Novel vaccine composition

Abstract

The present invention relates to a novel vaccine composition capable of inducing a more efficient antigen-specific T-cell immune response against prostate cancer. More specifically, the present invention provides a vaccine composition for treating and preventing prostate cancer, the vaccine composition containing a) a genetic construct comprising a polynucleotide encoding at least one prostate cancer antigen selected from the group consisting of prostatic acid phosphatase (PAP), prostate-specific antigen (PSA), and prostate-specific membrane antigen (PSMA), and b) at least one vaccine adjuvant or immunomodulator.

Description

Novel vaccine composition

[0001] The present invention relates to a novel vaccine composition, and more specifically, to a novel vaccine composition for treating and preventing prostate cancer and a dosing regimen using the same.

[0002] A DNA vaccine is defined as a purified plasmid DNA containing genes encoding vaccine antigens and regulatory genes that induce an immune response, designed for production in an appropriate host system. However, the use of plasmid DNA as a vaccine has been surprisingly ineffective in humans, hindering its practical application. It has been used in the development of some animal vaccines, and clinical trials of DNA vaccines have been conducted during the development of vaccines for diseases such as Zika and MERS. However, fully commercialized human vaccines remain rare.

[0003] To address these shortcomings, a technique called electroporation was introduced. This method involves placing a special injector on the skin and applying electrical stimulation to temporarily destabilize cell membranes, allowing the DNA contained in plasmids to be delivered through these gaps. Electroporation has significantly improved the efficiency of gene transfer into an individual.

[0004] Nevertheless, there are not many successful products using DNA vaccines because their gene transfer efficiency is still lower than that of viral vaccines or mRNA vaccines.

[0005] Meanwhile, cancer vaccines are an active immunotherapy method that enhances the body's immune function and eliminates cancer cells by administering tumor-specific antigens (TSAs) to cancer patients, thereby activating the immune system. Cytotoxic T lymphocyte (CTL) responses are crucial in the immune response to eliminate cancer cells. CTL activation allows them to destroy cancer cells through MHC class I molecules, which are antigen-recognizing molecules. CTL activation requires recognition of tumor-associated antigens (TAAs). However, none of the cancer antigens discovered to date are completely specific to cancer cells. While tumor antigens are primarily expressed on cancer cells, they are also expressed on normal cells. Therefore, stimulating the immune system to recognize tumor-associated antigens could lead to attacks on normal cells as well, potentially triggering an autoimmune response.

[0006] Among the various cancers amenable to cancer vaccines, metastatic castrate-resistant prostate cancer (mCRPC) remains a significant unmet medical need, despite the approval of several new drugs for its treatment. Enzalutamide and abiraterone are the first- and second-line treatments for mCRPC, generating annual global sales of approximately 7 trillion won. Despite aggressive standard treatment, including these two drugs, the median survival time for mCRPC patients is 18-24 months, making extending life expectancy a critical need.

[0007] Abiraterone also inhibits the production of cortisol and androgens by inhibiting the enzyme CYP17A1. However, cortisol suppression leads to a relative increase in aldosterone levels, a mineralocorticoid hormone. Increased aldosterone levels can cause fluid retention, including hypertension, hypokalemia, and edema, so caution is advised in patients with a history of myocardial infarction or ventricular arrhythmia.

[0008] Reports indicate that mCRPC patients with cardiovascular disease have increased rates of hospitalization and mortality, with Grade 3-5 systemic adverse reactions occurring in more than 50% of patients. Furthermore, treatment discontinuation due to adverse reactions accounted for more than 10% of cases. Therefore, safety management is essential. Furthermore, resistance develops around six months after administration of both drugs, and cross-resistance between the two drugs has been observed in 30% of patients, significantly limiting treatment options.

[0009] Additionally, no significant improvement was observed in the quality of life assessment of prostate cancer patients, so the overall benefit-risk ratio of treatment is not significant.

[0010] Although immune checkpoint inhibitors have shown therapeutic efficacy in various cancer types, clinical trials in patients with mCRPC have failed to demonstrate significant therapeutic effects as monotherapy. Combination therapy with pembrolizumab and enzalutamide has shown some clinical responses in patients with prostate cancer, but little objective benefit has been observed (Beer et al., J. Clin. Oncol. 35(1):40-47, 2017; Graffet et al., Oncotarget7(33):52810-52817, 2016; Slovinet et al., Ann. Oncol. 24(7):1813-1821, 2013). The immunological characteristics of mCRPC patients can be summarized into three categories: (1) a suppressive tumor microenvironment, (2) an impaired T cell immune system, and (3) a non-inflamed tumor environment. Approaches to overcoming these three factors are expected to be crucial for the treatment of mCRPC.

[0011] The present invention aims to address various issues, including the aforementioned ones, and provides a novel vaccine composition for the treatment and prevention of prostate cancer and a combination therapy with various immunomodulators. However, the scope of the present invention is not limited by the aforementioned objectives.

[0012] According to one aspect of the present invention, a vaccine composition for treating and preventing prostate cancer is provided, comprising: a) a genetic construct comprising a polynucleotide encoding at least one prostate cancer antigen selected from the group consisting of prostatic acid phosphatase (PAP), prostate-specific antigen (PSA), and prostate-specific membrane antigen (PSMA); and b) one or more vaccine adjuvants and / or immunomodulators.

[0013] According to another aspect of the present invention, a method for treating prostate cancer in a subject is provided, comprising administering to the subject any one of the above vaccine compositions.

[0014] A vaccine composition according to one embodiment of the present invention can be effectively used for the treatment of diseases requiring a T cell immune response, such as cancer, by inducing an antigen-specific T cell immune response more efficiently than when a nucleic acid molecule encoding an antigen is administered alone.

[0015] FIG. 1 is a schematic diagram schematically showing the structure of plasmid DNA SL-T10P for a DNA vaccine according to one embodiment of the present invention.

[0016] Figure 2 is a schematic diagram schematically showing the structure of the vaccine adjuvant BD-121A used in one embodiment of the present invention.

[0017] Figure 3a is a schematic diagram schematically showing a drug administration schedule for an animal experiment using the vaccine composition SL-T10 according to one embodiment of the present invention.

[0018] Figure 3b is a graph showing the results of analyzing the number of vaccine-specific T cells using an interferon-gamma specific ELISpot assay after administration of the vaccine composition SL-T10 according to one embodiment of the present invention.

[0019] FIG. 4a is a schematic diagram schematically showing a drug administration schedule for an animal experiment to compare differences according to the number of administrations of the vaccine composition SL-T10 according to one embodiment of the present invention.

[0020] Figure 4b is a series of graphs showing the results of analyzing the number of antigen (left: PAP, center: PSA, right: PSMA)-specific T cells using interferon-gamma specific ELISpot analysis after a single administration and three repeated administrations of SL-T10 in an animal experiment performed according to the schedule shown in Figure 4a.

[0021] Figure 5a is a schematic diagram schematically showing an experimental schedule for an animal experiment to confirm the effect of administering BD-121A, a vaccine adjuvant, to a DNA vaccine (SL-T10P) according to one embodiment of the present invention.

[0022] Figure 5b is a series of graphs showing changes in tumor growth in experimental animals administered substances (PBS, SL-T10P, and SL-T10) according to an embodiment of the present invention according to the administration schedule of Figure 5a. The upper graphs represent the results of measuring tumor volumes of individual experimental animals, and the lower graphs represent the results of comparing the tumor growth rates of the three substances.

[0023] Figure 6a is a graph showing the results of measuring tumor volume over time after administering a triple-agent combination of a DNA vaccine (SL-T10) and IL-7 according to one embodiment of the present invention, and then adding an anti-PD-1 antibody, which is an immune checkpoint inhibitor, to the DNA vaccine and IL-7 combination formulation to a tumor model animal.

[0024] Figure 6b is a graph showing the results of measuring the survival rate over time in the animal experiment of Figure 6a.

[0025] Figure 6c is a graph showing the results of measuring the tumor volume over time after repeating the same experiment in which the dosage of the DNA vaccine (SL-T10) according to one embodiment of the present invention was fixed at 12 μg in the experiment of Figure 6a.

[0026] Figure 5d is a graph showing the results of measuring the survival rate over time in the animal experiment of Figure 5c.

[0027] Figure 7a is a schematic diagram schematically showing an animal experiment schedule for elucidating the anticancer mechanism of a DNA vaccine (SL-T10) according to one embodiment of the present invention.

[0028] FIG. 7b is a series of graphs showing the results of analyzing the specific immune response to antigens (left: PAP, center: PSA, and right: PSMA) in the SL-T10 vaccine in the spleen of a tumor model animal (B16F10-PAP tumor mouse) in which SL-T10 according to one embodiment of the present invention was administered three times (priming on day 0, first boosting on day 7, and second boosting on day 14) as shown in FIG. 7a, and anti-PD-1 monoclonal antibody was intraperitoneally administered five times (on days 0, 4, 7, 11, and 14) and GX-I7 was intramuscularly administered once (on day 7), using an ex vivoIFN-γ ELISpot assay.

[0029] Figure 76c shows the naive T cells and CD3 in PBMCs after administering SL-T10 according to one embodiment of the present invention three times (priming on day 0, first boosting on day 7, and second boosting on day 14) to a tumor model animal (B16F10-PAP tumor mouse) as shown in Figure 7a, intraperitoneal administration of anti-PD-1 monoclonal antibody five times (days 0, 4, 7, 11, and 14), and intramuscular administration of GX-I7 once (day 7). +CD4 in T cell subsets (TCM) and memory T cell subsets (TEM) + T cells and CD8 + A series of graphs showing the results of flow cytometry analysis of the proportion of T cells.

[0030] Figure 7d shows CD4 in tumor tissues extracted after the end of the animal experiment described in Figure 7b. + T cells, CD8 + T cells and tumor-infiltrating CD8 + A series of graphs showing the results of analyzing the number of T cells using flow cytometry.

[0031] Figure 7e is a series of graphs showing the results of flow cytometry analysis of the number of myeloid-derived suppressor cells (MDSC) in tumor tissues extracted after the end of the animal experiment described in Figure 7b (left) and the results of measuring the volume of the extracted tumor tissues (right).

[0032] FIG. 8A is a schematic diagram schematically showing an animal experiment dosing schedule for analyzing vaccine-specific T cell responses when co-administering a DNA vaccine and an IL-2 or STING agonist as an immunomodulator according to one embodiment of the present invention.

[0033] Figure 8b is a series of graphs showing the results of analyzing the vaccine-specific T cell immune response using ex vivo INF-γ ELISpot analysis through animal experiments conducted according to the experimental schedule illustrated in Figure 8a.

[0034] Figure 8c is a schematic diagram schematically showing an animal experiment administration schedule for analyzing the anticancer effect when co-administering a DNA vaccine and an IL-2 or STING agonist as an immunomodulator according to one embodiment of the present invention.

[0035] Figure 8d is a series of graphs showing changes in tumor growth analyzed through animal experiments conducted according to the experimental schedule illustrated in Figure 8c.

[0036] According to one aspect of the present invention, a composition for treating and preventing prostate cancer is provided, comprising: a) a genetic construct comprising a polynucleotide encoding at least one prostate cancer antigen selected from the group consisting of prostatic acid phosphatase (PAP), prostate-specific antigen (PSA), and prostate-specific membrane antigen (PSMA); and b) one or more vaccine adjuvants and / or immunomodulators, wherein the prostate cancer may be metastatic castrate-resistant prostate cancer (mCRPC).

[0037] The term "adjuvant" as used in this document has the same meaning as "vaccine adjuvant" and refers to a pharmaceutical or immunological preparation administered for the purpose of enhancing the immune response to a vaccine.

[0038] The term "immunomodulator" as used in this document refers to a substance that, when administered in vivo, plays a role in enhancing the humoral immune response and / or the innate immune response.

[0039] In the above composition, the vaccine adjuvant and / or immunomodulator may be a common gamma-chain (γc) cytokine or a polynucleotide encoding the same, or a pattern recognition receptor agonist or a polynucleotide encoding the same, and the common gamma-chain (γc) cytokine may be at least one selected from the group consisting of IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21, and the pattern recognition receptor agonist may be a STING agonist.

[0040] The term "common gamma-chain (γc) cytokine (γc cytokine)" as used in this document refers to cytokines that interact with cytokine receptors that commonly have a γ chain. Such γc cytokines include IL-2, IL-4, IL-7, IL-15, and IL-21.

[0041] The term "pattern recognition receptor (PRR)" as used in this document refers to a type of receptor that can directly recognize specific molecular structures on the surface of pathogens, apoptotic host cells, and damaged senescent cells, and a pattern recognition receptor agonist refers to a substance that can bind to the receptor and induce downstream signaling. Pattern recognition receptor agonists include TLR agonists, RIG-1 activators or MDA5 agonists, and STING agonists. The TRL agonists include AST??008, CMP??001, CV??8102, G100, tilsotolimod, lefitolimod, MEDI??9197; NKTR??262, Poly??ICLC and SD??101, etc., and the RIG-1 activators or MDA5 agonists include BO-112 and MK-4621, and the STING agonists include ADU-S100, MK-1454, MK-2118, SB11285, GSK3745417, BMS-986301, BI-STING, E7766, TAK-676, SNX281, SYNB1891, JNJ-67544412, 3'3'-cyclic 3'3'-cAIMP, GSK532, GF3-002, TTI-10001, JNJ-'6196, CRD5500, CS-1018, CS-1020, CS-1010, ALG-031048, SR-8541A, SR-8314, MV-626, ONM-500, exoSTING, STING-NPs, and STACT-TREX1 exist. In the above vaccine composition, the vaccine adjuvant refers to a substance that can enhance the immune response of the vaccine by increasing the vaccine-specific B-cell response or T-cell response when administered before or after the vaccine or together with the vaccine.The above vaccine adjuvant may be a polynucleotide encoding IL-12, IL-12p35 and IL-12p40, or one or more gene constructs containing the same, a combination administration agent of IL-12 and IL-21, or a polynucleotide encoding IL-12p35, IL-12p40 and IL-21, or one or more gene constructs containing the polynucleotide, and in addition, traditional immunoadjuvants, such as aluminum hydroxide, aluminum phosphate, alum (potassium aluminum sulfate), MF59, virosome, AS04 [a mixture of aluminum hydroxide and monophosphoryl lipid A (MPL)], AS03 (a mixture of DL-α-tocopherol, squalene and polysorbate 80, an emulsifier), CpG, Flagellin, Poly I:C, AS01, AS02, ISCOMs and ISCOMMATRIX, etc. may be used. there is.

[0042] Optionally, the immunomodulatory agent may be IL-7 or a polynucleotide encoding IL-7, an anti-PD-1 antibody, or an anti-PD-L1 antibody or an antigen-binding fragment of the antibody, or granulocyte colony-stimulating factor (GCSF) or a polynucleotide encoding GCSF, IL-2 or a polynucleotide encoding IL-2, or a STING agonist.

[0043] In the above vaccine composition, the polynucleotide may be operably linked to a promoter and may be inserted into a viral or non-viral vector.

[0044] In the above vaccine composition, the gene construct may comprise: i) a polynucleotide encoding a fusion protein in which at least two proteins selected from the group consisting of PAP, PSA, and PSMA are linked by a linker peptide; ii) a polynucleotide encoding at least two prostate cancer antigens selected from the group consisting of PAP, PSA, and PSMA are operably linked to two or more promoters; or iii) a polynucleotide encoding at least two prostate cancer antigens selected from the group consisting of PAP, PSA, and PSMA are linked by an internal ribosome entry site (IRES).

[0045] In the above vaccine composition, the vaccine adjuvant or immunomodulator may additionally include MIP-1α or a polynucleotide encoding the same.

[0046] In the above vaccine composition, the polynucleotide encoding IL-12 may be a composition comprising a polynucleotide encoding IL-12p35 and a polynucleotide encoding IL-12p40, a polynucleotide encoding a fusion protein in which the IL-12p35 and IL-12p40 are fused, or a polycistronic gene construct in which the polynucleotide encoding IL-12p35 and the polynucleotide encoding IL-12p40 are linked by an IRES.

[0047] In the above composition, the recombinant protein comprising IL-7 may be a peptide having 2 to 10 amino acids selected from the group consisting of glycine and methionine added to the N-terminus of the IL-7. In a preferred embodiment, the peptide may have the amino acid sequence of MGM, and the recombinant protein may include the amino acid sequence of SEQ ID NO: 18. In addition, the recombinant protein comprising IL-7 may be a wild-type hIL-7, a mutant IL-7 protein having at least 70 to 99% sequence homology with the wild-type hIL-7 and performing the same function. Optionally, the IL-7 protein may be a fusion protein linked to the Fc region of an antibody. In this case, the Fc region of the antibody may be a hybrid Fc region in which portions of Fc of two or more isotypes are mixed, or a modified Fc region in which a specific amino acid is substituted, deleted, and / or inserted.

[0048] As used herein, the term "IL-2" or "interleukin-2" means any wild-type IL-2 obtained from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats), unless otherwise stated. The IL-2 may be obtained from animal cells, but also includes those obtained from recombinant cells capable of producing IL-2. Furthermore, the IL-2 may be wild-type IL-2 or a variant thereof.

[0049] In this specification, IL-2 or its variants are collectively referred to as "IL-2 protein" or "IL-2 polypeptide." IL-2, IL-2 protein, IL-2 polypeptide, and IL-2 variants specifically bind to, for example, the IL-2 receptor. This specific binding can be confirmed by methods known to those skilled in the art.

[0050] In the above vaccine composition, the STING agonist may be ADU-S100, MK-1454, MK-2118, SB11285, GSK3745417, BMS-986301, BI-STING, E7766, TAK-676, SNX281, SYNB1891, JNJ-67544412, 3'3'-cyclic3'3'-cAIMP, GSK532, GF3-002, TTI-10001, JNJ-'6196, CRD5500, CS-1018, CS-1020, CS-1010, ALG-031048, SR-8541A, SR-8314, MV-626, ONM-500, exoSTING, STING-NPs or STACT-TREX1. there is.

[0051] In the above vaccine composition, the Fc region of the antibody may be a hybrid Fc region in which portions of Fc of two or more isotypes are mixed, or a modified Fc region in which specific amino acids are substituted, deleted, and / or inserted.

[0052] In the above vaccine composition, the anti-PD-1 antibody may be nivolumab, pembrolizumab, MEDI0608, AMP-224, PDR001, BGB-A317, or any combination thereof, and the anti-PD-L1 antibody may include BMS-936559, MPDL3280A, MEDI4736, MSB0010718C, or any combination thereof.

[0053] According to another aspect of the present invention, a method for treating prostate cancer in a subject is provided, comprising administering to the subject any one of the above vaccine compositions.

[0054] In the above treatment method, the subject may be a human or a non-human animal.

[0055] In the above treatment method, the vaccine adjuvant or immunomodulator may be administered simultaneously with the gene construct or 1 to 21 days after administration of the gene construct, more preferably 4 to 12 days after or 17 to 21 days after. Optionally, the gene construct may be administered once or in multiple doses, and if administered in multiple doses, this may be viewed as a type of priming and boosting, in which case the immunomodulator according to one embodiment of the present invention, particularly the recombinant protein comprising IL-7, may be administered before or after priming and / or before or after boosting. For example, after the first administration (priming) of the vaccine gene construct (first preparation), an immunomodulator (second preparation) may be administered after a certain period of time, followed by a second administration (boosting) of the first preparation, and it is also possible to additionally administer the second preparation after boosting. The specific timing of administration of the first and second preparations can be adjusted depending on the type of antigen used or the patient's condition to maximize the therapeutic effect of the vaccine. If the gene construct and the immunomodulator are administered at different times, the gene construct and the immunomodulator are not formulated as a single composition but are formulated separately. Therefore, strictly speaking, it can be considered a kit containing each formulation rather than a composition. In this sense, the vaccine composition according to one embodiment of the present invention should be comprehensively interpreted as a concept that includes a vaccine kit containing a formulation containing a gene construct and a formulation containing an immunomodulator.

[0056] As used herein, the term "operably linked to" means that a nucleic acid sequence of interest (e.g., in an in vitro transcription / translation system or in a host cell) is linked to a regulatory sequence in such a way that its expression can occur. The term "regulatory sequence" includes promoters, enhancers, and other regulatory elements (e.g., polyadenylation signals). Regulatory sequences include those that direct the constitutive expression of a nucleic acid of interest in many host cells, those that direct the expression of a nucleic acid of interest only in specific tissue cells (e.g., tissue-specific regulatory sequences), and those that direct expression to be induced by a specific signal (e.g., inducible regulatory sequences). It will be appreciated by those skilled in the art that the design of an expression vector may vary depending on factors such as the choice of host cell to be transformed and the level of protein expression desired. The plasmid DNA of the present invention can be introduced into a host cell to express the fusion protein. The host cell may be a eukaryotic cell, but may additionally contain a replication origin capable of propagating in a prokaryotic cell for amplification and production of the plasmid. Such replication origins are well known to those skilled in the art.

[0057] The first promoter and the second promoter may be the same or different, and each include a CMV promoter, a CMV-HSV thymidine kinase promoter, an SV40, an RSV-promoter (Rowe's sarcoma virus), a human elongation factor 1α-promoter, a glucocorticoid-inducible MMTV-promoter (Moloney mouse tumor virus), a metallothionein-inducible or a tetracycline-inducible promoter. Furthermore, the first promoter may be a neurofilament-promoter, a PGDF-promoter, an NSE-promoter, a PrP-promoter or a thy-1-promoter to enable expression in vivo. The promoters are known in the art and are described in the literature (Charron, J. Biol. Chem. 270: 25739-25745, 1995).

[0058] In addition to the above components, the plasmid DNA of the present invention may further comprise a polynucleotide encoding a secretion signal. These secretion signals are well known to those skilled in the art. Furthermore, depending on the expression system used, a leader sequence capable of directing the fusion protein into a cellular compartment is combined with the coding sequence of the polynucleotide according to one embodiment of the present invention. Preferably, this leader sequence is capable of directly secreting the translated protein or its protein into the cytoplasm or extracellular medium.

[0059] The above vaccine composition or each agent or formulation within the composition can be administered by various administration methods such as subcutaneous injection, intramuscular injection, intraperitoneal injection, intravenous injection, electroporation, gene gun, etc., but electroporation is more preferred. The electroporation can be performed by an electroporator, and the electroporator is a commercially available electroporator for DNA drug injection into the body, such as Glinporator from IGEA of Italy. TM, CUY21EDIT from JCBIO of Korea, SP-4a from Supertech of Switzerland, OrbiJector from SL Weizen (Korea) ®　 etc. can be used.

[0060] The voltage applied when using the electroporation method may be 25 to 40 V / cm, more preferably 26 to 39 V / cm, 27 to 38 V / cm, 28 to 37 V / cm, 29 to 36 V / cm, or 30 to 35 V / cm.

[0061] The above vaccine composition can be used for the prevention and treatment of diseases requiring an immune response, particularly diseases requiring an immunogenic antigen-specific T cell immune response, and the diseases requiring an antigen-specific T cell immune response may be cancer, bacterial infection, fungal infection, viral infection, or parasitic infection.

[0062] The above vaccine composition may additionally include a pharmaceutically acceptable adjuvant, excipient or diluent in addition to the active ingredient in each formulation or preparation.

[0063] The term "pharmaceutically acceptable" as used herein refers to a composition that is physiologically tolerable and does not typically cause allergic reactions such as gastrointestinal upset, dizziness, or similar reactions when administered to humans. Examples of such carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, fillers, anticoagulants, lubricants, wetting agents, flavoring agents, emulsifiers, and preservatives may be additionally included.

[0064] Additionally, each formulation within the composition or kit according to one embodiment of the present invention may be formulated using methods known in the art to enable rapid, sustained, or delayed release of the active ingredient upon administration to a mammal. The formulations include powders, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatin capsules, sterile injectable solutions, and sterile powder forms.

[0065] Each agent in the composition or kit according to one embodiment of the present invention may be formulated in a suitable form together with a pharmaceutically acceptable carrier commonly used. Pharmaceutically acceptable carriers include, for example, carriers for parenteral administration such as water, suitable oils, saline solution, aqueous glucose, and glycol, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol. In addition, the composition according to the present invention may appropriately include suspending agents, solubilizing agents, stabilizers, isotonic agents, preservatives, antiadsorption agents, surfactants, diluents, excipients, pH adjusters, analgesics, buffers, antioxidants, and the like, if necessary, depending on the administration method or formulation. Pharmaceutically acceptable carriers and formulations suitable for the present invention, including those exemplified above, are described in detail in the literature [Remington's Pharmaceutical Sciences, latest edition].

[0066] In addition, the active ingredients in the vaccine composition of the present invention are administered in a therapeutically effective amount.

[0067] The term "therapeutically effective amount" as used herein means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dosage level can be determined according to factors including the type and severity of the individual, age, sex, activity of the drug, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. The vaccine composition or pharmaceutical composition of the present invention can be administered at a dosage of 0.1 mg / kg to 1 g / kg, and more preferably, it is administered at a dosage of 1 mg / kg to 500 mg / kg. Meanwhile, the dosage can be appropriately adjusted depending on the age, sex, and condition of the patient.

[0068] Hereinafter, the present invention will be described in more detail through examples and experimental examples. However, the present invention is not limited to the examples and experimental examples disclosed below, but can be implemented in various different forms. The following examples and experimental examples are provided to ensure that the disclosure of the present invention is complete and to fully inform those skilled in the art of the present invention of the scope of the invention.

[0069] Example 1: Design of a DNA vaccine targeting prostate cancer.

[0070] The present inventors selected prostate-specific antigen (PSA), prostate membrane-specific antigen (PMSA), and prostatic acid dephosphatase (PAP) as prostate cancer-specific antigens to produce a DNA vaccine for the treatment of prostate cancer. To produce an expression plasmid for expressing the same, a gene construct having the structure shown in Figure 1 was synthesized and inserted into the pGX27 backbone vector (Genexine, Korea), thereby producing a plasmid DNA for PSA / PMSA / PAP expression, which was named "SL-T10P," and the composition mixed with the vaccine adjuvant BD-121A was named "SL-T10." The antigen peptide of SL-T10 was linked to the tPA signal sequence to cause secretion from Flt3L. The components used in the production of SL-T10P, their amino acid sequences, and the corresponding nucleic acid sequences are summarized in Table 1.

[0071] Structure of SL-T10 and components used in its manufacture Component Sequence number (nucleic acid) Origin SL-T10 PtPA Signal peptide 1 (2) UniProt KB: P00750 Flt3L3 (4) UniProt KB: P49771 Linker #15 (6) (GS) 5 PAP7 (8) UniProt KB: P15309 Linker #29 (10) (G4S) 5 PSA 1 1 (12) UniProt KB: P07288 Linker #39 (13) (G4S) 5 PMSA 1 4 (15) UniProt KB: Q04609 Full sequence 16 (17) The present invention

[0072] Example 2: Vaccine adjuvant

[0073] 2-1: BD-121A

[0074] As a vaccine adjuvant, BD-121A (Korean Patent No. 10-2286397), a plasmid DNA vector containing polynucleotides encoding IL-12, IL-21, and MIP-1α, respectively, manufactured by the applicant, was used.

[0075] The basic structure of BD-121A is as shown in Fig. 2a.

[0076] Example 3: Immunomodulator

[0077] 3-1: Preparation of the GX-17

[0078] The third vaccine adjuvant (second formulation) used was GX-I7 (IL-7-hyFc, Korean Patent No. 10-1873201, Genexine, Korea), which has a modified Fc region linked to the C-terminus of IL-7.

[0079] 3-2: IL-2

[0080] The present inventors selected IL-2, a γc cytokine, as an immunomodulator, synthesized a polynucleotide (SEQ ID NO: 20) encoding mouse IL-2 (mIL-2) having an amino acid sequence represented by SEQ ID NO: 19, and cloned it into the expression vector pGX27 (Genexine, Inc.) to obtain pIL-2 (Table 2).

[0081] Structure of IL-2 and components used in its manufacture Component Sequence number Sequence mIL-2 Peptide 19MYSMQLASCVTLTLVLLVNSAPTSSSTSSSTAEAQQQQQQQQQQQQQHLEQLLMDLQELLSRMENYRNLKLPRMLTFKFYLPKQATELKDLQCLEDELGPLRHVLDLTQSKSFQLEDAENFISNIRVTVVKLKGSDNTFECQFDDESATVVDFLRRWIAFCQSIISTSPQmIL-2 DNA20ATGTACTCAATGCAGCTGGCTAGTTGTGTGACCCTGACCCTCGTGCTGCTCGTGAACAGCGCCCCAACCTCAAGCTCTACCTCCAGTAGCACAGCCGAAGCTCAGCAGCAGCAGCAACAaCAG CAaCAaCAGCAGCAGCACCTGGAGCAGCTGCTGATGGACCTGCAGGAGCTGCTGAGCCGGATGGAGAACTACAGGAACCTGAAGCTGCCTAGGATGCTGACATTCAAGTTCTACCTGCCAAAGCAGGCC ACCGAGCTGAAGGACCTGCAGTGTCTGGAGGACGAGCTGGGCCCCCTGCGCCACGTGCTCGACCTGACACAGTCCAAGTCCTTCCAGCTGGAGGACGCAGAGAACTTCATCTCCAACATCAGAGTGACC GTGGTGAAACTGAAGGGCTCTGACAACACCTTTGAGTGTCAGTTCGACGACGAGAGTGCCACTGTGTGGGATTTCCTGAGGGCGGTGGATCGCTTTCTGCCAGAGCATTATCTCTACCAGCCCACAGTAA

[0082] 3-3: STING agonist The inventors used InvivoGen's ADU-S100 as a STING agonist.

[0083] Experimental Example 1: Analysis of the Effects of the Presence and Mixing Ratio of Vaccine Adjuvants

[0084] 1-1: Use with BD-121A

[0085] To compare the effects of different mixing ratios when administered in combination with the vaccine adjuvant BD-121A, the present inventors conducted an evaluation experiment to determine the optimal mixing ratio of SL-T10P and BD-121A. Specifically, SL-T10, prepared in Example 1-1, was administered to C57BL / 6 mice via electroporation, either alone (8 μg) or in combination with various ratios of BD-121A, once (primed week 0). Two weeks later, the vaccine-specific T cell response was evaluated in the spleen using an ex vivo IFN-γ ELISpot assay (Fig. 3a). As shown in Fig. 3b, significant vaccine-specific T cells were induced even when SL-T10 was administered alone. In the SL-T10 / BD-121A combination groups with various ratios, various levels of vaccine-specific T cells were observed, and the best T cell immune responses were observed at the ratio of SL-T10 and BD-121A of 1:0.3 to 1:1.

[0086] Experimental Example 2: Analysis of the effects of single or repeated administration

[0087] To compare the effects of single or repeated administration of SL-T10, the inventors conducted an immunogenicity evaluation experiment according to single or repeated inoculation of SL-T10, a substance in which SL-T10P and BD-121A were mixed in equal proportions.

[0088] Specifically, SL-T10 was administered once (priming at week 0) or three times (priming at week -4, first boosting at week -2, and second boosting at week 0) via electroporation to C57BL / 6 mice, and the vaccine-specific T cell response was evaluated in the spleen using an ex vivoIFN-γ ELISpot assay two weeks later (Fig. 4a). As a result, as confirmed in Fig. 4b, compared to the control group (PBS), a significant vaccine-specific T cell induction was observed even with a single SL-T10 vaccination. However, a significantly increased T cell response to the three antigens contained in SL-T10 was observed with three repeated vaccinations compared to a single SL-T10 vaccination.

[0089] Experimental Example 3: Analysis of the effects of combined use with BD-121A

[0090] The present inventors evaluated the increased anticancer effect of combined administration of BD-121A with the DNA vaccine SL-T10P using a tumor model animal to compare it with the administration of the DNA vaccine alone. Specifically, C57BL / 6 mice were transplanted with the MC38-PSMA cell line, and tumor-growing individuals were selected. SL-T10P and SL-T10P / BD-121A (SL-T10) were intramuscularly administered four times (priming on day 7 from the date of tumor inoculation, the first boost on day 14, the second boost on day 21, and the third boost on day 28) to the selected MC38-PSMA tumor-bearing mice using the electroporation method according to the administration schedule described in Table 3 and Figure 5a. As a result, as confirmed in Figure 5b, both the SL-T10P and SL-T10 administration groups showed significant tumor growth inhibition compared to the PBS administration group. In addition, a significant tumor growth inhibition effect was confirmed in the SL-T10 administration group compared to the SL-T10P administration group.

[0091] DNA vaccine administration plan Experimental group Experimental head Number of administered substances Dosage / head Route of administration 18 PBS-PBS: i.m SL-T10: im + EP (50 μL / site) SL-T10P: im + EP (50 μL / site) 28 SL-T10P 12 μg / dose 38 SL-T10 24 μg / dose

[0092] Experimental Example 4: Analysis of the effect of triple administration of DNA vaccine / IL-7 / immune checkpoint inhibitor The present inventors investigated the anticancer effect of triple administration of a vaccine composition according to one embodiment of the present invention and IL-7, and then added an anti-PD-1 antibody, which is an immune checkpoint inhibitor, to the vaccine composition and IL-7 combination, using a tumor model animal.

[0093] To this end, specifically, the inventors of the present invention compared and evaluated the anticancer efficacy of a single administration group of a vaccine composition (SL-T10) containing SL-T10P and BD-121A mixed in a 1:1 ratio, prepared in Example 1-1, and a SL-T10 / GX-I7 / anti-PD-1 mAb combination group. To establish a tumor model, B16F10-PAP cell lines were transplanted into C57BL / 6 mice, and then individuals in which tumors grew were selected. Selected B16F10-PAP tumor mice were inoculated with SL-T10 three times (priming on day 4, first boost on day 11, and second boost on day 18) by electroporation, anti-PD-1 mAb (BE0146, Bio X Cell, USA) was administered intraperitoneally five times (days 4, 8, 11, 14, and 18), and GX-I7 was administered intramuscularly once (day 11).

[0094] Anticancer efficacy was evaluated by tumor growth rate and survival rate.

[0095] As a result, as confirmed in Fig. 6a, in terms of tumor growth rate, tumor growth was reduced to about 50% in the SL-T10 monotherapy group compared to the control group (PBS). In the SL-T10 / GX-I7 / anti-PD-1 mAb triple combination administration group, tumor growth was reduced to 26% (SL-T10 6 μg / dose) and 7% (SL-T10 12 μg / dose), respectively, in a SL-T10 dose-dependent manner compared to the control group. Through this, it was confirmed that the initial tumor growth rate was significantly suppressed by SL-T10 administration in the mouse tumor model, and it was found that this efficacy was maximized when GX-I7 and anti-PD-1 mAb were administered together.

[0096] As confirmed in Fig. 6b, the survival rate of the control group (PBS) was 0%, and the survival rates of the SL-T10 6 μg / dose single administration group or the SL-T10 12 μg / dose single administration group were 20% and 0%, respectively, but it was found that the survival period was significantly increased compared to the control group. The survival rate of the SL-T10 6 μg / GX-I7 / anti-PD-1 mAb triple combination administration group was 30%, which was about 10% higher than the SL-T10 6 μg / dose single administration group, and the survival rate of the SL-T10 12 μg / GX-I7 / anti-PD-1 mAb triple combination administration group was 60%, which was the highest survival rate among all experimental groups, and the combination administration group showed a tendency of increasing the dose-dependent anticancer effect of SL-T10. The SL-T10 12 μg / GX-I7 / anti-PD-1 mAb triple combination treatment group not only had a high survival rate, but also had the highest proportion of subjects whose tumors no longer grew at 50%.

[0097] From the above results, the inventors of the present invention fixed the SL-T10 dosage at 12 μg / dose and performed an animal experiment to compare the anticancer efficacy among the SL-T10 monotherapy group, the SL-T10 / GX-I7 combination therapy group, and the SL-T10 / GX-I7 / anti-PD-1 mAb triple therapy group. The specific experimental conditions were the same as those described above, except for the administered substances.

[0098] As a result, as confirmed in Fig. 6c, the SL-T10 monotherapy group showed low tumor growth inhibition and low survival effect, indicating limited anticancer efficacy of monotherapy. The SL-T10 / GX-I7 combination therapy group showed significant tumor growth inhibition effect, but low survival rate, indicating limited anticancer efficacy when used in combination with two drugs. On the other hand, the SL-T10 / GX-I7 / Anti-PD1 mAb triple combination group showed significantly superior anticancer efficacy in tumor growth inhibition and survival rate. This reaffirmed that the anticancer efficacy of the triple combination therapy is the best.

[0099] Experimental Example 5: Analysis of Anticancer Mechanisms

[0100] From the above experimental results, the inventors of the present invention explored the mechanism of action of the anticancer efficacy of the SL-T10 single administration group and the SL-T10 / GX-I7 / anti-PD-1 mAb triple combination administration group.

[0101] To establish a tumor model, C57BL / 6 mice were transplanted with the B16F10-PAP cell line, and tumor-growing individuals were screened. SL-T10 was administered three times (priming on day 0, the first boost on day 7, and the second boost on day 14) to the selected B16F10-PAP tumor mice via electroporation, anti-PD-1 mAb was administered intraperitoneally five times (on days 0, 4, 7, 11, and 14), and GX-I7 was administered intramuscularly once (on day 7) (Fig. 7a). The mechanism of action was evaluated by examining changes in prostate cancer antigen-specific T cell responses. Prostate cancer antigen-specific T cell responses were analyzed by ex vivo IFN-γ ELISpot assay for specific immune responses to antigens (PAP, PSA, and PSMA) in the SL-T10 vaccine in the spleen of tumor mice.

[0102] As a result of the analysis, as confirmed in Fig. 7b, it was confirmed that all experimental groups administered SL-T10 showed a significant quantitative increase in the three antigen-specific IFN-γ secreting T cells compared to the control group (PBS). In particular, the IFN-γ secreting T cell immune response to the PAP antigen expressed on tumor cells was significantly increased by about 4 times in the SL-T10 / GX-I7 / anti-PD-1 mAb triple combination group compared to the SL-T10 single administration group. There was no significant difference in the PSA- and PSMA-specific T cell immune responses between the SL-T10 single administration group and the SL-T10 / GX-I7 / anti-PD-1 mAb triple combination administration group.

[0103] This indicates that the number of prostatic acid dephosphatase reactive T cells (PAP-specific T cells) among tumor antigens in the SL-T10 / GX-I7 / anti-PD1 mAb triple combination administration group significantly increased compared to the SL-T10 alone and excipient groups.

[0104] Next, the inventors of the present invention sought to investigate changes in global T cell responses in PBMCs upon administration of a triple combination treatment according to one embodiment of the present invention.

[0105] To this end, the inventors specifically extracted peripheral blood mononuclear cells (PBMC) from experimental animals after the end of the animal experiment, and then collected naive T cells, CD3 + T cell subsets (T CM ) and memory T cell subsets (T EM ) CD4 + T cells and CD8 + The ratio of T cells was measured by flow cytometry (Fig. 7c). As a result, as confirmed in Fig. 7c, in the case of naive T cells, CD4 was increased compared to the control group when SL-T10 was administered alone or in combination with the triple agent. + T cells and CD8 + There was little change in the proportion of T cells, but in the case of the triple combination treatment according to one embodiment of the present invention, there was a difference in the CD4 in two subsets of T cell populations. + T cells and CD8 + The ratio of T cells was significantly increased. In particular, the triple combination treatment according to one embodiment of the present invention significantly increased the CD3 + CD8 in T cell subsets + The proportion of T cells was significantly increased. When SL-T10 was administered alone, both T cell subsets showed CD4 + T cells and CD8 + Considering that there was no significant change in the proportion of T cells, these results suggest that the triple combination therapy according to one embodiment of the present invention may be very effective in treating cancer by enhancing T cell responses in blood PBMCs.

[0106] In addition, the inventors of the present invention investigated changes in immune cells within the tumor tissue by sacrificing the experimental animals after the completion of the animal experiment, extracting tumor tissue, and analyzing changes in immune cells such as tumor-infiltrating lymphocytes (TILs) and myeloid-derived suppressor cells (MDSCs) through flow cytometry (Fig. 7d).

[0107] As a result, as shown in Fig. 7d, the intratumoral CD4 in the SL-T10 / GX-I7 / anti-PD-1 mAb triple combination group was higher than that in the SL-T10 monotherapy group. + or CD8 + The T cell ratio was found to significantly increase by about 1.5 times. In particular, the tumor-infiltrating CD8 in the SL-T10 / GX-I7 / anti-PD-1 mAb triple combination administration group was higher than in the other experimental groups. + The T cell ratio showed a tendency to increase by about 2 times.

[0108] Furthermore, the inventors analyzed the proportion of immune cells within tumor tissues in more detail. Specifically, the inventors analyzed CD8 cells within tumor tissues. + The ratio of cells and MDSCs was investigated, and CD8 + The correlation between the proportion of T cells and the volume of tumor tissue was analyzed (Fig. 7e).

[0109] As a result, as shown in Figure 7e, there was no significant difference in the SL-T10 single administration group compared to the control group (PBS), but in the triple combination administration group, there was a difference in CD8 + We were able to confirm that the proportion of T cells significantly increased. Furthermore, regardless of tumor size, CD8 + The proportion of cells increases, but more so when administered in combination with CD8 + It was confirmed that the proportion of T cells increased.

[0110] In comprehensive consideration, when analyzing the vaccine antigen (PAP, PSA, and PSMA)-specific immune responses in a tumor mouse model expressing the prostate cancer antigen PAP, the three antigen-specific IFN-γ-secreting T cell immune responses significantly increased in all groups administered SL-T10. In particular, the IFN-γ-secreting T cell immune response to the PAP antigen expressed on tumor cells significantly increased by about three times in the SL-T10 / GX-I7 / anti-PD1 mAb triple combination group compared to the SL-T10 single-administration group. Based on these results, it is expected that the triple combination of SL-T10, GX-I7, and anti-PD1 mAb will improve the tumor immunosuppressive environment and induce a T cell immune response dominant to tumor-expressed antigens.

[0111] In addition, CD3 in PBMC + When analyzing the changes in the proportion of T cells and memory T cells, TCM or TEM, there was no significant change in the control group or SL-T10 monotherapy group, but in the SL-T10 / GX-I7 / anti-PD1 mAb triple combination therapy group, there was a significant increase in CD3 compared to the control group or SL-T10 monotherapy group. + The proportion of T cells tended to increase, and among these cells, CD4 + TCM and CD4 + TEM and CD8 + It was confirmed that the TEM ratio significantly increased in all cases. This was due to the combination of GX-I7 and PBMC CD3 + This means that T cells increase quantitatively and, in particular, the proportion of memory T cells that have experienced antigens increases more than that of naive T cells by combined administration of SL-T10 / GX-I7 / anti-PD1 mAb.

[0112] To evaluate the possibility of improving the tumor microenvironment by combined administration of SL-T10 / GX-I7 / anti-PD1 mAb, we compared intratumoral MDSCs with CD8 +When observing the T cell ratio, there was no significant change in the control group or the SL-T10 single-administered group, but in the SL-T10 / GX-I7 / anti-PD1 mAb triple combination administration group, CD8 was increased regardless of tumor size. + The proportion of T cells was found to significantly increase. This is because the tumor immunosuppressive environment, such as the decrease in MDSCs, was improved by the triple combination of GX-I7 / anti-PD1 mAb, and the tumor-infiltrating CD8 cells capable of attacking tumor cells were increased by repeated SL-T10 vaccination. + It is thought that the T cell ratio has increased.

[0113] Experimental Example 6: Analysis of the Effects of Combined Use of Immunomodulators

[0114] 6-1: Confirmation of vaccine-specific T cell responses

[0115] The present inventors evaluated whether the SL-T10P DNA vaccine, when administered in combination with an innate or adaptive immune enhancer, increased antigen-specific T cell responses. Specifically, as described in Table 4 and Figure 8a, SL-T10P was administered intramuscularly twice (on days 0 and 14) to C57BL / 6 mice via electroporation. The innate immune enhancer, a STING agonist (ADU-S100), was co-administered intramuscularly twice (on days 0 and 14) at 25 μg / dose. IL-2 DNA, as an adaptive immune enhancer, was co-administered intramuscularly twice (on days 0 and 14) via electroporation. Two weeks after the last administration (on day 28), the vaccine-specific T cell response was evaluated in the spleen using an ex vivo IFN-γ ELISpot assay. As a result, as shown in Fig. 8b, a significant increase in vaccine-specific T cell responses was confirmed in all SL-T10P, SL-T10P / STING agonist, or SL-T10P / IL-2 administration groups compared to the PBS administration group. In addition, a significant increase in vaccine-specific T cell responses was confirmed in all SL-T10 / STING agonist or SL-T10P / IL-2 administration groups compared to the SL-T10P administration group.

[0116] DNA vaccine administration plan Experimental group Experimental head Number of administered substances Dose / head Route of administration 13 PBS-PBS: i.m SL-T10P: im + EP (50 μL / site) PRR agonist: im γc cytokine: i.m 2 5 SL-T10P 12 μg / dose 3 5 SL-T10P + STING agonist 12 μg / dose + 25 μg / dose 4 5 SL-T10P + pIL-2 12 μg / dose + 12 μg / dose

[0117] 6-2: Anticancer Activity Analysis The inventors of the present invention sought to evaluate the increased anticancer effect of SL-T10P DNA vaccine when combined with an innate immune enhancing substance using a tumor model animal. To this end, as specifically shown in Table 5 and Fig. 8c, after transplanting MC38-PSMA cell lines into C57BL / 6 mice, tumor-growing individuals were selected, and SL-T10P and SL-T10P / STING agonist (ADU-S100) were intramuscularly administered four times (priming on day 7 from the date of tumor inoculation, 1st boost on day 14, 2nd boost on day 21, 3rd boost on day 28). As a result, as confirmed in Fig. 8d, an improved tumor growth inhibition tendency was confirmed in the SL-T10P and SL-T10P / STING agonist administration groups compared to the PBS administration group. In addition, a trend toward improved tumor growth inhibition was confirmed in the SL-T10P / STING agonist administration group compared to the SL-T10P administration group.

[0118] DNA vaccine administration plan for anticancer activity analysis Experimental group Experimental head Number of administered substances Dosage / head Route of administration 18 PBS-PBS: i.m SL-T10P: im + EP (50 μL / site) PRR agonist: imγc Cytokine: i.m 2 8 SL-T10P 12 μg / dose 3 8 SL-T10P + STING agonist 12 μg / dose + 25 μg / dose 4 8 SL-T10P + pIL-2 12 μg / dose + 12 μg / dose

[0119] In summary, repeated administration of SL-T10 increased antigen-specific T cells, and combined administration of GX-I7 / anti-PD1 mAb, IL-2, or STING agonist improved the tumor immunosuppressive environment, such as quantitative increase of functional antigen-specific T cells and reduction of intratumoral immunosuppressive cells, which are reduced in prostate cancer patients, thereby directly acting on tumor-infiltrating CD8 + It is believed that an increase in the T cell ratio and recovery of T cell function will be possible. In this way, when the vaccine composition according to one embodiment of the present invention is administered in combination with IL-7, IL-2, or a STING agonist, the therapeutic effect on viral infection can be maximized by promoting an antigen-specific T cell response. Furthermore, when the vaccine composition according to one embodiment of the present invention is administered in combination with an immune checkpoint inhibitor and a triple agent, the therapeutic effect on intractable cancers that were not easy to treat with existing immunotherapeutic agents can be maximized by inducing an effective antigen-specific T cell response. Although the present invention has been described with reference to the above-described examples, these are merely exemplary, and those skilled in the art will understand that various modifications and equivalent other embodiments are possible therefrom. Therefore, the true technical protection scope of the present invention should be defined by the technical spirit of the appended claims.

[0120] A vaccine composition according to one embodiment of the present invention can be developed and used as a medicine for preventing and treating cancer.

Claims

1. a) a genetic construct comprising a polynucleotide encoding at least one prostate cancer antigen selected from the group consisting of prostatic acid phosphatase (PAP), prostate-specific antigen (PSA) and prostate-specific membrane antigen (PSMA); and b) A vaccine composition for treating and preventing prostate cancer, comprising one or more vaccine adjuvants and / or immunomodulators.

2. In paragraph 1, The above vaccine adjuvant and / or immunomodulator is a common gamma-chain (γc) cytokine or a polynucleotide encoding the same, or A vaccine composition comprising a pattern recognition receptor agonist or a polynucleotide encoding the same.

3. In paragraph 2, A vaccine composition wherein the common gamma-chain (γc) cytokine is at least one selected from the group consisting of IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21.

4. In paragraph 2, A vaccine composition, characterized in that the pattern recognition receptor agonist is a TLR agonist, a RIG-1 activator, an MDA5 agonist, or a STING agonist.

5. In paragraph 1, A vaccine composition wherein the vaccine adjuvant and / or immunomodulator is a composition comprising IL-12 and IL-21 or a polynucleotide encoding the IL-12 and IL-21, IL-12 or a polynucleotide encoding the IL-12, IL-7 or a polynucleotide encoding the IL-7, an anti-PD-1 antibody, or an anti-PD-L1 antibody or an antigen-binding fragment of the antibody, or a granulocyte colony-stimulating factor (GCSF), a polynucleotide encoding the GCSF.

6. In paragraph 1, The above genetic construct comprises i) a polynucleotide encoding a fusion protein in which at least two proteins selected from the group consisting of PAP, PSA and PSMA are linked by a linker peptide; or ii) a polynucleotide encoding at least two prostate cancer antigens selected from the group consisting of PAP, PSA and PSMA, each operably linked to two or more promoters; or iii) A vaccine composition comprising a polynucleotide encoding at least two prostate cancer antigens selected from the group consisting of PAP, PSA and PSMA, linked by an internal ribosome entry site (IRES).

7. In paragraph 1, A vaccine composition, wherein the vaccine adjuvant further comprises MIP-1α or a polynucleotide encoding the same.

8. In paragraph 5, A vaccine composition wherein the recombinant protein comprising the IL-7 is a wild-type hIL-7, a mutant IL-7 protein having at least 70 to 99% sequence homology with the wild-type hIL-7 and performing the same function, or a fusion protein in which the IL-7 protein is linked to the Fc region of an antibody.

9. In paragraph 5, A vaccine composition, wherein the recombinant protein containing the IL-7 has 2 to 10 amino acids selected from the group consisting of glycine and methionine added to the N-terminus of the IL-7.

10. In paragraph 3, A vaccine composition wherein the IL-2 comprises an amino acid sequence represented by SEQ ID NO:

19.

11. In paragraph 4, A vaccine composition wherein the TLR agonist is AST??008, CMP??001, CV??8102, G100, tilsotolimod, lefitolimod, MEDI??9197; NKTR??262, Poly??ICLC or SD??101.

12. A vaccine composition according to claim 4, wherein the RIG-1 activator or MDA5 agonist is BO-112 or MK-4621.

13. In paragraph 4, A vaccine composition wherein the STING agonist is ADU-S100, MK-1454, MK-2118, SB11285, GSK3745417, BMS-986301, BI-STING, E7766, TAK-676, SNX281, SYNB1891, JNJ-67544412, 3'3'-cyclic3'3'-cAIMP, GSK532, GF3-002, TTI-10001, JNJ-'6196, CRD5500, CS-1018, CS-1020, CS-1010, ALG-031048, SR-8541A, SR-8314, MV-626, ONM-500, exoSTING, STING-NPs, or STACT-TREX1.

14. A method for treating prostate cancer in a subject, comprising administering to the subject a vaccine composition of any one of claims 1 to 13.

Images