Inner beauty health food composition for protecting against / repairing skin damage and regenerating skin, and method for improving skin condition using same

Abstract

The present invention relates to: an inner beauty health food composition for protecting against / repairing skin damage and regenerating skin; and a method for improving skin condition using same. The inner beauty health food composition comprises a processed Haematococcus pluvialis product, a processed Aloe vera product, a processed red grape product, a processed ginger product, and a processed star anise product, which are known to have antioxidant efficacy, skin protection and skin regeneration efficacy, and arginine and glutamic acid, which are known to have skin structure restoration and cell proliferation and growth efficacy, as active ingredients, and thus has antioxidant efficacy, protects against and repairs skin damage caused by UV rays, and has skin regeneration efficacy.

Description

Inner beauty health food composition for skin damage prevention, repair, and skin regeneration, and method for improving skin condition using the same

[0001] The present invention relates to an inner beauty health food composition for skin damage prevention / repair and skin regeneration, which comprises as active ingredients a processed product of Haematococcus pluvialis, a processed product of aloe vera, a processed product of red grapes, a processed product of ginger and a processed product of star anise known to have antioxidant, skin defense and skin regeneration effects, and arginine and glutamic acid known to have skin structure recovery and cell proliferation / growth effects, and which has antioxidant, UV-ray-induced skin damage prevention / repair and skin regeneration effects, and a method for improving skin condition using the same.

[0002] The skin plays a vital role in protecting the body, regulating and conserving moisture and temperature, and maintaining homeostasis. Skin aging occurs as a result of complex biological processes, including a decline in the regenerative capacity of skin cells. It can be categorized into intrinsic aging, which occurs naturally over time, and extrinsic aging, which occurs due to exposure to UV rays.

[0003] Intrinsic aging is known to be caused by factors such as immune suppression, epidermal aging imbalances, hormonal changes, aging, stress, or an individual's genetic makeup. This type of intrinsic aging is characterized by decreased elasticity due to a decrease in cell number, fine wrinkles due to structural changes in the stratum corneum caused by moisture loss, and a decrease in the subcutaneous fat layer. Its impact on the skin is relatively minor.

[0004] On the other hand, extrinsic aging is known to be caused by oxidative stress due to UV rays or external substances. In particular, reactive oxygen species (ROS) generated by UV rays activate various transcription factors, increasing the production of cytokines related to inflammation and enzymes that degrade matrix proteins such as collagen and elastin in the dermis, or inhibiting enzymes that synthesize them. These reactive oxygen species reduce matrix proteins that maintain skin tension, strength, and elasticity, and play a role in protecting the skin, resulting in coarse and deep wrinkles, dry skin, and decreased elasticity. More than 80% of this extrinsic aging is caused by photoaging, which has detrimental effects on the skin, including wrinkle formation, dry skin, pigmentation, and peripheral vasodilation, caused by medium-wave ultraviolet B (UVB) rays.

[0005] In this regard, much research and development is being conducted on antioxidants that inhibit oxidation caused by free radicals. Antioxidants are widely distributed throughout the animal and plant kingdoms, and many physiologically active ingredients, such as tocopherol, vitamin C, and selenium, are known to be found in fruits and vegetables. By inhibiting oxidation caused by free radicals, these antioxidants can protect the skin by preventing damage to matrix proteins that play a protective role in the skin.

[0006] When skin ages due to factors like UV rays and stress, or is damaged by injury, its function weakens, triggering the skin regeneration process. This process begins with an acute inflammatory response, followed by the proliferation and migration of epidermal cells, the formation of new blood vessels, collagen synthesis, and the contraction of connective tissue. The migration and proliferation of keratinocytes and dermal fibroblasts, which account for over 90% of the epidermis, not only facilitate wound healing and skin regeneration, but also induce collagen synthesis, playing a crucial role in enhancing skin elasticity and basement membrane formation.

[0007] However, naturally occurring antioxidants are not expected to be sufficiently effective when applied to the skin. Therefore, synthetic antioxidants, which offer superior antioxidant properties and are inexpensive, are widely used. However, their use is limited due to safety concerns, including potential side effects.

[0008] Therefore, there was a need to develop an inner beauty health food composition made from natural materials that is harmless to the body, has excellent antioxidant properties, and has the effect of protecting and repairing skin damage caused by ultraviolet rays and regenerating the skin.

[0009] The present invention aims to solve the problems of the prior art as described above by providing a composition for inner beauty health food for skin damage prevention / repair and skin regeneration, which is harmless to the body and has excellent antioxidant properties and has the effect of preventing / repairing skin damage caused by ultraviolet rays and regenerating skin, and an inner beauty health food for skin damage prevention / repair and skin regeneration containing the composition.

[0010] In addition, the present invention aims to provide a method for improving skin condition using the aforementioned composition and an inner beauty health food containing the same.

[0011] However, the problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.

[0012] In order to achieve the above-described purpose, the present invention provides a method for improving skin condition, which comprises administering to a subject in need thereof a composition comprising a processed Haematococcus pluvialis product, a processed aloe vera product, a processed red grape product, a processed ginger product, and a processed star anise product as active ingredients, or an inner beauty health food comprising the same.

[0013] In the present invention, with respect to 100 parts by weight of the composition, 1 to 15 parts by weight of the processed Haematococcus pluvialis product, 1 to 15 parts by weight of the processed aloe vera product, 1 to 40 parts by weight of the processed red grape product, 1 to 70 parts by weight of the processed ginger product, and 1 to 70 parts by weight of the processed star anise product may be included.

[0014] In the present invention, the composition may further include amino acids, and the amino acids may be arginine and glutamic acid.

[0015] In the present invention, the composition may contain arginine and glutamic acid in a weight ratio of 1:5 to 5:1.

[0016] In the present invention, the composition and amino acid may be included in a weight ratio of 1:3 to 3:1.

[0017] In the present invention, with respect to 100 parts by weight of the composition, 1 to 5 parts by weight of processed Haematococcus pluvialis, 1 to 5 parts by weight of processed aloe vera, 10 to 20 parts by weight of processed red grape, 10 to 20 parts by weight of processed ginger, 10 to 20 parts by weight of processed star anise, 10 to 40 parts by weight of arginine, and 10 to 40 parts by weight of glutamic acid may be included.

[0018] In the present invention, with respect to 100 parts by weight of the composition, 2 to 3 parts by weight of the processed Haematococcus pluvialis product, 2 to 3 parts by weight of the processed aloe vera product, 12 to 17 parts by weight of the processed red grape product, 12 to 17 parts by weight of the processed ginger product, 12 to 17 parts by weight of the processed star anise product, 35 to 40 parts by weight of the arginine, and 10 to 15 parts by weight of the glutamic acid may be included.

[0019] In the present invention, the composition may further include collagen powder.

[0020] In the present invention, the five types of processed materials may be included in an amount of 0.0001 wt% to 99.0 wt% relative to the total weight of the composition.

[0021] In the present invention, the improvement in skin condition may be one or more of the effects of protecting against or repairing skin damage, regenerating skin, inhibiting or improving skin aging, improving skin wrinkles, improving skin elasticity, improving skin moisturizing, and strengthening the skin barrier.

[0022] In the present invention, the composition may exhibit one or more of the following activities: i) to iv):

[0023] i) Increased expression of collagen-1 and hyaluronic acid synthase (HAS) genes;

[0024] ii) Decreased expression of the hyaluronidase (HYAL) gene;

[0025] iii) decreased expression of matrix metalloproteinase-1 (MMP-1) and matrix metalloproteinase-2 (MMP-2) genes; and

[0026] iv) Increased expression of filaggrin, loricrin, and involucrin genes.

[0027] In the present invention, the health food may have a formulation selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, infused teas, gums, candies, and health drinks.

[0028] The present invention also provides an inner beauty health food composition for skin damage prevention / repair and skin regeneration comprising a processed product of Haematococcus pluvialis, a processed product of aloe vera, a processed product of red grapes, a processed product of ginger and a processed product of star anise as effective ingredients, and an inner beauty health food composition for skin damage prevention / repair and skin regeneration comprising the same.

[0029] According to one embodiment of the present invention, an inner beauty health food composition for skin damage prevention / repair and skin regeneration can be provided, which comprises as active ingredients a processed product of Haematococcus pluvialis, a processed product of aloe vera, a processed product of red grapes, a processed product of ginger, and a processed product of star anise, which are known to have antioxidant, skin defense, and skin regeneration effects.

[0030] According to one embodiment of the present invention, an inner beauty health food composition for skin damage prevention / repair and skin regeneration can be provided, which comprises a processed Haematococcus pluvialis product, a processed Aloe vera product, a processed Red Grape product, a processed Ginger product, and a processed Star Anise product, and an amino acid as active ingredients, which are known to have antioxidant, skin defense, and skin regeneration effects.

[0031] According to one embodiment of the present invention, an inner beauty health food for skin damage prevention / repair and skin regeneration can be provided that includes the inner beauty health food composition for skin damage prevention / repair and skin regeneration, thereby providing an inner beauty health food for skin damage prevention / repair and skin regeneration that is harmless to a living body and has excellent antioxidant effects, and has effects for prevention / repair and skin regeneration of skin damage caused by ultraviolet rays.

[0032] Figure 1 shows the toxicity of an inner beauty health food composition for skin damage prevention / repair and skin regeneration according to one embodiment of the present invention to skin keratinocytes.

[0033] Figure 2 shows the protective effect of an inner beauty health food composition for skin damage prevention / repair and skin regeneration according to one embodiment of the present invention against ultraviolet ray-induced skin keratinocyte death.

[0034] Figure 3 shows the effect of an inner beauty health food composition for skin damage prevention / repair and skin regeneration according to one embodiment of the present invention on the expression of a moisturizing factor-related biomarker.

[0035] Figure 4 shows the effect of an inner beauty health food composition for skin damage prevention / repair and skin regeneration according to one embodiment of the present invention on the expression of a biomarker related to substrate-decomposing enzymes.

[0036] FIG. 5 shows the effect of an inner beauty health food composition for skin damage prevention / repair and skin regeneration according to one embodiment of the present invention on the expression of a skin barrier-related biomarker.

[0037] In this specification, when a part is said to "include" a certain component, this does not mean that it excludes other components, but rather that it may include other components, unless otherwise specifically stated.

[0038] In this specification, “A and / or B” means “A and B, or A or B.”

[0039] In this specification, “antioxidant” refers to inhibiting oxidation of cells by highly reactive free radicals or reactive oxygen species (ROS) due to oxidative stress caused by intracellular metabolism or ultraviolet rays, and includes reducing damage to cells caused by removing free radicals or reactive oxygen species.

[0040] In this specification, “skin regeneration” may encompass the phenomenon of restoring homeostasis through the formation, differentiation, and shedding of skin cells, as well as the phenomena and processes at each stage.

[0041] Hereinafter, the present invention will be described in more detail.

[0042] The first aspect of the present invention relates to a method for improving skin condition, which comprises administering to a subject in need thereof a composition comprising a processed Haematococcus pluvialis product, a processed aloe vera product, a processed red grape product, a processed ginger product, and a processed star anise product as active ingredients, or an inner beauty health food comprising the same.

[0043] In this specification, "processed material" means any material obtained by physically and / or chemically treating a raw material. By applying conventional processing methods such as chopping, crushing, pulverizing, powdering, pressing, concentrating, fermenting, and extracting alone or in appropriate combination with other methods such as filtration, concentration, and drying, the chopping, crushing, pulverizing, powdering, pressing, concentrating, fermenting, and extracting used as the processed material of the present invention can be produced.

[0044] The composition according to one embodiment of the present invention or an inner beauty health food containing the same is derived from a natural material and is harmless to the body and has an excellent antioxidant effect, thereby preventing damage to the matrix protein that plays a role in protecting the skin from ultraviolet rays, and protecting against damage to skin cells or repairing and regenerating them, thereby increasing the gene expression of moisturizing factors and skin barrier factors of the skin, thereby maintaining the tension, strength, and elasticity of the skin.

[0045] Haematococcus pluvialis is a unicellular green freshwater algae that can be found in Arctic snowfields, oceans, lakes, and other microalgae. According to one embodiment of the present invention, the processed Haematococcus pluvialis product may be prepared in the form of a powder formulation comprising astaxanthin and an extract dried and powdered. Astaxanthin is known to have antioxidant and skin protective properties.

[0046] In this specification, the term "extract" includes the extract itself and all formulations that can be formed using the extract, such as an extract obtained by extraction treatment of a raw material, a diluted or concentrated extract, a dried product obtained by drying the extract, a conditioned or purified product of the extract, or a mixture thereof.

[0047] In the present invention, the extract can be extracted from a natural, hybrid or variant plant used as a raw material, and can also be extracted from a plant tissue culture.

[0048] In this specification, the term "extraction" may mean taking something out of the whole.

[0049] In the present invention, the extract can be prepared using hexane, chloroform, methylene chloride, ethyl acetate, acetone, a lower alcohol of C1 to C4, water or a mixed solvent thereof as an extraction solvent, and preferably, it can be prepared using a lower alcohol of C1 to C4, water or a mixed solvent thereof as an extraction solvent, but is not limited thereto.

[0050] The extraction method for obtaining the above extract can be prepared according to a commonly known physical, chemical or enzymatic extraction method used in the technical field to which the present invention belongs. Specifically, a commonly used extraction method such as a cold immersion method, a heating extraction method, an ultrasonic extraction method, a filtration method, a pressurized extraction method, a reflux extraction method, a supercritical extraction method, an electric extraction method, a steam distillation method, an organic solvent extraction method, a hot water extraction method, etc. can be used alone or in combination of two or more methods, and a common extraction device, an ultrasonic grinding extractor or a fractionator can be used.

[0051] In the present invention, the extract can be manufactured by supercritically extracting the raw material at least once using a supercritical fluid (e.g., carbon dioxide, pentane, etc.), and can be manufactured as a dried extract obtained by concentrating the supercritical extract under reduced pressure and then freeze-drying or spray-drying it.

[0052] Aloe vera is a succulent plant species of the genus Aloe, and is an evergreen perennial plant. Although it originated in the Arabian Peninsula, it can grow wild in tropical, subtropical, and arid climates around the world. The aloe vera processed product according to one embodiment of the present invention may be a powder formulation obtained by freeze-drying aloe vera gel, containing aloe sterol. The aloe sterol is known to have antioxidant and skin regeneration effects.

[0053] Grape is a general term for plants of the genus Grape or its fruit. It is a deciduous vine of the Grape family and its varieties include grape (V. vinifera), American grape (V. labrusca), and hybrids. Grape (V. vinifera) has been differentiated into cultivated types such as Southern European, Central Asian, and East Asian depending on the propagation process, and a total of 150,000 varieties have been created to date. The red grape processed product according to one embodiment of the present invention may be manufactured by pressing and concentrating red grapes, mixing them with dextrin and gum arabic, spray drying, and filtering, and may contain resveratrol and be in powder form. Resveratrol is known to have antioxidant, skin defense, and skin regeneration effects.

[0054] Ginger (Zingiber officinale) is a perennial herb belonging to the Zingiberaceae family and Zingiberaceae order, a monocotyledonous plant. It is also called saengang or saeyang and is native to Southeast Asia. The processed ginger product according to one embodiment of the present invention may be in powder form and include 10-Shogaol, a substance converted from gingerol in dried ginger. 10-Shogaol is known to have antioxidant, skin protective, and skin regenerative effects.

[0055] Star anise (Illicium verum) is an evergreen plant belonging to the Schisandra chinensis family native to China. The dried fruit is also called star anise or star anise fragrant in China and Korea and is mainly used as a spice. It grows wild in the border region of Guangxi Zhuang Autonomous Region in southern China and northern Vietnam, and is widely cultivated in southern China, southern India, and Indochina. The star anise processed product according to one embodiment of the present invention contains shikimic acid and may be in powder form. The shikimic acid is known to have antioxidant and skin regeneration effects.

[0056] According to one embodiment of the present invention, the Haematococcus pluvialis processed product, the aloe vera processed product, the red grape processed product, the ginger processed product, and the star anise processed product may be obtained by separately processing according to the characteristics of each raw material. For example, the Haematococcus pluvialis processed product may be manufactured by supercritical extraction of Haematococcus pluvialis, drying and powdering the extract, the aloe vera processed product may be manufactured by freeze-drying aloe vera gel and then powdering it, the red grape processed product may be manufactured by pressing and concentrating red grapes and then powdering it, the ginger processed product may be manufactured by powdering dried ginger, and the star anise processed product may be manufactured by powdering dried star anise fruit, but is not limited thereto. When manufacturing a composite by mixing the above five types of processed materials obtained through separate manufacturing processes, not only can the efficacy of the raw materials be maintained, but the efficacy can also be enhanced compared to manufacturing a processed material after mixing the raw materials.

[0057] In the present invention, the processed product may be obtained from at least one selected from the group consisting of the whole plant, root, stem, branch, leaf, seed and fruit of Haematococcus pluvialis, aloe vera, red grape, ginger or star anise. Specifically, the processed product may be derived from all or part of Haematococcus pluvialis, aloe vera, red grape, ginger or star anise, and may be a ground product obtained by grinding each of these; a chopped product obtained by grinding; a pressed product obtained by pressing; a concentrated concentrate obtained by drying the whole or part of Haematococcus pluvialis, aloe vera, red grape, ginger or star anise, the ground product or the chopped product; an extract obtained by extracting a specific component with a solvent from all or part of Haematococcus pluvialis, aloe vera, red grape, ginger or star anise; or a concentrate obtained by concentrating the extract.

[0058] According to one embodiment of the present invention, the composition may include 1 to 70 parts by weight of the processed ginger and 1 to 70 parts by weight of the processed star anise, based on 100 parts by weight of the composition. Specifically, the processed ginger may be included in an amount of 5 to 65 parts by weight, 10 to 60 parts by weight, 10 to 55 parts by weight, 10 to 50 parts by weight, 10 to 45 parts by weight, 10 to 40 parts by weight, 10 to 35 parts by weight, 10 to 30 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 11 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight, or 14 to 15 parts by weight, based on 100 parts by weight of the composition. Furthermore, the star anise processed product may be included in an amount of 5 to 65 parts by weight, 10 to 60 parts by weight, 10 to 55 parts by weight, 10 to 50 parts by weight, 10 to 45 parts by weight, 10 to 40 parts by weight, 10 to 35 parts by weight, 10 to 30 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 11 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight, or 14 to 15 parts by weight, based on 100 parts by weight of the composition. By including the ginger processed product and the star anise processed product in an amount within the above numerical range, it is possible to exhibit antioxidant activity, protection / repair of skin damage caused by ultraviolet rays and skin regeneration, inhibition or improvement of skin aging, improvement of skin wrinkles, improvement of skin elasticity, improvement of skin moisturizing, and strengthening of the skin barrier.

[0059] According to one embodiment of the present invention, the composition may include 1 to 15 parts by weight of the processed Haematococcus pluvialis product, 1 to 15 parts by weight of the processed Aloe vera product, 1 to 40 parts by weight of the processed Red Grape product, 1 to 70 parts by weight of the processed Ginger product, and 1 to 70 parts by weight of the processed Star Anise product, with respect to 100 parts by weight of the composition. Specifically, the processed Haematococcus pluvialis product may be included in an amount of 1 to 14 parts by weight, 1 to 12 parts by weight, 1 to 10 parts by weight, 1 to 8 parts by weight, 1 to 6 parts by weight, 1 to 4 parts by weight, 2 to 4 parts by weight, or 2 to 3 parts by weight, with respect to 100 parts by weight of the composition. Furthermore, the aloe vera processed product may be included in an amount of 1 to 14 parts by weight, 1 to 12 parts by weight, 1 to 10 parts by weight, 1 to 8 parts by weight, 1 to 6 parts by weight, 1 to 4 parts by weight, 2 to 4 parts by weight, or 2 to 3 parts by weight, based on 100 parts by weight of the composition. In addition, the red grape processed product may be included in an amount of 5 to 35 parts by weight, 10 to 30 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 11 to 19 parts by weight, 12 to 18 parts by weight, 13 to 17 parts by weight, or 14 to 16 parts by weight. In addition, the ginger processed product may be included in an amount of 5 to 65 parts by weight, 10 to 60 parts by weight, 10 to 55 parts by weight, 10 to 50 parts by weight, 10 to 45 parts by weight, 10 to 40 parts by weight, 10 to 35 parts by weight, 10 to 30 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 11 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight, or 14 to 15 parts by weight, based on 100 parts by weight of the composition.Furthermore, the star anise processed product may be included in an amount of 5 to 65 parts by weight, 10 to 60 parts by weight, 10 to 55 parts by weight, 10 to 50 parts by weight, 10 to 45 parts by weight, 10 to 40 parts by weight, 10 to 35 parts by weight, 10 to 30 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 11 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight, or 14 to 15 parts by weight, based on 100 parts by weight of the composition. By including the processed product in an amount within the above numerical range, the composition according to the present invention can exhibit excellent antioxidant effects, effects of protecting and repairing skin damage caused by ultraviolet rays and regenerating skin, inhibiting or improving skin aging, improving skin wrinkles, improving skin elasticity, improving skin moisturizing, and strengthening skin barrier.

[0060] According to one embodiment of the present invention, the composition further comprises amino acids, and the amino acids may be arginine and glutamic acid, more preferably L-arginine and L-glutamic acid. By further comprising arginine and glutamic acid, the antioxidant activity and skin defense effect of the composition are enhanced, so that the composition can defend and repair skin damage caused by ultraviolet rays and exhibit excellent skin regeneration effects, and can exhibit effects of inhibiting or improving skin aging, improving skin wrinkles, improving skin elasticity, improving skin moisturizing, and strengthening the skin barrier.

[0061] Arginine is an α-amino acid used in protein biosynthesis, and is known to have antioxidant enzyme activity, skin structure repair, and cell proliferation and growth effects.

[0062] Glutamic acid is an α-amino acid used in protein biosynthesis and is known to have the effect of restoring skin structure and promoting cell proliferation and growth.

[0063] According to one embodiment of the present invention, the composition may contain the arginine and glutamic acid in a weight ratio of 1:5 to 5:1, preferably in a weight ratio of 3:1 to 1:3. More preferably, the arginine and glutamic acid may contain the arginine and glutamic acid in a weight ratio of 2.34:1 to 4:1, specifically, in a weight ratio of 2.5:1 to 3.7:1, 2.7:1 to 3.5:1, 2.9:1 to 3.3:1, or 2.9:1 to 3.1:1. By containing the arginine and glutamic acid in the weight ratio, the skin structure repair and cell proliferation / growth efficacy of the composition may be improved.

[0064] According to one embodiment of the present invention, the composition may include a mixture of a processed Haematococcus pluvialis product, a processed Aloe vera product, a processed Red Grape product, a processed Ginger product, and a processed Star Anise product, and an amino acid in a weight ratio of 1:5 to 5:1, specifically, a weight ratio of 1:3 to 3:1. Alternatively, the composition may include a mixture of a processed Haematococcus pluvialis product, a processed Aloe vera product, a processed Red Grape product, a processed Ginger product, and a processed Star Anise product, and an amino acid in a weight ratio of 0.80:1 to 1.20:1, 0.90:1 to 1.10:1, or 0.95:1 to 1.00:1. By including a mixture including the five processed products and an amino acid in the weight ratio, excellent antioxidant and skin structure repair effects can be realized.

[0065] According to one embodiment of the present invention, the composition may include, based on 100 parts by weight of the composition, 1 to 5 parts by weight of a processed Haematococcus pluvialis product, 1 to 5 parts by weight of a processed aloe vera product, 10 to 20 parts by weight of a processed red grape product, 10 to 20 parts by weight of a processed ginger product, 10 to 20 parts by weight of a processed star anise product, 10 to 40 parts by weight of arginine, and 10 to 40 parts by weight of glutamic acid.Specifically, the Haematococcus pluvialis processed product may be included in an amount of 2 to 4 parts by weight or 2 to 3 parts by weight with respect to 100 parts by weight of the composition, the aloe vera processed product may be included in an amount of 2 to 4 parts by weight or 2 to 3 parts by weight with respect to 100 parts by weight of the composition, the red grape processed product may be included in an amount of 11 to 19 parts by weight, 12 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight or 14 to 15 parts by weight with respect to 100 parts by weight of the composition, the ginger processed product may be included in an amount of 11 to 19 parts by weight, 12 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight or 14 to 15 parts by weight with respect to 100 parts by weight of the composition, and the star anise processed product may be included in an amount of 100 parts by weight of the composition, It may be included in 11 to 19 parts by weight, 12 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight, or 14 to 15 parts by weight, and the arginine may be included in 15 to 40 parts by weight, 20 to 40 parts by weight, 25 to 40 parts by weight, 30 to 40 parts by weight, 35 to 40 parts by weight, 36 to 39 parts by weight, or 37 to 38 parts by weight, based on 100 parts by weight of the composition, and the glutamic acid may be included in 10 to 35 parts by weight, 10 to 30 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 10 to 15 parts by weight, 11 to 14 parts by weight, or 12 to 13 parts by weight, based on 100 parts by weight of the composition. By including the above-mentioned processed material, arginine and glutamic acid in the above-mentioned numerical range of contents, the composition has an excellent antioxidant effect and can realize the effects of protecting and repairing skin damage and regenerating skin, inhibiting or improving skin aging, improving skin wrinkles, improving skin elasticity, improving skin moisturizing and strengthening the skin barrier.

[0066] According to a preferred embodiment of the present invention, the composition may include 2.5 parts by weight of a processed Haematococcus pluvialis product, 2.5 parts by weight of a processed aloe vera product, 15 parts by weight of a processed red grape product, 15 parts by weight of a processed ginger product, 15 parts by weight of a processed star anise product, 37.5 parts by weight of arginine, and 12.5 parts by weight of glutamic acid, based on 100 parts by weight of the composition.

[0067] In a specific embodiment of the present invention, in order to confirm the cytotoxic concentration of the three compositions prepared according to the mixing ratios of Examples 1 to 3 as described in Table 7, the three compositions were treated at various concentrations (12.5 μg / ml to 800 μg / ml) to HaCaT cells, which are human keratinocytes, to evaluate cell viability. As a result, as confirmed in Fig. 1, none of the compositions of Examples 1 to 3 were observed to have toxicity toward keratinocytes in the concentration range of 12.5 μg / ml to 800 μg / ml. In Example 3, it was observed that there was almost no cytotoxicity toward keratinocytes, as it showed a cell viability of 90% or more compared to the control group (CON) treated with only distilled water at all concentrations.

[0068] In another specific embodiment of the present invention, in order to confirm the protective effect against skin damage caused by UV irradiation of three types of compositions prepared according to the mixing ratios of Examples 1 to 3 as described in Table 7, human keratinocyte HaCaT cells were pretreated with each of the three types of compositions at various concentrations (12.5 μg / ml to 800 μg / ml), irradiated with UV irradiation, and then cell viability was evaluated. As a result, as confirmed in Fig. 2, it was observed that all of the compositions of Examples 1 to 3 exhibited an effect of inhibiting cell death caused by UV irradiation in a concentration-dependent manner. Therefore, it can be seen that the composition according to the present invention can be safely used on the human body without toxicity.

[0069] Collagen, a major component of the extracellular matrix, is a protein produced in the form of procollagen by fibroblasts and accounts for 85-90% of the dermis. Type I collagen accounts for the majority of skin collagen. Its primary functions include providing mechanical strength to the skin, providing connective tissue resistance and tissue cohesion, supporting cell adhesion, and inducing cell division and differentiation.

[0070] Hyaluronic acid, which exists in the skin, is formed in fibroblasts and keratinocytes and is a component of mucopolysaccharides. It contains a lot of polysaccharides and has the characteristic of being able to contain a significant amount of moisture. It combines with moisture to regulate the skin barrier function and hydrate the extracellular matrix, thereby maintaining moisture homeostasis within the tissue. There are three types of hyaluronic acid synthase (HAS), HAS-1, 2, and 3, and in the initial stage of the synthase, glucuronic acid and N-acetylglucosamine are repeatedly added to polysaccharides to produce hyaluronic acid.

[0071] Hyaluronidase (HYAL) increases with aging, gradually reducing the amount of hyaluronic acid in the dermis.

[0072] Therefore, collagen-1, HAS-1, and HAYL are used as biomarkers to evaluate skin moisturizing functionality through maintenance of skin structure and function.

[0073] Accordingly, in a specific embodiment of the present invention, the skin moisturizing effect according to treatment with the composition of Example 3 of Table 7, which shows the best effect on cell damage caused by ultraviolet rays, was evaluated using collagen-1, HAS-1, and HAYL as indicators. To this end, HaCaT cells, which are keratinocytes, were pretreated with each of the three compositions at various concentrations (100 μg / ml to 400 μg / ml), irradiated with ultraviolet rays, and then the mRNA expression levels of collagen-1, HAS-1, and HAYL were confirmed. As a result, as confirmed in Fig. 3, the gene expression levels of collagen-1 and HAS-1, which are decreased by ultraviolet rays, were significantly improved by pretreatment with the composition of Example 3, and the gene expression level of HYAL, which is increased by ultraviolet rays, was significantly reduced by pretreatment with the composition of Example 3. Therefore, it can be seen that the composition according to the present invention can strengthen the skin barrier and promote skin moisturizing by maintaining the skin structure and function.

[0074] Matrix metalloproteinases (MMPs) are enzymes that play a key role in the skin aging process caused by UV rays. The expression of MMPs is induced by UV irradiation, and MMPs cause the breakdown of collagen and other collagen fibers in skin tissue, leading to skin aging, including wrinkle formation. Among them, MMP-1 is an enzyme that breaks down type 1 collagen, which accounts for more than 90% of the collagen distributed in the human body, as well as types 2 and 3 collagen, and is well known as a target for improving skin aging and wrinkles.

[0075] Accordingly, in a specific embodiment of the present invention, the skin aging and wrinkle improvement effect was evaluated using the composition of Example 3 of Table 7, using MMP-1 and MMP-2 as indicators. As a result, as confirmed in Fig. 4, the MMP-1 and MMP-2 gene expression levels increased by ultraviolet rays were significantly reduced by pretreatment with the composition of Example 3. Therefore, it can be seen that the composition according to the present invention exhibits an effect of improving skin aging and wrinkles caused by photoaging.

[0076] The skin barrier is formed by the complex formation of keratin proteins and filaggrin during the differentiation of keratinocytes, and the side chain bonds of proteins such as loricrin, involucrin, and envoplakin. Weakening or gradual loss of the skin barrier function due to external factors can lead to skin itching, atopic dermatitis, and psoriasis, and these symptoms can be exacerbated in dry environments. Furthermore, damage to proteins that constitute the skin's connective tissue, such as filaggrin and loricrin, can lead to a decrease in skin moisture content.

[0077] Accordingly, in a specific embodiment of the present invention, the skin barrier improvement and skin moisturizing effects were evaluated using the composition of Example 3 of Table 7, using filaggrin, loricrin, and involucrin as indicators. As a result, as confirmed in Fig. 5, the expression levels of filaggrin, loricrin, and involucrin genes, which are reduced by ultraviolet rays, were significantly increased by pretreatment with the composition of Example 3. Therefore, it can be seen that the composition according to the present invention exhibits the effect of improving the skin barrier.

[0078] In summary, the composition according to the present invention exhibits i) the effect of strengthening the skin barrier and improving skin moisturizing by maintaining skin structure and function, ii) the effect of improving skin aging and wrinkles, and iii) the effect of improving skin barrier, and thus can exhibit excellent effects in skin regeneration as well as in protecting against and recovering skin damage.

[0079] In this specification, the term "improving skin condition" may refer to one or more of the effects of protecting against or repairing skin damage, regenerating skin, inhibiting or improving skin aging, improving skin wrinkles, improving skin elasticity, improving skin moisturizing, and strengthening the skin barrier.

[0080] The effect of the composition according to the present invention can be achieved through one or more of the following activities i) to iv):

[0081] i) Increased expression of collagen-1 and hyaluronic acid synthase (HAS) genes;

[0082] ii) Decreased expression of the hyaluronidase (HYAL) gene;

[0083] iii) decreased expression of matrix metalloproteinase-1 (MMP-1) and matrix metalloproteinase-2 (MMP-2) genes; and

[0084] iv) Increased expression of filaggrin, loricrin, and involucrin genes.

[0085] As used herein, the term "skin aging" refers to a general set of tangible and intangible changes that occur in the skin with age, such as thinning of the epidermis, decreases in the number of cells or blood vessels in the dermis, DNA damage repair capacity, cell turnover cycle, wound healing, skin barrier function, moisture retention in the epidermis, sweat secretion, sebum secretion, vitamin D production, physical damage defense, chemical removal capacity, immune response, sensory function, and temperature regulation.

[0086] The composition according to the present invention can be used for improving skin aging caused by exogenous or endogenous factors. The exogenous factors refer to various external factors, such as ultraviolet rays (light), and the endogenous factors, also referred to as chronological factors, mainly refer to factors that occur over time. In other words, the skin aging includes not only premature aging symptoms induced by external stimuli such as ultraviolet rays, pollution, cigarette smoke, and chemicals, but also natural aging phenomena that occur due to a decrease in skin cell proliferation with age, and is a concept that includes wrinkles, loss of elasticity, sagging skin, and dryness. In addition, wrinkles include those caused by changes in internal and external factors that change the components that make up the skin tissue, thereby inducing wrinkles.

[0087] The aforementioned aging may be photoaging. The term "photoaging" refers to a phenomenon caused by external environmental factors, the most common of which is ultraviolet rays. Ultraviolet rays damage biological components, including the activation of proteolytic enzymes, chain cleavage of substrate proteins, and abnormal cross-linking. The repetition of these mechanisms leads to visible skin aging.

[0088] In this specification, the term “strengthening the skin barrier” may mean any action that enhances the function of the skin barrier, which is located at the outermost part of the skin and prevents moisture and nutrient loss.

[0089] In this specification, the term "moisturizing" means all actions that supply moisture to the skin or block the evaporation of moisture to maintain the flexibility of the skin and induce uniform exfoliation of dead skin cells to maintain a smooth surface, and "dry" means a state in which such skin moisturizing is insufficient.

[0090] In this specification, the term "skin moisturizing" includes all of improving or alleviating skin dryness symptoms, preventing the occurrence of skin dryness symptoms, or delaying the occurrence of skin dryness.

[0091] As used herein, the term "wrinkle" refers to a condition in which skin loses elasticity and becomes loose, such as folds. The term "wrinkle prevention or improvement" refers to any action that prevents or improves wrinkles by suppressing the expression of factors associated with wrinkles, increasing skin moisture, or increasing the total amount of collagen.

[0092] According to one embodiment of the present invention, the composition may further comprise collagen powder, preferably low-molecular collagen powder, more preferably low-molecular fish collagen powder. The average molecular weight of the low-molecular collagen may be 800 to 1,200 Da, but is not limited thereto. Specifically, collagen is a structural protein that constitutes the skin, and when the content of collagen in the skin is high and the activity of collagenase is low, the composition has the effect of improving skin wrinkles. By further comprising the collagen powder, the effects of increasing skin elasticity, forming a basement membrane, and improving skin wrinkles can be enhanced.

[0093] According to one embodiment of the present invention, the composition may contain a mixture of the five processed materials in an amount of 0.0001 wt% to 99.0 wt%, specifically, 1 wt% to 80 wt% or 10 wt% to 60 wt%, based on the total weight of the composition. By containing the processed materials in an amount within the above numerical range, it is possible to achieve effects of antioxidant activity, defense / repair of skin damage and skin regeneration, inhibition or improvement of skin aging, improvement of skin wrinkles, improvement of skin elasticity, improvement of skin moisturizing, and strengthening of the skin barrier.

[0094] The health food according to one embodiment of the present invention may be an inner beauty health food.

[0095] In this specification, “inner beauty” may be a general term for edible cosmetics that mean cultivating healthy skin from the inside, and “inner beauty food” may be an example of health food.

[0096] Inner beauty health food according to one embodiment of the present invention can achieve effects of antioxidant, skin damage prevention / repair and skin regeneration, skin aging inhibition or improvement, skin wrinkle improvement, skin elasticity improvement, skin moisturization improvement, and skin barrier strengthening.

[0097] According to one embodiment of the present invention, the inner beauty health food may have a formulation selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, infused teas, gums, candies, and health drinks.

[0098] In this specification, “health food” or “health functional food” may mean a general term for food that is effective in promoting health.

[0099] The above functional health food is the same term as food for special health use (FoSHU), and refers to a food with high medical and healthcare effects that has been processed to efficiently exhibit a bioregulatory function in addition to providing nutrition. Here, "functionality" means regulating nutrients for the structure and function of the human body or obtaining a useful effect for health purposes such as physiological action. The food of the present invention can be manufactured by a method commonly used in the art, and during the manufacturing process, raw materials and ingredients commonly added in the art can be added. In addition, the formulation of the food can also be manufactured without limitation as long as it is a formulation recognized as a food. The health functional food composition of the present invention can be manufactured in various forms of formulations, and unlike general drugs, it has the advantage of not having side effects that may occur with long-term use of drugs because it uses food as a raw material. The health food composition can perform functions related to preventing and improving skin damage caused by active oxygen, etc.

[0100] The above health food or health functional food may contain conventional food additives, and the suitability of the food additives may be determined by the specifications and standards for the relevant item in accordance with the general provisions and general test methods of the Food Additive Code approved by the Ministry of Food and Drug Safety, unless otherwise provided for.

[0101] The items listed in the above food additive code include, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, high-molecular-weight pigment, and guar gum; and mixed preparations such as sodium L-glutamate preparations, alkaline agents for noodles, preservative preparations, and tar color preparations.

[0102] There are no specific restrictions on the types of the above foods. Examples of foods to which the above extract can be added include formulations selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, infused teas, gums, candies, and health drinks, and include all health foods in the conventional sense.

[0103] Specifically, the functional food in tablet form can be manufactured by granulating a mixture of the composition according to the present invention, collagen, excipients, binders, disintegrants, and other additives using a conventional method, then adding a lubricant, etc. and compression molding, or by directly compression molding the mixture. In addition, the functional food in tablet form can contain a maturing agent, etc., if necessary, and can also be coated with an appropriate coating agent, if necessary.

[0104] Among the functional foods in the form of capsules, hard capsules can be manufactured by filling a conventional hard capsule with a mixture of the composition according to the present invention, collagen, and excipients, or a granular or coated granular substance thereof, and soft capsules can be manufactured by filling a mixture of the composition according to the present invention, collagen, and excipients, and other additives, into a capsule base such as gelatin.

[0105] The above soft capsule may contain a plasticizer such as glycerin or sorbitol, a coloring agent, a preservative, etc., as needed.

[0106] The above-mentioned ring-shaped functional food can be prepared by forming a mixture of the composition according to the present invention, collagen, excipients, binders, disintegrants, etc., by an appropriate method, and, if necessary, can be coated with white sugar or another appropriate coating agent, or can be coated with starch, talc, or an appropriate substance.

[0107] The above granular functional food can be manufactured into a granular form by a suitable method using a mixture of the composition according to the present invention, collagen, excipients, binders, disintegrants, etc., and can contain a flavoring agent, a flavor enhancer, etc., as needed.

[0108] In addition, the definitions of terms for the above excipients, binders, disintegrants, lubricants, maturing agents, flavoring agents, etc. are those described in documents known in the art and may include those having the same or similar functions.

[0109] The above health beverage composition may, like conventional beverages, contain various sweeteners, flavoring agents, or natural carbohydrates as additional ingredients. The sweetener may be a natural sweetener or a synthetic sweetener. The natural sweetener may be thaumatin or a stevia extract, and the synthetic sweetener may be saccharin or aspartame.

[0110] The natural carbohydrate may be a monosaccharide, a disaccharide, a polysaccharide, xylitol, sorbitol, or erythritol. The monosaccharide may be glucose or fructose, and the disaccharide may be maltose or sucrose. The polysaccharide may be dextrin or cyclodextrin. The proportion of the natural carbohydrate may generally be about 0.01 to 10 g, for example, about 0.01 to 0.1 g, per 100 ml of the composition of the present invention.

[0111] The above health food may contain food additives that are food-related and acceptable, and may contain suitable carriers commonly used in the manufacture of health foods.

[0112] In addition to the above, the composition of the present invention may include various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the composition of the present invention may include fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks. These components may be used independently or in combination. The proportion of these additives is not particularly critical, but is typically selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

[0113] The term "subject" as used herein refers to any animal, including humans, that suffers from dry skin, impaired skin barrier function, or aging skin, or that requires skin moisturization, skin barrier strengthening, or skin regeneration. The animal may be, but is not limited to, mammals such as cows, horses, sheep, pigs, goats, camels, antelopes, dogs, and cats that require treatment for similar symptoms, in addition to humans.

[0114] As used herein, the term “administration” means introducing an effective amount of the composition of the present invention or a health food containing the same to a subject by any appropriate method.

[0115] The above health food composition or inner beauty health food containing the same can be administered in an effective amount.

[0116] The above "effective amount" refers to an amount sufficient to achieve the efficacy or activity (e.g., improving skin condition) of the composition or a health food product containing the composition. In the context of the present invention, the effective amount administered to a subject will depend on the subject's characteristics, such as general health, age, sex, and weight. Those skilled in the art can determine an appropriate dosage based on these and other factors.

[0117] The typical daily dosage of the composition according to the present invention or a health food containing the same can be appropriately selected by a person skilled in the art, and can be administered once or in several divided doses.

[0118] The composition of the present invention or a health food containing it may be administered daily or intermittently, and the number of times per day can be administered once or divided into 2-3 doses. Furthermore, the composition of the present invention or a health food containing it may be used alone to improve skin condition, or in combination with other effective ingredients known to exhibit skin condition-improving effects. Taking all of the above factors into consideration, it is important to administer an amount that achieves maximum effect with the minimum amount possible without adverse effects, and this can be readily determined by those skilled in the art.

[0119] The second aspect of the present invention relates to a composition comprising a processed Haematococcus pluvialis product, a processed aloe vera product, a processed red grape product, a processed ginger product, and a processed star anise product as an active ingredient, or an inner beauty health food comprising the same.

[0120] The composition containing the above five processed materials and the description of the composition and effects of the inner beauty health food containing the same are the same as described above, so their description is omitted.

[0121] In addition, since the description of the components that may be additionally included in the composition is the same as described above, the description thereof is omitted.

[0122] Hereinafter, preferred examples are presented to aid understanding of the present invention. However, the following examples are provided solely to facilitate understanding of the present invention and are not intended to limit the scope of the present invention.

[0123] [Manufacturing Example 1]

[0124] 1-1. Analysis of the components of each processed product and selection of mixing ratio

[0125] In order to manufacture an inner beauty health food composition for skin damage prevention and recovery and skin regeneration containing Haematococcus pluvialis processed product, aloe vera processed product, red grape processed product, ginger processed product and star anise processed product as effective ingredients, the components of each processed product were analyzed and a possible mixing ratio was derived.

[0126] In this specification, “mixing ratio” may mean “weight ratio” and may be expressed so that the sum is 1.

[0127] Specifically, the Haematococcus pluvialis product was manufactured by supercritical extraction of Haematococcus pluvialis, followed by drying and powdering the extract; the aloe vera product was manufactured by freeze-drying aloe vera gel and then powdering it; the red grape product was manufactured by pressing and concentrating red grapes and then powdering them; the ginger product was manufactured by powdering dried ginger; and finally, the star anise product was manufactured by powdering dried star anise fruits.

[0128] 1-2. Confirmation of total polyphenol content and total flavonoid content of 5 types of processed products

[0129] The total polyphenol content (TPC) and total flavonoid content (TFC) of Haematococcus pluvialis processed product, aloe vera processed product, red grape processed product, ginger processed product, and star anise processed product were purchased as samples.

[0130] The total polyphenol content was measured using the Folin-Denis method. After preparing gallic acid and each sample, 0.01 mL of the sample was mixed with 0.79 mL of 3-DW, 0.15 mL of 20% sodium carbonate solution, and mixed. 0.05 mL of 0.9 N Folin-ciocalteu was added, and the mixture was incubated at room temperature in the dark for 30 minutes. 200 μL was dispensed into a microplate, and the absorbance was measured at 750 nm using a microplate reader (INNO-M, LTek, Korea). The average absorbance and mg / mL concentration of each gallic acid were plotted graphically to form a standard curve, and the total polyphenol content of each sample was calculated. The results are shown in Table 1 below.

[0131] The processed Haematococcus pluvialis, processed aloe vera, and processed red grape were dissolved and used at a concentration of 100 mg / mL, and the processed ginger and processed star anise were dissolved and used at a concentration of 50 mg / mL.

[0132] After preparing catechin and each processed product sample, 50 μL of each sample was dispensed into a microplate, 30 μL of 5% NaNO2 was dispensed, mixed, and reacted in a dark room for 5 minutes. 60 μL of 2% AlCl3 was additionally dispensed, mixed, and reacted in a dark room for 6 minutes. 100 μL of 4% NaOH was added, mixed, and reacted in a dark room for 11 minutes. After the reaction was completed, the absorbance was measured at 510 nm using a microplate reader (INNO-M, LTek, Korea). The average absorbance and mg / mL concentration of each catechin were plotted graphically to draw a standard curve, and the total flavonoid content of each sample was calculated, and the results are shown in Table 1 below.

[0133] The processed Haematococcus pluvialis, processed aloe vera, and processed red grape were dissolved and used at a concentration of 100 mg / mL, and the processed ginger and processed star anise were dissolved and used at a concentration of 10 mg / mL.

[0134] Total polyphenol content (mg GAE / g) Total flavonoid content (mg CE / g) Haematococcus pluvialis processed product 1.63 ± 0.10 1.12 ± 0.004 Aloe vera processed product 0 ± 00 ± 0 Red grape processed product 1.59 ± 0.38 0.34 ± 0.003 Ginger processed product 18.77 ± 0.47 7.64 ± 0.21 Star anise processed product 30.06 ± 0.10 17.18 ± 0.72

[0135] As shown in Table 1 above, the total polyphenol content and total flavonoid content of processed ginger and star anise were confirmed to be higher than those of other processed products. From these results, it can be expected that processed ginger and star anise will have a greater effect on antioxidant activity than other processed products.

[0136] [Manufacturing Example 2]

[0137] Selection of mixing ratio of 5 types of processed materials

[0138] The optimal mixing ratio of processed Haematococcus pluvialis, processed Aloe vera, processed red grape, processed ginger, and processed star anise was designed. Specifically, the appropriate mixing ratio of the above five types of processed products was designed using Response Surface Methodology (RSM). Response Surface Methodology is a type of statistical analysis method that predicts the result value at the level of a random variable belonging to the entire region of interest and optimizes the level of the variable to obtain the desired result value. In order to set the condition with the maximum antioxidant effect as the optimal condition, the independent variables for utilizing RSM were set as processed Haematococcus pluvialis, processed Aloe vera, processed red grape, processed ginger, and processed star anise.

[0139] Among the 36 mixing ratios obtained through response surface analysis, 6 mixing ratios including all 5 types of processed products and 1 mixing ratio in which the mixing ratios of the 5 types of processed products were appropriately adjusted to contain processed ginger and processed star anise in a certain ratio are shown in Table 2 below. Among these, 3 mixing ratios expected to have the best antioxidant effect were selected and shown in Table 3 below.

[0140] Haematococcus pluvialis processed product, Aloe vera processed product, Red grape processed product, Ginger processed product, Star anise processed product 10.60.10.10.10.120.10.60.10.10.130.10.10.60.10.140.10.10.10.60.150.10.10.10.10.660.20.20.20.270.050.050.30.30.3

[0141] Haematococcus pluvialis processed product, aloe vera processed product, red grape processed product, ginger processed product, star anise processed product 40.10.10.10.60.150.10.10.10.10.670.050.050.30.30.3

[0142] In order to select the optimal mixing ratio among the three mixing ratios in Table 3, the electron donating ability by ABTS was measured. Specifically, ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) radical scavenging activity is a method that measures the degree to which a blue-green ABTS solution changes to colorless when the cationic radical generated by the reaction between ABTS and potassium persulfate is scavenged by the antioxidant.

[0143] ABTS reagent was prepared by diluting 7 mM ABTS (2,2'-Azino-bis(3-etl1ylbenzothiazaline-6-sulfonic acid) Diammonium salt) and 2.45 mM potassium persulfate solution in a 1:1 ratio and storing in a dark room for 24 hours before use. The sample was dissolved in DW at a concentration of 1 mg / mL and used. 10 μL of the sample was dispensed into a 96-well plate, followed by 200 μL of ABTS reagent and mixing. After reacting for 30 minutes in a dark room, the absorbance of the reaction solution was measured at 414 nm. Ascorbic acid was used as the control, and the ABTS radical scavenging activity was expressed as ascorbic acid equivalent (AAE) by converting the difference in absorbance between the reaction solution and the control into a percentage, and the standard deviation (SD) is also shown in Table 4 below.

[0144] mg AAE / gSD422.371.14520.830.10730.792.52

[0145] To select the optimal mixing ratio among the three mixing ratios in Table 3, the electron donating ability was measured by FRAP.

[0146] Specifically, ferric reducing / antioxidant power (FRAP) activity (reducing power) is the reduction of ferric cations (Fe) by antioxidants at low pH. 3+ ) is a divalent iron cation (Fe2+ ) is a method for measuring the sulfur oxidation activity of a sample by using the characteristic of being reduced to .

[0147] The FRAP reagent was used in a 10:1:1 dilution of 10 mM TPTZ and 20 mM iron(III) chloride hexahydrate (FeCl36H2O) dissolved in 300 mM acetate buffer (pH 3.6) and 40 mM HCl, and the sample was used by dissolving it in DMSO at a concentration of 1 mg / mL. After dispensing 10 μL of each sample into a microplate, dispensing 200 μL of the FRAP reagent and mixing, the reaction was carried out in a 37 ℃ incubator for 5 minutes, and the absorbance was measured at 593 nm using a microplate reader (INNO-M, LTek, Korea). Ascorbic acid was used as the control group, and the average absorbance and μg / mL concentration of ascorbic acid were plotted graphically to create a standard curve. The difference in absorbance between the non-added and added sample groups was expressed as mg ascorbic acid (AAE) per 1 g of sample, as shown in Table 5 below.

[0148] mg AAE / gSD415.230.90519.310.10734.501.30

[0149] As shown in Tables 4 and 5 above, it was confirmed that the blending ratio 7 had a superior antioxidant activity effect compared to blending ratios 4 and 5.

[0150] In particular, it was confirmed that in the case of mixing ratio 7, the total content of processed ginger and processed star anise was low, but it exhibited antioxidant activity similar to or superior to that of mixing ratios 4 and 5.

[0151] [Manufacturing Example 3]

[0152] Selection of the mixing ratio of two types of amino acids and mixing with five types of processed products

[0153] To manufacture an inner beauty composition for skin damage prevention, recovery, and skin regeneration, which includes two types of amino acids, arginine and glutamic acid, in addition to a composition containing five types of processed materials in a seven-part mixing ratio, the mixing ratio of the two types of amino acids was selected. Specifically, the appropriate mixing ratio of the two amino acids was designed using response surface methodology (RSM). In order to set the conditions for maximizing skin damage prevention, recovery, and skin regeneration effects as the optimal conditions, the independent variables for utilizing response surface methodology were set to arginine and glutamic acid.

[0154] The specific mixing ratio is shown in Table 6 below.

[0155] Arginine glutamic acid 10.25 0.75 20.50 530.75 0.25

[0156] The mixing ratio of a composition containing five types of processed materials in a mixing ratio of 7 and an inner beauty health food composition for skin damage prevention / recovery and skin regeneration containing two types of amino acids mixed in a 1:1 ratio are shown in Table 7 below.

[0157] Haematococcus pluvialis processed product Aloe vera processed product Red grape processed product Ginger processed product Star anise processed product Arginine glutamic acid Example 10.0250.0250.150.150.150.1250.375 Example 20.0250.0250.150.150.150.250.25 Example 30.0250.0250.150.150.150.3750.125

[0158] [Example 1]

[0159] An inner beauty health food composition for skin damage prevention and recovery and skin regeneration was manufactured by mixing Haematococcus pluvialis processed product, aloe vera processed product, red grape processed product, ginger processed product, star anise processed product, arginine and glutamic acid in a mixing ratio of 0.025:0.025:0.15:0.15:0.15:0.125:0.375.

[0160] [Example 2]

[0161] An inner beauty health food composition for skin damage prevention / repair and skin regeneration was manufactured in the same manner as in Example 1, except that the mixing ratio was changed to 0.025:0.025:0.15:0.15:0.15:0.25:0.25.

[0162] [Example 3]

[0163] An inner beauty health food composition for skin damage prevention / repair and skin regeneration was manufactured in the same manner as in Example 1, except that the mixing ratio was changed to 0.025:0.025:0.15:0.15:0.15:0.375:0.125.

[0164] [Experimental Example 1]

[0165] 1-1. Materials

[0166] Human epithelial keratinocyte HaCaT cells used in this experiment were obtained from Amorepacific. Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), penicillin-streptomycin (PS), and phosphate-buffered saline (PBS) for cell culture were purchased from WelGENE (Daegu, South Korea). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Mazime RT PreMix Kit was purchased from Gene-All Biotechnology Co. Ltd. (Seoul, Korea). Trizol and SYBR Green Master primer were purchased from Thermo Fisher Scientific (USA).

[0167] 1-2. Cytotoxicity evaluation

[0168] The cytotoxicity of the inner beauty health food composition for skin damage prevention / repair and skin regeneration manufactured in the examples and its effect on cell survival rate after UV irradiation were measured. Specifically, the MTT assay was performed to confirm the cytotoxicity of the composition. The MTT assay is one of the experiments to confirm cell viability, and it is an experimental method to measure the activity of intracellular mitochondria using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), a type of tetrazolium salt.

[0169] In this specification, “NOR” may mean a sample treated with distilled water without irradiating with ultraviolet rays, and “CON” may mean a sample treated with distilled water and irradiated with ultraviolet rays.

[0170] HaCaT cells were cultured in DMEM medium containing 10% FBS and 1% PS, and when the cell density reached 70%, the cells were maintained by subculturing. Afterwards, 1.5 x 10 HaCaT cells were cultured. 4 ~ 1.0 x 10 5 After dispensing into 96-well plates at a density of 10 cells / well, the cells were cultured for 24 hours, and the samples were treated at different concentrations. Then, the cells were cultured for another 24 hours to ensure sufficient reaction. After 24 hours, the medium was replaced with serum-free medium containing MTT reagent (0.5 mg / mL) and incubated at 37°C for 1 hour. After removing the medium, DMSO was dispensed into each well, and the MTT formazan was dissolved. The absorbance was measured at 550 nm (Spectra Max M3; Molecular Devices, Sunnyvale, CA, USA).

[0171] Figure 1 shows the toxicity of an inner beauty health food composition for skin damage prevention / repair and skin regeneration according to one embodiment of the present invention to skin keratinocytes.

[0172] All of the compositions of Examples 1 to 3 showed no toxicity toward keratinocytes in the concentration range of 12.5 μg / ml to 800 μg / ml. In Example 3, cell viability was observed to be over 90% compared to the control group (CON) treated with only distilled water at all concentrations, indicating that there was almost no cytotoxicity toward keratinocytes.

[0173] [Experimental Example 2]

[0174] Measurement of cell protection effect upon UV irradiation

[0175] The effect of the inner beauty health food composition for skin damage prevention, repair, and skin regeneration prepared in the examples was measured against UV-induced cell death. Specifically, this method measures the cell protection effect of the composition under conditions where UV irradiation kills keratinocytes.

[0176] HaCaT cells were cultured at 1.0 x 10 5 Dispense into 6 wells at a density of 10 cells / well and culture for 24 hours. After that, dissolve the samples of Examples 1 to 3 in the medium according to concentration and exchange the medium while treating. After 2 hours, remove the medium again and exchange it with PBS buffer and incubate for 24 hours at 30 mJ / cm 2 The cells were exposed to UV light for 30 to 35 seconds. Afterwards, the PBS was replaced with the medium containing the sample, and the cells were cultured for 24 hours. After 24 hours, the cells were harvested and RNA was extracted.

[0177] Figure 2 shows the protective effect of an inner beauty health food composition for skin damage prevention / repair and skin regeneration according to one embodiment of the present invention against ultraviolet-induced HaCaT cell death.

[0178] As shown in Fig. 2, the inner beauty health food composition for skin damage prevention / repair and skin regeneration can prevent apoptosis by increasing the survival rate of cells reduced by UV irradiation. Specifically, the cell viability of HaCaT cells in the control group treated with distilled water due to UV irradiation was reduced by approximately 50% compared to the sample treated with distilled water without UV irradiation (NOR), indicating that apoptosis was induced. It can be confirmed that under these UV irradiation conditions, all three samples of the example exhibited an effect of inhibiting UV-induced apoptosis as the concentration increased.

[0179] When compared based on a concentration of 400 ㎍ / ㎖, Example 1 showed a 28.1% increase in cell viability compared to the control group, Example 2 showed a 28.5% increase, and Example 3 showed a 50.9% increase. Among the three mixing ratios of the examples, Example 3 showed the best cell protection effect against ultraviolet rays, and thus the effect on skin damage prevention / recovery and skin regeneration according to the concentration of Example 3 was confirmed.

[0180] [Experimental Example 3]

[0181] Biomarker measurement

[0182] Example 3's inner beauty health food composition for skin damage prevention / repair and skin regeneration at 100 μg / ml, 200 μg / ml and 400 μg / ml was treated to HaCaT cells and biomarkers were measured. Specifically, the effects of the composition on biomarkers related to moisturizing factors (collagen, hyaluronic acid), biomarkers related to matrix metalloproteinase (MMP), and biomarkers related to skin barrier factors (Filaggrin, Loricrin, Involucrin) were analyzed.

[0183] Total RNA was extracted from the harvested cells using TRIzol reagent according to the provided protocol. After quantifying the total RNA, cDNA was synthesized using the Maxime RT PreMix Kit containing reverse transcriptase in 1 μg. The synthesized cDNA was mixed with SYBR Green PCR Master Mix and primers (100 ng / mL) and PCR was performed. PCR was performed on an AriaMX real-time PCR system (Agilent Technology, Santa Clara, CA, USA).

[0184] The primers used in this experiment are shown in Table 8 below.

[0185] Gene sequence number Primer name Primer sequence (5'→3') Length (bp) Accession No. MMP11 MMP1_FATGAAGCAGCCCAGATGTGGAG22 NM_001297436.22 MMP1_RTGGTCCACATCTGCTCTTGGCA22 MMP23983_FTGCTACACGGATACCCCAAG20 NM_00453041055_RGCAGCATCGATATGCTTCACAG22 HAS15 HAS1_FCTGCGATACTGGGTAGCCTTCA22 NM_001523.46 HAS1_RCCAGGAACTTCTGGTTGTACCAG23 HYAL17369 FGGCCAGGGCTTCCTCAAATA20XM_054346414.18446 RCTGTGACAGTGGCTGAGTGT20 FLG9FLG_FGCTGAAGGAACTTCTGGAAAAGG23NM_00201610FLG_RGTTGTGGTCTATATCCAAGTGATC24 COL1a111COL_FGATTCCCTGGACCTAAAGGTGC22NM_00008812COL_RAGCCTTCCCATCTTTGCCAGCA22 Involucrin13IVL_FCTGCCTCAGCCTTACTGTGA20NM_00201614IVL_RGGAGGAACAGTCTTGAGGAG20 Loricrin15LRC_FGCAAACCTCGGGTAGCATCA20NM_00201616LRC_RGCCGTCCAAATAGATCCCCC20

[0186] Figure 3 illustrates the effect of an inner beauty health food composition for skin damage prevention / repair and skin regeneration according to one embodiment of the present invention on the expression of moisturizing factor-related biomarkers. Moisturizing factors may include collagen and hyaluronic acid, and the effect of the inner beauty health food composition for skin damage prevention / repair and skin regeneration on the expression levels of collagen-1, a collagen-related biomarker, HAS-1, a hyaluronic acid-related biomarker, and HYAL, a hyaluronic acid decomposition enzyme-related biomarker can be confirmed.

[0187] In the case of collagen-related biomarkers (Collagen-1) and hyaluronic acid-related biomarkers (HAS-1), the expression levels in the control group decreased by 24.8% and 27.3%, respectively, compared to NOR due to UV irradiation, and it was confirmed that the expression levels increased in a concentration-dependent manner when treated with the inner beauty health food composition for skin damage prevention / repair and skin regeneration. From this, it can be confirmed that the inner beauty health food composition for skin damage prevention / repair and skin regeneration of the example can restore and regenerate collagen and hyaluronic acid that have decreased due to damage to skin cells caused by UV irradiation.

[0188] In the case of hyaluronic acid decomposition enzyme-related biomarker (HYAL), the expression level in the control group increased compared to NOR due to UV irradiation, and it was confirmed that the expression level decreased in a concentration-dependent manner when treated with the inner beauty health food composition for skin damage prevention / repair and skin regeneration. From this, it can be confirmed that the inner beauty health food composition for skin damage prevention / repair and skin regeneration of the example can prevent skin damage by reducing the hyaluronic acid decomposition enzyme increased due to damage to keratinocytes caused by UV irradiation.

[0189] Figure 4 shows the effect of an inner beauty health food composition for skin damage prevention / repair and skin regeneration according to one embodiment of the present invention on the expression of biomarkers related to matrix metalloproteinases. Matrix metalloproteinases (MMPs), one of the main factors regulating the skin's inflammatory response, are known as matrix metalloproteinases that hydrolyze extracellular matrix (ECM) and basement membrane protein components secreted from keratinocytes, fibroblasts, etc., and cause skin aging such as wrinkles. In the control group, the expression levels of MMP-1 and MMP-2, which are biomarkers related to matrix metalloproteinases, significantly increased by 3.2 times and 2.4 times, respectively, due to UV irradiation compared to NOR.

[0190] On the other hand, when the inner beauty health food composition for skin damage prevention / repair and skin regeneration was treated at 100, 200 and 400 ㎍ / ㎖, the expression of MMP-1 decreased by 28.3%, 54.6% and 56.5%, respectively. A similar trend was observed for MMP-2, and when treated at 400 ㎍ / ㎖, the gene expression decreased by 41.8%. As described above, it can be confirmed that the inner beauty health food composition for skin damage prevention / repair and skin regeneration of the example has a regenerative effect on keratinocytes by increasing the mobility and proliferation of keratinocytes, inducing changes in the cell cycle of keratinocytes, and inhibiting the expression of matrix metalloproteinase (MMPs) genes involved in the hydrolysis of proteins such as extracellular matrix associated with skin aging. In addition, it can be seen that the inner beauty health food composition for skin damage prevention / repair and skin regeneration of the embodiment prevents and repairs skin damage by reducing the expression of MMPs that decompose the skin matrix when keratinocytes are damaged due to ultraviolet irradiation.

[0191] Figure 5 illustrates the effect of an inner beauty health food composition for skin damage prevention / repair and skin regeneration according to one embodiment of the present invention on the expression of skin barrier-related biomarkers. Skin barrier-related biomarkers may include filaggrin, loricrin, and involucrin, which are core proteins that constitute the skin barrier, and the effect of the inner beauty health food composition for skin damage prevention / repair and skin regeneration on the gene expression of these biomarkers can be confirmed.

[0192] All three types of skin barrier proteins showed a significant decrease in expression level compared to NOR in the control group when irradiated with UV rays, and when treated with the inner beauty health food composition for skin damage prevention / repair and skin regeneration, the gene expression of the three types of skin barrier proteins increased in a concentration-dependent manner. The gene expression of filaggrin, loricrin, and involucrin increased by 53.3%, 38.5%, and 50.5%, respectively, compared to the control group when treated with 400 ㎍ / ㎖ of the inner beauty health food composition for skin damage prevention / repair and skin regeneration of the example. From this, it can be confirmed that the inner beauty health food composition for skin damage prevention / repair and skin regeneration of the example can repair and regenerate the skin barrier that can be damaged by UV irradiation through the increase in the gene expression of filaggrin, loricrin, and involucrin.

Claims

1. A method for improving skin condition, comprising administering to a subject in need thereof a composition comprising a processed Haematococcus pluvialis product, a processed aloe vera product, a processed red grape product, a processed ginger product, and a processed star anise product as active ingredients, or an inner beauty health food comprising the same.

2. A method for improving skin condition, comprising, with respect to 100 parts by weight of the composition in paragraph 1, 1 to 15 parts by weight of the processed Haematococcus pluvialis product, 1 to 15 parts by weight of the processed aloe vera product, 1 to 40 parts by weight of the processed red grape product, 1 to 70 parts by weight of the processed ginger product, and 1 to 70 parts by weight of the processed star anise product.

3. A method for improving skin condition, further comprising an amino acid in the first paragraph, wherein the amino acid is arginine and glutamic acid.

4. A method for improving skin condition, comprising arginine and glutamic acid in a weight ratio of 1:5 to 5:1 in the third paragraph.

5. A method for improving skin condition, comprising the composition and amino acid in a weight ratio of 1:3 to 3:1 in the third paragraph.

6. A method for improving skin condition in claim 3, comprising, with respect to 100 parts by weight of the composition, 1 to 5 parts by weight of a processed Haematococcus pluvialis product, 1 to 5 parts by weight of a processed aloe vera product, 10 to 20 parts by weight of a processed red grape product, 10 to 20 parts by weight of a processed ginger product, 10 to 20 parts by weight of a processed star anise product, 10 to 40 parts by weight of arginine, and 10 to 40 parts by weight of glutamic acid.

7. A method for improving skin condition, further comprising collagen powder, in claim 1.

8. A method for improving skin condition, comprising the five types of processed materials in an amount of 0.0001 wt% to 99.0 wt% based on the total weight of the composition in the first paragraph.

9. A method for improving skin condition in paragraph 1, wherein the improvement in skin condition is at least one of the effects of protecting against or repairing skin damage, regenerating skin, inhibiting or improving skin aging, improving skin wrinkles, improving skin elasticity, improving skin moisturizing, and strengthening the skin barrier.

10. In the first paragraph, the composition is a method for improving skin condition that exhibits at least one of the following activities: i) to iv): i) Increased expression of collagen-1 and hyaluronic acid synthase (HAS) genes; ii) Decreased expression of the hyaluronidase (HYAL) gene; iii) decreased expression of matrix metalloproteinase-1 (MMP-1) and matrix metalloproteinase-2 (MMP-2) genes; and iv) Increased expression of filaggrin, loricrin, and involucrin genes.

11. A method for improving skin condition in accordance with claim 1, wherein the health food has a formulation selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, infused teas, gums, candies, and health drinks.

12. An inner beauty health food composition for improving skin condition, comprising a processed product of Haematococcus pluvialis, a processed product of aloe vera, a processed product of red grapes, a processed product of ginger, and a processed product of star anise as active ingredients.

13. In the 12th paragraph, the skin condition improvement is an inner beauty health food composition for improving skin condition, which has at least one effect of protecting and repairing skin damage, regenerating skin, inhibiting or improving skin aging, improving skin wrinkles, improving skin elasticity, improving skin moisturizing, and strengthening the skin barrier.

Images