Antioxidant microgels for liver diseases

Abstract

The present invention relates to microgels comprising salen-manganese complexes and their use in the treatment of a liver disease, such as liver failure.

Description

[0001] Antioxidant microgels for liver diseases

[0002] Technical field

[0003] The present disclosure relates to microgels comprising one or more salen-manganese complexes and their use in the treatment of a liver disease, such as liver failure.

[0004] Background

[0005] Chronic liver disease cases impact 1.5 billion people worldwide, with significant increased trends particularly in fatty liver disease, be it from metabolic syndrome or from alcohol in Western countries. As the disease advances, the development of chronic liver failure and repeat hospitalization imparts a huge healthcare cost (>40Bn in the Ell) and societal morbidity, with many succumbing to a severe inflammatory state resulting in multi-organ failure, known as acute-on-chronic liver failure (ACLF).

[0006] Current management for liver failure is entirely supportive, unless a liver transplant can be availed (limited availability), with no licensed treatments available. Given the central role of oxidative stress in liver failure and disease progression (Banerjee P et al 2023), use of N-acetyl cysteine as an antioxidant therapy in liver failure is limited by need for early intervention, and specifically in the context of acute liver failure secondary to drugs (mainly acetaminophen), and is applied only when the patient has already presented in liver failure. Moreover, N-acetyl cysteine targets the lack of glutathione for cell metabolism due to acetaminophen adducts but does nothing to counter the severe reactive oxidant species generation and inflammation common to causes of liver failure. Other strategies to support the liver (albumin dialysis; extracorporeal cell systems) have shown no consistent benefit in improving survival. A key drawback is the lack of significant ability to reverse the impact of necro-inflammation by systems that saturate within hours of application.

[0007] Oxidative stress and inflammation play an important role in the advancement of liver diseases. As described above, clinical treatment has aimed at using N-acetyl cysteine in the acute liver failure setting, which targets the lack of glutathione for cell metabolism but does not counter the ongoing reactive oxygen species (ROS) production by cellular damage and innate immune cell activation. Consequently, extracellular scavenging of ROS might be envisioned as rejuvenating the liver milieu. However, current strategies of reducing oxidant stress such as albumin dialysis, does not specifically feature design of antioxidant capacity, but relies on the capacity of albumin-binding to remove toxins and its antioxidative and immunomodulatory effects, and importantly, has not been shown to have any survival benefit.

[0008] Thus, access to therapeutic strategies that counteract cellular stress induced by reactive oxygen species (ROS) is an unmet clinical need.

[0009] Artificial cells (ACs) are micron-sized assemblies that are envisioned to replace, enhance or even add non-native activity to their living counter parts. However, the interaction of ACs with mammalian cells only started to be explored [1], Examples in this context include the use of vesicle-loaded alginate-based ACs co-cultured with osteoblasts for enhanced biomineralization [2], combating excitotoxicity in neuroblastoma cells by polystyrene-based ACs loaded with platinum nanoparticles removed exogenous H2O2 and NH4+[3;4] , microsphere-based artificial stem cells, which release Tp4-exosome to improve the angiogenic capacity of coronary endothelial cells [5], lipid-based protocells producing a cytotoxin to induce cytotoxicity in cancer cells [6], or the ability of ACs to support HepG2 cells [7], Other examples include HepG2 cells co-cultured with catalytically active ACs, e.g., alginate-based ACs functionalized with metalloporphyrins, transferred a fluorescent signal to HepG2 cells [8], and ACs with encapsulated catalase co-cultured in cell aggregates with HepG2 cells to alleviate oxidative stress [9; 10]. In the latter case, the short life-time of catalase limited the benefit of ACs substantially.

[0010] Summary

[0011] The present inventors have developed novel therapeutic strategies for reducing cellular reactive oxygen species (ROS) in order to treat liver diseases.

[0012] The main object of the present disclosure is to provide a microgel that comprise one or more salen-manganese complexes, which may for example be used in extracorporeal support of liver cells.

[0013] Thus, in a first aspect, the present disclosure concerns a microgel comprising one or more salen-manganese complexes. In a second aspect, the present disclosure concerns a microgel comprising one or more salen-manganese complexes for use in the treatment of a liver disease, such as liver failure.

[0014] In another aspect, the present disclosure concerns a composition comprising the microgel and one or more excipients.

[0015] In another aspect, the present disclosure concerns a pharmaceutical composition comprising the microgel and one or more pharmaceutically acceptable excipients.

[0016] In another aspect, the present disclosure concerns an ex vivo composition comprising the microgel and one or more excipients.

[0017] In another aspect, the present disclosure concerns a cellular composition comprising the microgel and one or more cells.

[0018] In another aspect, the present disclosure concerns a tissue culture system comprising the microgel and a support medium, such as a cellulose support.

[0019] In another aspect, the present disclosure concerns a system comprising the microgel.

[0020] In another aspect, the present disclosure concerns a bionic tissue system comprising the microgel.

[0021] In another aspect, the present disclosure concerns a paper chip comprising the microgel.

[0022] In another aspect, the present disclosure concerns an artificial cell (AC) comprising the microgel.

[0023] In another aspect, the present disclosure concerns a kit of parts comprising a. a microgel; and b. instructions for use. In another aspect, the present disclosure concerns a kit for ex vivo culturing of liver cells, wherein the kit comprises a. a microgel; and b. instructions for use.

[0024] In another aspect, the present disclosure concerns a method for treatment or prevention of liver failure comprising administration of a microgel to a subject in need thereof.

[0025] In another aspect, the present disclosure concerns a method of reducing reactive oxidative species and response to inflammatory conditions in hepatic cells using a microgel.

[0026] In another aspect, the present disclosure concerns a method of decreasing a response to a pathophysiological stressor in cells, said method comprising a step of co-culturing the microgel with said cells, optionally wherein the pathophysiological stressor is hydrogen peroxide or tert-butyl hydroperoxide.

[0027] In another aspect, the present disclosure concerns a method of decreasing a response to reactive oxygen species (ROS) in cells, said method comprising a step of coculturing the microgel with said cells.

[0028] In another aspect, the present disclosure concerns a method of decreasing a response to lipid-mediated oxidant stress and / or per-oxidant stress in cells, said method comprising a step of co-culturing the microgel with said cells.

[0029] In another aspect, the present disclosure concerns a method of decreasing a response to inflammatory conditions in cells, said method comprising a step of co-culturing the microgel with said cells.

[0030] In another aspect, the present disclosure concerns a method of decreasing a response to endotoxins, such as lipopolysaccharides (LPS), in cells, said method comprising a step of co-culturing the microgel with said cells. In another aspect, the present disclosure concerns a method of manufacturing a microgel, wherein the method comprises the steps of: a) contacting low molecular weight alginate and high molecular weight alginate; b) thereby obtaining an alginate solution; and c) contacting said alginate solution comprising a salen-manganese complex, such as ELIK-B; thereby obtaining a microgel comprising a salen-manganese complex, such as EUK-B.

[0031] Description of Drawings

[0032] Figure 1 a) The manganese-salen compound EUK-B and PtNPs were encapsulated in microgelbased ACs termed microgel ACEUK'Band microgel ACptNP, respectively, which convert O2 ' to H2O2, and H2O2 to H2O and oxygen, b) The microgel ACs were applied to floating paper chips at the liquid-air interface of the cell media of wells equipped with H2O2" or tert-butyl hydroperoxide (tBuOOH)-stressed hepatocytes.

[0033] Figure 2

[0034] Characterization of PtNPs. a) Representative TEM image of PtNPs. Scale bar is 30 nm. b) Size distribution of PtNPs. 150 PtNPs were counted, and the resulting histogram was fitted to a Gaussian amplitude function. Size is given as p±2o (n=1).

[0035] Figure 3

[0036] Characterization of microgels, a) Representative bright field images of microgel AC0, microgel ACptNPand microgel ACEUK'B. Scale bars are 200 pm. b) The size distribution of the microgels was based on 300 microgels. The resulting histogram was fitted to a Gaussian amplitude function. The size is given as p±2o (n=3).

[0037] Figure 4

[0038] ROS removal of antioxidative microgels. H2O2 removal of microgel AC0, microgel ACptNPand microgel ACEUK'Bover 8 h in PBS (i) or cell media (ii). The initial slope of the curve (from 0 h to 3 h) was fitted using linear regression. (n=3). Figure 5

[0039] O2” removal is given as SOD-like activity (%) after 30 min of different amounts of microgels on paper chips (n=3).

[0040] Figure 6 a) HepG2 cells were cultured in 12-well plates, and a floating paper chip was added to each well loaded with microgel AC0, microgel ACEUK'B, microgel ACptNPor a mixture of microgel ACEUK'Band microgel ACptNP(microgel ACEUK'B / ptNP). b) The HepG2 cell viability after exposure to 3 doses of either 0.2 (i) or 0.3 mM (ii) H2O2 over 9 h depending on the different types of floating paper chips (n=5). The statistical significance used to compare the means was determined using a one-way analysis of variance (one-way ANOVA) followed by a Tukey's multiple comparison post hoc test (*p<0.05). c) i) HepG2 cells were exposed to 3 doses of H2O2 followed by a 48 h recovery period in new media and exposure to 2 additional doses of H2O2 (0.1 -0.5 mM) before the HepG2 cell viability was assessed depending whether the microgel ACEUK'B- loaded paper chips remained or were removed after the 48 h recovery period, ii) The dose response curve of HepG2 cells exposed to 0.1 -0.5 mM H2O2when the microgel ACEUK-B-loaded paper chips either remained floating on the wells or were removed from the cell cultures after the 48 h recovery (n=4). The dose response curves are fitted with a sigmoidal curve to obtain EC50 values. The statistical significance used to compare the means of EC50 values was determined using a one-way analysis of variance (oneway ANOVA) followed by a Tukey's multiple comparison post hoc test. *p<0.05 (n=4).

[0041] Figure 7 a) Conversion of tBuOOH over 4 h in the presence of empty, microgel AC0-, microgel ACEUK-B-loaded paper chips (n=3). b) Dose response curves of HepG2 cells exposed to 0.1 -0.5 mM tBuOOH in wells with floating empty, microgel AC0-, microgel ACEUK'B- loaded paper chips (n=3). The dose response curve were fitted and the resulting EC50 values are shown. The statistical significance used to compare the means of EC50 values was determined using a one-way analysis of variance (one-way ANOVA) followed by a Tukey's multiple comparison post hoc test (*p<0.05).

[0042] Figure 8 a) HHL-5 cells were exposed to tBuOOH for 3 h before the cell viability and the intracellular ROS levels were determined. Viability measured with CCK-8 (b) or the

[0043] RECTIFIED SHEET (RULE 91) ISA / EP neutral red uptake assay (c) of HHL-5 cells upon exposure to 0.1-0.3 mM tBuOOH in the presence of empty, or microgel AC0-, or microgel ACEUK'B-loaded paper chips (n=3). ci) HHL-5 cell viability evaluated based ion the absorbance of the media following destaining. cii) Representative bright field images of 0.2 mM tBuOOH-challenged HHL-5 cells incubated with neutral red. Scale bars = 100 pm. d) i) Representative fluorescence microscopy images of 0.2 mM tBuOOH-challenged HHL-5 cells in the presence of empty, or microgel AC0-, or microgel ACEUK'B-loaded paper chips incubated with 6-carboxy-2',7'-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA), which is converted to the fluorescent carboxy-dichlorofluorescein (carboxy-DCF) in the presence of intracellular ROS (n=3). Scale bars = 100 pm. ii) The pixel intensity in the images originating from the fluorescent carboxy-DCF was quantified using Imaged. A minimum of 5 images of each condition was used per repeat (n=3). The statistical significance used to compare the means was determined using a one-way analysis of variance (one-way ANOVA) followed by a Tukey's multiple comparison post hoc test. *p<0.05, **p<0.005, n.s.=not significant.

[0044] Figure 9 a) Cartoon showing the experimental setup, b) Representative CLSM images of 1 :20 microgel-to-cell ratio after 1 dose (i), 2 doses (ii), 3 doses (iii), 2 doses plus 24h rest (iv) and 2 doses plus 48 h rest (v) (Scale bars: 20 pm; n=3). c) The expression of mitochondrial markers COX I (i) and COX II (ii) of 1 :20 microgel-to-cell ratio aggregates treated with different doses of ‘BuOOH measured by RT-qPCR (*p<0.05, n=3). d) The expression of glutathione reductase (GSR) marker of 1 :20 microgel-to-cell ratio aggregates treated with different doses of ‘BuOOH measured by RT-qPCR (*p<0.05, n=3). The statistical significance used to compare the means was determined using a one-way analysis of variance (one-way ANOVA) followed by a Tukey's multiple comparison post hoc test.

[0045] Detailed description

[0046] Definitions

[0047] As used herein "hydrogel", “microgel”, and "hydrophilic gel" are used interchangeably herein and refers to a continuous phase of a hydrophilic polymer that is capable of swelling on contact with water and other hydrophilic swelling agents. The term is used regardless of the state of hydration. Hydrogels are hydrophilic polymers characterized by their hydrophilicity (i.e. , capable of absorbing large amounts of fluid such as wound exudate). The hydrogels may be transparent or translucent, regardless of their degree of hydration. As used herein “microgels” may have a particle size between 0.1 pm and 500 pm. A microgel may comprise or be loaded with a functionalizing component, such as a salen-manganese complex or platinum nanoparticles, and the resulting microgel may be referred to as a microgel or microgel artificial cells (ACs). A control microgel AC without a functionalizing components is referred to as microgel AC0herein. “Microgel ACEUK-B“as usec| herein thus refers to a microgel artificial cell loaded with ELIK-B also known as a microgel loaded with ELIK-B. “Microgel ACptNP” as used herein refers to a microgel artificial cell loaded with platinum nanoparticles also known as a microgel loaded with platinum nanoparticles.

[0048] Particle size may be calculated from brightfield images by measuring at least 100 particles employing the software Fiji. A Gaussian curve can be fitted to the obtained histogram and the results can be presented as mean ± 2o for 95.4% of the population.

[0049] The term “salen-manganese complexes” as used herein refers to catalase mimetics with superoxide dismutase (SOD) and peroxidase mimetic activity. Salen-manganese complexes such as the prototype N,N'-bis(salicylidene) ethylenediamine chloride (EUK- 8) contain a coordinated manganese ion whose status determines whether the complex functions as an SOD or catalase mimetic. Without being bound by theory, the mechanism employed for the dismutation of superoxide anions is very similar to that of MnSOD. In a first step, Mn(lll) is reduced to Mn(ll) by a superoxide anion, releasing molecular oxygen. The Mn(ll) is then converted back to Mn(lll) by another superoxide anion, yielding water. In the context of its catalase mimetic activity, salen-manganese is oxidized to a salen-oxomanganese complex by hydrogen peroxide, liberating water. The initial complex is then regenerated, detoxifying another molecule of hydrogen peroxide thereby releasing water and molecular oxygen.

[0050] The term “culture growth medium suitable for culturing hepatic cells” as used herein refer to a solution containing nutrients that nourish growing cells. In certain embodiments, the culture medium is useful for growing human cells. Typically, a culture medium provides essential and non-essential amino acids, vitamins, energy sources, lipids, and trace elements required by the cell for minimal growth and / or survival. The culture medium may also contain supplementary components (see definition of "Supplementary components" below) that enhance growth and / or survival above the minimal rate, including, but not limited to, hormones and / or other growth factors, particular ions (such as sodium, chloride, calcium, magnesium, and phosphate), buffers, vitamins, nucleosides or nucleotides, trace elements (inorganic compounds usually present at very low final concentrations), amino acids, lipids, and / or glucose or other energy source. In certain embodiments, a medium is advantageously formulated to a pH and salt concentration optimal for cell survival and proliferation. One of ordinary skill in the art will recognize that alternative culture media may be used and / or certain alterations may be made to the compositions of the culture media. In certain embodiments, the medium is a feed medium that is added after the beginning of the cell culture. In certain embodiments, the cell culture medium is a mixture of a starting nutrient solution and any feed medium that is added after the beginning of the cell culture.

[0051] The term "supplementary components" as used herein refers to components that enhance growth and / or survival above the minimal rate, including, but not limited to, hormones and / or other growth factors, particular ions (such as sodium, chloride, calcium, magnesium, and phosphate), buffers, vitamins, nucleosides or nucleotides, trace elements (inorganic compounds usually present at very low final concentrations), amino acids, lipids, and / or glucose or other energy source. In certain embodiments, supplementary components are added to the initial cell culture. In certain embodiments, supplementary components are added after the beginning of the cell culture.

[0052] As used herein “about” means a stated value plus or minus another amount; thereby establishing a range of values. In certain preferred embodiments “about” indicates a range relative to a base (or core or reference) value or amount plus or minus up to 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, .75%, .5%, ,25% or .1%.

[0053] As used herein, the term "EC50," refers to that concentration of a stressor, such as hydrogen peroxide or tert-butyl hydroperoxide, at which the number of viable cells is 50% of the measurable using the same assay. Stated differently, the "EC50" is the concentration of stressor that gives 50% of viable cells, when 100% viable cells is set as the number of viable cells in absence of the stressor. A higher numerical EC50 value thus indicates a higher tolerance of the cells towards the stressor. The number of viable cells can be quantifies by cell counting kit-8 (CKK-8) and / or neutral red uptake assay.

[0054] The term “ELIK-8” refers to a compound having a structure according to Formula (I)

[0055] The term “EUK-134” refers to a compound having a structure according to Formula (II)

[0056] The term “EUK-189” refers to a compound having a structure according to Formula (III)

[0057]

[0058] The term “ELIK-A” refers to a compound having a structure according to Formula (V)

[0059]

[0060] The term “ELIK-B” refers to a compound having a structure according to Formula (VI)

[0061] The term “ELIK-C” refers to a compound having a structure according to Formula (VII)

[0062]

[0063] The term “ELIK-D” refers to a compound having a structure according to Formula (VIII)

[0064] (VIII).

[0065] The microgel

[0066] The present invention takes advantage of the antioxidative capacity of salen- manganese complexes comprised in microgels, which may be used in alleviating the extracellular oxidative stress on e.g. hepatic cells. The antioxidative potential of the microgels comprising salen-manganese complex are exemplified in the use of the salen-manganese complex ELIK-B. Specifically, i) microgel ACs comprising ELIK-B are capable of converting e.g. 02~ to H2O2, and H2O2 to H2O extracellularly (Figure 1a), and ii) these antioxidant microgel ACs can e.g. be loaded on floating paper chips and rescue peroxide challenged HepG2 cell and HHL-5 cells culture in proximity by not only improving their viability but also lowering the intracellular oxidative stress (Figure 1b).

[0067] In one embodiment, the present disclosure concerns a microgel comprising one or more salen-manganese complexes.

[0068] In another embodiments, the present disclosure concerns a microgel comprising one or more salen-manganese complexes for use in the treatment of a liver disease, such as liver failure.

[0069] Salen-manganese complexes Salen-manganese complexes are a group of small antioxidant compounds, which were first reported in the 1930’s. Eukarion (EUK) compounds are salen-manganese complexes, which possess superoxide dismutase and catalase activities and are excellent candidates in the preparation of antioxidative microgels. Salen-manganese complexes offer broad opportunities to manipulate their structure and coordination chemistry for envisioned applications. Compared to enzymes, EUK has reduced cost, higher stability, and it exhibits less environmental sensitivity. A variety of modified EUK compounds, including EUK-B, have been described. Selecting a suitable salen- manganese complex for the manufacturing of antioxidative microgels may depend on the requirements for catalytic activity and water solubility of the salen-manganese complex.

[0070] In some embodiments, the one or more salen-manganese complexes is selected from the group consisting of EUK-8, EUK-134, EUK-189 and EUK-207. In some embodiments, the one or more salen-manganese complexes is selected from the group consisting of EUK-A, EUK-B, EUK-C or EUK-D. In some embodiments, the one or more salen-manganese complexes is EUK-B.

[0071] In some embodiments, the one or more salen-manganese complexes is the compound displayed in Formula (VI) herein above. The optimal concentration of salen-manganese complex in a microgel solution is likewise dependent on the balance of the desired antioxidative capacity and the solubility of the salen-manganese complex. In some embodiments, the concentration of salen-manganese complex in a solution is between 0.001 and 10 mg mL-1 , such as between 0.01 and 9 mg mL-1, such as between 0.1 and 8 mg mL-1 , such as between 0.1 and 7 mg mL-1, such as between 0.1 and 6 mg mL-1 , such as between 0.1 and 5 mg mL-1, such as between 0.1 and 4 mg mL-1, such as between 0.1 and 3 mg mL-1, such as between 0.1 and 2 mg mL-1, or such as between 0.1 and 1 mg mL-1.

[0072] In some embodiments, the concentration of salen-manganese complex in a solution is between 0.1 and 1 mg mL-1, such as between 0.1 and 0.9 mg mL-1 , such as between mg mL-1 0.1 and 0.8 mg mL-1 , such as between 0.1 and 0.7 mg mL-1 , such as between 0.1 and 0.6 mg mL-1, such as between 0.1 and 0.5 mg mL-1 , such as between 0.1 and 0.45 mg mL-1 , such as between 0.1 and 0.4 mg mL-1 , such as between 0.1 and 0.3 mg mL-1, such as between 0.1 and 0.2 mg mL-1 , such as between 0.2 and 0.9 mg mL-1, such as between 0.2 and 0.8 mg mL-1 , such as between 0.2 and 0.7 mg mL-1, such as between 0.2 and 0.6 mg mL-1 , such as between 0.2 and 0.5 mg mL-1, such as between 0.2 and 0.45 mg mL-1 , such as between 0.2 and 0.4 mg mL-1, such as between 0.2 and 0.3 mg mL-1 , such as between 0.3 and 0.9 mg mL-1, such as between 0.3 and 0.8 mg mL-1 , such as between 0.3 and 0.7 mg mL-1, such as between 0.3 and 0.6 mg mL-1 , such as between 0.3 and 0.5 mg mL-1, such as between 0.3 and 0.45 mg mL-1 , such as between 0.3 and 0.4 mg mL-1, such as between 0.4 and 0.9 mg mL-1 , such as between 0.4 and 0.8 mg mL-1, such as between 0.4 and 0.7 mg mL-1 , such as between 0.4 and 0.6 mg mL-1, such as between 0.4 and 0.5 mg mL-1 , such as between 0.4 and 0.45 mg mL-1 , such as between 0.45 and 0.9 mg mL-1 , such as between 0.45 and 0.8 mg mL-1 , such as between 0.45 and 0.7 mg mL-1 , such as between 0.45 and 0.6 mg mL-1 , such as between 0.45 and 0.5 mg mL-1 , such as between 0.5 and 0.9 mg mL-1 , such as between 0.5 and 0.8 mg mL-1 , such as between 0.5 and 0.7 mg mL-1, such as between 0.5 and 0.6 mg mL-1 , such as between 0.6 and 0.9 mg mL-1, such as between 0.6 and 0.8 mg mL-1 , such as between 0.6 and 0.7 mg mL-1, such as between 0.7 and 0.9 mg mL-1 , such as between 0.7 and 0.8 mg mL-1, such as between 0.8 and 0.9 mg mL-1 , such as between 1 and 0.9 mg mL-1 , such as between 1 and 0.8 mg mL-1, such as between 1 and 0.7 mg mL-1 , such as between 1 and 0.6 mg mL-1 , such as between 1 and 0.5 mg mL-1 , such as between 1 and 0.45 mg mL-1, such as between 1 and 0.4 mg mL-1 , such as between 1 and 0.3 mg mL-1, or such as between 1 and 0.2 mg mL-1.

[0073] In some embodiments, the concentration of a salen-manganese complex selected from the group consisting of EUK-134, EUK-A, EUK-B, EUK-C or EUK-D in a solution is between 0.1 and 1 mg mL-1, such as between 0.1 and 0.9 mg mL-1 , such as between 0.1 and 0.8 mg mL-1, such as between 0.1 and 0.7 mg mL-1 , such as between 0.1 and 0.6 mg mL-1, such as between 0.1 and 0.5 mg mL-1 , such as between 0.1 and 0.45 mg mL-1, such as between 0.1 and 0.4 mg mL-1, such as between 0.1 and 0.3 mg mL- 1 , such as between 0.1 and 0.2 mg mL-1 , such as between 0.2 and 0.9 mg mL-1 , such as between 0.2 and 0.8 mg mL-1, such as between 0.2 and 0.7 mg mL-1 , such as between 0.2 and 0.6 mg mL-1, such as between 0.2 and 0.5 mg mL-1 , such as between 0.2 and 0.45 mg mL-1, such as between 0.2 and 0.4 mg mL-1 , such as between 0.2 and 0.3 mg mL-1 , such as between 0.3 and 0.9 mg mL-1 , such as between 0.3 and 0.8 mg mL-1, such as between 0.3 and 0.7 mg mL-1 , such as between 0.3 and 0.6 mg mL-1, such as between 0.3 and 0.5 mg mL-1 , such as between 0.3 and 0.45 mg mL-1, such as between 0.3 and 0.4 mg mL-1 , such as between 0.4 and 0.9 mg mL-1, such as between 0.4 and 0.8 mg mL-1 , such as between 0.4 and 0.7 mg mL-1, such as between 0.4 and 0.6 mg mL-1 , such as between 0.4 and 0.5 mg mL-1, such as between 0.4 and 0.45 mg mL-1 , such as between 0.45 and 0.9 mg mL-1 , such as between 0.45 and 0.8 mg mL-1 , such as between 0.45 and 0.7 mg mL-1 , such as between 0.45 and 0.6 mg mL-1 , such as between 0.45 and 0.5 mg mL-1, such as between 0.5 and 0.9 mg mL-1 , such as between 0.5 and 0.8 mg mL-1, such as between 0.5 and 0.7 mg mL-1 , such as between 0.5 and 0.6 mg mL-1, such as between 0.6 and 0.9 mg mL-1 , such as between 0.6 and 0.8 mg mL-1, such as between 0.6 and 0.7 mg mL-1 , such as between 0.7 and 0.9 mg mL-1, such as between 0.7 and 0.8 mg mL-1 , such as between 0.8 and 0.9 mg mL-1, such as between 1 and 0.9 mg mL-1 , such as between 1 and 0.8 mg mL-1, such as between 1 and 0.7 mg mL-1 , such as between 1 and 0.6 mg mL-1, such as between 1 and 0.5 mg mL-1, such as between 1 and 0.45 mg mL-1 , such as between 1 and 0.4 mg mL-1, such as between 1 and 0.3 mg mL-1 , or such as between 1 and 0.2 mg mL-1.

[0074] In some embodiments, the solution is a 15 mg mL-1 alginate solution. In some embodiments, the concentration of ELIK-B is between 0.1 and 0.8 mg mL-1, such as between 0.2 and 0.7 mg mL-1, such as between 0.3 and 0.6 mg mL-1 , such as between 0.4 and 0.5 mg mL-1 and the solution is a 15 mg mL-1 alginate solution

[0075] In some embodiments, the concentration of EUK-B is 0.46 mg mL-1 and the solution is a 15 mg mL-1 alginate solution.

[0076] The microgel composition

[0077] Identification of a suitable polymer for the preparation of the microgels described herein will depend on the end use of the microgel. Examples of compounds which may be used for the assembly of microgels include, but are not limited to alginate, cellulose, polyethylene glycol, hyaluronic acid, Poly(MMA / MAA / EGD)-GM, gelatin, PAMPS, polyacrylamide, Polyrotaxanes, Hydroxyethyl cellulose, Methacrylic acid, 2- hydroxyethyl methacrylate, chitosan, polyvinyl alcohol, and / or collagen.

[0078] In some embodiments, the microgel comprises polypeptides, peptides, DNA, synthetic polymers or polysaccharides. In some embodiments, the microgel comprises alginate, cellulose, polyethylene glycol, hyaluronic acid, Poly(MMA / MAA / EGD)-GM, gelatin, PAMPS, polyacrylamide, Polyrotaxanes, Hydroxyethyl cellulose, Methacrylic acid, 2- hydroxyethyl methacrylate, chitosan, polyvinyl alcohol, and / or collagen.

[0079] In some embodiments, the microgel comprises alginate. In some embodiments, the microgel comprises alginate and EUK-B.

[0080] The microgel comprising alginate may in some embodiments comprise both low and high molecular weight alginate. Solutions of high and low molecular weight alginate may thus be used to make alginate-based microgels in e.g. an instrument for controlled encapsulation, such as an Encapsulator B-390 instrument followed by cross-linking in e.g. a calcium bath. In some embodiments, the alginate comprises low and / or high molecular weight alginate.

[0081] The low molecular weight alginate may for example have a molecular weight less than 75 kDa and the high molecular wight alginate may for example have a molecular weight that is higher than 200 kDa. In some embodiments, the low molecular weight alginate has a molecular weight between 5 and 75 kDa, such as between 5 and 65 kDa, such as between 5 and 55 kDa, such as between 5 and 45 kDa, such as between 5 and 35 kDa, such as between 5 and 25 kDa, such as between 5 and 15 kDa, such as between 15 and 75 kDa, such as between 15 and 65 kDa, such as between 15 and 55 kDa, such as between 15 and 45 kDa, such as between 15 and 35 kDa, such as between 15 and 25 kDa, such as between 25 and 75 kDa, such as between 25 and 65 kDa, such as between 25 and 55 kDa, such as between 25 and 45 kDa, such as between 25 and 35 kDa, such as between 35 and 75 kDa, such as between 35 and 65 kDa, such as between 35 and 55 kDa, such as between 35 and 45 kDa, such as between 45 and 75 kDa, such as between 45 and 65 kDa, such as between 45 and 55 kDa, such as between 55 and 75 kDa, such as between 55 and 65 kDa, or such as between 65 and 75 kDa.

[0082] In some embodiments, the high molecular weight alginate has a molecular weight between 200 and 1000 kDa, such as between 200 and 900 kDa, such as between 200 and 800 kDa, such as between 200 and 700 kDa, such as between 200 and 600 kDa, such as between 200 and 500 kDa, such as between 200 and 400 kDa, such as between 200 and 300 kDa, such as between 300 and 1000 kDa, such as between 300 and 900 kDa, such as between 300 and 800 kDa, such as between 300 and 700 kDa, such as between 300 and 600 kDa, such as between 300 and 500 kDa, such as between 300 and 400 kDa, such as between 400 and 1000 kDa, such as between 400 and 900 kDa, such as between 400 and 800 kDa, such as between 400 and 700 kDa, such as between 400 and 600 kDa, such as between 400 and 500 kDa, such as between 500 and 1000 kDa, such as between 500 and 900 kDa, such as between 500 and 800 kDa, such as between 500 and 700 kDa, such as between 500 and 600 kDa, such as between 600 and 1000 kDa, such as between 600 and 900 kDa, such as between 600 and 800 kDa, such as between 600 and 700 kDa, such as between 700 and 1000 kDa, such as between 700 and 900 kDa, such as between 700 and 800 kDa, such as between 800 and 1000 kDa, such as between 800 and 900 kDa, or such as between 900 and 1000 kDa.

[0083] In some embodiments, the a-L-guluronate content in the alginate is between 60 and 100 %, such as between 60 and 90 %, such as between 60 and 80 %, such as between 60 and 70 %, such as between 70 and 100 %, such as between 70 and 90 %, such as between 70 and 80 %, such as between 80 and 100 %, such as between 80 and 90 %, or such as between 90 and 100 %. The assembly of the microgel may comprise cross-linking the polymer of the microgel, which may for example be done using a calcium bath. In some embodiments, the microgel is assembled by cross-linking. In some embodiments, the alginate comprises low and / or high molecular weight alginate assembled by cross-linking. In some embodiments, the alginate comprises low and / or high molecular weight alginate assembled by cross-linking in a calcium bath.

[0084] The dry microgel may be hydrated in a number of different buffers depending on the end use of the microgel. If the end use of the microgel is coculturing with cells, the microgel may for example be hydrated in a culture medium suitable for culturing cells. In some embodiments, the microgel is hydrated in phosphate buffered saline, HEPES buffered saline, or TRIS buffered saline. In some embodiments, the microgel is hydrated in a culture growth medium suitable for culturing mammalian cells.

[0085] In some embodiments, the microgel is hydrated in a culture medium growth suitable for culturing hepatic cells. In some embodiments, the microgel comprises alginate and is hydrated in a culture medium growth suitable for culturing hepatic cells.

[0086] In some embodiments, the microgel comprises phosphate buffered saline, HEPES buffered saline, or TRIS buffered saline. In some embodiments, the microgel comprises a culture growth medium suitable for culturing mammalian cells. In some embodiments, the microgel comprises a culture growth medium suitable for culturing hepatic cells.

[0087] The particle size of the microgel may depend on the assembly method of the microgel and for example whether the microgel, besides salen-manganese complexes comprise platinum nanoparticles. In some embodiments, the microgel has a particle size between 10 and 300 pm, such as between 10 and 280 pm, such as between 10 and 260 pm, such as between 10 and 240 pm, such as between 10 and 220 pm, such as between 10 and 200 pm, such as between 10 and 180 pm, such as between 10 and 160 pm, such as between 10 and 140 pm, such as between 10 and 120 pm, such as between 10 and 100 pm, such as between 10 and 80 pm, such as between 10 and 60 pm, such as between 10 and 40 pm, such as between 10 and 20 pm, such as between 20 and 300 pm, such as between 20 and 280 pm, such as between 20 and 260 pm, such as between 20 and 240 pm, such as between 20 and 220 pm, such as between 20 and 200 pm, such as between 20 and 180 pm, such as between 20 and 160 pm, such as between 20 and 140 pm, such as between 20 and 120 pm, such as between 20 and 100 m, such as between 20 and 80 pm, such as between 20 and 60 pm, such as between 20 and 40 pm, such as between 40 and 300 pm, such as between 40 and 280 pm, such as between 40 and 260 pm, such as between 40 and 240 pm, such as between 40 and 220 pm, such as between 40 and 200 pm, such as between 40 and 180 pm, such as between 40 and 160 pm, such as between 40 and 140 pm, such as between 40 and 120 pm, such as between 40 and 100 pm, such as between 40 and 80 pm, such as between 40 and 60 pm, such as between 60 and 300 pm, such as between 60 and 280 pm, such as between 60 and 260 pm, such as between 60 and 240 pm, such as between 60 and 220 pm, such as between 60 and 200 pm, such as between 60 and 180 pm, such as between 60 and 160 pm, such as between 60 and 140 pm, such as between 60 and 120 pm, such as between 60 and 100 pm, such as between 60 and 80 pm, such as between 80 and 300 pm, such as between 80 and 280 pm, such as between 80 and 260 pm, such as between 80 and 240 pm, such as between 80 and 220 pm, such as between 80 and 200 pm, such as between 80 and 180 pm, such as between 80 and 160 pm, such as between 80 and 140 pm, such as between 80 and 120 pm, such as between 80 and 100 pm, such as between 100 and 300 pm, such as between 100 and 280 pm, such as between 100 and 260 pm, such as between 100 and 240 pm, such as between 100 and 220 pm, such as between 100 and 200 pm, such as between 100 and 180 pm, such as between 100 and 160 pm, such as between 100 and 140 pm, such as between 100 and 120 pm, such as between 120 and 300 pm, such as between 120 and 280 pm, such as between 120 and 260 pm, such as between 120 and 240 pm, such as between 120 and 220 pm, such as between 120 and 200 pm, such as between 120 and 180 pm, such as between 120 and 160 pm, such as between 120 and 140 pm, such as between 140 and 300 pm, such as between 140 and 280 pm, such as between 140 and 260 pm, such as between 140 and 240 pm, such as between 140 and 220 pm, such as between 140 and 200 pm, such as between 140 and 180 pm, such as between 140 and 160 pm, such as between 160 and 300 pm, such as between 160 and 280 pm, such as between 160 and 260 pm, such as between 160 and 240 pm, such as between 160 and 220 pm, such as between 160 and 200 pm, such as between 160 and 180 pm, such as between 180 and 300 pm, such as between 180 and 280 pm, such as between 180 and 260 pm, such as between 180 and 240 pm, such as between 180 and 220 pm, such as between 180 and 200 pm, such as between 200 and 300 pm, such as between 200 and 280 pm, such as between 200 and 260 pm, such as between 200 and 240 pm, such as between 200 and 220 pm, such as between 220 and 300 m, such as between 220 and 280 pm, such as between 220 and 260 pm, such as between 220 and 240 pm, such as between 240 and 300 pm, such as between 240 and 280 pm, such as between 240 and 260 pm, such as between 260 and 300 pm, such as between 260 and 280 pm, or such as between 280 and 300 pm.

[0088] In some embodiments, the microgel has a particle size between 40 and 280 pm, such as between 40 and 260 pm, such as between 40 and 240 pm, such as between 40 and 220 pm, such as between 40 and 200 pm, such as between 40 and 180 pm, such as between 40 and 160 pm, such as between 40 and 140 pm, such as between 40 and 120 pm, such as between 40 and 100 pm, such as between 40 and 80 pm, such as between 40 and 60 pm, such as between 60 and 280 pm, such as between 60 and 260 pm, such as between 60 and 240 pm, such as between 60 and 220 pm, such as between 60 and 200 pm, such as between 60 and 180 pm, such as between 60 and 160 pm, such as between 60 and 140 pm, such as between 60 and 120 pm, such as between 60 and 100 pm, such as between 60 and 80 pm, such as between 80 and 280 pm, such as between 80 and 260 pm, such as between 80 and 240 pm, such as between 80 and 220 pm, such as between 80 and 200 pm, such as between 80 and 180 pm, such as between 80 and 160 pm, such as between 80 and 140 pm, such as between 80 and 120 pm, such as between 80 and 100 pm, such as between 100 and 280 pm, such as between 100 and 260 pm, such as between 100 and 240 pm, such as between 100 and 220 pm, such as between 100 and 200 pm, such as between 100 and 180 pm, such as between 100 and 160 pm, such as between 100 and 140 pm, such as between 100 and 120 pm, such as between 120 and 280 pm, such as between 120 and 260 pm, such as between 120 and 240 pm, such as between 120 and 220 pm, such as between 120 and 200 pm, such as between 120 and 180 pm, such as between 120 and 160 pm, such as between 120 and 140 pm, such as between 140 and 280 pm, such as between 140 and 260 pm, such as between 140 and 240 pm, such as between 140 and 220 pm, such as between 140 and 200 pm, such as between 140 and 180 pm, such as between 140 and 160 pm, such as between 160 and 280 pm, such as between 160 and 260 pm, such as between 160 and 240 pm, such as between 160 and 220 pm, such as between 160 and 200 pm, such as between 160 and 180 pm, such as between 180 and 280 pm, such as between 180 and 260 pm, such as between 180 and 240 pm, such as between 180 and 220 pm, such as between 180 and 200 pm, such as between 200 and 280 pm, such as between 200 and 260 m, such as between 200 and 240 pm, such as between 200 and 220 pm, such as between 220 and 280 pm, such as between 220 and 260 pm, such as between 220 and 240 pm, such as between 240 and 280 pm, such as between 240 and 260 pm, or such as between 260 and 280 pm

[0089] In some embodiments, the microgel comprises alginate and / or ELIK-B and has a particle size between 40 and 280 pm, such as between 40 and 260 pm, such as between 40 and 240 pm, such as between 40 and 220 pm, such as between 40 and 200 pm, such as between 40 and 180 pm, such as between 40 and 160 pm, such as between 40 and 140 pm, such as between 40 and 120 pm, such as between 40 and 100 pm, such as between 40 and 80 pm, such as between 40 and 60 pm, such as between 60 and 280 pm, such as between 60 and 260 pm, such as between 60 and 240 pm, such as between 60 and 220 pm, such as between 60 and 200 pm, such as between 60 and 180 pm, such as between 60 and 160 pm, such as between 60 and 140 pm, such as between 60 and 120 pm, such as between 60 and 100 pm, such as between 60 and 80 pm, such as between 80 and 280 pm, such as between 80 and 260 pm, such as between 80 and 240 pm, such as between 80 and 220 pm, such as between 80 and 200 pm, such as between 80 and 180 pm, such as between 80 and 160 pm, such as between 80 and 140 pm, such as between 80 and 120 pm, such as between 80 and 100 pm, such as between 100 and 280 pm, such as between 100 and 260 pm, such as between 100 and 240 pm, such as between 100 and 220 pm, such as between 100 and 200 pm, such as between 100 and 180 pm, such as between 100 and 160 pm, such as between 100 and 140 pm, such as between 100 and 120 pm, such as between 120 and 280 pm, such as between 120 and 260 pm, such as between 120 and 240 pm, such as between 120 and 220 pm, such as between 120 and 200 pm, such as between 120 and 180 pm, such as between 120 and 160 pm, such as between 120 and 140 pm, such as between 140 and 280 pm, such as between 140 and 260 pm, such as between 140 and 240 pm, such as between 140 and 220 pm, such as between 140 and 200 pm, such as between 140 and 180 pm, such as between 140 and 160 pm, such as between 160 and 280 pm, such as between 160 and 260 pm, such as between 160 and 240 pm, such as between 160 and 220 pm, such as between 160 and 200 pm, such as between 160 and 180 pm, such as between 180 and 280 pm, such as between 180 and 260 pm, such as between 180 and 240 pm, such as between 180 and 220 pm, such as between 180 and 200 pm, such as between 200 and 280 pm, such as between 200 and 260 pm, such as between 200 and 240 m, such as between 200 and 220 pm, such as between 220 and 280 pm, such as between 220 and 260 pm, such as between 220 and 240 pm, such as between 240 and 280 pm, such as between 240 and 260 pm, or such as between 260 and 280 pm

[0090] In some embodiments, the microgel has a particle size between 70 and 90 pm.

[0091] In some embodiments, the microgel has a particle size of about 83 pm. In some embodiments, the microgel comprises ELIK-B and has a particle size of about 83 pm. In some embodiments, the microgel comprises alginate and ELIK-B and has a particle size of about 83 pm. In some embodiments, the microgel has a particle size between 120 and 140 pm. In some embodiments, the microgel has a particle size of about 134 pm. In some embodiments, the microgel has a particle size between 220 and 240 pm. In some embodiments, the microgel has a particle size of about 226 pm.

[0092] Particle size may be calculated from brightfield images by measuring at least 100 particles employing the software Fiji. A Gaussian curve can be fitted to the obtained histogram and the results can be presented as mean ± 2o for 95.4% of the population

[0093] In some embodiments, the particle size is determined by: a. obtaining one or more images, such as microscopy images, of one or more particles, b. determining the particle size of said one or more particles from said images, optionally wherein said one or more particles are at least 100 particles.

[0094] In some embodiments, the particle size is determined: a. obtaining brightfield images by measuring a particle population comprising at least 100 particles, hereby obtaining a histogram, optionally wherein the brightfield images are obtained by employing the software Fiji, b. determining the particle size of the particles by fitting a Gaussian curve to the histogram, and c. optionally presenting the particle size as mean ± 2o for 95.4% of the particle population. Platinum nanoparticles

[0095] To further substantiate the antioxidative potential of microgels comprising salen- manganese complexes, the microgels may comprise platinum nanoparticles (PtNPs). PtNPs exhibit peroxidase-like activity (producing OH) under acidic conditions and catalase-like activity (producing H2O and O2) as well as SOD-like activity (scavenging O2 ") at neutral and alkaline conditions. Several examples illustrated that intracellularly placed PtNPs reduced oxidative stress-mediated cell damage and cell death

[0096] In some embodiments, the microgel further comprises platinum nanoparticles. In some embodiments, the microgel comprises platinum nanoparticles and ELIK-B. In some embodiments, the microgel comprises alginate, platinum nanoparticles and ELIK-B.

[0097] In some embodiments, the size of the platinum nanoparticle is between 1 and 10 nm, such as between 1 and 9 nm, such as between 1 and 8 nm, such as between 1 and 7 nm, such as between 1 and 6 nm, such as between 1 and 5 nm, such as between 1 and 4 nm, such as between 1 and 3 nm, such as between 1 and 2 nm, such as between 2 and 10 nm, such as between 2 and 9 nm, such as between 2 and 8 nm, such as between 2 and 7 nm, such as between 2 and 6 nm, such as between 2 and 5 nm, such as between 2 and 4 nm, such as between 2 and 3 nm, such as between 3 and 10 nm, such as between 3 and 9 nm, such as between 3 and 8 nm, such as between 3 and 7 nm, such as between 3 and 6 nm, such as between 3 and 5 nm, such as between 3 and 4 nm, such as between 4 and 10 nm, such as between 4 and 9 nm, such as between 4 and 8 nm, such as between 4 and 7 nm, such as between 4 and 6 nm, such as between 4 and 5 nm, such as between 5 and 10 nm, such as between 5 and 9 nm, such as between 5 and 8 nm, such as between 5 and 7 nm, such as between 5 and 6 nm, such as between 6 and 10 nm, such as between 6 and 9 nm, such as between 6 and 8 nm, such as between 6 and 7 nm, such as between 7 and 10 nm, such as between 7 and 9 nm, such as between 7 and 8 nm, such as between 8 and 10 nm, such as between 8 and 9 nm, or such as between 9 and 10 nm.

[0098] Functions of the microgel

[0099] As described herein the microgels of the present disclosure comprise salen- manganese complexes. Salen-manganese complexes are antioxidative compounds that exhibit dual functions, i.e. superoxide dismutase- and catalase-mimetic activities. In addition to the salen-manganese complexes, the microgels of the present disclosure may further comprise platinum nanoparticles. These nanoparticles exhibit peroxidase- like activity (producing OH) under acidic conditions and catalase-like activity (producing H2O and O2) as well as SOD-like activity (scavenging 02 ") at neutral and alkaline conditions.

[0100] In some embodiments, the microgel is anti-oxidative. In some embodiments, the microgel comprise ELIK-B and / or alginate and is anti-oxidative. In some embodiments, the microgel comprise platinum nanoparticles and / or alginate and is anti-oxidative.

[0101] The effect of co-culturing cells with microgel may be assessed using a number of assays. A non-limiting example is the assessment of the cellular response to stressors in the presence of a microgel comprising salen-manganese complex compared to the cellular response to stressors in presence of microgels lacking salen-manganese complexes or compared to cells lacking the co-culturing with a microgel.

[0102] In some embodiments, the microgel decreases or is capable of decreasing a response to a pathophysiological stressor in cells upon co-culturing with said microgel compared to cells without the co-culturing with said microgel. In some embodiments, the microgel decreases or is capable of decreasing the response to reactive oxygen species in cells upon co-culturing with said microgel compared to cells without the co-culturing with said microgel.

[0103] The pathophysiological stressor can be selected from a number of oxidative compounds. In some embodiments, the pathophysiological stressor is hydrogen peroxide or tert-butyl hydroperoxide. In some embodiments, the microgel decreases or is capable of decreasing the response to lipid-mediated oxidant stress and / or per- oxidant stress in cells upon co-culturing with said microgel compared to cells without the co-culturing with said microgel. In some embodiments, the microgel decreases or is capable of decreasing the response to inflammatory conditions in cells upon co- culturing with said microgel compared to cells without the co-culturing with said microgel. In some embodiments, the microgel decreases or is capable of decreasing the response to endotoxins, such as lipopolysaccharides (LPS), in cells upon co- culturing with said microgel compared to cells without the co-culturing with said microgel.

[0104] In another embodiment, the present disclosure concerns a method of decreasing a response to a pathophysiological stressor in cells, said method comprising a step of co- culturing the microgel with said cells, optionally wherein the pathophysiological stressor is hydrogen peroxide or tert-butyl hydroperoxide.

[0105] In another embodiment, the present disclosure concerns a method of decreasing a response to reactive oxygen species (ROS) in cells, said method comprising a step of co-culturing the microgel with said cells.

[0106] In another embodiment, the present disclosure concerns a method of decreasing a response to lipid-mediated oxidant stress and / or per-oxidant stress in cells, said method comprising a step of co-culturing the microgel with said cells.

[0107] In another embodiment, the present disclosure concerns a method of decreasing a response to inflammatory conditions in cells, said method comprising a step of co- culturing the microgel with said cells.

[0108] In another embodiment, the present disclosure concerns a method of decreasing a response to endotoxins, such as lipopolysaccharides (LPS), in cells, said method comprising a step of co-culturing the microgel with said cells.

[0109] In some embodiments, the cells are hepatic cells.

[0110] The oxidative stress may lead to cell death when cells are exposed to e.g. hydrogen peroxide and / or ter-butyl hydroperoxide. The microgels comprising salen-manganese of the present invention may in some embodiment increase the cell viability of cells exposed to these compounds compared to cells cocultured with microgels lacking salen-manganese complexes or cells lacking coculturing with microgels. In some embodiments, the microgel increases or is capable of increasing cell viability when exposed to hydrogen peroxide and / or tert-Butyl hydroperoxide. In some embodiments, the microgel increases or is capable of increasing the EC50 of HepG2 challenged with H2O2 or tBuOOH by at least 1.5 fold, such as at least 1.6 fold, such as at least 1 .7 fold, such as at least 1 .8 fold, such as at least 1.9 fold, or such as at least 2 fold. In some embodiments, the salen-manganese complexes are active at least 3 days in culture, such as at least 4 days, such as at least 5 days, such as at least 6 days, such as at least 7 days, such as at least 8 days, such as at least 9 days, such as at least 10 days in culture. Medical uses

[0111] As described herein above, the microgel of the present disclosure comprise salen- manganese complexes, which exhibit dual functions, i.e. superoxide dismutase- and catalase-mimetic activities. Without being bound by theory, the redox state constitutes an important underlying factor in a number of liver disorders and participates in the development of inflammatory, metabolic and proliferative liver diseases. Under normal conditions, the antioxidative stress is balanced by molecular strategies in the hepatic cells. However, if the oxidative capacity of antioxidant agents in the cells are outcompeted by the oxidants, the oxidative stress may cause damage of cellular structures such as DNA. The antioxidative microgel of the present disclosure may be used in the treatment of liver diseases, such as liver failure.

[0112] In another embodiment, the present disclosure concerns a microgel comprising one or more salen-manganese complexes for use in the treatment of a liver disease, such as liver failure.

[0113] In another embodiment, the present disclosure concerns a use of a microgel comprising one or more salen-manganese complexes for the manufacture of a medicament for the treatment of a liver disease, such as liver failure.

[0114] In another embodiment, the present disclosure concerns a method of treatment or prevention of a liver disease, such as liver failure, said method comprising one or more steps of administering a microgel of the present disclosure to an individual in need thereof.

[0115] In some embodiments, the present disclosure concerns a method of treatment or prevention of liver failure comprising administration of a microgel to a subject in need thereof.

[0116] In some embodiments, the liver disease is selected from the group consisting of fatty liver disease (FLD), such as hepatic steatosis and non-alcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver cirrhosis, liver cancer, such as hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), hepatitis, such as hepatitis A, hepatitis B and hepatitis C, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, cholestasis and liver failure.

[0117] In some embodiments, the liver disease is liver failure. In some embodiments, the microgel is for use in the treatment of liver failure. In some embodiments, the liver failure is acute or acute-on-chronic liver failure. In some embodiments, the subject is a human subject.

[0118] Other uses

[0119] In some embodiments, the microgel is for use in ex vivo culturing of liver cells, such as wherein liver cells are co-cultured with said microgel. In some embodiments, the microgel reduces the amount of reactive oxidative species in the liver milieu in the subject in need thereof.

[0120] The microgels of the present disclosure may further be used in bionic tissue. In some embodiments, the microgel is for use in sustaining bionic tissue.

[0121] In another embodiment, the present disclosure concerns a bionic tissue system comprising the microgel.

[0122] In some embodiments, the microgel is for use in stabilizing a subject in need of an organ transplantation until said subject can undergo the organ transplantation. In some embodiments, the organ transplantation is liver transplantation. The transplantation may be a liver transplantation which is performed to replace a diseased liver with a healthy liver from another person. A whole liver may be transplanted, or just part of one.

[0123] In another embodiment, the present disclosure concerns a cellular composition comprising the microgel and one or more cells. In some embodiments, the one or more cells are hepatocytes and / or endothelial cells. In some embodiments, the cellular composition as described herein further comprising a support medium, such as a cellulose support.

[0124] In another embodiment, the present disclosure concerns a tissue culture system comprising the microgel and a support medium, such as a cellulose support. In another embodiment, the present disclosure concerns a system comprising the microgel.

[0125] In another embodiment, the present disclosure concerns a paper chip comprising the microgel.

[0126] In another embodiment, the present disclosure concerns an artificial cell (AC) comprising the microgel.

[0127] The subject may receive other therapies in concert with the use of the microgels of the present disclosure. In some embodiments, N-acetyl cysteine is co-administrated to the subject in need thereof.

[0128] The microgel of the present disclosure may be administrate to a subject in need thereof and may for example be formulated in a composition further comprising excipients. Such excipients include any commonly used excipients in pharmaceutics and should be selected on the basis of compatibility and the release profile properties of the desired dosage form. Exemplary carrier materials include, e.g., binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like. "Pharmaceutically compatible carrier materials" may comprise, e.g., acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerine, magnesium silicate, sodium caseinate, soy lecithin, sodium chloride, tricalcium phosphate, dipotassium phosphate, sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, and the like.

[0129] In another embodiment, the present disclosure concerns a method of reducing reactive oxidative species and response to inflammatory conditions in hepatic cells using a microgel.

[0130] In some embodiments, the response, the inflammatory conditions and the hepatic cells, is as defined herein. Compositions

[0131] In another embodiment, the present disclosure concerns a composition comprising the microgel and one or more excipients.

[0132] In another embodiment, the present disclosure concerns a pharmaceutical composition comprising the microgel and one or more pharmaceutically acceptable excipients.

[0133] In another embodiment, the present disclosure concerns an ex vivo composition comprising the microgel and one or more excipients.

[0134] Kit

[0135] The microgel of the present disclosure may further be distributed in the form of a kit.

[0136] In another embodiment, the present disclosure concerns a kit of parts comprising a. a microgel; and b. instructions for use.

[0137] In another embodiment, the present disclosure concerns a kit for ex vivo culturing of liver cells, wherein the kit comprises a. a microgel; and b. instructions for use.

[0138] Manufacturing

[0139] In another embodiment, the present disclosure concerns a method of manufacturing a microgel, wherein the method comprises the steps of: a) contacting low molecular weight alginate and high molecular weight alginate; b) thereby obtaining an alginate solution; and c) contacting said alginate solution comprising a salen-manganese complex, such as ELIK-B; thereby obtaining a microgel comprising a salen-manganese complex, such as EUK-B.

[0140] Examples

[0141] Abbreviations:

[0142] HEPES 4-(2-hydroxyethyl)piperazine-1-ethane-sulfonic acid

[0143] NaCI sodium chloride HCI hydrochloric acid

[0144] NaOH sodium hydroxide

[0145] DMSO dimethyl sulfoxide

[0146] MEME minimum essential medium eagle (M2279, Sigma Aldrich)

[0147] PBS phosphate buffered saline

[0148] FBS Fetal bovine serum

[0149] TEM Transmission Electron Microscopy

[0150] PtNPs Platinum Nanoparticles

[0151] Example 1

[0152] Materials , 0.25% trypsin-EDTA, calcium chloride dihydrate (CaCh, purity > 99.0%), cell counting kit CCK-8, hydrogen peroxide (H2O2, 30% (w / w)), o-dianisidine, SOD determination kit (19160), hexachloroplatinic acid, sodium borohydride, trisodium citrate, o-dianisidine, SOD determination kit (19160), , MEM non-essential amino acid solution, ethanol 96%, and Neutral Red were purchased from Sigma Aldrich. DMEM glucose free (11966025), sodium pyruvate, L-glutamine, GlutaMAX, streptomycin and penicillin, qualitative filter papers grade 600 (516-0309), dichlorodihydrofluorescein diacetate (carboxy-F^DCFDA), and tert-Butyl hydroperoxide (70% Solution in water) were purchased from Thermo Fisher Scientific. Ultrapure low molecular weight sodium alginate with high a-L-guluronate (G block) (Mw< 75 kDa, > 60 % G block content, PRONOVA, UP VLVG), ultrapure high molecular weight sodium alginate with high G block content (Mw> 200 kDa, > 60 % G block content, PRONOVA, UP MVG) was purchased from NovaMatrix.

[0153] HEPES buffer consisted of 10 mM HEPES and 150 mM NaCI at pH 7.4. Ultrapure water (18.2 MQ cm resistance) was provided by an ELGA Purelab Ultra system (ELGA LabWater, Lane End).

[0154] Platinum Nanoparticles (PtNPs): PtNPs were synthesized based on a previously published protocol

[0011] , Briefly, 1 mL of a hexachloroplatinic acid solution (H2PtCl6) (32 mM in ultrapure water) was mixed with 1 mL of a trisodium citrate solution (80 mM in ultrapure water) and 32 mL ultrapure water and left to stir for 30 min at room temperature. Then, 400 pL of a NaBH4 solution (100 mM) was added, which turned the solution dark brown, and was left under stirring for 1 h at room temperature, to yield citrate-capped PtNPs. PtNPs were visualized using Transmission Electron Microscopy (TEM). 300 mesh copper formvar / carbon grids were treated with glow discharging, and 4 pL of PtNP solution were added to the grid. The solution was left to adsorb for 30 s before blotting the excess sample. TEM images were taken with a Tecnai G2 Spirit Instrument (TWIN / BioTWIN, FEI co.). The size distribution was measured from 150 PtNPs from a single repeat. (Figure 2)

[0155] Microgel Preparation: PtNPs and ELIK-B were directly encapsulated in alginate-based microgels to yield microgel ACptNPor microgel ACEUK'B. Specifically, 37.5 mg UP MVG alginate was mixed with 37.5 mg UP VLVG alginate (Pronova) and dissolved overnight in either 5 mL of the PtNP stock solution (final alginate concentration of 15 mg mL-1). Alternatively, 37.5 mg UP MVG alginate was mixed with 37.5 mg UP VLVG alginate and dissolved in 4310 pL HEPES buffer overnight. Then, the 17.4 mg mL-1alginate solution was added dropwise over -10 min to 690 pL of a 33.3 mg mL-1EUK-B in DMSO solution while vortexing to yield a final concentration of EUK-B of 0.46 mg mL-1and 15 mg mL-1alginate. Empty microgel AC0was made by mixing 37.5 mg UP MVG alginate with 37.5 mg UP VLVG alginate followed by dissolving in 5 mL HEPES buffer.

[0156] The resulting alginate solutions were loaded into a 20 mL syringe and connected to an Encapsulator B-390 (Buchi). A 200 pm inner and a 300 pm outer nozzle were used to form microgels of -200 pm. The syringe was fixed onto a pump and injected at a speed of 1.1 mL min-1. A frequency of 1300 Hz, a pressure of 0.945 mbar, a voltage of 800 V, and an air flow of 0.5 Nl min-1was used during microgel fabrication. The cross-linked particles were collected in a glass beaker containing 0.1 M CaCh under stirring, and were collected in a 40 pm cell strainer (Corning). The alginate microgels were visualized using an inverted Olympus microscope (1X81), and the size distribution was assessed from the images using Imaged. The size distribution was fitted with a Gaussian Amplitude function with Origin software, and the sizes are given as p±2o. A minimum of 300 particles were measured for each sample from three independent repeats.

[0157] Preparation of paper chip: The paper chips were prepared using a previously published protocol

[0012] , The diameter of the circular paper chips was chosen to have an inner and outer diameter of 1.3 cm and 2.0 cm to fit into a 12-well plate, and the width of the printed ring 0.35 cm. A central cross with a width of 0.1 cm was included to improve the floating of the paper chips. The pattern on the circular paper chips was designed in Microsoft Powerpoint and printed onto both sides of an A0 VWR qualitative filter paper grade 600 (516-0309), which was cut to an A4 size, using a LaserJet printer (Xerox WorkCentre 7845). The printed sheets were autoclaved to melt the ink particles that resulted in a hydrophobic barrier that allows the paper chip to float on aqueous solutions. The individual circular paper chips were cut out under sterile conditions when used in cell experiments, and applied to the top of the wells using a tweezer.

[0158] Results

[0159] The PtNPs and ELIK-B were encapsulated in alginate particles to form antioxidative microgels. The PtNPs or ELIK-B were dispersed in an alginate solution made from a mixture of low and high molecular weight alginate with high a-L-guluronate content. These solutions were used to make alginate-based microgels in Encapsulator B-390 followed by cross-linking in a calcium bath, yielding microgel ACptNPand microgel ACEUK'B. Microgels made of only alginate were made as controls and referred to as microgel AC0. Microgel AC0and microgel ACptNPshowed two populations in their size distribution (microgel AC0diameters of - 97 pm and 148 pm; microgel ACptNPdiameters of -134 pm and 226 pm). In contrast, microgel ACEUK'Bwas a single population with diameters of - 83 pm (Figure 3).

[0160] Example 2

[0161] Two different moieties, namely PtNP and an EUK derivative, with known SOD-like and catalase-like activity were compared for their ability to provide the active part in the antioxidant microgels. PtNPs exhibit peroxidase-like activity (producing OH) under acidic conditions and catalase-like activity (producing H2O and O2) as well as SOD-like activity (scavenging 02 ") at neutral and alkaline conditions.

[0162] Hydrogen peroxide (H2O2) and tert-butyl hydroperoxide (tBuOOH) detection assay: H2O2 and tBuOOH concentrations were detected to determine the PtNP and EUK-B activity. 100 mg microgel ACptNP, microgel ACEUK'Bor microgel AC0, prepared as described in Example 1 , were weighed off and placed on top of a floating paper chip, prepared as described in Example 1 , in a 12 well plate containing 1350 pL of either ultrapure water, PBS or cell media. 150 pL of 10 mM H2O2 was added to each well (final concentration of 1 mM H2O2). Wells with 1 mM H2O2 in ultrapure water, PBS or cell media without any paper chip or only a paper chip without any microgels were prepared as controls for the natural decomposition of H2O2. 10 pL from each well was taken out after 1 h, 3 h, 6 h or 8 h and the H2O2 concentration was detected immediately by adding 50 pL reaction mixture consisting of 0.13 mM o-dianisidine hydrochloride and 2 U mL"1Horse Radish Peroxidase in ultrapure water. The absorbance was monitored (A = 450 nm) using a multiplate reader (Perkin Elmer) immediately after adding the reaction mixture. A standard curve (25-1000 pM H2O2) was prepared in ultrapure water, PBS buffer or cell media and linear regression was used to determine H2O2 concentrations. Alternatively, the assay was performed with tBuOOH, where the removal of 70 mM tBuOOH was followed over 4 h in PBS. It should be noted that the o-dianisidine-based assay could only detect the conversion when significantly higher concentrations of tBuOOH were used compared to H2O2. Three independent repeats in triplicate were performed for each experiment.

[0163] Results

[0164] The H2O2 removal ability of the microgels was determined by loading 100 mg microgel AC on floating paper chips placed in the wells of a 12 well plate containing either 1.5 mL PBS buffer (Figure 4ai) or cell media (Figure 4aii) spiked with 1 mM H2O2. The floating paper chips were made by printing a ring in a regular ink jet printer followed by autoclaving to melt the ink particles into a hydrophobic barrier. The H2O2 consumption of microgel ACEUK'Band microgel ACptNPafter 1 , 3, 6 and 8 h was comparable in PBS and cell media i.e. , the possible protein corona formation on PtNPs in cell media did not affect the performance of the surface catalyst. As expected, microgel AC0did not lower the H2O2 concentration. However, there is a trend for more efficient H2O2 removal by microgel ACEUK'Bthan microgel ACptNP, an effect that was statistically significant in both PBS and cell media. The initial removal of H2O2 removal in cell media by microgel ACEUK'Band microgel ACptNPwas -0.23 and -0.12 mM H2O2 per hour, respectively, which was determined by fitting the slope of the curve from 0-3 h with linear regression.

[0165] Example 3

[0166] Superoxide dismutase (SOD) activity assay: SOD activity was evaluated using a commercially available kit (19160, Sigma Aldrich) and the WST working solution and enzyme working solution was prepared according to the manufacturer’s protocol. 1 mg, 2.5 mg, 5 mg, or 10 mg microgel ACptNP, microgel ACEUK'Bor microgel AC0were added to floating paper chips in a 12 well plate. Each well contained 100 pL ultrapure water, 1000 pL WST working solution and 100 pL enzyme working solution. Negative controls were included where no enzyme working solution (blank) or no microgels were added. The plate was left for 30 min at 37 °C before 100 pL was transferred from each well to a 96 well plate, and the absorbance was monitored (A = 450 nm) using a multiplate reader (Perkin Elmer). The SOD-like activity is given as

[0167] Inhibition rate repeats in triplicate were performed for each experiment.

[0168] Results

[0169] The SOD-like activity of microgel ACEUK'Band microgel ACptNPwas evaluated in the same set-up in PBS using 10-100 mg microgel AC per paper chip (Figure 5). The SOD-like activity could not be evaluated in cell media, because the xanthine oxidase enzyme that produce O2 ‘ was not active. Microgel AC0exhibited no O2 ‘ scavenging ability while already 10 mg microgel ACEUK'Band microgel ACptNPreached ~70 % SOD-like activity that increased to 95 % for 100 mg microgel AC. Initially, microgel ACEUK'Bresulted in ~ 10% higher SOD activities compared to microgel ACptNP.

[0170] Example 4

[0171] Culturing of HepG2 cells: The human liver cancer cell line HepG2 was purchased from European Collection of Cell Cultures. HepG2 cells were cultured in 75 cm2(TC-treated) culture flasks in glucose free DM EM at 37 °C and 5% CO2. The media was supplemented with 10% FBS, 2 mM glutamine, 100 pg mL-1streptomycin, and 100 II mL-1penicillin, 10 mM galactose, and 1 mM sodium pyruvate.

[0172] Cell viability of H2O2' or tBuOOH-challenged HepG2 cells: 1 mL of 500x103HepG2 cells mL-1were seeded per well in a 12 well plate, and left to adhere overnight at 37 °C and 5% CO2. Then, the cell media was exchanged to 1350 pL media and the floating paper chips, prepared as described in Example 1 , were added to each well. 100 mg of microgel AC0, microgel ACptNP, or microgel ACEUK'B, prepared as described in Example 1 , were added to each paper chip. Alternatively, 50 mg microgel ACptNPand 50 mg microgel ACEUK-Bwereadded to each paper chip, referred to as microgel ACEUK'B / ptNP. 3 doses of 150 pL of 1-5 mM H2O2 were added to each well over 9 h with 3 h intervals (final concentrations of 0.1 -0.5 mM H2O2). During the 9 h H2O2 exposure, the cells were left to incubate while shaking at 37 °C and 5% CO2. Then, the cell viability was measured using cell counting kit-8 solution (CCK-8) after removing the paper chips. The HepG2 cells were washed once with PBS, and 1000 pL of cell medium containing 25 pL of CCK-8 was added to each well of a 12 well plate. The plates were left to incubate for 2 h at 37 °C in 5% CO2 before 100 pL media were transferred to each well of a 96-well plate, and the absorbance (A = 450 nm) was monitored using a multimode plate reader (Perkin Elmer). If required, the HepG2 cells were left to recover for 48 h after the 9 h H2O2 exposure before the paper chips were either left or removed from the wells and two additional doses of 150 pL of 1-5 mM H2O2 were added to each well 3 h apart followed by the cell viability assessment using CCK-8. Four independent repeats in triplicate were performed for each experiment. Alternatively, the HepG2 cells were exposed to 0.1 -0.5 mM tBuOOH for 3 h in the presence of microgel-loaded paper chips before the CCK-8 assay was performed as outlined above. Three independent repeats in triplicate were performed for each experiment.

[0173] Results

[0174] The aims was to rescue H2O2-challenged HepG2 cells using the floating paper chips loaded with microgel ACptNPand microgel ACEUK'B(Figure 6a). Specifically, HepG2 cells were exposed to 3 doses of either 0.2 or 0.3 mM H2O2 in 3 h intervals in the presence of floating paper chips loaded with either 100 mg microgel AC0, microgel ACEUK'B, microgel ACptNPor a mixture of 50 mg microgel ACEUK'Band 50 mg microgel ACptNP(referred to as microgel ACEUK'B / ptNP) before the HepG2 cell viability was assessed (Figure 6b). As expected, the empty and microgel AC°-loaded paper chip had comparable reduction in HepG2 cell viability upon exposure to H2O2 concentrations. There was not a significant difference in HepG2 cell viability depending on the type of microgel-loaded paper chips when 0.2 mM was used as the challenger. In contrast, there was a significant increase in HepG2 cell viability of ~ 40% in the presence of microgel ACEUK'Bor microgel ACEUK' B / ptNP (Fjgure©bii). However, microgel ACptNPdid not lead to a significant increase in viability, confirming the higher activity of microgel ACEUK'B. Further, this result also suggested that 50 mg microgel ACEUK'Bwas already enough to remove the added amount of H2O2. With the aim to confirm this aspect, the viability of HepG2 cells that were challenged with H2O2 in the presence of paper chips that were loaded with 50 mg microgel ACEUK'Band 50 mg microgel AC0(referred to as microgel ACEUK'B / 0) was determined. Microgel ACEUK'B / 0resulted in a ~ 30% increase in HepG2 cell viability compared to the control. This improved viability was not statistically significantly different from microgel ACEUK'Bor microgel ACEUK'B / ptNP, suggesting that microgel ACEUK'Bwere the major contributor to the HepG2 cell rescue. Consequently, only microgel ACEUK'Bwas considered for the subsequent experiments. Next, the benefit of microgel ACEUK'Bon the HepG2 cell viability was evaluated when exposed to H2O2 over longer time. Specifically, HepG2 cells were exposed to a dose of H2O2 between 0.1 and 0.5 mM every 3 h three times in the presence of the microgel ACEUK-B-loaded paper chips, before the HepG2 cells were allowed to recover for 48 h in fresh media. Next, the HepG2 cells were exposed to an additional 2 doses of H2O2 over 6 h either with the microgel ACEUK'B-loaded paper chips present or after they were removed before the HepG2 cell viability was determined (Figure 6ci). The resulting dose response curves revealed that HepG2 cells had the highest viability when the microgel ACEUK-B-loaded paper chips were present the entire duration of the experiment with an half maximal effective concentration EC50 of - 226 pM (Figure 6cii). The EC50 exhibited a statistically significant reduction to ~ 177 pM when the microgel ACEUK'B-loaded paper chips were removed following the 48 h recovery period. Conversely, when HepG2 cells were exposed to the treatment without paper chips, their EC50 was notably lower at - 128 pM. Further, the microgel ACEUK'Bwas found to be active even after4 days in culture, demonstrating the benefit of long-lasting artificial enzymes.

[0175] Effect of antioxidant microgels on tert-butyl hydroperoxide (tBuOOH)-challenged HepG2 cells

[0176] In addition to H2O2, tert-butyl hydroperoxide (tBuOOH) is another commonly used method to induce oxidative stress in short-term cell cultures. tBuOOH and other organic peroxides decompose to other alkoxyl and peroxyl radicals facilitated by metal ions, resulting in the generation of ROS including H2O2. tBuOOH is commonly used in cell culture experiments due to the increased stability over H2O2, and further tBuOOH give a more consistent cellular stress response with respect to cell viability, intracellular ROS, reduced glutathione (GSH) levels, malondialdehyde levels (as indicator of lipid peroxidation) and the activity of antioxidant enzymes.

[0177] First, tBuOOH was successfully removed from solution when floating microgel ACEUK'Bloaded paper chips were present (Figure 7a). -30% tBuOOH remained after 4 h, which was comparable to the H2O2 removal after 3 h (Figure 4a). Second, the HepG2 cells in the same set-up as above were stressed with 0.1 -0.5 pM tBuOOH for 4 h in the presence of microgel ACEUK'B-loaded paper chips before their viability was measured to obtain dose response curves (Figure 7b). The EC50 value for paper chips loaded with microgel AC0and empty paper chips were comparable (~ 135 and 127 pM, respectively), while the presence of microgel ACEUK'B-loaded paper chips resulted in a statistically significantly higher EC50 value (~ 208 pM), confirming the prior observed rescue ability of microgel ACEUK'B.

[0178] Example 5

[0179] Culturing of HHL-5 cells: HHL-5 cells were cultured in 75 cm2(TC-treated) culture flasks in either MEME or glucose free DM EM at 37 °C and 5% CO2. All media were supplemented with 10% FBS, 2 mM GlutaMAX, 100 pg mL-1streptomycin, and 100 II mL-1penicillin. In addition, 1 % MEM nonessential amino acid solution was added to the MEME media, and 10 mM galactose and 1 mM sodium pyruvate was added to the glucose free cell media.

[0180] Cell viability of tBuOOH-challenged HHL-5 cells: 1 mL of 150x103HHL-5 cells mL'1were seeded per well in a 12 well plate and left to adhere overnight at 37 °C and 5% CO2. Then, the cell media was exchanged to 1350 pL media, and 150 pL of 200-500 pM tBuOOH was added to each well (final concentrations of 20-500 pM tBuOOH), and the floating paper chips, prepared as described in Example 1 , were added to each well. 100 mg of microgel AC0or microgel ACEUK'B, prepared as described in Example 1 , were added to each paper chip. The HHL-5 cells were left to incubate while shaking at 37 °C and 5% CO2 for 24 h. The HHL-5 cell viability was assessed using CCK-8 (as for HepG2 cells) or the neutral red uptake assay. In the latter case, neutral red was dissolved in PBS (4 mg mL'1), followed by dilution 100* in FBS-free media to give a saturated neutral red (40 pg mL'1) solution, which was then left at 37 °C in 5% CO2 overnight. Then, the neutral red solution was centrifuged at 600 xg for 10 min to sediment the precipitates. The HHL-5 cells were washed once with PBS before 1 mL of neutral red containing cell medium was added to each well and left to incubate for 3 h at 37 °C in 5% CO2 followed by washing extensively (~ 5-1 Ox with PBS) until no neutral red precipitate was observed in the microscope. Each well was imaged in 300 pL HBSS using bright field microscopy. Then, the HBSS was removed from each well and 500 pL de-staining solution (50 v / v% ethanol (96%), 49 v / v% deionized water, 1 v / v% glacial acetic acid) was added to each well and left to incubate while shaking for 10 min at room temperature. 100 pL from each well was transferred to a 96 well plate, and the absorbance (A = 540 nm) was measured using a multimode plate reader. Three independent repeats in triplicate were performed for each experiment. Intracellular ROS in HHL-5 cells: The HHL-5 cells were challenged with tBuOOH as outlined above using microgel-loaded paper chips before washing 2* with PBS and followed by the addition of 500 pL carboxy-H2DCFDA solution (25 pM in PBS) to each well. The cells were left to incubate for 30 min at 37 °C in 5% CO2. In the last 5 min, Hoechst 33342 was added at 1 v / v% for a final concentration of 1 pM. The HHL-5 cells were washed 2* in PBS, and 300 pL PBS was added to each well followed by imaging using epifluorescence microscopy. The settings during imaging were kept constant allowing for quantification of the pixel intensities in the carboxy-DCF channel. The images were analyzed using Imaged. A threshold (5-255) was applied to each image to exclude background pixels and select the region of interest (the intracellular space). The mean pixel intensities from the cells were measured from min 5 images. The mean pixel intensities were normalized to the mean pixel intensity from tBuOOH-treated HHL-5 cells in the presence of empty paper chips. The relative pixel intensity from three independent repeats were measured, and a one-way analysis of variance (one-way ANOVA) followed by a Tukey's multiple comparison post hoc test was used to compare the means. Three independent repeats in duplicate were performed for each experiment.

[0181] Results

[0182] The next aim was to evaluate the antioxidative potential of the microgel ACEUK'Busing a more physiologically relevant hepatic cell line. Specifically, the human hepatocyte line HHL-5, which is more akin to the primary hepatocyte phenotype, was used as an alternative to the hepatic tumor derived HepG2 cell line. The HHL-5 cells were exposed to 0.1 -0.3 mM tBuOOH for 3 h in the presence of microgel ACEUK'B- or microgel AC°- loaded paper chips before the cell viability and the intracellular ROS levels were assessed (Figure 8a). (note that only tBuOOH was used in this case due to it better suitability for cell experiments). As expected, the presence of microgel AC°-loaded paper chips resulted in similar tBuOOH dose response curves of HHL-5 as for HHL-5 cells with empty paper chips (EC50 - 185 and -190 pM, respectively) (Figure 8b). In contrast, microgel ACEUK'B-loaded paper chips led to a statistically significantly higher EC50 value (~ 360 pM).

[0183] Additionally, the neutral red uptake assay was introduced as an alternative method for assessing cell viability, in place of the previously used CCK-8 assay. The neutral red uptake assay relies on the accumulation of a cationic dye called neutral red within the lysosomes of cells. The retention of this dye is directly influenced by the lysosomal buffering capacity of the cells, and subsequently, it correlates with the number of viable cells, similar to the formazan dye produced by cellular dehydrogenases in the CCK-8 assay. The HHL-5 cells were incubated with neutral red followed by the extraction of the dye from viable cells with an acidic EtOH solution before the absorbance (Aabs = 540 nm) of the media was measured to determine dose response curves (Figure 8ci). The presence of microgel ACEUK'B-loaded paper chips led to qualitatively more neutral red being sequestered in the lysosomes, suggesting that the cells maintained their pH gradients due to a maintained ATP production. Similar to that observed with the CCK-8 assays, the EC50 values obtained for HHL-5 cells in the presence of microgel ACEUK'B- loaded paper chips (-373 pM) were increased compared to the non-treated HHL-5 cells or HHL-5 cells in the presence of microgel AC°-loaded paper chips (-195 and -204 pM). Additionally, HHL-5 cells, when treated with 0.2 mM tBuOOH as an exemplary concentration, displayed a diminished neutral red signal within the lysosomes and a reduction in the number of cells compared to the untreated HHL-5 cells when imaged with bright field microscopy (Figure 8cii). Considering the results collectively, microgel ACEUK-B demonstrated a positive impact on the viability of tBuOOH-stressed HHL-5 cells, indicating its potential beneficial effect under these conditions.

[0184] Finally, the aim was to evaluate whether improved HHL-5 cell viability could be correlated with a decrease in intracellular ROS. To this end, 6-carboxy-2',7'- dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA), which is internalized and converted to the deacetylated, oxidized and fluorescent product carboxydichlorofluorescein (carboxy-DCF) in the presence of ROS, was used as an indicator for intracellular ROS. HHL-5 cells challenged with 200 pM tBuOOH for 3 h in the presence of empty, or microgel AC0-, or microgel ACEUK'B-loaded paper chips were imaged using fluorescence microscopy. As anticipated, HHL-5 cells exposed to tBuOOH in the presence of empty or microgel AC°-loaded paper chips had an increase in carboxy- DCF signal originating from the higher ROS levels compared to pristine HHL-5 cells. Importantly, HHL-5 in the presence of microgel ACEUK'B-loaded paper chips had a clear decrease in carboxy-DCF signal, suggesting lower ROS levels (Figure 8di). Further, the mean fluorescence intensity of the signal originating from carboxy-DCF was quantitated by determining the sum of the values of all the pixels in a region of interest, before the background corrected pixel intensities of each sample were normalized to HHL-5 cells exposed to 200 pM tBuOOH in absence any of paper chips (Figure 8dii). A significantly lower relative pixel intensity was observed for tBuOOH-challenged HHL-5 cells in the presence of microgel ACEUK'B-loaded paper chips (~ 40%) compared to HHL-5 cells in all other cases, supporting the supportive effect of microgel ACEUK'Bobserved when considering their viability.

[0185] Example 6

[0186] Methods

[0187] Materials: 4-(2-hydroxyethyl)-1 -piperazineethanesulfonic acid (HEPES), sodium chloride (NaCI), calcium chloride (CaCh), minimum essential medium eagle (MEME), non- essential amino acid solution (100x), L-glutamine, trypsin-EDTA, and clear round bottom 96-well plate Ultra-Low Attachment were purchased from Sigma Aldrich. Ethanol, calcein-AM, Ethidium homodimer I solution were purchased from VWR. Tert-Butyl hydroperoxide (70% Solution in water), fetal bovine serum (FBS), L-glutamine, Pen Strep, Antibiotic-Antimycotic, SYBR™ Power SYBR™ Green PCR Master Mix, High Capacity cDNA Reverse Transcription kit, TaqMan™ Fast Advanced Master Mix, GSR Taqman assay (Hs00167317_m1) were purchased from Thermo-Fisher. RNeasy Mini Kit was purchased from Qiagen. 1 ,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) was purchased from Avanti Lipids. Ultrapure alginate (75-200 MW, G / M < 1 and > 200 MW, G / M > 1.5) was purchased from Dupont. Ultrapure water (18.2 MQ cm resistance) was obtained from ELGA Purelab Ultra system (ELGA LabWater, Lane End). Unless otherwise stated experiments were conducted in 10 mM HEPES buffer at pH of 7.4.

[0188] Culture conditions: Human liver cancer cell line HepG2 was purchased from European Collection of Cell Cultures. HepG2 cells were cultured in 75 cm2 (TC-treated) culture flasks in MEME media at 37 °C and 5% CO2. All media were supplemented with 10% FBS, 2 x 10"3M L-glutamine, 100 pg mL-1streptomycin, 100 U mL-1penicillin and 1 % MEM nonessential amino acid.

[0189] Fabrication of microgels: Alginate solution (15 mg mL-1final concentration) in HEPES buffer (10 mM HEPES, 150 mM NaCI) was prepared by mixing high molecular weight and low molecular weight alginate (1 :1 ratio) and stirred overnight. The microgels were produced using an encapsulator (B-390 from Buchi, Switzerland) by a flow vibration nozzle. The parameters used for the microgel formation were an inner nozzle of 80 pm, outer nozzle of 200 pm, frequency of 1300 Hz, pressure of 950 mbar, potential of 800 V, flowrate of 1.1 mL min-1and a normalized airflow of 1.3 L min-1. The microgels were crosslinked on a gelation bath of 0.1 M CaCh for 5 minutes prior to collection. Then, the microgels were washed 3 times with HEPES buffer and passed through a 40 pm cell strainer followed by a 70 m and 100 pm splitting the microgels in two populations with a range size of 40-70 pm and 70-100 pm respectively. The microgels were visualized by using the inverted Olympus microscope (Olympus 1X81). The size distribution of the microgels was calculated from the brightfield images by measuring at least 100 particles employing the software Fiji. A Gaussian curve was fitted to the obtained histogram and the results are presented as mean ± 2o for 95.4% of the population.

[0190] Encapsulation of ELIK in DOPC liposome: 200 pL DOPC (25 mg mL'1in CHCh) and 165 pL EUK solution (10 mg mL-1in EtOH) were transferred to a round bottom flask and the solvent was evaporated with a N2 stream to form a thin film. Then, the flask was connected to a vacuum line overnight to completely remove any residual solvents. The film was rehydrated using 1 mL HEPES (10 mM HEPES, 150 mM NaCI, pH = 7.4) followed by sonicating for 5 seconds and vortexing for 5 seconds. The solution was transferred to an Eppendorf tube and stored in the fridge (4°C) before use.

[0191] Preparation of MicrogelEUK: 37.5 mg high molecular weight, high G block sodium alginate (Mw >200 KDa, > 60 % G content) and 37.5 mg low molecular weight, high G block content sodium alginate (Mw < 75 KDa, > 60 % G content) were mixed and dissolved in

[0192] 4 mL HEPES buffer. To this viscous solution, 1 mL of EUK liposome solution from the last step was added and the mixture was loaded into a 20 mL syringe and the microgels were formed as previously described. The microgels were collected in a CaCh bath (0.1 M in water) while stirring and cured for 10 mins in the bath before filtered through a 40 and 100 pm cell strainer.

[0193] Microgels integration into 3D cell aggregates: microgels were integrated into 3D cell aggregates at an microgel-to-cell ratio of 1 :20, 1 :10 or 1 :5 in 96-well plates with an ultralow attachment surface. Briefly, 10 000 HepG2 cells and 500, 1000 or 2000 microgels were used per aggregate in 200 pL growth medium in presence or absence of

[0194] 5 mM CaCh (final concentration). The aggregates were left to form for 5 days, being under orbital shaking (80 rpm) for the first 48 h. The media was changed 3 days after seeding and then every other day until imaging. The aggregates were visualized by brightfield microscopy after 3 and 5 days culture by using the inverted Olympus microscope. Scavenging ^uOOH MicrogelEUKaggregates: First, either 500 or 1000 microgelEUKor microgel0were integrated with 10 000 HepG2 cells as previously described and grown for 3 days. Then, 75 pM ‘BuOOH (final concentration) was added to the cell aggregates one time (1 dose, 24 hours), two (2 doses, 48 hours) or three times (3 doses, 72 hours) or 2 doses followed by 24 or 48 h resting period where the media was replaced with fresh media. The aggregates were stained with LIVE / DEAD staining and visualized by CLSM for each of the conditions as previously described.

[0195] Quantitative reverse transcription polymerase chain reaction (RT-qPCR): RNA was isolated using the RNeasy Mini Kit (Qiagen). Single-strand cDNA was synthesized from total RNA of 100 ng using High Capacity cDNA Reverse Transcription kit. After reverse transcription (RT), each sample was diluted 10x. Quantitative PCR (qPCR) was performed in duplicates on a 96-well plate in a final volume of 20 pL containing 10 pL 2x Power SYBRGreen PCR Master, 1 pL forward primers (0.5 pM final concentration), 1 pL reverse primers (0.5 pM final concentration) and 8 pL of sample (4 ng cDNA final concentration). Mitochondrial (COX I, COX II) and housekeeping gene transcripts (glyceraldehyde 3-phosphate dehydrogenase (GADPH)) expression were amplified using primer sequences (5’ to 3’, Table 1 below) using a QuantStudio™ Real-Time PCR system. In the case of GSR Taqman assays, 8 pL of sample, 1 pL Taqman assay, 10 pL TaqMan™ Fast Advanced Master Mix and 1 pL nuclease free H2O was used. The changes in the expression were determined using the delta-delta-Ct method using GAPDH as internal standard to correct for differences in starting mRNA concentrations. The data was represented as fold-change relative to aggregates with no treatment. Two technical repeats and three independent repeats were performed.

[0196] Oligo Name Sequence (5' to 3')

[0197] GAPDH Forward AGCCACATCGCTCAGACAC (SEQ ID NO: 1)

[0198] GAPDH Reverse GCCCAATACGACCAAATCC (SEQ ID NO: 2)

[0199] COX I Forward GGAGCAGGAACAGGTTGAACAG (SEQ ID NO: 3)

[0200] COX I Reverse GTTGTGATGAAATTGATGGC (SEQ ID NO: 4)

[0201] COX II Forward CGTCTGAACTATCCTGCCCG (SEQ ID NO: 5)

[0202] COX II Reverse TGGTAAGGGAGGGATCGTTG (SEQ ID NO: 6)

[0203] Table 1. Overview over the primes used to quantify mitochondrial transcripts.

[0204] Results The results are shown in Figure 9 as representative CLSM images after 1 dose (i), 2 doses (ii), 3 doses (iii), 2 doses plus 24h rest (iv) and 2 doses plus 48 h rest (v) (Figure 9 b)), expression of mitochondrial markers COX I (i) and COX II (ii) (Figure 9 c)), and expression of glutathione reductase (GSR) marker (Figure 9 d)).

[0205] In conclusion, EUK-loaded microgels could revert intracellular markers of the mitochondria and antioxidant enzymes in tBuOOH-stressed HepG2 cells to the level of pristine HepG2 cells.

[0206] References

[0207] 1. Elani, Y., Angew. Chem. Int. Ed. 2021 , 60, 5602-5611.

[0208] 2. Itel, F., Skovhus Thomsen, J. & Stadler, B., ACS Applied Materials & Interfaces. 2018, 10, 30180-30190.

[0209] 3. Armada-Moreira, A., Taipaleenmaki, E., Baekgaard-Laursen, M., Schattling, P.S., Sebastiao, A.M., Vaz, S.H. & Stadler, B., ACS Applied Materials & Interfaces. 2018, 10, 7581-7592.

[0210] 4. Armada-Moreira, A., Coelho, J.E., Lopes, L.V., Sebastiao, A.M., Stadler, B. & Vaz, S.H., Advanced Biosystems. 2020, 4, 2000139.

[0211] 5. Chen, P., Ning, X., Li, W., Pan, Y., Wang, L., Li, H., Fan, X., Zhang, J., Luo, T., Wu, Y., Ou, C. & Chen, M., Bioactive Materials. 2022, 14, 416- 429.

[0212] 6. Krinsky, N., Kaduri, M., Zinger, A., Shainsky-Roitman, J., Goldfeder, M., Benhar, I., Hershkovitz, D. & Schroeder, A., Advanced Healthcare Materials. 2018, 7, 1701163.

[0213] 7. Westensee, I.N. & Stadler, B., Interface Focus. 2023, accepted.

[0214] 8. Qian, X., Westensee, I.N., Fernandes, C.C. & Stadler, B., Angew. Chem. Int. Ed. 2021, 60, 18704-18711.

[0215] 9. Zhang, Y., Schattling, P.S., Itel, F. & Stadler, B., ACS Omega. 2017, 2, 7085-7095.

[0216] 10. Zhang, Y., Baekgaard-Laursen, M. & Stadler, B., Advanced Healthcare Materials. 2017, 6.

[0217] 11. Buddingh’, B.C. & van Hest, J.C.M., Acc. Chem. Res. 2017, 50, 769-777.

[0218] 12. De Dios Andres, P., Westensee, I.N., Brodszkij, E., Ramos-Docampo, M.A., Gal, N. & Stadler, B., Biomacromolecules. 2021 , 22, 3860-3872. 13. Banerjee P et al 2023 “Oxidative Stresselnduced Liver Damage and

[0219] Remodeling of the Liver Vasculature”.

[0220] Items 1. A microgel comprising one or more salen-manganese complexes.

[0221] 2. A microgel comprising one or more salen-manganese complexes for use in the treatment of a liver disease, such as liver failure.

[0222] 3. The microgel or the microgel for use according to any one of the preceding items, wherein the one or more salen-manganese complexes is selected from the group consisting of ELIK-8 of formula (I), EUK-134 of formula (II), EUK-189 of formula (III) and EUK-207 of formula (IV)

[0223] (II),

[0224] The microgel or the microgel for use according to any one of the preceding items, wherein the one or more salen-manganese complexes is selected from the group consisting of ELIK-A of formula (V), ELIK-B of formula (VI), ELIK-C of formula (VII) or ELIK-D of formula (VIII)

[0225]

[0226] (VIII).

[0227] 5. The microgel or the microgel for use according to any one of the preceding

[0228] 5 items, wherein the one or more salen-manganese complexes is ELIK-B of formula (VI) The microgel or the microgel for use according to any one of the preceding items, wherein the microgel further comprises platinum nanoparticles. The microgel or the microgel for use according to any one of the preceding items, wherein the size of the platinum nanoparticle is between 1 and 10 nm, such as between 1 and 9 nm, such as between 1 and 8 nm, such as between 1 and 7 nm, such as between 1 and 6 nm, such as between 1 and 5 nm, such as between 1 and 4 nm, such as between 1 and 3 nm, such as between 1 and 2 nm, such as between 2 and 10 nm, such as between 2 and 9 nm, such as between 2 and 8 nm, such as between 2 and 7 nm, such as between 2 and 6 nm, such as between 2 and 5 nm, such as between 2 and 4 nm, such as between 2 and 3 nm, such as between 3 and 10 nm, such as between 3 and 9 nm, such as between 3 and 8 nm, such as between 3 and 7 nm, such as between 3 and 6 nm, such as between 3 and 5 nm, such as between 3 and 4 nm, such as between 4 and 10 nm, such as between 4 and 9 nm, such as between 4 and 8 nm, such as between 4 and 7 nm, such as between 4 and 6 nm, such as between 4 and 5 nm, such as between 5 and 10 nm, such as between 5 and 9 nm, such as between 5 and 8 nm, such as between 5 and 7 nm, such as between 5 and 6 nm, such as between 6 and 10 nm, such as between 6 and 9 nm, such as between 6 and 8 nm, such as between 6 and 7 nm, such as between 7 and 10 nm, such as between 7 and 9 nm, such as between 7 and 8 nm, such as between 8 and 10 nm, such as between 8 and 9 nm, or such as between 9 and 10 nm.

[0229] 8. The microgel or the microgel for use according to any one of the preceding items, wherein the concentration of salen-manganese complex in a solution is between 0.001 and 10 mg mL-1, such as between 0.01 and 9 mg mL-1, such as between 0.1 and 8 mg mL-1, such as between 0.1 and 7 mg mL-1, such as between 0.1 and 6 mg mL-1, such as between 0.1 and 5 mg mL-1, such as between 0.1 and 4 mg mL-1, such as between 0.1 and 3 mg mL-1, such as between 0.1 and 2 mg mL-1, or such as between 0.1 and 1 mg mL-1.

[0230] 9. The microgel or the microgel for use according to any one of the preceding items, wherein the concentration of salen-manganese complex in a solution is between 0.1 and 1 mg mL-1, such as between 0.1 and 0.9 mg mL-1, such as between mg mL-10.1 and 0.8 mg mL-1, such as between 0.1 and 0.7 mg mL-1, such as between 0.1 and 0.6 mg mL-1, such as between 0.1 and 0.5 mg mL-1, such as between 0.1 and 0.45 mg mL-1, such as between 0.1 and 0.4 mg mL- 1, such as between 0.1 and 0.3 mg mL-1, such as between 0.1 and 0.2 mg mL-

[0231] 1, such as between 0.2 and 0.9 mg mL-1, such as between 0.2 and 0.8 mg mL-

[0232] 1, such as between 0.2 and 0.7 mg mL-1, such as between 0.2 and 0.6 mg mL-

[0233] 1, such as between 0.2 and 0.5 mg mL-1, such as between 0.2 and 0.45 mg mL-1, such as between 0.2 and 0.4 mg mL-1, such as between 0.2 and 0.3 mg mL-1, such as between 0.3 and 0.9 mg mL-1, such as between 0.3 and 0.8 mg mL-1, such as between 0.3 and 0.7 mg mL-1, such as between 0.3 and 0.6 mg mL-1, such as between 0.3 and 0.5 mg mL-1, such as between 0.3 and 0.45 mg mL-1, such as between 0.3 and 0.4 mg mL-1, such as between 0.4 and 0.9 mg mL-1, such as between 0.4 and 0.8 mg mL-1, such as between 0.4 and 0.7 mg mL-1, such as between 0.4 and 0.6 mg mL-1, such as between 0.4 and 0.5 mg mL-1, such as between 0.4 and 0.45 mg mL-1, such as between 0.45 and 0.9 mg mL-1, such as between 0.45 and 0.8 mg mL-1, such as between 0.45 and 0.7 mg mL-1, such as between 0.45 and 0.6 mg mL-1, such as between 0.45 and 0.5 mg mL-1, such as between 0.5 and 0.9 mg mL-1, such as between 0.5 and 0.8 mg mL-1, such as between 0.5 and 0.7 mg mL-1, such as between 0.5 and 0.6 mg mL-1, such as between 0.6 and 0.9 mg mL-1, such as between 0.6 and 0.8 mg mL-1, such as between 0.6 and 0.7 mg mL-1 , such as between 0.7 and 0.9 mg mL-1, such as between 0.7 and 0.8 mg mL-1 , such as between 0.8 and 0.9 mg mL-1, such as between 1 and 0.9 mg mL-1 , such as between 1 and 0.8 mg mL-1, such as between 1 and 0.7 mg mL-1, such as between 1 and 0.6 mg mL-1, such as between 1 and 0.5 mg mL-1, such as between 1 and 0.45 mg mL-1 , such as between 1 and 0.4 mg mL-1 , such as between 1 and 0.3 mg mL-1 , or such as between 1 and 0.2 mg mL-1. The microgel or the microgel for use according to any one of the preceding items, wherein the concentration of a salen-manganese complex selected from the group consisting of EUK-134, EUK-A, EUK-B, EUK-C or EUK-D in a solution is between 0.1 and 1 mg mL-1 , such as between 0.1 and 0.9 mg mL-1 , such as between 0.1 and 0.8 mg mL-1, such as between 0.1 and 0.7 mg mL-1 , such as between 0.1 and 0.6 mg mL-1, such as between 0.1 and 0.5 mg mL-1 , such as between 0.1 and 0.45 mg mL-1, such as between 0.1 and 0.4 mg mL- 1 , such as between 0.1 and 0.3 mg mL-1 , such as between 0.1 and 0.2 mg mL-

[0234] 1 , such as between 0.2 and 0.9 mg mL-1 , such as between 0.2 and 0.8 mg mL-

[0235] 1 , such as between 0.2 and 0.7 mg mL-1 , such as between 0.2 and 0.6 mg mL-

[0236] 1 , such as between 0.2 and 0.5 mg mL-1 , such as between 0.2 and 0.45 mg mL-1 , such as between 0.2 and 0.4 mg mL-1 , such as between 0.2 and 0.3 mg mL-1 , such as between 0.3 and 0.9 mg mL-1 , such as between 0.3 and 0.8 mg mL-1 , such as between 0.3 and 0.7 mg mL-1 , such as between 0.3 and 0.6 mg mL-1 , such as between 0.3 and 0.5 mg mL-1 , such as between 0.3 and 0.45 mg mL-1, such as between 0.3 and 0.4 mg mL-1, such as between 0.4 and 0.9 mg mL-1, such as between 0.4 and 0.8 mg mL-1, such as between 0.4 and 0.7 mg mL-1, such as between 0.4 and 0.6 mg mL-1, such as between 0.4 and 0.5 mg mL-1, such as between 0.4 and 0.45 mg mL-1, such as between 0.45 and 0.9 mg mL-1 , such as between 0.45 and 0.8 mg mL-1 , such as between 0.45 and 0.7 mg mL-1 , such as between 0.45 and 0.6 mg mL-1, such as between 0.45 and 0.5 mg mL-1 , such as between 0.5 and 0.9 mg mL-1, such as between 0.5 and 0.8 mg mL-1, such as between 0.5 and 0.7 mg mL-1 , such as between 0.5 and 0.6 mg mL-1, such as between 0.6 and 0.9 mg mL-1 , such as between 0.6 and 0.8 mg mL-1, such as between 0.6 and 0.7 mg mL-1 , such as between 0.7 and 0.9 mg mL-1, such as between 0.7 and 0.8 mg mL-1 , such as between 0.8 and 0.9 mg mL-1, such as between 1 and 0.9 mg mL-1 , such as between 1 and 0.8 mg mL-1, such as between 1 and 0.7 mg mL-1, such as between 1 and 0.6 mg mL-1, such as between 1 and 0.5 mg mL-1, such as between 1 and 0.45 mg mL-1 , such as between 1 and 0.4 mg mL-1 , such as between 1 and 0.3 mg mL-1 , or such as between 1 and 0.2 mg mL-1.

[0237] 11. The microgel or the microgel for use according to any one of the preceding items, wherein the solution is a 15 mg mL-1 alginate solution.

[0238] 12. The microgel or the microgel for use according to any one of the preceding items, wherein the concentration of EUK-B is between 0.1 and 0.8 mg mL-1 , such as between 0.2 and 0.7 mg mL-1, such as between 0.3 and 0.6 mg mL-1 , such as between 0.4 and 0.5 mg mL-1 and the solution is a 15 mg mL-1 alginate solution

[0239] 13. The microgel or the microgel for use according to any one of the preceding items, wherein the concentration of EUK-B is 0.46 mg mL-1 and the solution is a 15 mg mL-1 alginate solution.

[0240] 14. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel comprises polypeptides, peptides, DNA synthetic polymers or polysaccharides.

[0241] 15. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel comprises alginate, cellulose, polyethylene glycol, hyaluronic acid, Poly(MMA / MAA / EGD)-GM, gelatin, PAMPS, polyacrylamide, Polyrotaxanes, Hydroxyethyl cellulose, Methacrylic acid, 2-hydroxyethyl methacrylate, chitosan, polyvinyl alcohol, and / or collagen.

[0242] 16. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel comprises alginate.

[0243] 17. The microgel or the microgel for use according to any one of the preceding items, wherein the alginate comprises low and / or high molecular weight alginate. The microgel or the microgel for use according to any one of the preceding items, wherein the low molecular weight alginate has a molecular weight between 5 and 75 kDa, such as between 5 and 65 kDa, such as between 5 and 55 kDa, such as between 5 and 45 kDa, such as between 5 and 35 kDa, such as between 5 and 25 kDa, such as between 5 and 15 kDa, such as between 15 and 75 kDa, such as between 15 and 65 kDa, such as between 15 and 55 kDa, such as between 15 and 45 kDa, such as between 15 and 35 kDa, such as between 15 and 25 kDa, such as between 25 and 75 kDa, such as between 25 and 65 kDa, such as between 25 and 55 kDa, such as between 25 and 45 kDa, such as between 25 and 35 kDa, such as between 35 and 75 kDa, such as between 35 and 65 kDa, such as between 35 and 55 kDa, such as between 35 and 45 kDa, such as between 45 and 75 kDa, such as between 45 and 65 kDa, such as between 45 and 55 kDa, such as between 55 and 75 kDa, such as between 55 and 65 kDa, or such as between 65 and 75 kDa. The microgel or the microgel for use according to any one of the preceding items, wherein the high molecular weight alginate has a molecular weight between 200 and 1000 kDa, such as between 200 and 900 kDa, such as between 200 and 800 kDa, such as between 200 and 700 kDa, such as between 200 and 600 kDa, such as between 200 and 500 kDa, such as between 200 and 400 kDa, such as between 200 and 300 kDa, such as between 300 and 1000 kDa, such as between 300 and 900 kDa, such as between 300 and 800 kDa, such as between 300 and 700 kDa, such as between 300 and 600 kDa, such as between 300 and 500 kDa, such as between 300 and 400 kDa, such as between 400 and 1000 kDa, such as between 400 and 900 kDa, such as between 400 and 800 kDa, such as between 400 and 700 kDa, such as between 400 and 600 kDa, such as between 400 and 500 kDa, such as between 500 and 1000 kDa, such as between 500 and 900 kDa, such as between 500 and 800 kDa, such as between 500 and 700 kDa, such as between 500 and 600 kDa, such as between 600 and 1000 kDa, such as between 600 and 900 kDa, such as between 600 and 800 kDa, such as between 600 and 700 kDa, such as between 700 and 1000 kDa, such as between 700 and 900 kDa, such as between 700 and 800 kDa, such as between 800 and 1000 kDa, such as between 800 and 900 kDa, or such as between 900 and 1000 kDa. 20. The microgel or the microgel for use according to any one of the preceding items, wherein the a-L-guluronate content in the alginate is between 60 and 100 %, such as between 60 and 90 %, such as between 60 and 80 %, such as between 60 and 70 %, such as between 70 and 100 %, such as between 70 and 90 %, such as between 70 and 80 %, such as between 80 and 100 %, such as between 80 and 90 %, or such as between 90 and 100 %.

[0244] 21. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel is assembled by cross-linking.

[0245] 22. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel is hydrated in phosphate buffered saline, HEPES buffered saline, or TRIS buffered saline.

[0246] 23. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel is hydrated in a culture growth medium suitable for culturing mammalian cells.

[0247] 24. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel is hydrated in a culture growth medium suitable for culturing hepatic cells.

[0248] 25. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel comprises phosphate buffered saline, HEPES buffered saline, or TRIS buffered saline.

[0249] 26. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel comprises a culture growth medium suitable for culturing mammalian cells.

[0250] 27. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel comprises a culture growth medium suitable for culturing hepatic cells. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel has a particle size between 10 and 300 pm, such as between 10 and 280 pm, such as between 10 and 260 pm, such as between 10 and 240 pm, such as between 10 and 220 pm, such as between 10 and 200 pm, such as between 10 and 180 pm, such as between 10 and 160 pm, such as between 10 and 140 pm, such as between 10 and 120 pm, such as between 10 and 100 pm, such as between 10 and 80 pm, such as between 10 and 60 pm, such as between 10 and 40 pm, such as between 10 and 20 pm, such as between 20 and 300 pm, such as between 20 and 280 pm, such as between 20 and 260 pm, such as between 20 and 240 pm, such as between 20 and 220 pm, such as between 20 and 200 pm, such as between 20 and 180 pm, such as between 20 and 160 pm, such as between 20 and 140 pm, such as between 20 and 120 pm, such as between 20 and 100 pm, such as between 20 and 80 pm, such as between 20 and 60 pm, such as between 20 and 40 pm, such as between 40 and 300 pm, such as between 40 and 280 pm, such as between 40 and 260 pm, such as between 40 and 240 pm, such as between 40 and 220 pm, such as between 40 and 200 pm, such as between 40 and 180 pm, such as between 40 and 160 pm, such as between 40 and 140 pm, such as between 40 and 120 pm, such as between 40 and 100 pm, such as between 40 and 80 pm, such as between 40 and 60 pm, such as between 60 and 300 pm, such as between 60 and 280 pm, such as between 60 and 260 pm, such as between 60 and 240 pm, such as between 60 and 220 pm, such as between 60 and 200 pm, such as between 60 and 180 pm, such as between 60 and 160 pm, such as between 60 and 140 pm, such as between 60 and 120 pm, such as between 60 and 100 pm, such as between 60 and 80 pm, such as between 80 and 300 pm, such as between 80 and 280 pm, such as between 80 and 260 pm, such as between 80 and 240 pm, such as between 80 and 220 pm, such as between 80 and 200 pm, such as between 80 and 180 pm, such as between 80 and 160 pm, such as between 80 and 140 pm, such as between 80 and 120 pm, such as between 80 and 100 pm, such as between 100 and 300 pm, such as between 100 and 280 pm, such as between 100 and 260 pm, such as between 100 and 240 pm, such as between 100 and 220 pm, such as between 100 and 200 pm, such as between 100 and 180 pm, such as between 100 and 160 pm, such as between 100 and 140 pm, such as between 100 and 120 pm, such as between 120 and 300 pm, such as between 120 and 280 pm, such as between 120 and 260 m, such as between 120 and 240 pm, such as between 120 and 220 pm, such as between 120 and 200 pm, such as between 120 and 180 pm, such as between 120 and 160 pm, such as between 120 and 140 pm, such as between 140 and 300 pm, such as between 140 and 280 pm, such as between 140 and 260 pm, such as between 140 and 240 pm, such as between 140 and 220 pm, such as between 140 and 200 pm, such as between 140 and 180 pm, such as between 140 and 160 pm, such as between 160 and 300 pm, such as between 160 and 280 pm, such as between 160 and 260 pm, such as between 160 and 240 pm, such as between 160 and 220 pm, such as between 160 and 200 pm, such as between 160 and 180 pm, such as between 180 and 300 pm, such as between 180 and 280 pm, such as between 180 and 260 pm, such as between 180 and 240 pm, such as between 180 and 220 pm, such as between 180 and 200 pm, such as between 200 and 300 pm, such as between 200 and 280 pm, such as between 200 and 260 pm, such as between 200 and 240 pm, such as between 200 and 220 pm, such as between 220 and 300 pm, such as between 220 and 280 pm, such as between 220 and 260 pm, such as between 220 and 240 pm, such as between 240 and 300 pm, such as between 240 and 280 pm, such as between 240 and 260 pm, such as between 260 and 300 pm, such as between 260 and 280 pm, or such as between 280 and 300 pm. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel has a particle size between 40 and 280 pm, such as between 40 and 260 pm, such as between 40 and 240 pm, such as between 40 and 220 pm, such as between 40 and 200 pm, such as between 40 and 180 pm, such as between 40 and 160 pm, such as between 40 and 140 pm, such as between 40 and 120 pm, such as between 40 and 100 pm, such as between 40 and 80 pm, such as between 40 and 60 pm, such as between 60 and 280 pm, such as between 60 and 260 pm, such as between 60 and 240 pm, such as between 60 and 220 pm, such as between 60 and 200 pm, such as between 60 and 180 pm, such as between 60 and 160 pm, such as between 60 and 140 pm, such as between 60 and 120 pm, such as between 60 and 100 pm, such as between 60 and 80 pm, such as between 80 and 280 pm, such as between 80 and 260 pm, such as between 80 and 240 pm, such as between 80 and 220 pm, such as between 80 and 200 pm, such as between 80 and 180 pm, such as between 80 and 160 pm, such as between 80 and 140 pm, such as between 80 and 120 m, such as between 80 and 100 pm, such as between 100 and 280 pm, such as between 100 and 260 pm, such as between 100 and 240 pm, such as between 100 and 220 pm, such as between 100 and 200 pm, such as between 100 and 180 pm, such as between 100 and 160 pm, such as between 100 and 140 pm, such as between 100 and 120 pm, such as between 120 and 280 pm, such as between 120 and 260 pm, such as between 120 and 240 pm, such as between 120 and 220 pm, such as between 120 and 200 pm, such as between 120 and 180 pm, such as between 120 and 160 pm, such as between 120 and 140 pm, such as between 140 and 280 pm, such as between 140 and 260 pm, such as between 140 and 240 pm, such as between 140 and 220 pm, such as between 140 and 200 pm, such as between 140 and 180 pm, such as between 140 and 160 pm, such as between 160 and 280 pm, such as between 160 and 260 pm, such as between 160 and 240 pm, such as between 160 and 220 pm, such as between 160 and 200 pm, such as between 160 and 180 pm, such as between 180 and 280 pm, such as between 180 and 260 pm, such as between 180 and 240 pm, such as between 180 and 220 pm, such as between 180 and 200 pm, such as between 200 and 280 pm, such as between 200 and 260 pm, such as between 200 and 240 pm, such as between 200 and 220 pm, such as between 220 and 280 pm, such as between 220 and 260 pm, such as between 220 and 240 pm, such as between 240 and 280 pm, such as between 240 and 260 pm, or such as between 260 and 280 pm The microgel or the microgel for use according to any one of the preceding items, wherein the microgel has a particle size between 70 and 90 pm. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel has a particle size of about 83 pm. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel has a particle size between 120 and 140 pm. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel has a particle size of about 134 pm. 34. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel has a particle size between 220 and 240 pm.

[0251] 35. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel has a particle size of about 226 pm.

[0252] 36. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel is anti-oxidative.

[0253] 37. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel decreases or is capable of decreasing a response to a pathophysiological stressor in cells upon co-culturing with said microgel compared to cells without the co-culturing with said microgel.

[0254] 38. The microgel or the microgel for use according to item 37, wherein the pathophysiological stressor is hydrogen peroxide or tert-butyl hydroperoxide

[0255] 39. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel decreases or is capable of decreasing the response to reactive oxygen species in cells upon co-culturing with said microgel compared to cells without the co-culturing with said microgel.

[0256] 40. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel decreases or is capable of decreasing the response to lipid-mediated oxidant stress and / or per-oxidant stress in cells upon co- culturing with said microgel compared to cells without the co-culturing with said microgel.

[0257] 41 . The microgel or the microgel for use according to any one of the preceding items, wherein the microgel decreases or is capable of decreasing the response to inflammatory conditions in cells upon co-culturing with said microgel compared to cells without the co-culturing with said microgel.

[0258] 42. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel decreases or is capable of decreasing the response to endotoxins, such as lipopolysaccharides (LPS), in cells upon co-culturing with said microgel compared to cells without the co-culturing with said microgel. The microgel or the microgel for use according to any one of the preceding items, wherein the cells are selected from the group consisting of liver cells, immune cells, such as macrophages and monocytes, endothelial cells and stellate cells. The microgel or the microgel for use according to any one of the preceding items, wherein the cells are hepatic cells. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel increases or is capable of increasing cell viability when exposed to hydrogen peroxide and / or tert-Butyl hydroperoxide. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel increases or is capable of increasing the EC50 of HepG2 challenged with H2O2 or tBuOOH by at least 1 .5 fold, such as at least

[0259] 1 .6 fold, such as at least 1 .7 fold, such as at least 1 .8 fold, such as at least 1.9 fold, or such as at least 2 fold. The microgel or the microgel for use according to any one of the preceding items, wherein the salen-manganese complexes are active at least 3 days in culture, such as at least 4 days, such as at least 5 days, such as at least 6 days, such as at least 7 days, such as at least 8 days, such as at least 9 days, such as at least 10 days in culture. The microgel or the microgel for use according to any one of the preceding items, wherein the liver disease is selected from the group consisting of fatty liver disease (FLD), such as hepatic steatosis and non-alcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver cirrhosis, liver cancer, such as hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), hepatitis, such as hepatitis A, hepatitis B and hepatitis C, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, cholestasis and liver failure. 49. The microgel or the microgel for use according to any one of the preceding items, wherein the liver disease is liver failure.

[0260] 50. The microgel according to any one of the preceding items for use in the treatment of liver failure.

[0261] 51. The microgel according to any one of the preceding items for use in ex vivo culturing of liver cells, such as wherein liver cells are co-cultured with said microgel.

[0262] 52. The microgel according to any one of the preceding items for use in sustaining bionic tissue.

[0263] 53. The microgel according to any one of the preceding items for use in stabilizing a subject in need of an organ transplantation until said subject can undergo the organ transplantation.

[0264] 54. The microgel or the microgel for use according to any one of the preceding items, wherein the liver failure is acute or acute-on-chronic liver failure.

[0265] 55. The microgel or the microgel for use according to any one of the preceding items, wherein the subject is a human subject.

[0266] 56. The microgel or the microgel for use according to any one of the preceding items, wherein N-acetyl cysteine is co-administrated to the subject in need thereof.

[0267] 57. The microgel or the microgel for use according to any one of the preceding items, wherein the microgel reduces the amount of reactive oxidative species in the liver milieu in the subject in need thereof.

[0268] 58. The microgel or the microgel for use according to any one of the preceding items, wherein the organ transplantation is liver transplantation. A composition comprising the microgel according to any one of the preceding items and one or more excipients. A pharmaceutical composition comprising the microgel according to any one of the preceding items and one or more pharmaceutically acceptable excipients. An ex vivo composition comprising the microgel according to any one of the preceding items and one or more excipients. A cellular composition comprising the microgel according to any one of the preceding items and one or more cells. The cellular composition according to any one of the preceding items, wherein the one or more cells are hepatocytes and / or endothelial cells. The cellular composition according to any one of the preceding items further comprising a support medium, such as a cellulose support. A tissue culture system comprising the microgel according to any one of the preceding items and a support medium, such as a cellulose support. A system comprising the microgel according to any one of the preceding items. A bionic tissue system comprising the microgel according to any one of the preceding items. A paper chip comprising the microgel according to any one of the preceding items. An artificial cell (AC) comprising the microgel according to any one of the preceding items. A kit of parts comprising a. a microgel as defined in any one of the preceding items; and b. instructions for use. 71. A kit for ex vivo culturing of liver cells, wherein the kit comprises a. a microgel as defined in any one of the preceding items; and b. instructions for use.

[0269] 72. A method for treatment or prevention of liver failure comprising administration of a microgel according to any one of the preceding items to a subject in need thereof.

[0270] 73. A method of reducing reactive oxidative species and response to inflammatory conditions in hepatic cells using a microgel according to any one of the preceding items.

[0271] 74. The method according to item 72, wherein the response, the inflammatory conditions and the hepatic cells, is as defined in any one of items 41 to 58.

[0272] 75. A method of decreasing a response to a pathophysiological stressor in cells, said method comprising a step of co-culturing the microgel according to any of the preceding items with said cells, optionally wherein the pathophysiological stressor is hydrogen peroxide or tert-butyl hydroperoxide.

[0273] 76. A method of decreasing a response to reactive oxygen species (ROS) in cells, said method comprising a step of co-culturing the microgel according to any of the preceding items with said cells.

[0274] 77. A method of decreasing a response to lipid-mediated oxidant stress and / or per- oxidant stress in cells, said method comprising a step of co-culturing the microgel according to any of the preceding items with said cells.

[0275] 78. A method of decreasing a response to inflammatory conditions in cells, said method comprising a step of co-culturing the microgel according to any of the preceding items with said cells. 79. A method of decreasing a response to endotoxins, such as lipopolysaccharides (LPS), in cells, said method comprising a step of co-culturing the microgel according to any of the preceding items with said cells. 80. A method of manufacturing a microgel according to any one of the preceding items, wherein the method comprises the steps of: a) contacting low molecular weight alginate and high molecular weight alginate; b) thereby obtaining an alginate solution; and c) contacting said alginate solution comprising a salen-manganese complex, such as EUK-B; thereby obtaining a microgel comprising a salen-manganese complex, such as EUK-B.

Claims

Claims1. A microgel comprising one or more salen-manganese complexes for use in the treatment of a liver disease, such as liver failure.

2. The microgel for use according to claim 1 , wherein the one or more salen- manganese complexes is selected from the group consisting of ELIK-8 of formula (I), EUK-134 of formula (II), EUK-189 of formula (III), EUK-207 of formula (IV), ELIK-A of formula (V), ELIK-B of formula (VI), ELIK-C of formula (VII) or ELIK-D of formula (VIII), preferably ELIK-B of formula (VI),(II),(VIII).

3. The microgel for use according to claim 1 , wherein the one or more salen- manganese complexes is ELIK-B of formula (VI)4. The microgel for use according to any one of the preceding claims, wherein the concentration of salen-manganese complex in a solution is between 0.001 and 10 mg mL-1, such as between 0.01 and 9 mg mL-1 , such as between 0.1 and 8 mg mL-1, such as between 0.1 and 7 mg mL-1, such as between 0.1 and 6 mg mL-1, such as between 0.1 and 5 mg mL-1, such as between 0.1 and 4 mg mL- 1, such as between 0.1 and 3 mg mL-1, such as between 0.1 and 2 mg mL-1 , or such as between 0.1 and 1 mg mL-1.

5. The microgel for use according to any one of the preceding claims, wherein the concentration of salen-manganese complex in a solution is between 0.1 and 1 mg mL-1.

6. The microgel for use according to any one of the preceding claims, wherein the concentration of a salen-manganese complex selected from the group consisting of EUK-134, EUK-A, EUK-B, EUK-C or EUK-D in a solution is between 0.1 and 1 mg mL-1.

7. The microgel for use according to any one of the preceding claims, wherein the concentration of EUK-B is between 0.1 and 0.8 mg mL-1.

8. The microgel for use according to any one of the preceding claims, wherein the microgel further comprises platinum nanoparticles.

9. The microgel for use according to any one of the preceding claims, wherein the microgel comprises polypeptides, peptides, DNA, synthetic polymers or polysaccharides, such as wherein the microgel comprises alginate, cellulose, polyethylene glycol, hyaluronic acid, Poly(MMA / MAA / EGD)-GM, gelatin,PAM PS, polyacrylamide, Polyrotaxanes, Hydroxyethyl cellulose, Methacrylic acid, 2-hydroxyethyl methacrylate, chitosan, polyvinyl alcohol, and / or collagen, preferably wherein the microgel comprises low molecular weight alginate and / or high molecular weight alginate.

10. The microgel or the microgel for use according to any one of the preceding claims, wherein the low molecular weight alginate has a molecular weight between 5 and 75 kDa, such as between 5 and 65 kDa, such as between 5 and 55 kDa, such as between 5 and 45 kDa, such as between 5 and 35 kDa, such as between 5 and 25 kDa, such as between 5 and 15 kDa, such as between 15 and 75 kDa, such as between 15 and 65 kDa, such as between 15 and 55 kDa, such as between 15 and 45 kDa, such as between 15 and 35 kDa, such as between 15 and 25 kDa, such as between 25 and 75 kDa, such as between 25 and 65 kDa, such as between 25 and 55 kDa, such as between 25 and 45 kDa, such as between 25 and 35 kDa, such as between 35 and 75 kDa, such as between 35 and 65 kDa, such as between 35 and 55 kDa, such as between 35 and 45 kDa, such as between 45 and 75 kDa, such as between 45 and 65 kDa, such as between 45 and 55 kDa, such as between 55 and 75 kDa, such as between 55 and 65 kDa, or such as between 65 and 75 kDa.

11. The microgel or the microgel for use according to any one of the preceding claims, wherein the high molecular weight alginate has a molecular weight between 200 and 1000 kDa, such as between 200 and 900 kDa, such as between 200 and 800 kDa, such as between 200 and 700 kDa, such as between 200 and 600 kDa, such as between 200 and 500 kDa, such as between 200 and 400 kDa, such as between 200 and 300 kDa, such as between 300 and 1000 kDa, such as between 300 and 900 kDa, such as between 300 and 800 kDa, such as between 300 and 700 kDa, such asbetween 300 and 600 kDa, such as between 300 and 500 kDa, such as between 300 and 400 kDa, such as between 400 and 1000 kDa, such as between 400 and 900 kDa, such as between 400 and 800 kDa, such as between 400 and 700 kDa, such as between 400 and 600 kDa, such as between 400 and 500 kDa, such as between 500 and 1000 kDa, such as between 500 and 900 kDa, such as between 500 and 800 kDa, such as between 500 and 700 kDa, such as between 500 and 600 kDa, such as between 600 and 1000 kDa, such as between 600 and 900 kDa, such as between 600 and 800 kDa, such as between 600 and 700 kDa, such as between 700 and 1000 kDa, such as between 700 and 900 kDa, such as between 700 and 800 kDa, such as between 800 and 1000 kDa, such as between 800 and 900 kDa, or such as between 900 and 1000 kDa.

12. The microgel for use according to any one of the preceding claims, wherein the microgel comprises culture growth medium suitable for culturing mammalian cells, such as wherein the microgel comprises a culture growth medium suitable for culturing hepatic cells.

13. The microgel for use according to any one of the preceding claims, wherein the microgel has a particle size between 10 and 300 pm, such as between 40 and 280 pm, such as between 60 and 200 pm, such as between 60 and 180 pm, such as between 60 and 160 pm.

14. The microgel for use according to claim 13, wherein said particle size is determined by: a. obtaining one or more images, such as microscopy images, of one or more particles, b. determining the particle size of said one or more particles from said images, optionally wherein said one or more particles are at least 100 particles.

15. The microgel for use according to claim 13, wherein said particle size is determined by: a. obtaining brightfield images by measuring a particle population comprising at least 100 particles, hereby obtaining a histogram,optionally wherein the brightfield images are obtained by employing the software Fiji, b. determining the particle size of the particles by fitting a Gaussian curve to the histogram, and c. optionally presenting said particle size as mean ± 2o for 95.4% of the particle population.

16. The microgel for use according to any one of the preceding claims, wherein the microgel decreases or is capable of decreasing a response to a pathophysiological stressor in cells upon co-culturing with said microgel compared to cells without the co-culturing with said microgel, optionally wherein the pathophysiological stressor is hydrogen peroxide and / or tert-butyl hydroperoxide17. The microgel for use according to any one of the preceding claims, wherein the cells are hepatic cells.

18. The microgel for use according to any one of the preceding claims, wherein the microgel increases or is capable of increasing cell viability when exposed to hydrogen peroxide and / or tert-Butyl hydroperoxide.

19. The microgel for use according to any one of the preceding claims, wherein the liver disease is selected from the group consisting of fatty liver disease (FLD), such as hepatic steatosis and non-alcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver cirrhosis, liver cancer, such as hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), hepatitis, such as hepatitis A, hepatitis B and hepatitis C, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, cholestasis and liver failure.

20. The microgel for use according to any one of the preceding claims, wherein the liver failure is acute or acute-on-chronic liver failure.

21. A microgel comprising one or more salen-manganese complexes, optionally wherein the microgel further comprises platinum nanoparticles.

22. A paper chip comprising the microgel according to claim 21.

23. The paper chip according to claim 22 for use in the treatment of a liver disease, such as liver failure.

24. A cellular composition comprising the microgel according to claim 21 and one or more cells, optionally wherein the one or more cells are hepatocytes and / or endothelial cells.

25. The cellular composition according to claim 24 for use in the treatment of a liver disease, such as liver failure.

26. A system comprising the microgel according to claim 21.

27. The system according to claim 26 for use in the treatment of a liver disease, such as liver failure.

Images