Nucleic acid molecule that regulates gene expression using RNA splicing modulator

Abstract

A nucleic acid molecule that regulates gene expression using an RNA splicing modulator, a nucleic acid construct containing an alternative splicing regulatory element and a target gene located at the 3' end of the alternative splicing regulatory element, a transcript of the nucleic acid construct under different conditions, and a vector, recombinant virus, cell and pharmaceutical composition containing the nucleic acid construct or the transcript, a method for regulating the expression level of a target gene by using same, and the use thereof in gene therapy.

Description

Nucleic acid molecules that regulate gene expression using RNA splicing regulators Technical Field

[0001] The present disclosure relates generally to the fields of molecular biology and medicine, and more particularly to a nucleic acid molecule for regulating gene expression using an RNA splicing regulator. Background Art

[0002] Many human diseases are associated with genetic defects. A promising approach to treating these diseases is gene therapy. In gene therapy, exogenous genetic material is transferred into target cells to intervene in the cellular physiological functions at the nucleic acid level, ultimately treating the disease. For example, gene therapy can achieve the purpose of treating the disease by introducing normal genes to replace deleted or abnormally mutated disease-causing genes, or by inhibiting the function of harmful endogenous genes through gene silencing technology. Over the past 20 years, the research focus of gene therapy has been mainly on the development and optimization of gene delivery systems. For example, engineering adeno-associated virus (AAV) capsids can improve their gene delivery efficiency and targeting to specific organs. However, gene therapy has conducted less research on the therapeutic genes themselves. These studies have mainly focused on promoter technology, gene expression regulation technology, and 3' regulatory elements that limit expression to specific cell types.

[0003] Gene expression levels are a key factor influencing the effectiveness of gene therapy. If the therapeutic gene is not expressed at all or not expressed at all, gene therapy will not achieve the desired effect. On the other hand, if the therapeutic gene is expressed at too high a level, i.e., overexpressed, gene therapy is likely to cause undesirable toxic side effects in patients. Regulating gene expression levels after gene delivery into the body is a difficult and painful issue in gene therapy research. Currently, relevant gene expression regulation technologies are extremely limited. One approach is to regulate gene expression through drug-induced changes in RNA splicing.

[0004] Currently, the RNA splicing regulatory drugs known to be used for gene expression regulation are limited to LMI070, and the types are single. On the other hand, the regulatory ability of the RNA splicing regulatory drugs currently in use is also limited, and it is necessary to further improve it. In addition, the detection methods for RNA splicing changes are limited, and more effective detection technologies need to be developed. Furthermore, the nucleic acid sequences of the existing technology are long, and the intron sequences with key functions are unclear. It is necessary to develop smaller nucleic acid sequences and clarify the sequences that play a key role in the sequences through experiments. Another defect is that the variable splicing regulatory elements reported in the existing literature are derived from cells cultured in vitro, rather than organs in vivo, and lack adaptation and optimization for the physiological and pathological environment in vivo.

[0005] Summary of the Invention

[0006] In order to solve the above problems existing in the prior art, a technical solution of the present disclosure is provided.

[0007] In the first aspect of the present disclosure, a variable splicing regulatory element is provided. The variable splicing regulatory element comprises, from the 5' end to the 3' end, a first exon, a first intron, a pseudo exon, a second intron, and a second exon; the pseudo exon comprises a nucleotide sequence having at least 95% homology to the sequence shown in SEQ ID NO: 1; the junction of the pseudo exon and the second intron contains a variable splicing regulatory small molecule drug binding site; the variable splicing regulatory element contains a unique start codon only in the pseudo exon. The start codon can be selected from ATG, GTG, ACG, CTG, ATA, or TTG, preferably ATG.

[0008] In one embodiment, the alternative splicing regulating small molecule drug binding site comprises the nucleotide sequence ATGAGTA, wherein ATGA belongs to the pseudo exon and GTA belongs to the second intron; or, the alternative splicing regulating small molecule drug binding site comprises the nucleotide sequence AGAGTA, wherein AGA belongs to the pseudo exon and GTA belongs to the second intron. The sequence of the first exon immediately following the sequence of the first intron is CAG, and the sequence of the first intron immediately following the sequence of the first exon is GTA; and / or, the sequence of the first intron immediately following the sequence of the pseudo exon is TAG, and the sequence of the pseudo exon immediately following the sequence of the first intron is GTT; and / or, the sequence of the second intron immediately following the sequence of the second exon is CAG, and the sequence of the second exon immediately following the sequence of the second intron is TTT.

[0009] In one embodiment, the first intron comprises a nucleotide sequence having at least 95% (preferably 96%, 97%, 98%, 99% or 99.5%) homology to the sequences shown in SEQ ID NOs: 19 and 20; and the second intron comprises a nucleotide sequence having at least 95% homology to the sequence shown in SEQ ID NO: 21.

[0010] In one embodiment, the nucleotide length of the first intron is 41 to 500 bp, preferably 41 to 410 bp, preferably 41 to 140 bp, preferably 41 to 110 bp; the nucleotide length of the second intron is 60 to 569 bp, preferably 60 to 479 bp, preferably 60 to 209 bp, preferably 60 to 129 bp.

[0011] In one embodiment, the first intron contains a nucleotide sequence that is at least 95% (preferably 96%, 97%, 98%, 99% or 99.5%) homologous to the sequence shown in any one of SEQ ID NOs: 3 to 5, 22 to 25; the second intron contains a nucleotide sequence that is at least 95% (preferably 96%, 97%, 98%, 99% or 99.5%) homologous to the sequence shown in any one of SEQ ID Nos: 6 to 8, 26 to 32.

[0012] Preferred combinations include:

[0013] (a) the first intron comprises a nucleotide sequence having at least 95% (preferably 96%, 97%, 98%, 99% or 99.5%) homology to the sequence shown in SEQ ID NO: 5; the second intron comprises a nucleotide sequence having at least 95% (preferably 96%, 97%, 98%, 99% or 99.5%) homology to the sequence shown in SEQ ID NO: 8; or,

[0014] (b) the first intron comprises a nucleotide sequence having at least 95% (preferably 96%, 97%, 98%, 99% or 99.5%) homology to the sequence shown in SEQ ID NO: 4; the second intron comprises a nucleotide sequence having at least 95% (preferably 96%, 97%, 98%, 99% or 99.5%) homology to the sequence shown in SEQ ID NO: 7; or,

[0015] (c) the first intron comprises a nucleotide sequence having at least 95% (preferably 96%, 97%, 98%, 99% or 99.5%) homology to the sequence shown in SEQ ID NO: 3; and the second intron comprises a nucleotide sequence having at least 95% (preferably 96%, 97%, 98%, 99% or 99.5%) homology to the sequence shown in SEQ ID NO: 6.

[0016] In one embodiment, the first exon contains a nucleotide sequence that is at least 95% (preferably 96%, 97%, 98%, 99% or 99.5%) homologous to the sequence shown in SEQ ID NO: 2; and / or the second exon contains a nucleotide sequence that is at least 95% (preferably 96%, 97%, 98%, 99% or 99.5%) homologous to the sequence shown in SEQ ID NO: 9.

[0017] After combining the above-mentioned first exon and second exon nucleotide sequences, the variable splicing regulatory element further preferably contains a nucleotide sequence having at least 95% (preferably 96%, 97%, 98%, 99% or 99.5%) homology with the sequence shown in any one of SEQ ID NOs: 10 to 12.

[0018] In the second aspect of the present disclosure, the present disclosure provides a nucleic acid molecule, which comprises the variable splicing regulatory element described in the first aspect of the present disclosure and a target gene located at the 3' end of the variable splicing regulatory element described in the present disclosure; wherein the target gene is one or more protein-encoding genes and / or genes encoding non-coding RNA, and the first start codon ATG of the protein-encoding gene is deleted.

[0019] In one embodiment, there is no nucleic acid sequence between the 3' end of the alternative splicing regulatory element and the 5' end of the target gene.

[0020] In one embodiment, a sequence encoding a protease cleavage site is present between the 3' end of the alternative splicing regulatory element and the 5' end of the target gene, wherein the protease cleavage site is cleaved by a mammalian protease or is self-cleaved, such as a 2A peptide, including but not limited to P2A (porcine teschovirus-1), T2A (thosea asigna virus), F2A (foot-and-mouth disease virus), E2A (equine rhinitis A virus), preferably P2A (SEQ ID NO: 13). Those skilled in the art will understand that in this embodiment, the number of bases of the sequence encoding the protease cleavage site between the 3' end of the alternative splicing regulatory element and the 5' end of the target gene should be 3n, where n is an integer greater than or equal to 1, so as to ensure that the reading frame of the target gene is not changed or moved.

[0021] In one embodiment, the 5' end of the alternative splicing regulatory element is operably linked to a promoter sequence.

[0022] In one embodiment, the promoter sequence is a mammalian cell constitutive promoter, a mammalian cell specific promoter, a mammalian non-coding RNA promoter or a prokaryotic cell promoter.

[0023] In one embodiment, the promoter sequence is a mammalian cell constitutive promoter. Preferably, the promoter is CMV (cytomegalovirus), CAG (cytomegalovirus enhancer and chicken β-actin promoter), CBG, EF1a (elongation factor-1α), PGK1 (phosphoglycerate kinase 1) or Ubc (ubiquitin C).

[0024] In one embodiment, the promoter sequence is a mammalian cell-specific promoter. Preferably, the promoter is Tnnt2 (cardiac myocytes), Nppa (atrial cardiomyocytes), My12 (ventricular cardiomyocytes), Mck (skeletal muscle cells), Nkx2.5 (cardiac progenitor cells), Syn (neurons), Mecp2 (neurons), TBG (hepatocytes), Pdx1 (pancreatic cells), K14 (skin keratinocytes), Rpe65 (retinal cells), or SP-C (lung epithelial cells).

[0025] In one embodiment, the promoter sequence is a mammalian non-coding RNA promoter. Preferably, the promoter is U6 or H1 (a eukaryotic RNA polymerase III-dependent promoter).

[0026] In one embodiment, the promoter sequence is a prokaryotic promoter. Preferably, the promoter is T7 (T7 phage), T3 (T3 phage), or SP6 (SP6 phage).

[0027] In one embodiment, the nucleic acid molecule of the present disclosure further comprises a target sequence of a post-transcriptional regulatory element and / or a microRNA. Preferably, the post-transcriptional regulatory element (PRE) comprises a post-transcriptional regulatory element derived from hepatitis B (HPRE), bat (BPRE), ground squirrel (GSPRE), Arctic squirrel (ASPRE), duck (DPRE), chimpanzee (CPRE), woolly monkey (WMPRE) or marmot (WPRE). The target sequence of the microRNA is selected from the target sequence of miR122, miR199, miR7, miR148, miR1 or miR208. Optionally, the target sequence of the post-transcriptional regulatory element and / or microRNA is arranged at the 3' end of the target gene.

[0028] In one embodiment, the nucleic acid molecule of the present disclosure further comprises a polyadenylation signal (polyA), optionally wherein the polyA is disposed at the 3' end of the target gene. Preferably, the polyA signal is SV40 polyA, human growth hormone (HGH) polyA, bovine growth hormone (BGH) polyA, β-globin polyA, α-globin polyA, ovalbumin polyA, kappa-light chain polyA, or synthetic polyA.

[0029] In one embodiment, the alternative splicing regulatory element is capable of binding to an alternative splicing regulatory small molecule drug. Preferably, the alternative splicing regulatory small molecule drug is LMI070, a derivative having the same binding site as LMI070 on the alternative splicing regulatory element, or a pharmaceutically acceptable salt of LMI070; or, the alternative splicing regulatory small molecule drug is risdiplam, a derivative having the same binding site as risdiplam on the alternative splicing regulatory element, or a pharmaceutically acceptable salt of risdiplam.

[0030] In one embodiment, the gene encoding the protein is a gene encoding a nuclease, and / or a gene encoding a therapeutic protein, and / or a gene encoding a reporter or marker protein, and / or a gene encoding a non-coding RNA. Preferably, the nuclease includes a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN) or a CRISPR associated protein (Cas protein) or its same functional derivative, and further preferably, the Cas protein includes a Cas9 protein, a Cas12 protein or a Cas13 protein. Preferably, the therapeutic protein includes YAP (Yes associated protein), LMNA (lamin), RPE65 (all-trans retinol ester isomerase), SMN1 (motor neuron survival gene 1 protein), FVIII (coagulation factor VIII), FIX (coagulation factor IX) or its same functional derivative. Preferably, the marker protein includes eGFP (enhanced green fluorescent protein), tdTomato (a variant of red fluorescent protein), mCherry (cherry red fluorescent protein), Luciferase (luciferase), SEAP (secreted placental alkaline phosphatase), CAT (catalase), GST (glutathione sulfhydryltransferase), β-GUS (β-glucuronidase), β-Gal (β-galactosidase), or their functionally equivalent derivatives. Preferably, the non-coding RNA includes at least one of miRNA, shRNA, or lncRNA having gene suppression function.

[0031] In one embodiment, the method for constructing the nucleic acid molecule disclosed herein comprises connecting the target gene with the 5' start codon removed to the 3' end of the variable splicing regulatory element disclosed herein, so that the target gene and the start codon in the variable splicing regulatory element use the same reading frame.

[0032] In the third aspect of the present disclosure, a transcript of the nucleic acid molecule according to the second aspect of the present disclosure in the presence of an alternative splicing regulating small molecule drug is provided; in another embodiment, a transcript of the nucleic acid molecule according to the present disclosure in the absence of an alternative splicing regulating small molecule drug is provided; wherein the alternative splicing regulating small molecule drug is LMI070, or a derivative having the same binding site as LMI070 on the alternative splicing regulatory element, or a pharmaceutically acceptable salt of LMI070; or the alternative splicing regulating small molecule drug is Risdiplam, or a derivative having the same binding site as Risdiplam on the alternative splicing regulatory element, or a pharmaceutically acceptable salt of Risdiplam.

[0033] In one embodiment, the nucleic acid molecule is a DNA molecule and the transcript is an RNA molecule.

[0034] In one embodiment, the transcript is an mRNA comprising a first exon and a second exon sequentially from the 5' end to the 3' end, and the nucleotide sequence is SEQ ID NO: 14, or comprises SEQ ID NO: 14.

[0035] In another embodiment, the transcript is an mRNA comprising a first exon, a pseudo exon and a second exon from the 5' end to the 3' end, and the boundary sequence between the pseudo exon and the second exon is preferably TGATTT, wherein TGA belongs to the pseudo exon and TTT belongs to the second exon, and further the nucleotide sequence of the mRNA is SEQ ID NO: 15, or comprises SEQ ID NO: 15.

[0036] In a fourth aspect of the present disclosure, the present disclosure provides a vector comprising the nucleic acid molecule according to the present disclosure or the transcript according to the present disclosure.

[0037] In one embodiment, the vector is a DNA or RNA vector. Preferably, the vector is a circular vector. More preferably, the vector is a plasmid.

[0038] In one embodiment, the vector is double-stranded or single-stranded; preferably, the vector is double-stranded.

[0039] In one embodiment, the vector is a viral vector. Preferably, the viral vector is an adeno-associated virus (AAV) vector, a chimeric AAV vector, an adenoviral vector, a retroviral vector, a lentiviral vector, a herpes simplex virus vector, a baculoviral vector, or any mutant or derivative thereof. Preferably, the viral vector is a recombinant AAV vector, a self-complementary AAV (scAAV) vector, or a single-stranded AAV (ssAAV) vector. Preferably, the recombinant AAV vector comprises one or more inverted terminal repeats (ITRs), optionally wherein the ITRs are AAV2 ITRs, optionally wherein the AAV vector comprises two ITRs.

[0040] In the fifth aspect of the present disclosure, the present disclosure provides a recombinant virus, which comprises the variable splicing regulatory element according to the first aspect of the present disclosure, the nucleic acid molecule according to the second aspect of the present disclosure, the transcript according to the third aspect of the present disclosure, or the vector according to the fourth aspect of the present disclosure.

[0041] In one embodiment, the recombinant virus is an adeno-associated virus (AAV), a chimeric AAV, an adenovirus, a retrovirus, a lentivirus, a herpes simplex virus, a baculovirus, or any mutant or derivative thereof. Preferably, the recombinant virus is AAV. More preferably, the AAV comprises one or more of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAVrh36, AAVrh37, AAVrh74, AAVrh79, AAV-DJ, AAV-DJ / 8, AAV.Anc80, AAV.Anc80L65, AAV-PHP.B, AAV-PHP.B2, AAV-PHP.B3, AAV-PHP.A, AAV-PHP.eB, AAV-PHP.S, AAV2i8, MyoAAV, AAVMYO, AAV.CPP.16 capsid serotypes or variants thereof, such as a combination of capsids from more than one AAV serotype. In one embodiment, the AAV is AAV9.

[0042] In the sixth aspect of the present disclosure, the present disclosure provides a cell, which comprises one or more variable splicing regulatory elements described in the first aspect of the present disclosure, or one or more nucleic acid molecules described in the second aspect of the present disclosure, or one or more transcripts described in the third aspect of the present disclosure, or one or more vectors described in the fourth aspect of the present disclosure, or one or more recombinant viruses according to the fifth aspect of the present disclosure.

[0043] In one embodiment, the cells are human cells, wherein the human cells can be cells in vivo, cells isolated from the body, or immortalized cell lines or cancer cells.

[0044] Preferably, the human cell is a heart cell, a muscle cell, a neuron, a liver cell, a spleen cell, a lung cell or a kidney cell.

[0045] In one embodiment, when the alternative splicing regulating small molecule drug is present in the cell, the expression level of the target gene is 1 to 2000 times higher than the expression level of the target gene when the alternative splicing regulating small molecule drug is not present in the cell, for example, 1 to 100 times, 1 to 300 times, 1 to 500 times, 1 to 700 times, 1 to 900 times, 1 to 1100 times, 1 to 1300 times, 1 to 1500 times, 1 to 1700 times, 1 to 1900 times, 1 to 2000 times higher; optionally, when the alternative splicing regulating small molecule drug is not present in the cell, the expression level of the target gene cannot be detected.

[0046] In the seventh aspect of the present disclosure, a pharmaceutical composition is provided, which comprises one or more variable splicing regulatory elements described in the first aspect of the present disclosure, or one or more nucleic acid molecules described in the second aspect of the present disclosure, or one or more transcripts described in the third aspect of the present disclosure, or one or more vectors described in the fourth aspect of the present disclosure, or one or more recombinant viruses according to the fifth aspect of the present disclosure, or one or more cells according to the sixth aspect of the present disclosure.

[0047] In an eighth aspect of the present disclosure, a method for regulating the expression of a target gene based on an alternative splicing regulating small molecule drug is provided, the method comprising: combining one or more alternative splicing regulating elements described in the first aspect of the present disclosure, or one or more nucleic acid molecules described in the second aspect of the present disclosure, or one or more transcripts described in the third aspect of the present disclosure, or one or more vectors described in the fourth aspect of the present disclosure, or one or more recombinant viruses described in the fifth aspect of the present disclosure, or one or more cells described in the sixth aspect of the present disclosure with one or more alternative splicing regulating small molecule drugs. The method further comprises contacting the target gene with a substance, wherein, in the presence of the alternative splicing regulating small molecule drug, the expression level of the target gene is 1 to 2000 times higher than the expression level of the target gene in the absence of the alternative splicing regulating small molecule drug, for example, 1 to 100 times, 1 to 300 times, 1 to 500 times, 1 to 700 times, 1 to 900 times, 1 to 1100 times, 1 to 1300 times, 1 to 1500 times, 1 to 1700 times, 1 to 1900 times, or 1 to 2000 times higher; optionally, in the absence of the alternative splicing regulating small molecule drug, the expression level of the target gene cannot be detected.

[0048] In a ninth aspect of the present disclosure, a gene therapy method for treating a subject in need is provided, the gene therapy method comprising administering to the subject one or more alternative splicing regulatory elements according to the first aspect of the present disclosure, or one or more nucleic acid molecules according to the second aspect of the present disclosure, or one or more transcripts according to the third aspect of the present disclosure, or one or more vectors according to the fourth aspect of the present disclosure, or one or more recombinant viruses according to the fifth aspect of the present disclosure, or one or more cells according to the sixth aspect of the present disclosure, or one or more pharmaceutical compositions according to the seventh aspect of the present disclosure, and a One or more alternative splicing regulating small molecule drugs; wherein, when the alternative splicing regulating small molecule drug is present, the expression level of the target gene is 1 to 2000 times higher than the expression level of the target gene in the absence of the alternative splicing regulating small molecule drug, for example, 1 to 100 times, 1 to 300 times, 1 to 500 times, 1 to 700 times, 1 to 900 times, 1 to 1100 times, 1 to 1300 times, 1 to 1500 times, 1 to 1700 times, 1 to 1900 times, or 1 to 2000 times higher; optionally, when the alternative splicing regulating small molecule drug is not present, the expression level of the target gene cannot be detected.

[0049] In the tenth aspect of the present disclosure, a kit is provided, comprising: (1) one or more variable splicing regulatory elements described in the first aspect of the present disclosure, or one or more nucleic acid molecules described in the second aspect of the present disclosure, or one or more transcripts described in the third aspect of the present disclosure, or one or more vectors described in the fourth aspect of the present disclosure, or one or more recombinant viruses described in the fifth aspect of the present disclosure, or one or more cells described in the sixth aspect of the present disclosure, or one or more pharmaceutical compositions described in the seventh aspect of the present disclosure; and / or (2) one or more variable splicing regulatory small molecule drugs.

[0050] In the eleventh aspect of the present disclosure, there is provided the use of (a) and (b) for regulating the expression level of a target gene or for preparing a gene therapy drug, wherein (a) is selected from one or more variable splicing regulatory elements described in the first aspect of the present disclosure, or one or more nucleic acid molecules described in the second aspect of the present disclosure, or one or more transcripts described in the third aspect of the present disclosure, or one or more vectors described in the fourth aspect of the present disclosure, or one or more recombinant viruses described in the fifth aspect of the present disclosure, or one or more cells described in the sixth aspect of the present disclosure, or one or more pharmaceutical compositions described in the seventh aspect of the present disclosure, and (b) is a variable splicing regulating small molecule drug.

[0051] Preferably, the indications that the gene therapy drug can treat include heart diseases such as ischemic heart disease and cardiomyopathy, muscular dystrophy, neuromuscular diseases, progeria, retinitis pigmentosa (also known as retinitis pigmentosa, Retinitis Pigmentosa), Leber's congenital amaurosis (LCA), age-related macular degeneration, spinal muscular atrophy (SMA), hemophilia, etc.

[0052] In a twelfth aspect of the present disclosure, a probe is provided, wherein the probe targets the junction between the pseudo exon and the second exon in the transcript in the presence of an alternative splicing regulating small molecule drug in the third aspect of the present disclosure.

[0053] In one embodiment, the probe comprises a nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in SEQ ID NO:16.

[0054] In one embodiment, the 5' end of the probe is modified with a fluorescent group, and the 3' end of the probe is modified with a non-fluorescent quencher group; wherein the fluorescent group includes but is not limited to HEX, VIC, FAM or TET, and the non-fluorescent quencher group includes but is not limited to MGB, TAMRA or BHQ.

[0055] In the thirteenth aspect of the present disclosure, there is provided a method for detecting the alternative splicing regulatory element according to the first aspect of the present disclosure, or one or more nucleic acid molecules according to the second aspect of the present disclosure, or one or more transcripts according to the third aspect of the present disclosure, or one or more vectors according to the fourth aspect of the present disclosure, or one or more recombinant viruses according to the fifth aspect of the present disclosure, or one or more cells according to the sixth aspect of the present disclosure, or one or more pharmaceutical compositions according to the seventh aspect of the present disclosure, wherein the method comprises a qPCR amplification step, and the probe according to the twelfth aspect of the present disclosure is used in the qPCR amplification step. The qPCR amplification step comprises contacting the mRNA in the transcript or its PCR amplification product with one or more probes according to the present disclosure, and then quantitatively detecting the degree of reaction. When the probe carries a fluorescent group, the degree of reaction can be characterized by the intensity of the fluorescent signal.

[0056] In one embodiment, the upstream primer used in the qPCR amplification step is selected from SEQ ID NO: 17.

[0057] In one embodiment, the method further comprises an RT-PCR amplification step before the qPCR amplification step. Preferably, the upstream primer used in the RT-PCR amplification step is selected from SEQ ID NO: 18.

[0058] The beneficial effects achieved by the present disclosure include:

[0059] (1) The RNA splicing regulatory drugs used in the prior art are limited to LMI070, while the alternative splicing regulatory elements provided in the present disclosure can be regulated by a variety of alternative splicing regulatory small molecule drugs, such as RISDIPLAM and LMI070. RISDIPLAM is an FDA-approved drug for clinical treatment, while LMI070 has not yet been approved by the FDA for marketing. Therefore, the alternative splicing regulatory elements provided in the present disclosure have greater application value and broader application prospects.

[0060] (2) The ability of RNA splicing regulatory drugs to regulate gene expression in the prior art is limited, usually no more than 200-fold, while the variable splicing regulatory elements provided in the present disclosure can achieve a regulation factor of up to 2000-fold.

[0061] (3) The existing methods for detecting changes in RNA splicing are limited. The present disclosure designs probes that can accurately detect RNA splicing for multiple variable splicing regulatory elements with different compositions and constructs an accurate detection method.

[0062] (4) The prior art nucleic acid sequences are relatively long, no less than 560 bp, and the intron sequences with key functions are unclear. The present invention, by testing the initial obtained variable splicing regulatory elements through segment-by-segment truncation, clarifies the key intron sequences, thereby obtaining variable splicing regulatory elements with both low payload and high regulatory capacity. For example, starting from the variable splicing regulatory element Zf1, after optimization, the Zf2 and Zf3 sequences with similar functions to Zf1 were obtained, of which the Zf3 sequence is only 403 bp.

[0063] (5) The existing technology is derived from cells cultured in vitro, and it is unclear whether it can function in vivo in organs such as the heart, skeletal muscle, and liver. The alternative splicing regulatory element sequence provided in this disclosure is derived from cardiac tissue and has been confirmed to be functional in organs such as the heart, skeletal muscle, and liver.

[0064] (6) The existing technology adds additional amino acid sequences of unknown function to the downstream target gene, and the technology for seamless expression of the target gene is still unclear. The variable splicing regulatory element provided by the present disclosure does not have redundant sequences between the downstream target gene, or there are sequences that only serve as a linker and have no expression function (such as P2A sequences). This removes the additional amino acids expressed by the variable splicing regulatory elements of the prior art, achieving seamless expression of the target gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] In order to more clearly illustrate the specific embodiments of the present disclosure or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0066] Figure 1 shows the discovery process of alternative splicing segments regulated by Risdiplam (RIS) in mouse heart;

[0067] Figure 2 shows the process of modifying candidate sequences and screening the gene expression regulatory switch Zfr;

[0068] FIG3 shows the in vitro validation and evaluation results of the gene expression regulatory switch Zfr;

[0069] FIG4 shows the in vivo validation and evaluation results of the gene expression regulatory switch Zfr;

[0070] Figure 5 shows the effects of LMI070 (LMI) and RIS on X on Or comparative analysis on Zfr;

[0071] Figure 6 shows the study and verification of Zfr controlling YAP gene expression;

[0072] Figure 7 shows the research and verification of Zfr-controlled CRISPR / Cas9 gene editing;

[0073] FIG8 shows a study on reducing the size of the Zf element by deleting part of the intron sequence. DETAILED DESCRIPTION

[0074] (I) Definitions or terms

[0075] The following abbreviations shall apply to the relevant definitions or terms involved in this disclosure. Unless otherwise defined, all scientific and technical terms used herein have the meanings commonly understood by those of ordinary skill in the art. The following terms are provided below.

[0076] As used herein, the singular forms "a," "an," and "the" include the plural forms unless the context clearly indicates otherwise. As will be apparent to one of skill from the teachings contained herein, when used in the context of numerical values ​​and ranges, the terms "about" or "approximately" refer to a value or range that is approximately or close to the specified value or range, such that the embodiment can perform as intended. In some embodiments, "about" means ±10% of the numerical value.

[0077] The terms "polynucleotide" and "nucleic acid" are used interchangeably herein and refer to polymeric forms of nucleotides of any length. They may include one or more ribonucleotides or deoxyribonucleotides. Thus, the term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases, such as locked nucleic acids (LNA) and peptide nucleic acids (PNA).

[0078] The terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide typically contains at least two amino acids or amino acid variants, and there is no limit on the maximum number of amino acids that can comprise a protein or peptide sequence. A polypeptide includes any peptide or protein comprising two or more amino acids or variants linked to each other by peptide bonds. These terms include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, and the like. Polypeptides include naturally occurring peptides, recombinant peptides, or combinations thereof.

[0079] The terms "identity" and "homology" are used interchangeably herein and refer to the percentage of bases or amino acids that are identical and in the same relative position when comparing or aligning two sequences of polypeptides or polynucleotides. Sequence identity can be determined in a variety of different ways. For example, sequences can be aligned using various methods and computer programs (e.g., BLAST, T-COFFEE, MUSCLE, MAFFT, etc.).

[0080] The nucleic acid molecule described in the present disclosure can, for example, be a kind of isolated nucleic acid molecule.The term "isolated" when used for nucleic acid molecules or protein molecules refers to a nucleic acid or protein separated from one or more components associated therewith that are normally present in the natural environment.Separation can include breaking away from a larger nucleic acid (for example, from a gene or chromosome) or from other proteins or molecules that are normally in contact with the nucleic acid or protein.The term encompasses but does not require complete separation.

[0081] The nucleic acid molecules provided by the present disclosure include an alternative splicing regulatory element and a target gene encoding a target molecule (e.g., a target protein), wherein the target gene is operably connected to the 3' end of the alternative splicing regulatory element. It will be understood by those skilled in the art that the connection between the target gene and the alternative splicing regulatory element can be a tight connection, that is, there is no nucleic acid sequence between the target gene and the alternative splicing regulatory element; the connection between the target gene and the alternative splicing regulatory element can also be a non-tight connection, that is, there are other nucleic acid sequences between the target gene and the alternative splicing regulatory element, as long as the other nucleic acid sequences do not affect the expression of the target gene and do not affect the function of the alternative splicing regulatory element, the purpose of the present invention can be met, for example, the other nucleic acid sequences do not contain a stop codon, nor a start codon (e.g., ATG), and the number of nucleotides of the other nucleic acid sequences is a multiple of 3, so as not to affect the reading frame of the target gene.

[0082] The nucleic acid molecules provided herein can be any type of nucleic acid molecule, so long as the nucleic acid molecule can achieve the purposes of the present invention. For example, the nucleic acid molecules of the present invention can be single-stranded or double-stranded deoxyribonucleic acid molecules (i.e., DNA molecules), or single-stranded or double-stranded ribonucleic acid molecules (i.e., RNA molecules); the nucleic acid molecules of the present invention can be linear or circular.

[0083] The term "operably connected" refers to the functional relationship between two or more polynucleotide (e.g., DNA) segments. Typically, the term refers to the functional relationship between a transcriptional regulatory sequence and a sequence to be transcribed. For example, if a promoter or enhancer sequence, for example, stimulates or regulates the transcription of a coding sequence in an appropriate host cell or other expression system, the promoter or enhancer sequence is operably connected to the coding sequence. Typically, the promoter transcriptional regulatory sequence operably connected to the sequence is adjacent to the sequence or is separated by a short spacer sequence, i.e., they are cis-acting. However, some transcriptional regulatory sequences, such as enhancers, do not need to be physically adjacent to or located very close to the position of the coding sequence that these transcriptional regulatory sequences enhance their transcription.

[0084] The term "DreAM" is the abbreviation of Drug-elicitable Alternative-splicing Modulator, which is a nucleic acid molecule that regulates gene expression using RNA splicing regulators.

[0085] Various exemplary embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The description of the exemplary embodiments is merely illustrative and does not constitute any limitation on the present invention, its application, or use. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. These embodiments are provided to make the present invention thorough and complete and to fully convey the scope of the present invention to those skilled in the art. It should be noted that unless otherwise specifically stated, the technical means described in these embodiments should be interpreted as being merely exemplary and not restrictive.

[0086] Alternative splicing regulatory elements

[0087] The alternative splicing regulatory element provided by the present invention comprises a plurality of introns and exons and the nucleic acid sequence of at least one alternative splicing regulating small molecule drug binding site.In an embodiment, the alternative splicing regulatory element is operably connected to the target gene, and the target gene is located at the downstream position of the alternative splicing regulatory element.The alternative splicing regulatory element provided by the present disclosure is used in combination with one or more alternative splicing regulating small molecule drugs, and can regulate (such as open) the expression of the target gene.The regulation based on the combination of the alternative splicing regulatory element and one or more alternative splicing regulating small molecule drugs provided by the present disclosure presents dose correlation, that is, the target gene expression level can be controlled by applying the alternative splicing regulating small molecule drugs of different doses.In addition, the regulation based on the combination of the alternative splicing regulatory element and one or more alternative splicing regulating small molecule drugs provided by the present disclosure presents time correlation, that is, the target gene expression level can be controlled by applying the alternative splicing regulating small molecule drugs at different times.

[0088] In various aspects, the alternative splicing regulatory element comprises, in order from the 5' to the 3' end, at least: a first exon, a first intron, a pseudo exon, a second intron, and a second exon. One or more alternative splicing regulatory small molecule drugs bind to a sequence at the junction of the pseudo exon and the second intron. In the presence of the alternative splicing regulatory small molecule drug, the pseudo exon is included in the mRNA product of the nucleic acid; and in the absence of the alternative splicing regulatory small molecule drug, the pseudo exon is not included in the mRNA product of the nucleic acid.

[0089] In the present disclosure, the pseudoexon of the alternative splicing regulatory element has a unique start codon (eg, ATG sequence).

[0090] Small molecule drugs that regulate alternative splicing

[0091] The variable splicing regulating small molecule drug used in the present disclosure refers to a compound that can mediate variable splicing. In some embodiments, the variable splicing regulating small molecule drug regulates (especially increases) the mRNA product comprising the pseudo exon. In some embodiments, the variable splicing regulating small molecule drug binds to a sequence at a specific position in the variable splicing regulatory element. Preferably, in some embodiments, the specific position in the variable splicing regulatory element to which the variable splicing regulating small molecule drug binds is located at the junction of the 3' end of the pseudo exon and the 5' end of the second exon. More preferably, in some embodiments, the specific position in the variable splicing regulatory element to which the variable splicing regulating small molecule drug binds is located at the junction of the 3' end of the pseudo exon and the 5' end of the second exon at the AGAGTA sequence, wherein AGA is the last 3 nucleotide residues at the 3' end of the pseudo exon, and GTA is the 1st to 3rd nucleotide residues at the 5' end of the second intron.

[0092] In the first aspect of the variable splicing regulating small molecule drug, the variable splicing regulating small molecule drug used in the present disclosure is LMI070 or a derivative having the same binding site as LMI070 on the variable splicing regulatory element or a pharmaceutically acceptable salt of LMI070, wherein LMI070 is also known as Branaplam or NVS-SM1, and is a compound having a structure shown in the following formula (1).

[0093] A derivative having the same binding site as LMI070 on the variable splicing regulatory element refers to a derivative compound obtained by replacing a group conventionally used in the art on the basis of the compound of formula (1), and the derivative compound binds to the same sequence fragment as LMI070 on the variable splicing regulatory element; as a means of testing whether it belongs to the derivative defined in the present disclosure, those skilled in the art can determine it through simple experiments, for example, whether the variable splicing regulatory element described in the present disclosure can also produce the same effect as LMI070, that is, if the addition of a certain derivative of LMI070 can also make the generated mRNA contain the pseudo exon, then this derivative belongs to the derivative having the same binding site as LMI070 on the variable splicing regulatory element described in the present disclosure.

[0094] Examples of pharmaceutically acceptable salts of LMI070 include, but are not limited to, inorganic and organic acid salts, such as hydrochloride, hydrobromide, sulfate, citrate, lactate, tartrate, maleate, fumarate, mandelate, and oxalate; and inorganic and organic base salts formed with bases such as sodium hydroxide, tris(hydroxymethyl)aminomethane (TRIS, tromethamine), and N-methylglucamine.

[0095] In the second aspect of the alternative splicing regulating small molecule drug, the alternative splicing regulating small molecule drug used in the present disclosure is Risdiplam or a derivative having the same binding site as Risdiplam on the alternative splicing regulatory element or a pharmaceutically acceptable salt of Risdiplam, wherein Risdiplam is a compound having a structure shown in the following formula (2).

[0096] The derivative having the same binding site as Risdiplam on the variable splicing regulatory element refers to a derivative compound obtained by replacing the group conventionally used in the art on the basis of the compound of formula (2), and the derivative compound binds to the same sequence fragment as Risdiplam on the variable splicing regulatory element; as a means of testing whether it belongs to the derivative defined in the present disclosure, those skilled in the art can determine it through simple experiments, for example, whether the variable splicing regulatory element described in the present disclosure can also produce the same effect as Risdiplam, that is, if the addition of a certain derivative of Risdiplam can also make the generated mRNA contain the pseudo exon, then this derivative belongs to the derivative having the same binding site as Risdiplam on the variable splicing regulatory element described in the present disclosure.

[0097] Examples of pharmaceutically acceptable salts of risdiplam include, but are not limited to, inorganic and organic acid salts, such as hydrochloride, hydrobromide, sulfate, citrate, lactate, tartrate, maleate, fumarate, mandelate, and oxalate; and inorganic and organic base salts formed with bases such as sodium hydroxide, tris(hydroxymethyl)aminomethane (TRIS, tromethamine), and N-methylglucamine.

[0098] Cleavage site

[0099] In some embodiments, the nucleic acid molecules of the present disclosure optionally include one or more sequences encoding cleavage sites, wherein the sequences encoding the cleavage sites are located between the alternative splicing regulatory element and the target gene, for achieving the purpose of cleavage and separation of the alternative splicing regulatory element and the target gene. The cleavage site can be a self-cleavage site, a protease cleavage site, or a combination of the two.

[0100] 2A peptide

[0101] 2A peptide is a short peptide derived from viruses ( 2A peptides are peptides that contain 2A residues, often called "self-cleaving" peptides, and they enable a single transcript to produce multiple proteins. 2A peptides are not completely self-cleaving, but rather work by causing the ribosome to skip the synthesis of the glycine and proline peptide bonds at the C-terminus of the 2A element, ultimately leading to the separation of the end of the 2A sequence from the downstream product. The upstream protein will have some additional 2A residues added to its C-terminus, while the downstream protein will have an additional proline at its N-terminus. There are currently four commonly used 2A peptides: P2A, T2A, E2A, and F2A, derived from four different viruses.

[0102] target gene

[0103] The present disclosure controls the expression of target genes through the variable splicing regulatory elements provided. Target genes are genes encoding proteins or nucleic acids that need to be increased or decreased or controlled expression in vivo or in cells for gene therapy or other purposes. Without being limited by theory, technicians can use the variable splicing regulatory elements disclosed herein to construct nucleic acid molecules comprising any target genes. In some embodiments, the target gene can be a gene encoding a protein, such as a gene encoding an antibody or a functional binding fragment, a receptor, an enzyme, etc. In some embodiments, the target gene can be a gene encoding a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), or a Cas9 protein. In some embodiments, the target gene can be a gene that is transcribed to produce RNA, such as a gene that is transcribed to produce inhibitory RNA, such as miRNA, shRNA, LncRNA, etc. The number of target genes contained in the nucleic acid molecules provided by the present disclosure can be more than one or more.

[0104] Detection of nucleic acid molecules containing alternative splicing regulatory elements

[0105] The nucleic acid molecules provided by the present disclosure include alternative splicing regulatory elements and target genes, wherein the composition of the alternative splicing regulatory elements has restrictive conditions as described in the present disclosure, but it will be understood by those skilled in the art that the selection range of target genes is extensive and not fixed, and different target genes can be selected according to the different purposes of using nucleic acid molecules disclosed herein. Based on this, for the purpose of qualitative or quantitative detection of the presence of nucleic acid molecules determined in the present disclosure, it is possible to use a method such as RT-PCR for detection, wherein the upstream primer (or forward primer) of the primer pair used is designed according to the alternative splicing regulatory element, but the downstream primer (or reverse primer) needs to be designed according to the difference of the target gene. The principle, tool, and method of primer design known in the art can be used to design and screen downstream primers.

[0106] Fluorescent probes

[0107] A fluorescent probe (such as a Taqman probe) is an oligonucleotide labeled with an emitter and a quencher at each end. When the probe is intact, the fluorescent signal emitted by the emitter is absorbed by the quencher. During PCR amplification, the 5' to 3' exonuclease activity of the Taq enzyme cleaves and degrades the probe, separating the fluorescent emitter and quencher. This allows the fluorescence monitoring system to receive the fluorescent signal from the fluorescent emitter. This means that each time a DNA strand is amplified, a fluorescent molecule is formed, achieving complete synchronization between the accumulation of the fluorescent signal and the formation of the PCR product, thus enabling quantification. Commonly used fluorescent groups include FAM, TET, VIC, and HEX, while commonly used fluorescent quenchers include MGB, TAMRA, and BHQ.

[0108] Zfr gene

[0109] Zfr encodes zinc finger RNA binding protein, an RNA-binding protein characterized by its DZF (zinc finger associated domain) domain. The encoded protein may play a role in the nucleocytoplasmic shuttling of Staufen homolog 2, another RNA-binding protein in neurons. The expression of this gene is regulated by alternative polyadenylation that mediates differential microRNA targeting. Elevated expression of this gene has been observed in human patients with pancreatic cancer, and knockdown of this gene may result in reduced viability and invasiveness of pancreatic cancer cells.

[0110] Tlk2 gene

[0111] TLK2 (Tousled-like kinase 2) is a protein-coding gene. Disorders associated with TLK2 include intellectual disability, autosomal dominant 57, and pica. Pathways involved include miRNA regulation of the DNA damage response and the role of Chks in checkpoint regulation.

[0112] Agrn gene

[0113] AGRN (Agrin) is a protein-coding gene. Disorders associated with AGRN include myasthenic syndrome, congenital myasthenic syndrome, and presynaptic congenital myasthenic syndrome. Pathways involved include chondroitin sulfate / dermatan sulfate metabolism and glycosaminoglycan metabolism.

[0114] Ubap2l gene

[0115] UBAP2L (ubiquitin-associated protein 2 analog) is a protein-coding gene. Diseases associated with UBAP2L include spinal neuroblastoma and spinal primitive neuroectodermal tumors. Pathways involved include VEGFA-VEGFR2 signaling.

[0116] Angel2 gene

[0117] ANGEL2 (Angel homolog 2) is a protein-coding gene. Diseases associated with ANGEL2 include pontocerebellar dysplasia, interstitial lung disease type 7, and rheumatoid arthritis.

[0118] E030003E18Rik gene

[0119] It originates from 20495496-20495544 of mouse chromosome 19 (NCBI Gene ID: 320092). Currently, there are no related research reports on this gene.

[0120] (II) Exemplary Embodiments

[0121] The following embodiments illustrate the technical solutions of the present disclosure, but do not constitute any limitation to the scope of protection of the present disclosure.

[0122] Wild-type C57BL / 6 mice were used as the animal model for the experiments disclosed herein. Animal production, breeding, and experiments were performed at the Department of Laboratory Animal Science, Peking University Health Science Center. The experimental procedures involved were approved by the Peking University Biomedical Ethics Committee (Approval No. 2022412).

[0123] Example 1 Discovery of splicing regulatory elements responsive to Risdiplam

[0124] The process for discovering alternatively spliced ​​segments regulated by risdiplam in mouse heart is shown in Figure 1, A. Risdiplam (T16757, TargetMol) was selected as a small molecule splicing regulator. It was stored as a powdered solid at -80°C for long-term use. Before each experiment, a 1 mg / ml solution was prepared for animal administration. The solvent formulation of the solution was 10% DMSO, 40% PEG 300, 5% TWEEN 80, and 45% saline.

[0125] The mice were weighed and administered at a dose of 10 mg / kg. Small molecule splicing regulators were administered orally to conscious adult mice aged 6 to 10 weeks. The control group was given an equal amount of solvent (SOL). n = 5 per group. 48 hours after administration, the mice were anesthetized with isoflurane and sacrificed, and the apical tissue was quickly obtained and frozen at -80°C for RNA sequencing experiments.

[0126] RNA was extracted using the following method: mouse tissue was first disrupted using a homogenizer (DREMEL F6 / 10), and then RNA was extracted using Trizol (TransGen, ER501-01), aliquoted, and stored at -80°C. After quality control of the extracted RNA, 1 mg of reverse-transcribed cDNA was collected and a bulk transcriptome library was constructed using the KAPA Hyper Prep Kits (KAPA, KK8504). After quality control using Fragment Analyzer 1.0.2.9 and quantification by qPCR, PE150 paired-end sequencing (next-generation sequencing) was performed on the Illumina Nova-seq sequencing platform. The returned sequencing data was analyzed using bioinformatics techniques.

[0127] The above-mentioned second-generation sequencing results were preprocessed using Trim Galore software, and the processed data were quality controlled using FastQC software. The quality-controlled sequencing results were then aligned with the mouse mm10 reference genome using STAR software and screened based on the statistical analysis results. Then, CASH software was used for variable splicing analysis, and 6 potential variable splicing candidate sites were screened (including Tlk2, Agrn, Ubap2l, Zfr, Angel2 and E030003E18Rik gene sites, B to C in Figure 1, where C shows the location of the alternative sequence in the mouse genome, including the gene name containing the sequence and the specific coordinates in the mouse mm10 reference genome). The screening thresholds included: False Discovery Rate (FDR) < 0.05; Percent Spliced-In (PSI) < 0.05 in the solvent control group; Percent Spliced-In (PSI) > 0.4 in the RIS-treated group; the variable splicing type was "cassette" exon"; the number of reads related to alternative splicing in RNA-seq data was >400. We also identified alternatively spliced ​​fragments containing pseudo exons (D in Figure 1, Sashimi diagram of alternative sequence RNA splicing, arcs and numbers indicate the number of reads spanning exons, and black boxes mark pseudo exons (PSEs)).

[0128] Example 2 Screening and obtaining Zfr splicing regulatory elements

[0129] To obtain the optimal splicing regulatory element that responds to Risdiplam, it is necessary to modify the sequence fragment of the gene site and perform in vitro verification and comparison of the potential alternative splicing candidate sites in Example 1:

[0130] The inventors retained the sequences necessary for mRNA splicing at each gene locus (as indicated by the dotted positions in A in Figure 2), including the first exon-first intron junction, the branch point sequence required for splicing in the first intron, the first intron-pseudo-exon junction, the pseudo-exon-second intron junction, the branch point sequence required for splicing in the second intron, and the second intron-second exon junction. At the same time, a unique ATG was set as the start codon on each pseudo-exon, and the start codon sequences such as ATG and CTG were deleted from other components. Other non-essential sequences were also deleted to reduce the size for in vitro verification.

[0131] In order to verify the functions of the engineered splicing regulatory element sequences from different genes, the inventors constructed a reporter plasmid CMV-DreAM-GFP (as shown in Figure 2B) based on the AAV-U6sgRNA-U6sgRNA-Tnnt2-Cre plasmid vector disclosed in a published paper (Guo Y et al., Analysis of Cardiac Myocyte Maturation Using CASAAV, a Platform for Rapid Dissection of Cardiac Myocyte Gene Function In Vivo. Circ Res., 120(12):1874-1888, 2017), wherein DreAM corresponds to the engineered start / initial splicing regulatory elements derived from different gene sites and is named DreAM-Tl (Tlk2), DreAM-Ag (Agrn), DreAM-Ub (Ubap2l), DreAM-Zf1 (Zfr), DreAM-An (Angel2), and DreAM-E03 (E030003E18Rik), and their nucleotide sequences are shown in SEQ ID NO: 5. ID NOs: 33-35, 10, 36-37. CMV is a constitutive expression promoter, and the GFP gene has its own ATG deleted. The ATG in the GFP gene is in the same reading frame as that in DreAM-Tl / DreAM-Ag / DreAM-Ub / DreAM-Zf1 / DreAM-An / DreAM-E03. Furthermore, as a positive control group (PC), the inventors constructed a CMV-GFP reporter plasmid in which the GFP gene retained its own ATG. As a negative control group (NC), the inventors constructed a CMV-(ATG)GFP reporter plasmid in which the GFP gene had its own ATG deleted.

[0132] To screen for the optimal splicing regulatory elements that respond to Risdiplam, the inventors transfected HEK293T cells with the reporter plasmids CMV-DreAM-Tl-GFP, CMV-DreAM-Ag-GFP, CMV-DreAM-Ub-GFP, CMV-DreAM-Zf1-GFP, CMV-DreAM-An-GFP, and CMV-DreAM-E03-GFP. The cells transfected with the CMV-(ATG)GFP plasmid served as the negative control group. After treatment with 1 μM Risdiplam for 24 hours, the cell fluorescence signal was captured using a fluorescence microscope, and the fluorescence signal intensity was quantitatively analyzed (B to D in Figure 2, where C is the GFP fluorescence microscopy image of each group and D is the quantification of GFP fluorescence intensity using a microplate reader (n=4)). The results showed that after the addition of Risdiplam, cells transfected with the splicing element reporter plasmid expressed GFP fluorescence signals, indicating that Risdiplam has the function of inducing alternative splicing regulation. Moreover, the expression difference of GFP fluorescence signal of DreAM-Zf element was the most significant before and after drug administration (E in FIG2 , the fluorescence intensity multiple of RIS treatment relative to SOL control group).

[0133] The initial / starting DreAM-Zf1 splicing regulatory sequence discovered by the present invention is 1234 bp long and includes the first exon-first intron junction sequence (CAGGTA), the branch point sequence required for splicing in the first intron (CTTAACAT, with the fifth A representing the branch site), the first intron-pseudo-exon junction sequence (TAGGTT), the pseudo-exon-second intron junction sequence (ATGAGTA), the branch point sequence required for splicing in the second intron (TCTAACTC, with the fifth A representing the branch site), and the second intron-second exon junction sequence (CAGTTT). The nucleotide sequence of this initial / starting DreAM-Zf1 is as follows:

[0134] The division of each region of the variable splicing regulatory element is shown in Table 1.

[0135] Table 1 Sequences of various regions of alternative splicing regulatory elements Note: The sequence TGAGTA (underlined sequence in this table) immediately adjacent to the 3' end of the pseudo exon and the 5' end of the second intron is the binding site for Risdiplam.

[0136] Example 3 Construction of a plasmid containing a Zfr splicing regulatory element

[0137] To accurately quantify the production of pseudoexons regulated by alternative splicing of nucleic acid regulatory elements, the inventors designed a Taqman probe qPCR assay for detection. The upstream primer was designed on the pseudoexon, and the Taqman probe was designed to connect the pseudoexon to the second exon after splicing. The probe was activated by HEX and quenched by MGB. The downstream primer was designed on the target gene (GFP) (Figure 3A). HEK293T cells were transfected with the CMV-DreAM-Zf1-GFP plasmid and then treated with 1 μM Risdiplam. DMSO was used as a solvent control. After 0, 3, 6, 12, 18, 24, 36, and 48 hours, cells were harvested for Taqman-qPCR and quantitative analysis (Figure 3B, n = 3 per group, t-test comparing RIS and SOL, *P < 0.05, **P < 0.01, ***P < 0.001. Gray values ​​indicate the multiple of RIS compared to SOL at each time point). The results showed that risdiplam alters DreAM splicing products, inducing elevated expression of transcripts containing pseudoexons, and this effect was positively correlated with the duration of drug administration. To further validate the regulation of alternative splicing by the nucleic acid regulatory element, the inventors also performed RT-PCR. The upstream primer for RT-PCR was designed for exon 1, with the sequence: CGTGAAGACATTACATCCAGTGCA (SEQ ID NO: 18); the downstream primer was designed for the target gene (Figure 3C), with the sequence: TGAACTTGTGGCCGTTTACGT (SEQ ID NO: 42). These primers were used to measure the relative levels of mRNA containing the PSE (243 bp band) and those not containing the PSE (159 bp band). The results showed that risdiplam's ability to induce alternative splicing regulation began to take effect within 3 hours of drug administration and reached saturation at 6 hours (Figure 3D, bottom RT-PCR electropherogram, top quantification plot (n=3)).

[0138] To explore the relationship between Risdiplam administration concentration and the regulation of alternative splicing of nucleic acid regulatory elements, the inventors transfected HEK293T cells with CMV-DreAM-Zf1-GFP plasmids and then treated them with 0, 0.05, 0.5, 3, and 10 μM Risdiplam, respectively. The cells transfected with CMV-GFP plasmids served as the positive control group, and the cells transfected with CMV-(ATG)GFP plasmids served as the negative control group. After 24 hours of Risdiplam treatment, the fluorescence signal intensity was observed and quantitatively analyzed. At the same time, the cells were collected and Taqman probe qPCR was used to detect the fluorescence signal intensity. Risidiplam-induced pseudoexons and alternative splicing regulation of nucleic acid regulatory elements were quantitatively detected by qPCR (E) and RT-PCR (F) (Figure 3, E to G, where E and F represent treatment with different concentrations of RIS, followed by collection of samples 24 hours after treatment, and analysis of the relationship between RIS concentration and RNA splicing by qPCR (E) and RT-PCR (F). G represents the quantitative analysis of GFP fluorescence signals after treatment with different concentrations of RIS for 24 hours. A conventional reporter gene plasmid without DreAM-Zf1 was used as a positive control, and the values ​​on the bar graph reflect the relative fluorescence intensity relative to the positive control). The results showed that after the addition of Risdiplam, the cells expressed GFP fluorescence signals, indicating that Risdiplam has the function of inducing alternative splicing regulation, and this function is positively correlated with the dosage concentration.

[0139] Example 4 Construction of AAV vector controlled by Zf1 element

[0140] To verify the effectiveness of the DreAM-Zf1 element in vivo, the inventors packaged an AAV9 viral vector containing CMV-DreAM-Zf1-GFP. The AAV plasmid was constructed as follows: the DreAM-Zf1 sequence was redesigned while retaining a portion of the wild-type mouse genomic sequence. Primers were designed, and multiple fragments were amplified and seamlessly cloned using the mouse genome, as shown in Figure 4, A. CMV and GFP sequences were obtained from public data sources such as Addgene. DNA splicing and plasmid construction were performed using seamless cloning reactions.

[0141] The AAV packaging method is as follows: The plasmids used for AAV packaging are 70 μg of AAV plasmid (containing the CMV-DreAM-Zf1-GFP element), 70 μg of AAV9 Rep / Cap plasmid, and 160 μg of pHelper helper plasmid. These plasmids are transfected into HEK293T cells cultured in 15 cm dishes using PEI transfection reagent (Yeasen, 40816ES03). 60 hours after transfection, the cells are scraped and resuspended in lysis buffer (20 mM Tris pH = 8, 150 mM NaCl, 1 mM MgCl2, 50 μg / ml benzoic acid enzyme (Yeasen, 20156ES60)). The cells are lysed by three freeze-thaw cycles to release AAV9 into the solution. Simultaneously, AAV9 in the cell culture medium is precipitated with 40% PEG8000 (Sigma, P2139) in 2.5 M NaCl solution, resuspended in lysis buffer, and mixed with the cell lysate. AAV in the lysate was purified by ultracentrifugation in a 70Ti rotor (Beckman, XPN-100) on an Optiprep (Sigma, D1556-250ML) density gradient. AAV was then transferred to a 0.001% pluronic F68 / PBS (Caisson, PFL01-100ML) solution and concentrated using a 100 kDa centrifugal filter tube (Millipore, UFC910096). AAV titer was measured by qPCR using primers AAGCTGACCCTGAAGTTCATCTGC (SEQ ID NO: 45) and CTTGTAGTTGCCGTCGTCCTTGAA (SEQ ID NO: 46) that recognize the GFP sequence.

[0142] On postnatal day 1 (P1), mice were anesthetized with isoflurane and subcutaneously injected with an AAV9 viral vector containing the DreAM-Zf1 element (AAV-CMV-DreAM-Zf1-GFP). Seven days later, mice were intraperitoneally injected with 10 mg / kg risdiplam. Heart, liver, and skeletal muscle tissues were harvested 1, 2, 3, 4, and 5 days after administration for qPCR, RT-PCR, and Western blot analysis. GFP fluorescence was observed under a confocal microscope (Figure 4, B-D; B: Using samples from the day of RIS injection as a control, the expression of PSE-containing mRNA was determined over time using a Taqman probe assay. C: RT-PCR analysis of the relative levels of alternatively spliced ​​mRNA containing and without PSE. D-E: Western blot analysis of GFP protein expression over time using samples from the day of RIS injection as a control). The functional capacity of the Zf1 element was evaluated (n = 2 per group).

[0143] The operation method of Taqman-qPCR and RT-PCR is as follows: After the freshly removed tissue is rinsed in pre-cooled PBS, it is placed in an RNase-free EP tube and 1 mL of Trizol lysis buffer is added for grinding until there are no obvious tissue pieces. After standing at room temperature for 5 minutes, place it in a 4°C centrifuge and centrifuge at 12000g for 5 minutes, and the supernatant is transferred to a new enzyme-free EP tube. Add 200uL of chloroform and shake vigorously to mix. Stand on ice for 5 minutes, and centrifuge at 12000g at 4°C for 15 minutes. Transfer the supernatant to a new EP tube, add an equal amount of anhydrous ethanol to the supernatant, shake gently to mix, and then transfer it to the adsorption column of the commercially available RNA extraction Kit, and further elute according to the instructions (TransZol Up Plus RNA Kit, TranGene, ER501). After the extracted RNA was concentrated using NanoDrop2000 (Thermofish), a commercially available reverse transcription reagent ( III All-in-one RT SuperMix Perfect for qPCR, Vazyme, R333) was used according to the instructions for reverse transcription to obtain cDNA for further Taqman-qPCR and RT-PCR.

[0144] Taqman-qPCR:

[0145] 1. Prepare the following mixture in a qPCR tube

[0146] The primer sequences are as follows:

[0147] 2. Perform qPCR reaction according to the following conditions

[0148] 3. After the reaction is completed, confirm the amplification curve and melting curve of Real Time PCR, and perform PCR quantitative calculation and statistical analysis.

[0149] RT-PCR:

[0150] 1. Prepare the following mixture in a qPCR tube

[0151] The primer sequences are as follows:

[0152] 2. Perform qPCR reaction according to the following conditions

[0153] 3. The PCR products were subjected to gel electrophoresis on 1.5% agarose gel and visualized using a gel imaging system.

[0154] The results showed that after intraperitoneal injection of risdiplam, the extent of pseudoexon splicing into mRNA peaked one day after injection, as detected by qPCR. RT-PCR detected the most pronounced target band at this time, and gradually weakened from the second day onward (Figure 4, B-C). Therefore, the optimal duration for a single risdiplam injection to enhance the effect of the DreAM-Zf1 element is one day.

[0155] Western blotting was performed as follows: fresh tissue was washed with cold PBS and then thoroughly disrupted using a homogenizer in RIPA buffer (25 mM Tris pH 7.0-8.0, 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% Triton X-100, and protease inhibitors (Solarbio, A8260)). Lysis was continued on ice for 10 minutes. The lysate was then centrifuged at 12,000 rpm for 15 minutes at 4°C. The supernatant was collected and protein concentration was determined using the BCA assay (TransGen, DQ111-01).

[0156] After measuring the protein concentration of the samples, the protein concentrations of the lysates were adjusted to the same level using RIPA buffer and diluted in 4× SDS sample buffer (Solarbio, P1016). After boiling the dilutions for 10 minutes, 20 μg of protein from each sample was loaded onto a 4% to 15% gradient gel (TransGen, DG101-01) and transferred to a PVDF membrane. After incubation in TBST containing 5% skim milk for one hour at room temperature, the membranes were incubated with primary antibodies (Ms-Anti-GAPDH, 1:10,000, TransGen, HC301; Ms-Anti-GFP, 1:5,000, TransGen, HT801) at 4°C overnight. The following day, the membranes were rinsed three times with TBST for five minutes each, followed by incubation with a secondary antibody (HRP-Gt-Anti-Ms, 1:5,000, BBI, D110087-0100) for one hour. The membrane was then washed three times with TBST for five minutes each time, and then incubated with ECL substrate (Solarbio, PE0010) evenly. Images were captured using an iBright CL1500 imaging system (Thermo Fisher Scientific).

[0157] Western blot results showed that the DreAM-Zf1 element could enhance the expression of the reporter gene GFP in the heart, liver, and skeletal muscle tissues in the presence of Risdiplam, with the specificity in the heart and skeletal muscle being better than that in the liver tissue (D to E in FIG4 ).

[0158] Mouse heart, liver, and skeletal muscle tissues were embedded in OCT, frozen sections were cut, and cell membranes were labeled with WGA. Confocal microscopy was used to examine the regulation of GFP fluorescent protein expression by the DreAM-Zf1 element before and after risdiplam injection. The results showed that after risdiplam injection, the expression signal of the reporter gene GFP in each tissue was significantly enhanced (Figure 4F).

[0159] Furthermore, the inventors treated mice injected with AAV-CMV-DreAM-Zf1-GFP with different doses of risdiplam (0, 2, 10, and 50 mg / kg). Dynamic changes in CMV-DreAM-Zf1 activity were examined using Taqman qPCR, RT-PCR, and Western blot. The results showed that the extent of pseudoexon splicing into mRNA and GFP protein levels in mice were significantly enhanced after administration and positively correlated with the dose.

[0160] The results of this example show that the DreAM-Zf1 element of the present invention can control the expression of the target gene by administering Risdiplam, and this regulation is time- and dose-dependent.

[0161] Example 5 Comparison of CMV-DreAM-Zf1 and X on element

[0162] Published X on The element has a similar drug recognition motif (A in FIG5 ) to the CMV-DreAM-Zf1 element of the present invention, and the two differ by only one base. on -GFP (for construction methods, see Monteys, AM et al., Regulated control of gene therapies by drug-induced splicing. Nature 596, 291–295 (2021)) and CMV-DreAM-Zf1-GFP plasmids were transfected into 293T cells, and 1 μM LMI070 and risdiplam were used to regulate and induce the expression of the target gene GFP. Western blot analysis and fluorescence microscopy were used to observe the GFP signal. The results showed that CMV-DreAM-Zf1 and X onIn both systems, GFP expression was significantly increased after LMI070 and Risdiplam administration compared to the untreated control group (Sol) (Figure 5B-C, B shows the GFP fluorescence signal comparison, and C shows the Western blot comparison result). This indicates that both systems can be modulated by LMI070 and Risdiplam.

[0163] Furthermore, newborn mice (P1) were injected with AAV-CMV-DreAM-Zf1-GFP. Seven days later, 10 mg / kg of risdiplam and LMI070 were intraperitoneally injected, respectively. Two days later, heart tissue was harvested for Western blot analysis (Figure 5, D and E). The results showed that both risdiplam and LMI070 significantly enhanced GFP expression in the mouse heart. This suggests that the DreAM-Zf1 system is regulated in vivo by both LMI070 and risdiplam.

[0164] The results of this example show that the RNA splicing regulator to which the DreAM-Zf1 element of the present invention can respond can be selected from either of the two drugs LMI070 and Risdiplam.

[0165] Example 6 DreAM-Zf1 element regulates the activation of the Yap gene

[0166] The Yap gene is an important gene that regulates cardiomyocyte proliferation and myocardial regeneration. Yap activation is important for treating heart diseases such as myocardial infarction that involve cardiomyocyte death. To verify that the DreAM-Zf1 element can regulate downstream genes used for gene therapy, such as the Yap gene, the inventors first constructed the CMV-DreAM-Zf1-HA-Yap1 S127A In this plasmid, Yap1 S127A Refers to a YAP mutant with an S>A mutation at amino acid 127 (SEQ ID NO: 42). HA is used as a tag protein to detect YAP protein expressed under Zf1 control. In order to prevent DreAM-Zf1 from adding additional amino acids of unknown function to the N-terminus of YAP1 protein, the inventors also constructed the plasmid CMV-DreAM-Zf1-2A-HA-Yap1 S127A In this plasmid, the inventors added a short peptide P2A, which can self-cleave between the amino acids encoded by DreAM-Zf1 and the amino acids of YAP1, thereby seamlessly expressing the complete Yap1. S127A Protein. The specific working principle and process are shown in Figure 6 A. As a positive control, the inventors constructed CMV-HA-Yap1 S127A plasmid.

[0167] The plasmid construction method is as follows: DreAM-Zf1 sequence is derived from the vector plasmid constructed in Example 3, Yap1 S127A DNA fragments were synthesized by Suzhou GENEWIZ Biotechnology Co., Ltd. (GENEWIZ, Suzhou, Jiangsu, China). CMV and HA were derived from publicly available plasmid sequences from Addgene. DNA splicing and plasmid construction were performed using seamless cloning reactions.

[0168] After the three plasmids were transfected into 293T cells, the medium was changed and drugs were added after 6 hours, and the cells were collected and analyzed by Western blot after 24 hours. S127A and CMV-DreAM-Zf1-2A-HA-Yap1 S127A The negative control group was treated with 1 μM Risdiplam, and the negative control group was the group without plasmid transfection (NC). The results showed that the A band shown in Figure 6B was the HA-YAP band, the B band was the DreAM-Zf1-HA-YAP band, and the C band was the DreAM-Zf1-2A-HA-YAP band where 2A did not undergo self-cleavage. These results indicate that the P2A short peptide can undergo self-cleavage, removing the amino acids encoded by DreAM-Zf1, thereby seamlessly expressing the complete Yap1. S127A protein.

[0169] YAP1 5SA (referring to a YAP mutant with an S>A mutation at five amino acids in the YAP protein, SEQ ID NO: 43) compared to Yap1 S127A The inventors then constructed CMV-DreAM-Zf1-2A-HA-Yap1 5SA Plasmids and CMV-HA-Yap1 5SA Plasmids (positive control). 293T cells were transfected with these two plasmids separately. After 6 hours, the medium was changed and cells were treated with 1 μM Risdiplam or a SOL control. A negative control group (NC) was used, which did not receive plasmid transfection. After 24 hours of treatment, cells were harvested for Western blot analysis and immunofluorescence staining, and HA-positive cells were observed using confocal microscopy.

[0170] The results showed that after treatment with Risdiplam, cells transfected with DreAM-Zf1-2A-HA-YAP expressed two bands, namely HA-YAP protein before 2A self-cleavage (band C in Figure 6C) and after self-cleavage (band A in Figure 6C). Confocal microscopy imaging showed that YAP1 was expressed in 293T cells after treatment with Risdiplam. S127A and YAP1 5SA, and YAP protein has obvious nuclear localization (D in Figure 6, where WGA marks the nucleus and HA marks the Zf-controlled YAP protein, and the high-magnification image confirms the nuclear localization of the YAP mutant). These results indicate that the DreAM-Zf1 element can be activated by Risdiplam in vitro and regulate the expression of multiple downstream target genes.

[0171] To further verify whether DreAM-Zf1 is effective in regulating YAP gene expression in vivo, the inventors tandemly expressed the cardiomyocyte-specific Tnnt2 promoter, DreAM-Zf1 element and YAP1 S127A ,YAP1 5SA Reporter genes were packaged with a new AAV9 vector for in vivo studies in mice.

[0172] The method for constructing AAV plasmids is as follows: The DreAM-Zf1 sequence DNA fragment was commissioned to Suzhou GENEWIZ Biotechnology Co., Ltd. (GENEWIZ, Suzhou, Jiangsu, China) for gene synthesis. S127A and YAP1 5SA The genes were derived from publicly available plasmid sequences on Addgene. DNA splicing and plasmid construction were performed using seamless cloning reactions.

[0173] The inventors packaged the above plasmid into AAV. Newborn mice (P1) were injected with AAV, and 7 days later, Risdiplam (10 mg / kg) was injected intraperitoneally. One day later, the mouse heart tissue was taken for Taqman-qPCR, Western blot and immunofluorescence staining confocal imaging analysis. Taqman-qPCR results showed that at the mRNA splicing level, Risdiplam increased the splicing degree of Zf1 element pseudoexon in the heart by about 40 times (E in Figure 6). Western blot results showed that at the protein level, Risdiplam significantly increased YAP1 in the heart. S127A and YAP1 5SA Western blot could only detect the band after 2A self-cleavage (band A in Figure 6), but could not detect the band before self-cleavage (band C in Figure 6), indicating that the self-cleavage peptide has a high working efficiency in vivo. Immunofluorescence staining results showed that Risdiplam significantly increased YAP1 in cardiomyocytes. S127A and YAP1 5SA The expression of YAP was detected and YAP was localized in the nucleus ( FIG6G ).

[0174] Example 7 Application of the DreAM-Zf1 Element-Regulated Gene Editing System

[0175] In this example, the inventors studied whether the DreAM-Zf1 element can regulate Cas9 gene editing. To this end, the inventors concatenated CMV or EFS promoter, DreAM-Zf1 element and SaCas9 to construct a plasmid for gene editing, which was verified on Neuro2a cells. Both EFS and CMV are promoters that can activate systemic transcription. The activity of EFS is weaker than that of CMV. The above-mentioned plasmid also contains an expression element for sgRNA targeting the Camk2d gene (SEQ ID NO: 44, A in Figure 7). Camk2d is a gene encoding CaMKIIδ and is a key therapeutic target for heart disease.

[0176] Plasmid construction was performed as follows: DreAM-Zf1 and sgRNA sequence DNA fragments were synthesized by Suzhou Genewiz Biotechnology Co., Ltd. (GENEWIZ, Suzhou, Jiangsu, China). CMV, EFS, SaCas9, and U6 were derived from publicly available plasmids from Addgene. DNA splicing and plasmid construction were performed using seamless cloning. Three plasmids, U6-sgRNA-CMV-SaCas9-HA, U6-sgRNA-CMV-DreAM-Zf1-SaCas9-HA, and U6-sgRNA-EFS-DreAM-Zf1-SaCas9-HA, were constructed.

[0177] The above plasmids were transfected into Neuro2a cells, and the medium was changed after 6 hours. After adding Risdiplam (1 μM) or solvent treatment for 36 hours, the cells were collected for Taqman-qPCR, RT-PCR, Western blot, immunofluorescence and amplicon sequencing analysis (B in Figure 7). The qPCR results showed that the level of mRNA pseudo-exon splicing induced by Risdiplam was significantly higher under the CMV promoter than that under the EFS promoter, up to 2000 times (C in Figure 7). The expression of SaCas9 mRNA level induced by Risdiplam increased by about 2.6 times, and the ability of the EFS promoter to activate SaCas9 transcription was significantly lower than that of the CMV promoter under the condition of drug administration or non-drug administration, which was about 30% of the transcriptional activation of the CMV promoter (D in Figure 7), verifying the fact that the activity of the CMV promoter is higher than that of EFS.

[0178] RT-PCR showed that the degree of pseudo-exon splicing into mRNA in DreAM-Zf1 elements activated by two different promoters was significantly increased after Risdiplam treatment (E in Figure 7). Western blot and immunofluorescence staining results showed that in DreAM-Zf1 elements activated by two different promoters, CMV and EFS, the protein expression level of SaCas9 was also significantly increased after Risdiplam induction (F and G in Figure 7). Amplicon sequencing results showed that the incidence of base insertion / deletion mutations (indels) in the DreAM-Zf1 element activated by the CMV promoter did not increase significantly after Risdiplam treatment, while the incidence of base insertion / deletion mutations (indels) in the DreAM-Zf1 element activated by the EFS promoter increased by 2.1 times after Risdiplam treatment. When not treated with Risdiplam, the incidence of indels generated by the SaCas9 gene editing system induced by the DreAM-Zf1 element activated by the EFS promoter was significantly lower than that in the CMV promoter group (H in Figure 7).

[0179] These results indicate that the DreAM-Zf1 element is suitable for controlling gene editing systems. However, because gene editing is a highly sensitive system that is sensitive to low-expression Cas9, the DreAM-Zf1 element needs to be combined with a promoter with weak transcriptional activation ability to achieve control of gene editing.

[0180] Example 8 Further truncation of the DreAM-Zf1 element

[0181] The method for truncating the DreAM-Zf1 element is as follows:

[0182] The inventors believe that the (pseudo)exons of the DreAM-Zf1 element and their adjacent intronic segments are essential for DreAM function, but that non-essential nucleic acid segments may exist within the middle segments of the two introns. Therefore, the inventors divided the middle segments of introns 1 and 2 of the DreAM-Zf1 element into several smaller fragments, deleted each of them, and tested their effects on DreAM function. Based on the existing DreAM-Zf1 element, the inventors designed primers to amplify and seamlessly clone and splice multiple fragments of a vector plasmid containing the DreAM-Zf1 element, constructing a vector plasmid containing the truncated element (Zf1a-i) ( Figure 8 , A).

[0183] Subsequently, the inventors transfected HEK293T cells with the vector plasmids containing the truncated elements. After 24 hours of risdiplam treatment, the difference in GFP protein expression caused by risdiplam was detected by Western blot (Figure 8, A). The cells transfected with the CMV-GFP plasmid served as the positive control, and the cells transfected with the CMV-(ATG)GFP plasmid served as the negative control.

[0184] The data showed that, with the exception of Zf1i, the other truncated fragments in the Zf1a-i element had no significant effect on DreAM function. The inventors deleted these small fragments that did not affect the properties of the DreAM-Zf1 element to obtain the DreAM-Zf2 element (Figure 8A).

[0185] Based on the DreAM-Zf2 element, the inventors further conducted small fragment deletion experiments. Similarly, by designing primers, multiple fragments of the vector plasmid containing the DreAM-Zf2 element were amplified and seamlessly cloned to construct a vector plasmid containing the truncated element. The vector plasmid containing the truncated element was transfected into HEK293T cells. The cells transfected with the CMV-GFP plasmid served as the positive control group, and the cells transfected with the CMV-(ATG)GFP plasmid served as the negative control group. After 24 hours of risdiplam treatment, the difference in GFP protein expression caused by risdiplam was detected by Western blot (Figure 8B).

[0186] The data showed that deletion of several small fragments in the DreAM-Zf2 element did not significantly affect DreAM function. The inventors deleted these small fragments that did not affect the properties of the DreAM-Zf2 element together to obtain the DreAM-Zf3 element (Figure 8B).

[0187] HEK293T cells were transfected with vector plasmids containing the DreAM-Zf1, DreAM-Zf2, and DreAM-Zf3 elements, respectively. Cells transfected with the CMV-GFP plasmid served as a positive control, and cells transfected with the CMV-(ATG)GFP plasmid served as a negative control. After 24 hours of risdiplam treatment, the fluorescence signal intensity was observed and quantitatively analyzed. Cells were then harvested and RT-PCR was used to quantitatively detect risdiplam-induced pseudoexons and alternative splicing regulation within the nucleic acid regulatory elements (Figure 8, C and D). The data showed that the truncated DreAM-Zf2 and DreAM-Zf3 elements still possessed properties similar to those of the DreAM-Zf1 element, while being significantly shortened in length.

[0188] The nucleotide sequence of the DreAM-Zf2 element is:

[0189] The nucleotide sequence of the first intron of the DreAM-Zf2 element is:

[0190] The nucleotide sequence of the second intron of the DreAM-Zf2 element is:

[0191] The nucleotide sequence of the DreAM-Zf3 element is:

[0192] The nucleotide sequence of the first intron of the DreAM-Zf3 element is:

[0193] The nucleotide sequence of the second intron of the DreAM-Zf3 element is:

[0194] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present disclosure, rather than to limit them. Although the present disclosure has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present disclosure.

Claims

1. A variable splicing regulatory element, which comprises, from the 5' end to the 3' end, a first exon, a first intron, a pseudo exon, a second intron and a second exon; the pseudo exon comprises a nucleotide sequence having at least 95% homology to the sequence shown in SEQ ID NO: 1; the junction between the pseudo exon and the second intron comprises a variable splicing regulatory small molecule drug binding site; the variable splicing regulatory element contains a unique start codon only in the pseudo exon.

2. The alternative splicing regulatory element according to claim 1, wherein The alternative splicing regulating small molecule drug binding site comprises the nucleotide sequence ATGAGTA, wherein ATGA belongs to the pseudoexon and GTA belongs to the second intron; or, The variable splicing regulating small molecule drug binding site comprises the nucleotide sequence AGAGTA, wherein AGA belongs to the pseudoexon and GTA belongs to the second intron.

3. The alternative splicing regulatory element according to claim 1 or 2, wherein The sequence of the first exon immediately following the sequence of the first intron is CAG, and the sequence of the first intron immediately following the sequence of the first exon is GTA; and / or, The sequence of the first intron immediately following the sequence of the pseudo exon is TAG, and the sequence of the pseudo exon immediately following the sequence of the first intron is GTT; and / or, The sequence of the second intron immediately following the sequence of the second exon is CAG, and the sequence of the second exon immediately following the sequence of the second intron is TTT.

4. The alternative splicing regulatory element according to any one of claims 1 to 3, wherein The first intron contains a nucleotide sequence having at least 95% homology to the sequences shown in SEQ ID NO: 19 and 20; the second intron contains a nucleotide sequence having at least 95% homology to the sequence shown in SEQ ID No:

21.

5. The alternative splicing regulatory element according to any one of claims 1 to 4, wherein The nucleotide length of the first intron is 41 to 500 bp, preferably 41 to 410 bp, preferably 41 to 140 bp, preferably 41 to 110 bp; the nucleotide length of the second intron is 60 to 569 bp, preferably 60 to 479 bp, preferably 60 to 209 bp, preferably 60 to 129 bp.

6. The alternative splicing regulatory element according to any one of claims 1 to 5, wherein The first intron contains a nucleotide sequence having at least 95% homology to the sequence shown in any one of SEQ ID NOs: 3-5, 22-25; the second intron contains a nucleotide sequence having at least 95% homology to the sequence shown in any one of SEQ ID NOs: 6-8, 26-32.

7. The alternative splicing regulatory element according to any one of claims 1 to 6, wherein (a) the first intron contains a nucleotide sequence having at least 95% homology to the sequence shown in SEQ ID NO:5; the second intron contains a nucleotide sequence having at least 95% homology to the sequence shown in SEQ ID NO:8; or, (b) the first intron contains a nucleotide sequence having at least 95% homology to the sequence shown in SEQ ID NO:4; the second intron contains a nucleotide sequence having at least 95% homology to the sequence shown in SEQ ID NO:7; or, (c) the first intron comprises a nucleotide sequence having at least 95% homology to the sequence shown in SEQ ID NO:3; and the second intron comprises a nucleotide sequence having at least 95% homology to the sequence shown in SEQ ID NO:

6.

8. The alternative splicing regulatory element according to any one of claims 1 to 7, wherein The first exon contains a nucleotide sequence having at least 95% homology to the sequence shown in SEQ ID NO:2; and / or the second exon contains a nucleotide sequence having at least 95% homology to the sequence shown in SEQ ID NO:

9.

9. The alternative splicing regulatory element according to any one of claims 1 to 8, wherein The variable splicing regulatory element contains a nucleotide sequence having at least 95% homology to the sequence shown in any one of SEQ ID NOs: 10-12. 10 . A nucleic acid molecule comprising the alternative splicing regulatory element according to any one of claims 1 to 9 and a target gene located at the 3′ end of the alternative splicing regulatory element.

11. The nucleic acid molecule according to claim 10, wherein There is no nucleic acid sequence between the 3' end of the variable splicing regulatory element and the 5' end of the target gene.

12. The nucleic acid molecule according to claim 10, wherein There is a sequence encoding a protease cleavage site between the 3' end of the variable splicing regulatory element and the 5' end of the target gene, wherein the protease cleavage site is cleaved by a mammalian protease or is self-cleaved, and the number of bases in the sequence encoding the protease cleavage site is an integral multiple of 3.

13. The nucleic acid molecule according to any one of claims 10 to 12, wherein The 5' end of the alternative splicing regulatory element is operably connected to a promoter sequence.

14. The nucleic acid molecule according to claim 13, wherein The promoter sequence is a mammalian cell constitutive promoter, a mammalian cell specific promoter, a mammalian non-coding RNA promoter or a prokaryotic cell promoter.

15. The nucleic acid molecule according to claim 14, wherein The mammalian cell constitutive promoter is CMV, CAG, CBG, EF1a, PGK1 or Ubc; the mammalian cell specific promoter is Tnnt2, Nppa, Myl2, Mck, Nkx2.5, Syn, Mecp2, TBG, Pdx1, K14, Rpe65 or SP-C; the mammalian non-coding RNA promoter is U6 or H1; and the prokaryotic cell promoter is T7, T3 or SP6.

16. The nucleic acid molecule according to any one of claims 10 to 15, wherein The nucleic acid molecule further comprises a post-transcriptional regulatory element and / or a target sequence for a microRNA.

17. The nucleic acid molecule according to claim 16, wherein The post-transcriptional regulatory element (PRE) comprises a post-transcriptional regulatory element derived from hepatitis B (HPRE), bat (BPRE), ground squirrel (GSPRE), arctic squirrel (ASPRE), duck (DPRE), chimpanzee (CPRE), woolly monkey (WMPRE) or woodchuck (WPRE); The microRNA is selected from miR122, miR199, miR7, miR148, miR1 or miR208; Optionally, the post-transcriptional regulatory element and / or the target sequence of the microRNA is disposed at the 3' end of the target gene.

18. The nucleic acid molecule according to any one of claims 10 to 17, wherein The nucleic acid molecule further comprises a polyadenylation signal (polyA), optionally wherein the polyA is disposed at the 3' end of the gene of interest.

19. The nucleic acid molecule according to claim 18, wherein The polyA signal is SV40 polyA, human growth hormone (HGH) polyA, bovine growth hormone (BGH) polyA, β-globin polyA, α-globin polyA, ovalbumin polyA, κ-light chain polyA or synthetic polyA.

20. The nucleic acid molecule according to any one of claims 10 to 19, wherein The variable splicing regulatory element can be combined with a variable splicing regulatory small molecule drug, and the variable splicing regulatory small molecule drug is LMI070, a derivative having the same binding site as LMI070 on the variable splicing regulatory element, or a pharmaceutically acceptable salt of LMI070; or, the variable splicing regulatory small molecule drug is Risdiplam, a derivative having the same binding site as Risdiplam on the variable splicing regulatory element, or a pharmaceutically acceptable salt of Risdiplam.

21. The nucleic acid molecule according to any one of claims 10 to 20, wherein The protein encoding gene is a gene encoding a nuclease, and / or a gene encoding a therapeutic protein, and / or a gene encoding a reporter or marker protein, and / or a gene encoding a non-coding RNA; Preferably, the nuclease comprises a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN) or a CRISPR associated protein (Cas protein) or a derivative with the same function thereof, and further preferably, the Cas protein comprises a Cas9 protein, a Cas12 protein or a Cas13 protein; Preferably, the therapeutic protein comprises YAP, LMNA, RPE65, SMN1, FVIII, FIX or their functionally equivalent derivatives; Preferably, the marker protein includes eGFP, tdTomato, mCherry, Luciferase, SEAP, CAT, GST, β-GUS, β-Gal or their functionally equivalent derivatives; Preferably, the non-coding RNA includes at least one of miRNA, shRNA or LncRNA having gene inhibition function.

22. A method for constructing a nucleic acid molecule according to any one of claims 10 to 21, comprising connecting a target gene with the 5' start codon removed to the 3' end of the alternative splicing regulatory element according to any one of claims 1 to 9, so that the target gene and the start codon in the alternative splicing regulatory element use the same reading frame.

23. A transcript, which is a transcript of a nucleic acid molecule according to any one of claims 10 to 21 or a nucleic acid molecule obtained by the construction method according to claim 22 in the presence of an alternative splicing regulating small molecule drug; or a transcript of a nucleic acid molecule according to any one of claims 10 to 21 or a nucleic acid molecule obtained by the construction method according to claim 22 in the absence of an alternative splicing regulating small molecule drug; The variable splicing regulating small molecule drug is LMI070, a derivative having the same binding site as LMI070 on the variable splicing regulatory element, or a pharmaceutically acceptable salt of LMI070; or, the variable splicing regulating small molecule drug is Risdiplam, a derivative having the same binding site as Risdiplam on the variable splicing regulatory element, or a pharmaceutically acceptable salt of Risdiplam.

24. A vector comprising the alternative splicing regulatory element according to any one of claims 1 to 9, the nucleic acid molecule according to any one of claims 10 to 21, the nucleic acid molecule obtained by the construction method according to claim 22, or the transcript according to claim 23.

25. The vector according to claim 24, wherein The vector is a DNA or RNA vector, or, the vector is double-stranded or single-stranded.

26. The vector according to claim 24, wherein The vector is a viral vector.

27. The vector according to claim 26, wherein The viral vector is an adeno-associated virus (AAV) vector, a chimeric AAV vector, an adenoviral vector, a retroviral vector, a lentiviral vector, a herpes simplex virus vector, a baculoviral vector, or any mutant or derivative thereof.

28. A recombinant virus comprising the variable splicing regulatory element according to any one of claims 1 to 9, the nucleic acid molecule according to any one of claims 10 to 21, the nucleic acid molecule obtained by the construction method according to claim 22, the transcript according to claim 23, or the vector according to any one of claims 24 to 27.

29. The recombinant virus according to claim 28, wherein The recombinant virus is an adeno-associated virus (AAV), a chimeric AAV, an adenovirus, a retrovirus, a lentivirus, a herpes simplex virus, a baculovirus, or any mutant or derivative thereof.

30. The recombinant virus according to claim 29, wherein The adeno-associated virus is one or more of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAVrh36, AAVrh37, AAVrh74, AAVrh79, AAV-DJ, AAV-DJ / 8, AAV.Anc80, AAV.Anc80L65, AAV-PHP.B, AAV-PHP.B2, AAV-PHP.B3, AAV-PHP.A, AAV-PHP.eB, AAV-PHP.S, AAV2i8, MyoAAV, AAVMYO, AAV.CPP.16 capsid serotype or its variants.

31. A cell comprising one or more alternative splicing regulatory elements according to any one of claims 1 to 9, one or more nucleic acid molecules according to any one of claims 10 to 21, nucleic acid molecules obtained by the construction method according to claim 22, transcripts according to claim 23, one or more vectors according to any one of claims 24 to 27, or one or more recombinant viruses according to any one of claims 28 to 30.

32. The cell according to claim 31, wherein The cell is a human cell; Preferably, the human cells are cells isolated from the body; Preferably, the human cells are immortalized cell lines or cancer cells.

33. The cell according to claim 32, wherein The human cells are heart cells, muscle cells, neurons, liver cells, spleen cells, lung cells or kidney cells; 34. A pharmaceutical composition, comprising one or more variable splicing regulatory elements according to any one of claims 1 to 9, one or more nucleic acid molecules according to any one of claims 10 to 21, nucleic acid molecules obtained by the construction method according to claim 22, transcripts according to claim 23, one or more vectors according to any one of claims 24 to 27, or one or more recombinant viruses according to any one of claims 28 to 30, or one or more cells according to any one of claims 31 to 33.

35. A method for regulating the expression of a target gene based on alternative splicing-regulated small molecule drugs, comprising: Contacting one or more nucleic acid molecules according to any one of claims 10 to 21, nucleic acid molecules obtained by the construction method according to claim 22, transcripts according to claim 23, one or more vectors according to any one of claims 24 to 27, one or more recombinant viruses according to any one of claims 28 to 30, one or more cells according to any one of claims 31 to 33, one or more pharmaceutical compositions according to claim 34 with one or more alternative splicing regulating small molecule drugs; Wherein, the variable splicing regulating small molecule drug is LMI070, a derivative having the same binding site as LMI070 on the variable splicing regulatory element, or a pharmaceutically acceptable salt of LMI070; or, the variable splicing regulating small molecule drug is Risdiplam, a derivative having the same binding site as Risdiplam on the variable splicing regulatory element, or a pharmaceutically acceptable salt of Risdiplam.

36. A kit comprising: (1) one or more nucleic acid molecules according to any one of claims 10 to 21, nucleic acid molecules obtained by the construction method according to claim 22, transcripts according to claim 23, one or more vectors according to any one of claims 24 to 27, one or more recombinant viruses according to any one of claims 28 to 30, one or more cells according to any one of claims 31 to 33, one or more pharmaceutical compositions according to claim 34; and / or, (2) one or more alternative splicing regulating small molecule drugs; wherein: The variable splicing regulating small molecule drug is LMI070, a derivative having the same binding site as LMI070 on the variable splicing regulatory element, or a pharmaceutically acceptable salt of LMI070; or, the variable splicing regulating small molecule drug is Risdiplam, a derivative having the same binding site as Risdiplam on the variable splicing regulatory element, or a pharmaceutically acceptable salt of Risdiplam.

37. (a) and (b) for use in regulating the expression of a target gene or in preparing a gene therapy drug; Wherein (a) is selected from one or more alternative splicing regulatory elements according to any one of claims 1 to 9, one or more nucleic acid molecules according to any one of claims 10 to 21, nucleic acid molecules obtained by the construction method according to claim 22, transcripts according to claim 23, one or more vectors according to any one of claims 24 to 27, one or more recombinant viruses according to any one of claims 28 to 30, one or more cells according to any one of claims 31 to 33, one or more pharmaceutical compositions according to claim 34, or the kit according to claim 36; (b) is a small molecule drug for regulating alternative splicing; wherein the small molecule drug for regulating alternative splicing is LMI070, a derivative having the same binding site as LMI070 on the alternative splicing regulatory element, or a pharmaceutically acceptable salt of LMI070, or the small molecule drug for regulating alternative splicing is Risdiplam, a derivative having the same binding site as Risdiplam on the alternative splicing regulatory element, or a pharmaceutically acceptable salt of Risdiplam; Preferably, the indications that the gene therapy drug can treat include ischemic heart disease, cardiomyopathy, muscular dystrophy, neuromuscular disease, progeria, retinitis pigmentosa, congenital amaurosis, age-related macular degeneration, spinal muscular atrophy or hemophilia.

38. A probe targeting the junction between the pseudo exon and the second exon in the transcript of claim 23 in the presence of an alternative splicing regulating small molecule drug.

39. The probe according to claim 38, wherein The probe contains a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in SEQ ID NO:

16.

40. A method for detecting the alternative splicing regulatory element according to any one of claims 1 to 9, one or more nucleic acid molecules according to any one of claims 10 to 21, nucleic acid molecules obtained by the construction method according to claim 22, transcripts according to claim 23, one or more vectors according to any one of claims 24 to 27, one or more recombinant viruses according to any one of claims 28 to 30, one or more cells according to any one of claims 31 to 33, or one or more pharmaceutical compositions according to claim 34, wherein: The method comprises a qPCR amplification step, in which the probe according to claim 38 or 39 is used.

41. The method of claim 40, wherein: The upstream primer used in the qPCR amplification step is selected from SEQ ID NO:

17.

42. The method according to claim 40, further comprising a RT-PCR amplification step before the qPCR amplification step, preferably, the upstream primer used in the RT-PCR amplification step is selected from SEQ ID NO: 18.

Images