Biomarker composition for predicting prognosis of cerebral infarction, comprising mir-93-5p, and use thereof

Abstract

The present invention relates to a biomarker for diagnosing or predicting prognosis of cerebral infarction, and a use thereof and, more specifically, to: a marker composition for diagnosing or predicting the prognosis of cerebral infarction, comprising miR-93-5p; a composition for diagnosing or predicting prognosis of cerebral infarction, comprising an agent for measuring the level of miR-93-5p; a kit comprising the composition; and method for providing information for diagnosing or predicting the prognosis of cerebral infarction. The biomarker according to the present invention can effectively diagnose the risk of recurrence and the occurrence of cerebral infarction, which has not been efficiently and accurately diagnosed, and can be effectively used for efficient treatment and management.

Description

Biomarker composition for predicting the prognosis of cerebral infarction including MIR-93-5P and use thereof

[0001] The present invention relates to a biomarker composition for predicting the prognosis of cerebral infarction, including miR-93-5p, and more specifically, by analyzing the expression level of miR-93-5p in blood or thrombus isolated from an individual, information related to predicting the prognosis of cerebral infarction can be provided.

[0002] This invention was carried out with the support of the research project "Establishment of a Precision Medical Strategy through Analysis of Cerebral Infarction Thrombus" (Project Unique Number: 1711181475, Project Number: 2022R1A2C2007064) of the Basic Research Project in Science and Technology Fields supported by the Ministry of Science and ICT.

[0003] Stroke (or apoplexy) is a general term for a sudden, localized neurological deficit caused by an abnormality in cerebral blood flow. Stroke is a symptomatic term, and when medically referred to as a disease, it is called cerebrovascular disease. Stroke is broadly categorized into cerebral infarction and cerebral hemorrhage.

[0004] Traditionally, stroke diagnosis involved skilled specialists determining the cause and assessing the severity. The internationally accepted standard for classifying stroke etiology is the TOAST (Trial of Org 10172 in Acute Stroke Treatment) criteria. The TOAST classification system remains the most widely used. Based on the underlying mechanism, strokes are classified as large artery atherosclerosis, cardioembolism, small artery occlusion, other causes, and undetermined causes.

[0005] Furthermore, the degree (severity) of initial neurological deficit is known to be a crucial determinant of stroke prognosis. While various scales are used to measure the degree of initial neurological deficit, they fall short of satisfying all criteria, including validity, reliability, and ease of measurement. Severity is assessed using the NIHSS.

[0006] The National Institute of Health Stroke Scale (NIHSS) is known for its high validity and reliability, making it the most widely used scale in Korea. While quantitative measurement of neurological deficit severity is essential in clinical research, actual clinical practice often relies on descriptive measures and records, rather than quantitative measurement and analysis. Additionally, the Modified Rankin Scale (mRS) can be used to assess post-stroke status after three months.

[0007] The aforementioned prior literature discloses techniques for diagnosing common diseases or lesions, rather than for diagnosing and predicting the prognosis of cerebral infarction. However, diagnosing and predicting the prognosis of cerebral infarction requires considering both extensive MRI imaging data and the patient's clinical information. This requires considerable time and can lead to significant variability in the results, depending on the expertise of the medical staff. Therefore, there is a need for a technology that can rapidly diagnose cerebral infarction while minimizing variability in the results, thereby enhancing the accuracy of the medical staff's final diagnosis and prognosis prediction, and enabling optimal medical intervention accordingly.

[0008] Accordingly, the present inventors investigated the miRNA expression pattern in thrombi of patients with cerebral infarction with or without recurrent vascular events, thereby deriving miRNAs that can increase the accuracy of predicting the prognosis of cerebral infarction and have the potential to treat cerebral infarction, thereby completing the present invention.

[0009] The present inventors aim to provide a method for providing information and a diagnostic kit for diagnosing and predicting prognosis of cerebral infarction, which can reliably predict the condition of a patient with cerebral infarction, in order to solve the problems of the prior art.

[0010] The present invention also aims to predict the prognosis of vascular diseases such as recurrence of cerebral infarction that may occur after treatment for cerebral infarction, and to provide mortality rates in advance.

[0011] To achieve the above purpose, the present invention provides a biomarker composition for predicting the prognosis of cerebral infarction, including miR-93-5p, and a composition for predicting the prognosis of cerebral infarction, including a preparation for measuring the expression level of the miR-93-5p gene.

[0012] In the composition for predicting prognosis of the present invention, the agent is preferably, but not limited to, a primer pair or probe that specifically hybridizes to the miRNA or its cDNA, or a set of oligonucleotides that specifically hybridize to the miRNA or its cDNA, and any agent capable of measuring the expression level of the miRNA may be used without limitation.

[0013] The present invention also provides a kit for predicting the prognosis of cerebral infarction, comprising the composition for predicting the prognosis described above.

[0014] In another embodiment of the present invention, a method for providing information for predicting the prognosis of cerebral infarction is provided, comprising the steps of: (a) measuring the expression level of the miR-93-5p gene in a biological sample isolated from an individual suffering from cerebral infarction; and b) comparing the level of the measured gene with the level of the gene in a normal control sample.

[0015] If the expression level of the gene in the above step (b) is higher than that of the normal control group, it can be determined that cerebral infarction has recurred.

[0016] In the present invention, it is preferable that the biological sample is blood or a blood clot separated from a patient.

[0017] The present invention also provides a pharmaceutical composition for the prevention or treatment of cerebral infarction, comprising a miR-93-5p inhibitor as an active ingredient. According to a preferred embodiment of the present invention, the cerebral infarction is a recurrent cerebral infarction that occurs after treatment for an initial cerebral infarction.

[0018] In the present invention, the miR-93-5p inhibitor may include, but is not limited to, an antagomir, an antisense oligonucleotide, an inhibitory RNA molecule, siRNA, shRNA, and an RNA aptamer of miR-93-5p.

[0019] In addition, according to one embodiment of the present invention, the present invention provides a use of a biomarker composition comprising miR-93-5p for predicting the prognosis of cerebral infarction and a use of a miR-93-5p inhibitor for preventing or treating cerebral infarction.

[0020] The matters mentioned in the biomarker composition of the present invention, the prognosis prediction method using the same, the pharmaceutical composition and the use thereof are equally applicable unless they are contradictory.

[0021] The biomarker composition according to the present invention, a composition including a preparation for measuring the expression level of miR-93-5p, can effectively diagnose or predict in advance the risk of recurrence and the occurrence of cerebral infarction, for which there was no efficient and accurate diagnostic method in the past, thereby enabling efficient post-treatment management after cerebral infarction.

[0022] In addition, the present invention can predict in advance various vascular diseases (vascular events) that appear after cerebral infarction, thereby enabling simple prediction of the prognosis of cerebral infarction.

[0023] Figure 1 is a flowchart illustrating the process of selecting each cohort for conducting an experiment according to one embodiment of the present invention. Figure 1A illustrates the process of selecting the TAOIST target cohort. Among patients who underwent endovascular thrombectomy, 24 patients with insufficient thrombi or miRNA were excluded, and 79 patients with thrombi were ultimately selected. Figure 1B illustrates the process of selecting the CARPET target cohort. Among 110 patients with acute ischemic stroke (cerebral infarction), blood samples from 70 patients were used as subjects.

[0024] Figures 2 to 4 illustrate the results of analyzing miRNA expression levels in the TAOIST cohort according to one embodiment of the present invention. Figure 2 shows the results of microarray analysis, confirming that 19 miRNAs were significantly upregulated and 9 miRNAs were downregulated in patients with recurrent vascular events. Figure 3 shows the results of thrombotic principal component analysis in the TAOIST cohort, indicating the miRNA expression patterns in patients with stable prognosis (blue dots) and recurrent vascular events (green dots). Figure 4 shows the results of quantitative real-time polymerase chain reaction (qRT-PCR) analysis, confirming that the expression of miR-93-5p was significantly increased in patients with recurrent vascular events.

[0025] Figure 5 shows the results of analyzing the correlation between miR-93-5p and laboratory variables in thrombi of the TAOIST cohort according to one embodiment of the present invention. Figure 5A shows the results of Receiver Operating Characteristic (ROC) curve analysis for predicting miR-93-5p expression and recurrent vascular events. Figure 5B shows the results of Kaplan Meyer survival curve analysis, confirming a significant difference between patients with low miR-93-5p expression (black line) and high miR-93-5p expression (red line) in thrombi. Figure 5C is a waterfall plot graph analyzing miR-93-5p expression levels (vertical axis) and prognosis analysis (horizontal axis) of patients treated for cerebral infarction. The results confirm that patients with miR-93-5p levels higher than the cutoff point have a higher rate of vascular events and mortality. Figure 5D shows the results of analyzing blood samples at the time of endovascular thrombectomy analysis, showing that miR-93-5p expression tended to increase in patients with recurrent vascular events compared to patients with stable prognosis (p=0.058, t-test), but with reference to Figure E, there was no correlation between miR-93-5p levels in blood and thrombi (r=0.028, Pearson correlation, p=0.90).

[0026] Figure 6 shows the results of correlation analysis between miRNA and laboratory variables according to one embodiment of the present invention and the immunohistochemical results of miR-93-5p. Figures 6A and 6B show the results of correlation analysis between miRNA and variables, and it can be confirmed that both miR-93-5p (Figure 6A) and miR-20b (Figure 6B) have a significant correlation with initial neurological severity such as NIHSS, e / e', and serum parathyroid hormone (PTH) at discharge, but a low correlation with vitamin D levels. Figure 6C shows the immunohistochemical results, showing that miR-93-5p is located throughout the thrombus.

[0027] Figure 7 shows the results of confirming the influence of miR-17-5p and miR-93-5p in stroke (cerebral infarction) patients according to one embodiment of the present invention. Figures 7A and 7B are graphs showing the expression levels of miR-17-5p and miR-93-5p in non-stroke patients and stroke (cerebral infarction) patients, and the expression level of miR-93-5p was elevated among patients with recurrent vascular events in the CARPET cohort. Figures 7C and 7D are results confirming the correlation between the metabolic activity of the brain amygdala and the expression of miR-17-5p and miR-93-5p, and it can be confirmed that the expression of miR-17-5p and miR-93-5p is correlated with the metabolic activity of the brain amygdala. In addition, E and F of Fig. 7 show the results of confirming the correlation between glucose uptake in the carotid artery and the expression of miR-17-5p and miR-93-5p, and it can be confirmed that the expression of miR-17-5p and miR-93-5p is correlated with glucose uptake in the carotid artery.

[0028] Figure 8 shows the results confirming the effect of miR-17-5p and miR93-5p as antagonistic sequences in an in vitro thrombolysis model according to one embodiment of the present invention (Figure 8A). It was confirmed that inhibition of miR-17-5p or miR-93-5p with the antagonistic sequence promoted the thrombolytic activity of recombinant tissue plasminogen activator (Figure 8B), plasmin (Figure 8C), and urokinase (Figure 8D).

[0029] Figures 9 to 11 illustrate the results of confirming the effects of miR-17-5p and miR-93-5p antagonistic sequences in an in vitro endothelial injury model according to one embodiment of the present invention. In pathological conditions, endothelial damage was significantly attenuated by the antagonistic sequences of miR-17-5p or miR-93-5p (Figure 9), and inhibition of miR-17-5p and miR-93-5p significantly improved migration (Figure 10) and tube formation (Figure 11) in various pathological conditions.

[0030] Below, various examples are presented to aid understanding of the invention. These examples are provided solely to facilitate understanding of the invention and are not intended to limit the scope of protection of the invention.

[0031] The present invention provides a biomarker composition for predicting the prognosis of cerebral infarction, including miR-93-5p, for the purpose of solving the above-described technical problem.

[0032] In the present invention, “prediction of the prognosis of cerebral infarction” means predicting the possibility that cerebral infarction will recur or a vascular event will occur in a patient receiving cerebral infarction treatment, and further means predicting the mortality rate of the treated patient.

[0033] As used herein, "stroke" refers to a disease that causes damage to a body part by causing a local brain tissue to lose its function due to a blockage or rupture of a cerebral blood vessel supplying blood to the brain tissue, and can be classified into ischemic stroke and hemorrhagic stroke. As used herein, "cerebral infarction" refers to a disease in which a part of the brain is damaged due to a blockage of a cerebral blood vessel. In a preferred embodiment, the present invention provides a substance that can diagnose, predict the prognosis of, and treat cerebral infarction, among the symptoms of stroke.

[0034] In this article, “vascular event (or vascular disease; VE)” may refer to a disease directly related to blood vessels, and may include, for example, stroke, cardiac arrest, pulmonary embolism, and superior mesenteric artery occlusion.

[0035] As used herein, “diagnosis” includes determining the susceptibility of an individual to a particular disease or condition, determining whether an individual currently has a particular disease or condition, determining the prognosis of an individual with a particular disease or condition, or therametrics (e.g., monitoring the condition of an individual to provide information about the efficacy of a treatment).

[0036] In this specification, "prognosis" refers to the outlook for future symptoms or course of a disease, as determined by diagnosis. For patients with cerebral infarction, treatment prognosis typically refers to the degree of reduction in miR-93-5p expression. Predicting prognosis is a crucial clinical task, as it provides clues to the future direction of cerebral infarction treatment.

[0037] The term “sample isolated from an individual” as used herein may be, but is not limited to, any one or more selected from the group consisting of tissues, cells, bone marrow, whole blood, serum, and plasma that differ from the control group in the expression level of the biomarker miR-93-5p, and most preferably, a thrombus or blood isolated from an individual.

[0038] The present invention also provides a kit for predicting the prognosis of cerebral infarction, comprising the composition for predicting the prognosis described above.

[0039] The kit of the present invention may include a kit for extracting nucleic acid (e.g., total RNA) from body fluid, blood, cells or tissues, a fluorescent material for labeling, an enzyme and medium for nucleic acid amplification, instructions for use, etc.

[0040] The kit of the present invention is a device for predicting the prognosis of cerebral infarction, wherein a preparation capable of measuring the expression level of the miR-93-5p gene is bound or attached to, for example, a solid phase. Examples of the solid phase's material include plastic, paper, glass, silicon, etc., and plastic is a preferred material for the solid phase due to its ease of processing. The solid phase may have any shape, such as a square, circle, rectangle, film, etc.

[0041] In another embodiment of the present invention, a method for providing information for predicting the prognosis of cerebral infarction is provided, comprising the steps of: a) measuring the expression level of the miR-93-5p gene in a biological sample isolated from an individual suffering from cerebral infarction; and b) comparing the level of the measured gene with the level of the gene in a normal control sample.

[0042] Measuring the expression level of the above miRNAs includes quantitative PCR (qPCR), real-time PCR, reverse transcription PCR (RT-PCR), solid phase PCR, competitive PCR, overlap-extension PCR, multiplex PCR, nested PCR, inverse PCR, ligation-mediated PCR, intersequencespecific PCR (ISSR), methylation-specific PCR (MSP), colony PCR, miniprimer PCR, nanoparticle-assisted PCR (nanoPCR), thermal asymmetric interlaced PCR (TAIL-PCR), touchdown (step-down) PCR, hot start PCR, in silico PCR, and allele-specific It may be comprised of one or more amplification reactions selected from the group consisting of allele-specific PCR, assembly PCR, asymmetric PCR, dial-out PCR, digital PCR (dPCR), and helicase-dependent amplification technology.

[0043] The present invention also provides a pharmaceutical composition for preventing or treating cerebral infarction, comprising a miR-93-5p inhibitor as an active ingredient.

[0044] The term "prevention" in the present invention means averting, delaying, impeding, or hindering the onset of a disease. The term "treatment" in the present invention means improving, curing, or reducing the symptoms of a disease, or slowing or halting the progression of a disease.

[0045] In the present invention, the term "pharmaceutical composition" refers to a composition for the prevention or treatment of cerebral infarction, comprising miR-93-5p or a pharmaceutically acceptable salt thereof according to the present invention. The pharmaceutical composition of the present invention may include pharmaceutically acceptable excipients, such as diluents or carriers. In some embodiments, a method of administering a pharmaceutical composition comprising the composition of the present invention to a subject according to need is provided. In some embodiments, the composition of the present invention can be administered to a human.

[0046] In the present invention, the description of pharmaceutical compositions primarily relates to pharmaceutical compositions intended for administration to humans. However, those skilled in the art will appreciate that such compositions are generally suitable for administration to all types of animals (particularly mammals other than humans). A skilled veterinary pharmacologist, with a keen understanding of the possibilities for modifying pharmaceutical compositions for administration to various animals, can design and / or implement such modifications, if necessary, simply through routine experimentation.

[0047] In the present invention, the pharmaceutical composition may be prepared by any method known in the art of pharmacology or described herein. Typically, such methods for preparing tablets include the steps of associating the active ingredient with excipients and / or one or more other auxiliary ingredients, followed by, if necessary or desired, shaping and / or packaging the product into desired single- or multi-dose units.

[0048] In the present invention, the pharmaceutical composition may be manufactured, packaged, and / or sold unpackaged as a single unit dose and / or multiple single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient administered to a subject and / or a convenient fraction of such a dosage, such as one-half or one-third of the dosage.

[0049] In the present invention, the relative amounts of the active ingredient, pharmaceutically acceptable excipients, and / or any additional ingredients in the pharmaceutical composition will vary depending on the identity, size, and / or disorder of the subject being treated and the route by which the composition is administered. For example, the composition may comprise 0.1% to 100% (w / w) active ingredient.

[0050] In the present invention, pharmaceutically acceptable excipients include any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersing or suspending aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants, and the like suitable for a particular dosage form purpose. Remington's publication [The Science and Practice of Pharmacy, 21st Edition, AR Gennaro, (Lippincott, Williams & Wilkins, Baltimore, MD, 2006]] discloses various excipients used in the preparation of pharmaceutical compositions and known techniques for their preparation. Except that any conventional carrier medium is incompatible with the substance or its derivatives, e.g., by providing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component of the pharmaceutical composition, its use is contemplated to be within the scope of the present invention. Pharmaceutically acceptable excipients are at least 95%, 96%, 97%, 98%, 99%, or 100% pure.

[0051] The above excipients are approved for human and veterinary use. In some embodiments, the excipients are approved by the U.S. Food and Drug Administration. In some embodiments, the excipients are pharmaceutical grade. In some embodiments, the excipients meet the standards of the United States Pharmacopeia (USP), European Pharmacopeia (EP), British Pharmacopeia, and / or International Pharmacopeia (EP).

[0052] In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the U.S. Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopeia (USP), European Pharmacopeia (EP), British Pharmacopeia, and / or International Pharmacopeia (EP).

[0053] Pharmaceutically acceptable excipients used in the preparation of pharmaceutical compositions include, but are not limited to, inert diluents, dispersing and / or granulating agents, surface active and / or emulsifying agents, disintegrating agents, binders, preservatives, buffers, lubricants, and / or oils.

[0054]

[0055] The following examples are presented to help understand the invention and do not limit the scope of protection of the invention.

[0056]

[0057] [Example 1]

[0058] 1-1. Selection of experimental subjects

[0059] In this experiment, two preliminary cohorts were formed, as shown in Fig. 1.

[0060] The first cohort (Fig. 1A) was a thrombus analysis of ischemic stroke (TAOIST) study that investigated the expression profile of miRNAs in thrombi derived from endovascular thrombectomy in patients with stroke (cerebral infarction) from February 2017 to March 2020. The protocol for this study was reviewed and approved by the institutional review board of Chung-Ang University Hospital, and informed consent was obtained from the patients' caregivers or guardians (IRB number: 1621-003-264). Patients in the first cohort underwent a comprehensive stroke etiological evaluation, including brain MRI, Doppler echocardiography, 24-hour Holter monitoring, and a lipid panel. Additionally, bone mineral status was assessed using dual-energy X-ray absorptiometry and serum bone metabolism markers, including parathyroid hormone, vitamin D, and osteocalcin, were assessed in the first cohort.

[0061] The second independent cohort (Fig. 1B) included 70 stroke patients from the Cerebral Atherosclerosis Study Using Positron Emission Tomography (CARPET), which investigated the pathophysiology of cerebral atherosclerosis in stroke patients using [18F]-fluorodeoxyglucose positron emission tomography (FDG PET). The protocol for this trial was reviewed and approved by the Institutional Review Board of Chung-Ang University Hospital, and informed consent was obtained from the patients' caregivers or guardians (IRB number: C2015061). All patients underwent FDG PET after stabilization, and 70 of the 110 patients enrolled 5 ml of venous blood.

[0062] Patients enrolled in both cohorts of this trial received treatment, including antiplatelet or anticoagulant therapy, according to the most recent stroke management guidelines. Neurological severity was assessed by a trained neurologist using the National Institute of Health Stroke Scale (NIHSS) at baseline and discharge, and stroke progression was designated when a patient experienced neurological deterioration of the NIHSS 2 or greater. Patients were also followed after discharge from the outpatient clinic to monitor for recurrent vascular events or death. If patients were unable to visit the clinic, information was obtained from their caregivers or by telephone.

[0063]

[0064] 1-2. miRNA expression analysis

[0065] Clots extracted from the TAOIST cohort were stored in a nitrogen tank at -70°C or lower. Venous blood samples (5-10 ml) were also collected from patients at the end of the thrombectomy procedure. Once a sufficient number of clots were enrolled, they were dissected into two sections for microRNA and histological analysis. Half of the clots were lysed and miRNA was extracted using the miRNeasy kit (Qiagen, GmbH, Germany) according to the manufacturer's protocol.

[0066] In this study, we first derived miRNAs associated with stroke etiology using previous microarray analysis data derived from the Affymetrix miRNA 4.0 array (ThermoFisher, Waltham, Massachusetts), which contained 2,578 human mature miRNAs from 24 patients. Subjects were divided into two groups: 9 with and 15 without recurrent vascular events within 1 year after stroke (cerebral infarction). miRNA expression was normalized using the Robust Multi-Average algorithm, and a heat map was constructed for miRNAs showing significant changes greater than twofold and p<0.05 between the two groups. Principal component analysis was performed to derive eigenvalues ​​and eigenvectors from the miRNA expression profiles of each thrombus.

[0067] The miRNAs significantly altered in the microarray analysis were further examined by quantitative real-time polymerase chain reaction (qRT-PCR) in 55 other patients from the TAOIST cohort. The locations, seed sequences, and previously reviewed literature for the miRNAs selected in this study are shown in Table 1. All samples were tested in triplicate, and the relative abundance of target miRNAs was determined by calculating the 2-ΔCт based on the ratio of microRNAs to miR-652 derived from the standard curve. Expression levels between groups were compared using the Student's t-test, with p<0.05 considered significant. Pearson's correlation analysis was performed between miRNA expression levels and clinical / laboratory variables.

[0068] miRNAs derived from the first cohort were confirmed in the second cohort. As previously described, miRNAs were extracted from venous samples from 70 patients using a commercial kit (Qiagen, GmbH, Germany) after centrifugation of serum at 1000 g for 10 minutes. Correlation analysis was performed between microRNA expression levels on FDG PET images and laboratory / imaging variables, including metabolic activity in each organ. All samples were tested in triplicate, and the relative expression levels of microRNAs were determined by calculating the 2-ΔCт using the miRNA-to-RNA ratio and the reference concentration derived from a standard curve of U6 small nuclear 2.

[0069]

[0070] NameLocation on chromosomeSequencePositive role in vascular diseasemiR-17-5pChr13: 92003326-92003348CAAAGUGCUUACAGUGCAGGUAGElevated among the patients with vulnerable cerebral atherosclerosismiR-20b-5pChrX: 134169809-134169877CAAAGUGCUCAUAGUGCAGGUAGPromotes cardiac hypertrophy by the inhibition of Mitofusin 2-mediated calcium signalingmiR-93-5pChr7:99691438-99691460CAAAGUGCUGUUCGUGCAGGUAGRegulates Msk2-mediated chromatin remodeling in diabetic nephropathymiR-629-5pChr15:70371766-70371786UGGGUUUACGUUGGGAGAACUPromoting the invasion of lung cancer via increasing cell invasion and endothelial cell permeabilitymiR-450-5pChrX:133674261-133674282UUUUGCAAUAUGUUCCUGAAUAElevated in animal model of transient ischemic attacklet7i-5pChr12:62997471-62997492UGAGGUAGUAGUUUGUGCUGUUDecreased among stroke patients and predicted to regulate leukocyte response

[0071] 1-3. Immunohistochemistry for miRNA expression in thrombi

[0072] In this example, miRNA in situ hybridization was performed on paraffin-embedded clot sections.

[0073] Paraffin-fixed clots were deparaffinized with xylene and 99% ethanol at room temperature and rehydrated with phosphate-buffered saline. Approximately 200 μl of proteinase K solution was applied to each slide and incubated in a humidified incubator at 37°C for 10 minutes, followed by dehydration. A hybridization mixture containing 1 μl of a 100 μM locked nucleic acid probe and 9 μl of transfer buffer was denatured at 90°C for 4 minutes, and 990 μl of hybridization buffer was added to obtain a probe concentration of 100 nM. The hydration mixture was applied to each slide and incubated at 55°C for 2 hours. A 10 nM locked nucleic acid antigen of the U6 snRNA probe was used as a positive control, and a 40 nM double digoxigenin-locked nucleic acid miRNA probe was used to label the miRNA of interest. After several washes, miRNA signals were visualized by applying 1:800 diluted alkaline phosphatase-conjugated anti-digoxigenin antibody.

[0074]

[0075] 1-4. In vitro thrombosis / thrombolysis analysis

[0076] To investigate whether the derived miRNA plays a mechanistic role in thrombosis / thrombolysis, we applied the antagonistic sequence of the derived miRNA to an in vitro thrombolysis model. The antagonistic sequence and its mimic were administered to the blood of healthy volunteers or stroke patients, and the transparency after halo formation was monitored. All experiments were performed four times, and the mean seconds (s) with standard deviation are provided.

[0077]

[0078] 1-5. In vitro endothelial damage model

[0079] We generated a model of vascular injury using HUVEC cell lines under 1) hyperglycemic / insulin resistance conditions induced by glucose and dexamethasone supplementation, 2) inflammatory conditions induced by lipopolysaccharide, and 3) reactive oxygen species damage induced by H2O2. Cell survival / migration, angiogenesis / vascular development, and collagen contraction were compared with the application of miRNA mimics and their antagonistic sequences.

[0080]

[0081] 1-6. Statistical Analysis

[0082] In experiments for the present invention, categorical variables were compared using the chi-square test, and continuous variables were compared using the Student's t-test. Pearson's correlation analysis was performed between microRNA expression levels and laboratory variables. All statistical analyses were performed using SPSS version 23.0 (USA). A P value of less than 0.05 was considered significant.

[0083]

[0084] [Example 2]

[0085] Experimental results

[0086] 2-1. TAOIST Cohort

[0087] A total of 79 thrombi from 103 patients in the thrombosis analysis cohort were included in this study (mean age, female patients). Twenty vascular events (25.3%) occurred within 1 year of stroke onset, including 16 infarction progression or recurrence, 1 hemorrhagic stroke, 1 mesenteric artery occlusion, 1 cardiac arrest, and 1 pulmonary thromboembolism. According to the microarray analysis results of the present invention, 19 miRNAs (miR-18b-5p, miR-18a-5p, miR-26b-5p, miR-664b-3p, miR-30b-5p, miR-28-5p, miR-30c-5p, miR-106b-5p, miR-146b-5p, miR-192-5p, miR-17-5p, miR-106a-5p, miR-20b-5p, miR-181a-5p, miR-20a-5p, miR-423-3p, miR-93-5p, miR-182-5p, and let7g-5p) were significantly increased, whereas 9 miRNAs (miR-6133, miR-1225-5p, miR-4417, miR-6776-5p, miR-6790-5p, miR-3180, miR-5572, miR-6784-5p, miR-6723-5p, miR-4322, and miR-3188) were downregulated in patients who experienced recurrent vascular events after index stroke (cerebral infarction) (Figure 2). Principal component analysis based on microarray data showed that the two groups had different but mixed miRNA expression profiles (Figure 3). In-silico analysis and literature review revealed that miR-17-5p, miR-93-5p, miR-20-5p, and miR-106-5p, along with miR-519-3p, have very similar seed sequences and biological targets.

[0088] In-silico analysis and review revealed that miR-17-5p, miR-93-5p, miR-20-5p, and miR-106-5p, along with miR-519-3p, share highly similar seed sequences and biological targets. Based on microarray analysis results and a previous literature review, we decided to measure the expression levels of five miRNAs for validation (Table 1). qRT-PCR results from thrombosis assays showed that miR-93-5p expression was significantly increased in recurrent patients, and miR-20b-5p tended to be increased in recurrent patients (Figure 4). However, miR-629-5p expression did not differ significantly between the two groups (Figure 4). A comparison of clinical and miRNA expression levels between patients with and without recurrent vascular events is shown in Table 2.

[0089]

[0090] Comparison of clinical and laboratory variables between patients with and without recurrent thromboembolism in a thrombotic analysis of an ischemic stroke (cerebral infarction) cohort. Patient without recurred event (n=43). Patient with recurred vascular event (n=12). P value. Age, mean (SD) 71.8 (13.0). 69.4 (11.1). 0.56. Female 17.30.36. Hypertension 22.70.66. Diabetes 12.40.71. Smoking 74.0.19. Atrial fibrillation 21.50.66. Previous stroke 11.10.20. Initial NIHSS, mean (SD) 14.0 (6.7). 20.2 (5.8). 0.006. Discharge NIHSS, mean (SD) 5.3 (5.2). 20.8 (12.9). 0.002. WBC, mean (SD) 90.95. (4918)7813 (3150)0.40Hematocrit, mean (SD)37.6 (5.8)37.9 (7.3)0.90Platelet, mean (SD)213.0 (62.1)204.8 (112.9)0.74eGFR, mean (SD)80.7 (31.6)87.3 (25.1)0.50Vitamin D, mean (SD)19.4 (9.6)12.6 (5.7)0.008PTH, mean (SD)93.8 (52.7)125.3 (104.1)0.17e / e', mean (SD)14.7 (6.5)14.0 (7.7)0.78BMD at spine, mean (SD)1.11 (0.26)1.17 (0.34)0.71miR-20b-5p, mean (SD)11.7 (13.7)29.1 (29.3)0.068miR-93-5p, mean (SD)3.82 (5.42)11.2 (14.5)0.008miR-629-5p, mean (SD)1.82 (2.83)2.54 (3.37)0.46miR-450b-5p, mean (SD)2.15 (2.97)1.89 (3.25)0.82Let7i-5p, mean (SD)9.81 (11.9)12.2 (12.7)0.54

[0091] Receiver Operating Characteristic (ROC) curve analysis predicting recurrent vascular events with miR-93-5p showed nonsignificant results (area under the curve = 0.608, 95% confidence interval: 0.416 - 0.799; p = 0.245, Fig. 5A), but Kaplan Meyer survival curve analysis showed significantly shorter event-free survival times among patients with higher miR-93-5p expression in thrombi (log-rank test, p = 0.034, Fig. 5B). In addition, waterfall plot results according to miR-93-5p expression showed that patients with recurrent vascular events or death were concentrated in those with higher miR-93-5p expression (Fig. 5C). Patients with recurrent vascular events tended to have increased miR-93-5p expression in venous blood samples (p = 0.058 by t-test; Fig. 5D), but miR-93-5p expression levels did not appear to correlate between clots and blood from the same patients (r = 0.0275, p = 0.90, Pearson's correlation; Fig. 5E).

[0092] Correlation analysis between microRNAs and laboratory variables in the TAOIST cohort showed that the expression level of 93-5p was correlated with the initial National Institute of Health Stroke Scale (r = 0.331, p = 0.016), e / e' on echocardiography (r = 0.321, p = 0.022)) and serum parathyroid hormone (r = 0.451, p = 0.0009), and its level was negatively correlated with serum vitamin D (r = -0.375, p = 0.007; Fig. 6A).

[0093] Correlation analysis between miRNAs and laboratory variables in the TAOIST cohort showed that the expression level of 93-5p was positively correlated with the e / e' of initial NIHSS (National Institute of Health Stroke Scale; r = 0.331, p = 0.016), echocardiography (r = 0.321, p = 0.022), and serum parathyroid hormone (r = 0.451, p = 0.0009), and negatively correlated with serum vitamin D (r = -0.375, p = 0.007; Fig. 6A). The correlation between the expression level of miR-20b-5p and laboratory variables also showed a similar trend to that of miR-93-5p, with positive correlations with initial NIHSS (r = 0.446, p = 0.0008), e / e' (r = 0.309, p = 0.022), and parathyroid hormone (r = 0.366, p = 0.008), and negative correlations with vitamin D (r = -0.432, p = 0.002; Fig. 6B). The expression levels of miR-93-5p and miR-20b-5p had a strong positive correlation (r = 0.827, p < 0.001, Pearson correlation). Immunohistochemistry of miR-93-5p in thrombi showed abundant positive signals throughout the thrombi, regardless of cell type (Fig. 6C).

[0094]

[0095] 2-2. CARPET Cohort

[0096] When we investigated the circulating microRNA expression levels between patients with and without stroke recurrence in the CARPET cohort, patients with recurrent stroke had higher levels of miR-17b-5p (2.21±1.19 vs. 3.24±1.68, p=0.047) and miR-93b-5p (2.33±1.42 vs. 3.60±1.72, p=0.035) than patients with stable prognosis (see Table 3).

[0097]

[0098] Comparison of clinical and laboratory variables between patients with and without recurrent thromboembolism in the cerebral atherosclerosis study cohort. Patients without recurrence (n=63) Patients with recurrence (n=7) P value Age, mean (SD) 71.6 (10.0) 66.1 (12.8) 0.185 Sex, female, n (%) 28 (44.4) 1 (14.3) 0.226 Ln (miR-17-5p), mean (SD) 2.21 (1.19) 3.24 (1.68) 0.047 Ln (miR-93-5p), mean (SD) 2.33 (1.42) 3.60 (1.72) 0.035 Ln (let7i-5p), mean (SD) 3.88 (1.20) 4.43 (1.11)0.253Ln (miR-378f), mean (SD)0.41 (1.56)1.37 (1.27)0.151Ln (miR-450b-5p), mean (SD)3.67 (5.33)4.42 (2.36)0.139Ln (miR-629-5p), mean (SD)2.26 (1.81)3.38 (0.76)0.113

[0099] Circulating miR-17-5p was correlated with glucose uptake (r=0.270, p=0.046, Figure 7A) and 2-h postprandial insulin (r=0.347, p=0.014, Figure 7D) and C-peptide levels (r=0.420, p=0.002, Figure 7E) in symptomatic carotid arteries. In addition, miR-93b-5p levels were positively correlated with glucose uptake (r=0.326, p=0.012, Figure 7C) and 2-h postprandial C-peptide levels (r=0.272, p=0.049, Figure 7F) in the amygdala. The associations between microRNAs and glucose uptake in the lumbar spine, spleen, and liver were not significant. Inflammatory markers, including white blood cells, high-sensitivity C-reactive protein, or monocyte-lymphocyte ratio, did not correlate with the tested miRNAs.

[0100]

[0101] 2-3. In vitro thrombolysis model

[0102] In this example, to quantify the thrombotic / clot-dissolving potential of antagonistic sequences of target microRNAs, we constructed an in vitro thrombolytic model using human blood and several thrombolytic agents, including alteplase, plasmin, and urokinase (Fig. 8A). In an in vitro model using blood from healthy donors, the addition of antagonistic sequences of miR-93-5p and miR-17-5p enhanced the thrombolytic response with alteplase (Fig. 8B). The enhanced thrombolytic effect by wo microRNA modulation was maintained even when plasmin and urokinase were administered instead of alteplase (Figs. 8C and D).

[0103]

[0104] 2-4. In vitro endothelial damage model

[0105] Endothelial damage in pathological conditions was significantly attenuated by antagonistic sequences of miR-17-5p or miR-93-5p (Fig. 9). Inhibition of miR17-5p / 93-5p significantly improved migration (Fig. 10) and tube formation (Fig. 11) in various pathological conditions.

[0106]

[0107] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

Claims

1. A biomarker composition for predicting the prognosis of cerebral infarction, comprising miR-93-5p.

2. A composition for predicting the prognosis of cerebral infarction, comprising a preparation for measuring the expression level of the miR-93-5p gene.

3. In paragraph 2, The composition wherein the above formulation is a primer pair or probe that specifically hybridizes to the miRNA or its cDNA.

4. In paragraph 2, The composition is a set of oligonucleotides that specifically hybridize to the miRNA or its cDNA.

5. A kit for predicting the prognosis of cerebral infarction comprising the composition of Article 2. 6.(a) A step of measuring the expression level of the miR-93-5p gene in a biological sample isolated from an individual with cerebral infarction; and (b) A method for providing information for predicting the prognosis of cerebral infarction, comprising a step of comparing the level of the measured gene with the level of the gene of a normal control sample.

7. In paragraph 6, A method for providing information for predicting prognosis, wherein if the expression level of a gene in the above step (b) is higher than that of a normal control group, it is determined that cerebral infarction has recurred.

8. In paragraph 6, A method for providing information for predicting prognosis, wherein when the expression level of a gene in the above step (b) is higher than that of a normal control group, it is determined that a vascular event has occurred or the probability of death is high.

9. In paragraph 6, The above biological sample is blood or a blood clot, and is a method for providing information for predicting the prognosis of cerebral infarction.

10. A pharmaceutical composition for preventing or treating cerebral infarction, comprising a miR-93-5p inhibitor as an active ingredient.

11. In paragraph 10, The above cerebral infarction is a recurrent cerebral infarction that occurs after treatment for the first cerebral infarction, and is a pharmaceutical composition for prevention or treatment.

12. In paragraph 10, A pharmaceutical composition comprising at least one selected from the group consisting of an antagomir, an antisense oligonucleotide, an siRNA, an shRNA, and an RNA aptamer specific to miR-93-5p, wherein the miR-93-5p inhibitor is

Images