserved nontranslated region 2 (CNS2) by RBPJ gene knockout. FoxP3 induction in naive conventional T cells with RBPJ gene knockout was performed as described in Example 1. After 3 days of FoxP3 induction stimulation, CD3 / CD28 Dynabeads were removed, and the cells were cultured in fresh T cell medium containing 500 IU / mL IL-2 and 10 μg / mL ascorbic acid at 37°C in a 5% CO2 incubator for 7 days. During the culture period, half of the T cell medium was replaced daily with fresh medium supplemented with 1000 IU / mL IL-2 and 20 μg / mL ascorbic acid. After culture, the cells were stained as described in Example 1, and the live FoxP3-positive fraction was sorted using a FACS Aria Fusion. The sorted cells were reversed for over 20 hours and then DNA was extracted using NucleoSpin Tissue XS (Takara Bio Inc.). The extracted DNA was bisulfite converted using the EZ DNA Methylation-Lightning Kit (Zymo Research), and the FoxP3 CNS2 region was amplified by PCR (Fw Primer: 5'-TTGGGTTAAGTTTGTTGTAGGATAG-3' (SEQ ID NO: 5), Rv Primer: 5'-ATCTAAACCCTATTATCACAACCCC-3' (SEQ ID NO: 6), FASMAC). The amplified amplicon was excised from the gel after agarose gel electrophoresis and purified using a QIAquick Gel Extraction Kit (Qiagen). The purified amplicon was subjected to a TA cloning reaction (16°C, 1 hour) using the pTAKN-2 DynaExpress TA Cloning Kit (BioDynamics Laboratory Inc.), and the ligation mixture was transformed into Escherichia coli (DH5α, Takara Bio Inc.) (42°C, 45 seconds). The E. coli was plated on a kanamycin-containing LB plate and cultured at 37°C for 17–20 hours.After incubation, 16–24 single colonies per sample were selected and used to prepare sequencing templates using the illustra TempliPhi 100 Amplification Kit (Cytiva). The prepared templates were sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). The processed samples were analyzed by Sanger sequencing using an Applied Biosystems 3500 (Applied Biosystems). The sequence data were analyzed for demethylation at 11 CpG methylation sites in the CNS2 region, using the bisulfite conversion indicator. The demethylation rate was calculated from the data for 12 clones in each sample.

[0095] These results indicate that demethylation of the CNS2 region of the FoxP3 locus is promoted in RBPJ-knockout induced regulatory T cells (Fig. 3). Since demethylation of CNS2 has been reported to be involved in the stability of FoxP3 expression (Ohkura et al., Immunity. 2012 Nov 16;37(5):785-99.), we speculate that more stable induced regulatory T cells were obtained.

[0096] Example 4. Enhanced T Cell Proliferation Suppression in RBPJ Gene Knockout-Induced Regulatory T Cells. Naive conventional T cells prepared as in Example 3 were FoxP3-inducible and then cultured for 7 days. After culture, the induced regulatory T cells were fluorescently labeled by incubating at 37°C for 20 minutes in a CellTrace Far Red Cell Proliferation Kit (Thermo Fischer Scientific) diluted 1:1000 with PBS. Human PBMCs were frozen and thawed and fluorescently labeled in the same manner using a CellTrace Violet Cell Proliferation Kit (Thermo Fischer Scientific). First, 100 μL of PRIME-XV T Cell Expansion XSFM (serum-free T cell medium, Irvine Scientific) containing 20 IU / mL IL-2 and 1 μg / mL anti-CD3 antibody (OKT3, BioLegend) was added to each well of a V-bottom 96-well plate. Fluorescently labeled PBMCs were collected at 1 × 10 5 PBMCs were suspended in serum-free T cell medium at a ratio of 1:0.5 to 1:0.0625 (common ratio of 2) and seeded into a V-bottom 96-well plate. Fluorescently labeled induced regulatory T cells were also suspended in 50 μL of serum-free T cell medium and seeded into the plate. The cell suspension in each well was resuspended by pipetting and then cultured at 37°C for 3 days in a 5% CO2 incubator. After culture, the cells were stained with the Zombie-Green Fixable Viability Kit (BioLegend), anti-CD4 antibody (RPA-T4), and anti-CD8 antibody (RPA-T8) for 30 minutes at 4°C, and then analyzed by flow cytometry using a FACS Celesta.

[0097] For each sample, the percentage of CellTrace Far Red-negative CD4+ and CD8+ T cells that had divided at least once (% proliferation) was calculated, and the % suppression was calculated by: 100 × {(mean proliferation rate in wells without induced regulatory T cells) - (proliferation rate in control wells)} / (mean proliferation rate in wells without induced regulatory T cells). Furthermore, the % suppression ratio for each well was calculated relative to the suppression rate for wells containing negative control induced regulatory T cells at a PBMC:induced regulatory T cell ratio of 1:0.5, and the ratio was plotted as 1.

[0098] These results confirmed that induced regulatory T cells in which the RBPJ gene was knocked out had a higher ability to suppress T cell proliferation than the negative control (Figure 4).

[0099] Example 5. Effect of RBPJ gene knockout-induced regulatory T cells on graft-versus-host disease (GVHD) Graft-versus-host disease (GVHD) was induced in NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ mice (NSG mice, 7 weeks old, male, Jackson Laboratory Japan) by administering human-derived PBMCs. Human-derived PBMCs were frozen and thawed, and cell clumps formed by freezing and thawing were removed by passing them through a 40 μm cell strainer. Inducible regulatory T cells were prepared as in Example 3. Endogenous regulatory T cells were stained as in Example 1 and then separated by flow cytometry using FACS Aria Fusion as a fraction of CD4-positive, CD127-negative, and low-expressing cells, excluding CD25-intermediate, CD45RA-negative cells. Endogenous regulatory T cells were grown at a cell density of 1 × 10 in T cell medium containing 500 IU / ml IL-2. 6The cells were suspended at 2.5 × 10 cells / mL and mixed 1:1 with Dynabeads Human Treg Expander (hereafter referred to as Treg expander beads, Thermo Fisher Scientific) in a 5% CO2 incubator at 37°C for 8 days. After 8 days, the Treg expander beads were removed, and the cells were cultured under the same conditions for an additional 8–10 days. During the culture period, fresh T cell medium supplemented with 1000 IU / mL IL-2 was replaced with half the volume or added in equal amounts every day. Dead cells were removed from induced and endogenous regulatory T cells using the EasySep Dead Cell Removal (Annexin V) Kit. PBMCs, induced regulatory T cells, and endogenous regulatory T cells were each collected at 2.5 × 10 cells / mL in PBS. 7 The cells were suspended at 2.5 × 10 cells / mL, and 100 μL of PBMCs and regulatory T cells were mixed together to prepare 200 μL of cell mixture per mouse. The day before cell administration, NSG mice were irradiated with 2.25 Gy of X-rays using an MBR-1520R-3 (Hitachi Power Solutions). The day after X-ray irradiation, NSG mice were irradiated with 2.5 × 10 cells / mL. ６ PBMCs and 2.5 x 10 cells ６ A 200μL mixture of cells and induced or endogenous regulatory T cells was administered intravenously. After administration of the cell mixture, mice's weight and survival rate were measured at random intervals for 30 days. Mice that lost 20% or more of their body weight were euthanized and treated as dead.

[0100] As a result, it was confirmed that the negative control induced regulatory T cells had no effect on the reduced survival rate due to GVHD, but the induced regulatory T cells in which the RBPJ gene was knocked out improved survival rate to a level equivalent to that of endogenous regulatory T cells (Figure 5).

[0101] Example 6. In vivo stability of RBPJ gene knockout induced regulatory T cells. The in vivo stability of RBPJ gene knockout induced regulatory T cells was verified by intravenously administering them to NSG mice. The induced regulatory T cells were prepared as in Example 5, and 100 μL of cell suspension was administered to each mouse. Five days after cell administration, spleens were harvested from the mice and blood was collected from the inferior vena cava. The spleens were ground using a 70 μm mesh to prepare a cell suspension. The suspension was suspended in 500 μL of erythrocyte lysis buffer, Hybri-Max (Sigma-Aldrich), and incubated at room temperature for 5 minutes for hemolysis. The hemolyzed cells were washed in PBS containing 2% bovine serum albumin before staining. 500-700 μL of collected peripheral blood was added to 10 mL of ACK Lysing Buffer (Gibco) and incubated at room temperature for 10 minutes for hemolysis. Similarly, hemolyzed cells were washed in PBS containing 2% bovine serum albumin before staining. Spleen and peripheral blood-derived cells were mixed and stained using the Zombie-Green Fixable Viability Kit, anti-CD4 antibody (RPA-T4), anti-FoxP3 antibody (236A / E7), and anti-mouse CD45 antibody (30-F11) as described in Example 1, followed by flow cytometry analysis using a FACS Celesta.

[0102] The administered induced regulatory T cells were analyzed as a human CD4-positive mouse CD45-negative fraction, and the FoxP3-positive rate in the corresponding fraction was calculated.

[0103] These results indicated that RBPJ-knockout induced regulatory T cells stably expressed FoxP3 in vivo (Figure 6), as predicted from the enhanced CNS2 demethylation at the FoxP3 locus in Example 2. This is thought to be related to the maintenance of the suppressive ability of induced regulatory T cells, and is consistent with the effect on GVHD shown in Example 5.

[0104] Example 7. Enhancement of FoxP3 expression by knockout of GPS2, NCOR2, and HDAC3 genes In the same manner as in Example 1, the GPS2 gene (gRNA1: GCTGCACCGGCACATTATGATGG (SEQ ID NO: 7), gRNA2: AACGGAGCGAAAGGAACAGAGG (SEQ ID NO: 8)), NCOR2 gene (gRNA1: GGAACACGGCCGCAACTGGTCGG (SEQ ID NO: 9), gRNA2: AGAAGGCTGAACTGCACATCGG (SEQ ID NO: 10)), and HDAC3 gene (gRNA1: GTAATGCAGGCAGGCTATGGG (SEQ ID NO: 11), gRNA2: GACGTGGGCAACTTCCACTACGG (SEQ ID NO: 12)) were knocked out in PBMC-derived conventional CD4+ T cells, respectively, followed by induction of FoxP3 expression and expression analysis. As a result, it was confirmed that higher FoxP3 expression was induced in cells in which any of the genes for GPS2, NCOR2, or HDAC3, components of the SMRT-NCoR inhibitory complex, was knocked out (Figure 7).

[0105] Example 8. Involvement of the SMRT-NCoR inhibitory complex in RBPJ-mediated suppression of FoxP3 expression. Naive conventional T cells prepared as in Example 1 were stimulated with plate-immobilized anti-CD3 antibody (10 μg / mL, UCHT1, BioLegend) and anti-CD28 antibody (5 μg / mL, CD28.2, BioLegend) for 2 hours at 37°C in a 5% CO2 incubator for 24 hours. Subsequently, cells were infected with lentiviruses expressing green fluorescent protein (GFP), wild-type RBPJ, or mutant RBPJ with the F235A / L362A amino acid substitution mutations by centrifugal infection (33°C, 1400 x g, 2 hours). Since the wild-type and mutant RBPJ-expressing viruses cotranscribe the 2A self-cleavage sequence and the GFP gene, GFP can be used as a reporter. Two days after infection, the cells were cultured in fresh T cell medium containing 500 IU / mL IL-2 at 37°C in a 5% CO2 incubator for 6-8 days. After culture, the GFP-positive viable cells were separated by flow cytometry using a FACS Aria Fusion. The separated GFP-positive conventional T cells were subjected to FoxP3 expression induction as in Example 1, followed by FoxP3 expression analysis using a FACS Celesta. The amino acid sequences of wild-type RBPJ and mutant RBPJ are shown in SEQ ID NOs: 13 and 14, respectively.

[0106] As a result, FoxP3 induction was significantly reduced in conventional T cells expressing wild-type RBPJ, whereas expression of mutant RBPJ had almost no effect (Fig. 8). Since F235 / L362 has been reported to be important for SHARP-mediated SMRT-NCoR inhibitory complex formation (Yuan et al., Cell Rep. 2019 Jan 22;26(4):845-854.e6.), this confirms the involvement of the SMRT-NCoR inhibitory complex in RBPJ-mediated FoxP3 repression.

[0107] Example 9. Effect of HDAC3 gene knockout on suppression of FoxP3 expression by RBPJ overexpression. As in Example 8, naive conventional T cells were infected with lentivirus expressing wild-type or mutant RBPJ. After 8–10 days of culture, RNP containing HDAC3 gRNA (gRNA1: GTAATGCAGGAGGACCAGGCTAT (SEQ ID NO: 15), gRNA2: GACGTGGGCAACTTCCACTA (SEQ ID NO: 16)) was introduced into the cells by electroporation, as in Example 1. After 6–8 days of culture, the cells were sorted by flow cytometry using a FACS Aria Fusion to separate the GFP-positive viable cells. As in Example 1, the sorted GFP-positive conventional T cells were subjected to induction of FoxP3 expression and then analyzed for FoxP3 expression using a FACS Celesta.

[0108] As a result, we confirmed that HDAC3 gene knockout had no effect on mutant RBPJ overexpression, while the decrease in FoxP3 expression observed with wild-type RBPJ overexpression was partially restored by HDAC3 knockout (Fig. 9). Because HDAC3 is a component of the SMRT-NCoR inhibitory complex, RBPJ-mediated FoxP3 suppression may target the SMRT-NCoR inhibitory complex, which contains RBPJ, thereby regulating FoxP3 expression.

[0109] Example 10. Changes in histone acetylation at the FoxP3 locus due to RBPJ gene knockout. Inducible regulatory T cells in which the RBPJ gene was knocked out were prepared as in Example 1. The prepared cells were fixed by incubating in 1% formaldehyde at room temperature for 10 minutes. After fixing, the cells were washed in PBS containing 2% bovine serum albumin and then suspended in 100 μL of nuclear lysis buffer (50 mM Tris-HCl pH 7.5, 10 mM EDTA, 1% SDS) containing cOmplete protease inhibitor cocktail (Roche) and incubated on ice for 10 minutes. The cells were sonicated using a Picoruptor (Diagenode) by repeating five cycles of 30 seconds of disruption and 30 seconds of incubation. After disruption, the cells were centrifuged at 10,000 xg for 10 minutes at 4°C, and the supernatant was collected to prepare a solution containing sheared chromatin. Chromatin immunoprecipitation was performed using the iDeal ChIP-seq kit for Histones (Diagenode) according to the package insert. Anti-histone H3 acetylation antibody (Millipore) was used for immunoprecipitation. Sequencing libraries were prepared from the immunoprecipitated DNA solution using the KAPA HyperPrep kit (NIPPON Genetics) according to the package insert. The prepared libraries were sequenced using NextSeq500 (Illumina) or NovaSeq (Illumina). The peak signal of histone H3 acetylation in the human genome was calculated from the resulting sequence data.

[0110] These results confirmed that in induced regulatory T cells in which the RBPJ gene was knocked out, histone H3 acetylation was elevated at the FoxP3 locus and its surrounding area compared to negative controls (Figure 10). Changes in histone structure caused by histone acetylation are generally thought to promote transcription by allowing transcription factors and other transcriptional activators to access the genome, which is regulated by HDAC molecules (Nat Rev Mol Cell Biol. 2015 Apr;16(4):258-64). Therefore, together with Examples 8-10, this suggests that FoxP3 expression in induced regulatory T cells is regulated by the SMRT-NCoR inhibitory complex, which includes RBPJ and HDAC3, through histone H3 acetylation at the FoxP3 locus and its surrounding area.

[0111] Example 11. Changes in histone acetylation at the FoxP3 locus due to RBPJ overexpression. Inducible regulatory T cells overexpressing the RBPJ gene were prepared as described in Example 6. The prepared cells were fixed by incubation in 1% formaldehyde at room temperature for 10 minutes. After fixation, the cells were washed in PBS containing 2% bovine serum albumin and then suspended in lysis / permeabilization buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP40, 0.1% Tween 20, 0.01% Digitonin, 1% BSA) and permeabilized by incubation on ice for 3 minutes. After treatment, the cells were washed with wash buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 1% BSA) and then blocked by incubation on ice for 10 minutes in intracellular staining buffer (BioLegend) containing TruStain FcX (BioLegend). After blocking, the cells were stained with anti-FoxP3 antibody (259D) by incubation on ice for 45 minutes. The live FoxP3-positive fraction was separated from the stained cells using a FACS Aria Fusion. A solution containing sheared chromatin was prepared from the separated FoxP3-positive fraction as described in Example 10. The prepared sheared chromatin solution was diluted with 10x ChIP dilution buffer (16.7 mM Tris pH 7.5, 167 mM NaCl, 1.2 mM EDTA, 1.1% TritonX-100, 0.01% SDS) at 1 / 10 the volume of the solution and added with cComplete protease inhibitor cocktail. The solution was then blocked by incubating on ice for at least 1 hour with Fab Fragment Goat Anti-Mouse IgG (Jackson ImmunoResearch). Immunoprecipitation, library preparation, DNA sequencing, and data analysis were then performed as described in Example 10.

[0112] As a result, it was confirmed that in induced regulatory T cells overexpressing the RBPJ gene, histone H3 acetylation at the FoxP3 locus was suppressed compared to the negative control (Figure 11). Similar to Example 10, this result supports the idea that FoxP3 expression in induced regulatory T cells is regulated by the SMRT-NCoR inhibitory complex containing RBPJ and HDAC3 through histone H3 acetylation at and around the FoxP3 locus.

Claims

1. A method for producing regulatory T (Treg) cells, comprising a step of suppressing RBPJ activity in conventional T (Tconv) cells.

2. The method according to claim 1, further comprising the step of inducing regulatory T (Treg) cells from Tconv cells.

3. The method according to claim 2, wherein the step of inducing Treg cells from Tconv cells comprises the step of reacting Tconv cells with IL-2 and TGF-β.

4. The method according to claim 1, wherein the step of suppressing RBPJ activity is a step of suppressing the expression of the RBPJ gene or a step of suppressing the function of the RBPJ protein.

5. The method according to claim 4, wherein the step of suppressing expression of the RBPJ gene is a step of knocking out the RBPJ gene or a step of knocking down the RBPJ gene.

6. The method according to claim 4, wherein the step of suppressing the function of the RBPJ protein is a step of inhibiting the transcriptional activity of the RBPJ protein, or a step of inhibiting the formation of a complex consisting of the RBPJ protein, the SHARP protein, the NCoR1 or NCoR2 protein, the GPS2 protein, and the HDAC3 protein.

7. The method of claim 1, wherein the Treg cells are inducible Treg (iTreg) cells.

8. The Tconv cells are CD4 + cells, CD8 + cells, CD4 + CD25 - Cells, or CD4 + CD25 - CD45RA + The method of claim 1, which is a cell.

9. The method of claim 1, wherein the Tconv cells are human Tconv cells and the Treg cells are human Treg cells.

10. The method of claim 1, characterized in that the process is carried out in vitro.

11. The method according to claim 1, wherein, when Treg cells produced from Tconv cells in which RBPJ activity is suppressed are compared with Treg cells produced from Tconv cells in which RBPJ activity is not suppressed, the former Treg cells have any of the following characteristics (i) to (v): (i) a higher expression level of FoxP3, (ii) a more stable expression level of FoxP3, (iii) more enhanced demethylation in the conserved non-coding sequence 2 (CNS2) region of the FoxP3 gene, (iv) a stronger immunosuppressive ability of Treg cells, and (v) a more stable immunosuppressive ability of Treg cells.

12. A drug for inducing Treg cells, comprising as an active ingredient a compound that suppresses RBPJ activity.

13. A drug for inducing Treg cells, comprising as an active ingredient Tconv cells in which RBPJ activity is suppressed.

14. Treg cells produced by the method of claim 1.

15. A drug for immunosuppression comprising any one of the following (a) to (c) as an active ingredient: (a) a Treg cell described in claim 14; (b) a compound that suppresses RBPJ activity; (c) a Tconv cell in which RBPJ activity is suppressed.

16. The drug according to claim 15 for treating patients with autoimmune diseases.

17. The drug according to claim 16, wherein the autoimmune disease is any one of Addison's disease, ankylosing spondylitis, autoimmune hepatitis, dermatitis, Goodpasture's syndrome, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, hemolytic anemia, juvenile arthritis, juvenile myositis, Kawasaki disease, inflammatory bowel disease (such as Crohn's disease and ulcerative colitis), polymyositis, pulmonary alveolar proteinosis, multiple sclerosis, myasthenia gravis, neuromyelitis optica, psoriasis vulgaris, psoriatic arthritis, rheumatoid arthritis, Sjogren's syndrome, systemic sclerosis, systemic sclerosis, systemic lupus erythematosus, thrombocytopenic purpura (TTP), type I diabetes mellitus, uveitis, vasculitis, and vitiligo vulgaris.

18. The method of claim 15 for treating tissue transplant patients.

19. The agent according to claim 18 for inhibiting transplant rejection and / or graft-versus-host disease (GVHD).

20. A method for screening drugs for immunosuppression, comprising the step of selecting a compound that inhibits the activity of RBPJ.

21. The method of claim 20, comprising: (a) measuring the activity of RBPJ in the presence and absence of a test compound; and (b) selecting the compound if the activity of RBPJ is inhibited in the presence of the test compound compared to the absence of the test compound.

22. The method of claim 21, wherein the measurement is performed using cells that express RBPJ.

23. The method according to claim 21, wherein the test compound is any one of an organic compound, an inorganic compound, a nucleic acid (siRNA, shRNA, miRNA, antisense, decoy, aptamer, ribozyme), a protein (antibody), a peptide (linear peptide, cyclic peptide), a glycan, a lipid, or a combination thereof.

Images