Method for rapidly constructing nucleic acid library

Abstract

A method for rapidly constructing a nucleic acid library, relating to the technical field of library construction. Provided is a reagent combination for DNA end repair-linker ligation. An end-repair enzyme excises a 3' overhang of a DNA fragment and / or fills in a 5' overhang of the DNA fragment to finally form a blunt-ended double-stranded DNA fragment; a ligase ligates the end-repaired DNA fragment with linkers; a nucleic acid extension enzyme extends complementary strands of the linkers ligating the DNA fragment, so as to obtain a DNA fragment with double-stranded linkers on both ends, thereby implementing end repair and linker ligation within a single reaction system, and reducing the steps of A-tailing and purification. By adding linkers to a DNA in a one-step reaction, one-step library construction is achieved.

Description

A method for rapidly constructing a nucleic acid library Technical Field

[0001] The present invention belongs to the technical field of library construction, and in particular relates to a method for rapidly constructing a nucleic acid library. Background Art

[0002] With the development of high-throughput gene sequencing technology, the cost of gene sequencing has rapidly decreased. However, the process of preparing samples for next-generation sequencing—library preparation—remains complex and lengthy, and the cost of library construction remains high. This pre-sequencing library preparation process has become a bottleneck restricting the large-scale application of gene sequencing technology.

[0003] Preparing a DNA sample into a high-throughput sequencing library requires multiple steps, including DNA fragmentation, end-repair, end-addition, adapter ligation, and PCR. This complex, time-consuming, and labor-intensive process has delayed research progress. Although optimization has enabled the integration of DNA fragmentation, end-repair, and end-addition into a single-step reaction, reducing the number of steps and time required for library construction, while the increased sequencing speed still requires further improvement in the complexity and duration of library construction.

[0004] The DNBSEQ sequencer launched by MGI uses DNB (DNA Nano Ball) generated by rolling circle linear amplification as the sequencing unit. It uses linear amplification to amplify the base signal of the target fragment. Unlike bridge PCR amplification, it does not cause the accumulation of amplification errors and therefore has higher accuracy during sequencing.

[0005] Combining the DNBSEQ platform with PCR-free library preparation technology enables truly amplification-free sequencing. The current DNBSEQ platform library preparation process includes DNA fragmentation, end-repair and end-addition, adapter ligation, PCR, library circularization, and DNB preparation. The entire process consists of six steps, resulting in a large number of steps, cumbersome operations, and prolonged hands-on time. After optimization, the process remains a three-step process: DNA fragmentation, end-repair and end-addition, adapter ligation, and circularization and DNB preparation. Furthermore, multiple purification steps are required between library preparation steps, which is not only cumbersome but also results in low DNA utilization efficiency. Therefore, sufficient DNA is required to meet the requirements for final library sequencing. This lengthy library preparation process also hinders the application of time-sensitive projects, such as virus tracing and clinical microbial infection detection, on next-generation sequencing platforms, particularly the DNBSEQ platform. Existing enzyme digestion library preparation methods suffer from complex operations, the need for purification, high costs, and a long time-consuming process.

[0006] Tn5 library construction utilizes the characteristics of Tn5 transposase to embed the adapter, allowing DNA fragmentation and adapter addition to be achieved in a single step. However, Tn5 library construction has the following disadvantages: the adapter needs to be embedded in advance; an additional extension step is required after the adapter is connected to bring the adapter to both ends of the DNA; and a purification step is required in between.

[0007] Summary of the Invention

[0008] The first aspect of the present invention aims to provide a reagent combination for DNA end repair and linker ligation.

[0009] The second aspect of the present invention aims to provide a reagent combination for DNA shearing-end repair-adapter ligation.

[0010] The third aspect of the present invention aims to provide a library construction kit.

[0011] The fourth aspect of the present invention aims to provide a method.

[0012] The fifth aspect of the present invention aims to provide a nucleic acid library.

[0013] The sixth aspect of the present invention aims to provide a reaction system.

[0014] In order to achieve the above object, the technical solution adopted by the present invention is:

[0015] In a first aspect, the present invention provides a reagent combination for DNA end repair and linker ligation, comprising:

[0016] a connector, the connector being a single-strand connector; and

[0017] end-repair enzymes; and

[0018] A ligase that catalyzes the formation of a phosphodiester bond between a 5'-P terminus and a 3'-OH terminus of a single-stranded oligonucleotide (single-stranded RNA and / or single-stranded DNA), or a single nucleotide, either intramolecularly or intramolecularly; and

[0019] Nucleic acid elongase.

[0020] Preferably, the nucleotide at the 3' end of the linker is a ribonucleotide (ie, rNTP, such as rATP, rGTP, tCTP, rUTP).

[0021] Preferably, the nucleotides other than the nucleotide at the 3' end of the linker are each independently selected from ribonucleotides (rNTPs) and deoxyribonucleotides (dNTPs).

[0022] Preferably, the linker comprises a 5' blocking group modified end and a 3' hydroxyl end.

[0023] Preferably, the blocking group modification includes at least one of amino modification, dideoxy modification, spacer modification, and hydroxyl modification.

[0024] Preferably, the linker comprises a first linker and a second linker.

[0025] Preferably, the first linker comprises a linker sequence.

[0026] Preferably, the first adapter further comprises a sequencing primer sequence.

[0027] Preferably, the first adapter further comprises a sample tag sequence for distinguishing different samples to facilitate subsequent multi-sample mixed sequencing, such as a barcode sequence or an index sequence.

[0028] Preferably, the first adapter further comprises a unique molecular identifier (UMI) sequence for counting the copy number of the nucleic acid molecule in the sample.

[0029] Preferably, the second linker comprises a linker sequence.

[0030] Preferably, the second adapter further comprises a sequencing primer sequence.

[0031] Preferably, the second adapter further comprises a sample tag sequence for distinguishing different samples to facilitate subsequent multi-sample mixed sequencing, such as a barcode sequence or an index sequence.

[0032] Preferably, the second adapter further comprises a unique molecular identifier (UMI) sequence for counting the copy number of the nucleic acid molecule in the sample.

[0033] Preferably, the length of the sample tag sequence is 5 to 20 bp.

[0034] Preferably, the length of the unique molecular tag is 5 to 20 bp.

[0035] Preferably, the first linker and the second linker have different sequences.

[0036] Preferably, the end repair enzyme comprises a polymerase.

[0037] Preferably, the end repair enzyme further comprises polynucleotide kinase.

[0038] Preferably, the polynucleotide kinase comprises T4 polynucleotide kinase.

[0039] Preferably, the polymerase comprises at least one of T4 DNA polymerase, DNA polymerase I (Klenow) large fragment (Klenow fragment), T7 DNA polymerase, and DNA polymerase I; and further comprises at least one of T4 DNA polymerase and DNA polymerase I (Klenow) large fragment (Klenow fragment).

[0040] Preferably, the ligase comprises at least one of T4 RNA ligase 1, TS2126 RNA ligase, single-stranded DNA / RNA circular ligase (ssDNA / RNA CircLigase), and a truncated version of T4 RNA ligase 2; and further comprises: T4 RNA ligase 1.

[0041] Preferably, the nucleic acid extender comprises at least one of an RNA-dependent DNA polymerase (ie, reverse transcriptase) and a DNA-dependent DNA polymerase.

[0042] Preferably, the RNA-dependent DNA polymerase comprises at least one of M-MLV reverse transcriptase and AMV reverse transcriptase.

[0043] Preferably, the DNA-dependent DNA polymerase comprises a DNA polymerase that depends on DNA containing ribonucleotides; and further comprises at least one of Tth DNA polymerase, BGI Golden U+ polymerase, BGI Platinum polymerase, BGI Golden polymerase, Q5 high-fidelity DNA polymerase, KAPA high-fidelity polymerase, and KAPA U+ high-fidelity polymerase.

[0044] Preferably, the reagent combination further comprises: a buffer, wherein the buffer comprises: dNTP; and

[0045] At least one of ATP and GTP; and

[0046] Metal ions.

[0047] Preferably, the metal ions include at least one of magnesium ions and manganese ions.

[0048] Preferably, the buffer comprises at least one of citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloric acid buffer.

[0049] Preferably, the pH of the buffer solution is 6-8.

[0050] Preferably, the reagent combination is used for DNA end repair-adapter ligation of DNA fragments.

[0051] Preferably, the DNA fragments can be subjected to DNA end repair-adapter ligation without undergoing shearing treatment.

[0052] Preferably, the DNA fragments comprise at least one of naturally occurring small molecule DNA (e.g., cfDNA, DNA in formalin-fixed paraffin-embedded samples), amplified DNA fragments (e.g., MDA products, cDNA products, amplicons, etc.), and sheared DNA fragments (the shearing method can be a chemical shearing method (e.g., enzymatic cleavage) or a physical shearing method (e.g., ultrasonic shearing and mechanical shearing)).

[0053] Preferably, the reagent combination is used to perform DNA end repair-adapter ligation in the same reaction system; wherein the same reaction system is specifically performed in the same reaction vessel.

[0054] Preferably, the reagent combination is used for one-step library construction.

[0055] A second aspect of the present invention provides a reagent combination for DNA shearing-end repair-adapter ligation, comprising: a shearing enzyme;

[0056] and the agent combination of the first aspect of the invention.

[0057] Preferably, the breaking enzyme comprises a nuclease; further comprises a non-specific nuclease; further comprises at least one of nuclease DNase I, micrococcal nuclease (MNase), nuclease dsDNase, salt-active nuclease SAN, and nuclease Vvn; and further comprises nuclease DNase I.

[0058] Preferably, the metal ions further include calcium ions.

[0059] Preferably, the reagent combination is used for DNA shearing-end repair-adapter ligation of DNA.

[0060] Preferably, the DNA needs to be sheared and then end-repaired and adapter-ligated.

[0061] Preferably, the reagent combination is used to perform DNA shearing-end repair-adapter ligation in the same reaction system; wherein the same reaction system is specifically performed in the same reaction vessel.

[0062] Preferably, the reagent combination is used for one-step library construction.

[0063] The third aspect of the present invention provides a library construction kit comprising the reagent combination of the first aspect of the present invention or the reagent combination of the second aspect of the present invention.

[0064] Preferably, the kit further comprises: a DNB preparation reagent.

[0065] Preferably, the DNB preparation reagent is a substance selected from any one of the following DNB preparation methods: a1) single-chain cyclization (cyclization reaction), linear single-chain digestion, purification, and rolling circle replication (rolling circle amplification) are performed in sequence to obtain DNA nanoballs; a2) single-chain cyclization and rolling circle replication are completed in one step to obtain DNA nanoballs; further preferably, the DNB preparation reagent is a substance selected from the following DNB preparation methods: a2) single-chain cyclization and rolling circle replication are completed in one step to obtain DNA nanoballs.

[0066] Preferably, the DNB preparation reagent comprises: polynucleotide kinase.

[0067] Preferably, the polynucleotide kinase is T4 polynucleotide kinase.

[0068] Preferably, the DNB preparation reagent comprises: a splint nucleic acid molecule, the splint nucleic acid molecule comprising a complementary sequence to the 5' end sequence of a linker and a 5' end sequence of another linker (the splint nucleic acid molecule comprises a complementary sequence to the 5' end sequence of a linker and a 5' end sequence of another linker from 5'-3': and / or the splint nucleic acid molecule comprises a complementary sequence to the 5' end sequence of a linker and a complementary sequence to the 5' end sequence of another linker from 5'-3').

[0069] Preferably, the kit may further comprise: PCR reaction reagents.

[0070] A fourth aspect of the present invention provides a method.

[0071] b1) A method for constructing a nucleic acid library, comprising the steps of using the reagent combination of the first aspect of the present invention, further specifically as follows: DNA fragments, linkers, end repair enzymes, ligases and nucleic acid extension enzymes are mixed, and the resulting system is reacted.

[0072] b2) A method for constructing a nucleic acid library, comprising the steps of using the reagent combination of the second aspect of the present invention, further specifically as follows: DNA, linker, fragmentation enzyme, end repair enzyme, ligase and nucleic acid extension enzyme are mixed, and the resulting system is reacted.

[0073] Preferably, the systems in b1) and b2) further comprise a buffer (b1) is preferably the buffer in the first aspect of the present invention, and b2) is preferably the buffer in the second aspect of the present invention).

[0074] In b1) and b2):

[0075] Preferably, the concentration of the buffer in the system is 10-100 mM.

[0076] Preferably, the concentration of magnesium ions and / or manganese ions in the buffer in the system is 1 to 50 mM.

[0077] Preferably, the concentration of dNTP in the buffer in the system is 0.05-5 mM.

[0078] Preferably, the concentration of ATP and / or GTP in the buffer in the system is 0.1-10 mM.

[0079] Preferably, the concentration of the linker in the system is 100 nM to 10 μM.

[0080] Preferably, the concentration of the polynucleotide kinase in the end repair enzyme in the system is 0.01 U / μL to 1 U / μL.

[0081] Preferably, the concentration of the polymerase in the end repair enzyme in the system is 0.01 U / μL to 1 U / μL.

[0082] Preferably, the concentration of the ligase in the system is 0.1 U / μL to 10 U / μL.

[0083] Preferably, the concentration of the nucleic acid extender in the system is 0.005 U / μL to 1 U / μL.

[0084] b1) In:

[0085] Preferably, the concentration of the DNA fragment in the system is 1 nM to 100 nM.

[0086] Preferably, the DNA fragment is the DNA fragment in the first aspect of the present invention.

[0087] Preferably, the reaction procedure comprises: reaction at 16-40° C. for 10-60 min; reaction at 50-75° C. for 5-60 min.

[0088] In b2):

[0089] Preferably, the concentration of the disrupting enzyme in the system is 0.00001 U / μL to 0.1 U / μL; further 0.0002 U / μL.

[0090] Preferably, the concentration of calcium ions in the buffer in the system is 0.001 to 50 mM.

[0091] Preferably, the concentration of the DNA in the system is 1 nM to 100 nM.

[0092] Preferably, the DNA is the DNA in the second aspect of the present invention.

[0093] Preferably, the reaction procedure comprises: reaction at 16-40°C for 10-60 min; reaction at 50-75°C for 5-60 min; further comprises: reaction at 37°C for 15 min; reaction at 65°C for 5-10 min.

[0094] In b1) and b2):

[0095] Preferably, the method further comprises: performing an amplification reaction on the DNA fragments connected to the adapter.

[0096] Preferably, the amplification reaction is at least one of linear amplification and rolling circle amplification; further, rolling circle amplification (ie, the nucleic acid library construction method is a PCR-free nucleic acid library construction method).

[0097] Preferably, when the amplification reaction is linear amplification and rolling circle amplification, linear amplification is performed first and then rolling circle amplification.

[0098] Preferably, the rolling circle amplification further comprises a circularization reaction.

[0099] Preferably, the rolling circle amplification and cyclization reaction use the DNB preparation reagent in the third aspect of the present invention, that is, the cyclization reaction and rolling circle amplification can be completed in one step or in multiple steps.

[0100] Preferably, the cyclization reaction further includes a phosphorylation reaction (preferably a 5' end phosphorylation reaction).

[0101] Preferably, the phosphorylation reaction uses polynucleotide kinase (preferably T4 polynucleotide kinase).

[0102] Preferably, the linear amplification uses a PCR reaction reagent (preferably the PCR reaction reagent in the third aspect of the present invention).

[0103] The fifth aspect of the present invention provides a nucleic acid library obtained by the nucleic acid library construction method of the fourth aspect of the present invention.

[0104] The sixth aspect of the present invention provides a reaction system.

[0105] c1) A reaction system for constructing a nucleic acid library, comprising DNA fragments and the linker, end-repair enzyme, ligase and nucleic acid extender according to the first aspect of the present invention.

[0106] c2) A reaction system for constructing a nucleic acid library, comprising DNA and the linker, the breaking enzyme, the end-repair enzyme, the ligase and the nucleic acid extension enzyme according to the second aspect of the present invention.

[0107] Preferably, the reaction systems in c1) and c2) further comprise a buffer (c1) is preferably the buffer in the first aspect of the present invention, and c2) is preferably the buffer in the second aspect of the present invention).

[0108] In c1) and c2):

[0109] Preferably, the concentration of the buffer in the reaction system is 10-100 mM.

[0110] Preferably, the concentration of magnesium ions and / or manganese ions in the buffer in the reaction system is 1 to 50 mM.

[0111] Preferably, the concentration of dNTP in the buffer in the reaction system is 0.05-5 mM.

[0112] Preferably, the concentration of ATP and / or GTP in the buffer in the system is 0.1-10 mM.

[0113] Preferably, the concentration of the linker in the reaction system is 100 nM to 10 μM.

[0114] Preferably, the concentration of the polynucleotide kinase in the end repair enzyme in the reaction system is 0.01 U / μL to 1 U / μL.

[0115] Preferably, the concentration of the polymerase in the end repair enzyme in the reaction system is 0.01 U / μL to 1 U / μL.

[0116] Preferably, the concentration of the ligase in the reaction system is 0.1 U / μL to 10 U / μL.

[0117] Preferably, the concentration of the nucleic acid extender in the reaction system is 0.005 U / μL to 1 U / μL.

[0118] In c1):

[0119] Preferably, the concentration of the DNA fragment in the reaction system is 1 nM to 100 nM.

[0120] Preferably, the DNA fragment is the DNA fragment in the first aspect of the present invention.

[0121] In c2):

[0122] Preferably, the concentration of the disrupting enzyme in the reaction system is 0.00001 U / μL to 0.1 U / μL; further 0.0002 U / μL.

[0123] Preferably, the concentration of calcium ions in the buffer solution in the reaction system is 0.001 to 50 mM.

[0124] Preferably, the concentration of the DNA in the reaction system is 1 nM to 100 nM.

[0125] Preferably, the DNA is the DNA in the second aspect of the present invention.

[0126] The beneficial effects of the present invention are:

[0127] The present invention provides a DNA end-repair-adapter ligation reagent combination, which uses an end-repair enzyme to remove the 3' overhang of a DNA fragment and / or fill in the 5' overhang of the DNA fragment, thereby ultimately forming a double-stranded DNA fragment with a blunt end. The end-repaired DNA fragment is ligated to a linker by a ligase, and the complementary chain of the linker connecting the DNA fragment is extended by a nucleic acid extension enzyme (using the linker as a template to extend the complementary chain), thereby obtaining a DNA fragment with a double-stranded linker at both ends, thereby achieving DNA end-repair and linker ligation in one reaction system. Compared with the existing DNA end-repair-adapter ligation method in enzyme digestion library construction, the end-repair and linker ligation step is reduced. At the same time, DNA end-repair and linker ligation can be achieved in one reaction system. The DNA fragment is directly reacted in one step and then the linker is added to achieve a one-step library construction, which can greatly reduce the steps of library preparation and directly prepare DNBs, thereby greatly reducing library construction time.

[0128] Furthermore, the present invention provides a reagent combination for DNA shearing-end repair-adapter ligation, in which DNA (e.g., genomic DNA) is fragmented by a shearing enzyme into DNA fragments of different sizes, 3' overhangs of the DNA fragments are removed by an end repair enzyme and / or 5' overhangs of the DNA fragments are filled to form double-stranded DNA fragments with blunt ends, the end-repaired DNA fragments are ligated to an adaptor by a ligase, and the complementary strands of the adaptors connecting the DNA fragments are extended by a nucleic acid extender (using the adaptor as a template to extend the complementary strands), thereby obtaining DNA fragments with double-stranded adaptors at both ends, thereby achieving DNA shearing, end repair, and adaptor ligation in a single reaction system. Compared with the existing DNA shearing-end repair-adapter ligation method for enzyme digestion library construction, the end A addition step is eliminated. At the same time, DNA shearing, end repair, and adaptor ligation can be achieved in a single reaction system. DNA is directly reacted in a single step and then adaptors are added to achieve a one-step library construction, which can greatly reduce the steps of library preparation, reduce the number of purification times, improve DNA utilization efficiency, and directly prepare DNBs, greatly reducing library construction time. BRIEF DESCRIPTION OF THE DRAWINGS

[0129] FIG1 is a schematic diagram of the process for rapidly constructing a nucleic acid library according to the present invention.

[0130] FIG2 is a schematic diagram of a single-chain connector preferably used in the present invention.

[0131] Figure 3 is a schematic diagram of one-step DNB preparation on the DNBSEQ platform. DETAILED DESCRIPTION

[0132] In the description of the present invention, the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, a feature specified as "first" or "second" may explicitly or implicitly include at least one of such features. In the description of the present invention, "plurality" means at least two, for example, two, three, etc., unless otherwise specifically defined.

[0133] In a first aspect, the present invention provides a reagent combination for DNA end repair and linker ligation, comprising:

[0134] a connector, the connector being a single-strand connector; and

[0135] End-repair enzymes, which are used to remove 3' overhangs of DNA fragments and / or fill in 5' overhangs of DNA fragments to ultimately form blunt-ended double-stranded DNA fragments (i.e., end-repair reactions); and

[0136] A ligase that catalyzes the formation of a phosphodiester bond between the 5'-P end and the 3'-OH end of a single-stranded oligonucleotide (single-stranded RNA and / or single-stranded DNA), or a single nucleotide, between or within a molecule, and is used to connect the end-repaired DNA fragment to a linker (i.e., a linker ligation reaction); and

[0137] Nucleic acid extendase is used to extend the complementary chain of the linker connecting DNA fragments (extending the complementary chain using the linker as a template, i.e., linker extension reaction), thereby obtaining DNA fragments with double-stranded linkers at both ends.

[0138] The above reagent combination uses an end-repair enzyme to remove the 3' overhang of the DNA fragment and / or fill in the 5' overhang of the DNA fragment, thereby ultimately forming a double-stranded DNA fragment with a blunt end. The end-repaired DNA fragment is ligated to an adapter by a ligase, and the complementary chain of the adapter connecting the DNA fragment is extended by a nucleic acid extension enzyme (using the adapter as a template to extend the complementary chain), thereby obtaining a DNA fragment with a double-stranded adapter at both ends, thereby achieving DNA end repair and adapter ligation in a single reaction system. Compared with the existing DNA end repair-adapter ligation method for library construction in enzyme digestion, the end-A addition step is reduced. At the same time, DNA end repair and adapter ligation can be achieved in a single reaction system. The DNA fragment is directly reacted in a single step and then the adapter is added to achieve a one-step library construction, which can greatly reduce the steps of library preparation and directly prepare DNBs, greatly reducing library construction time.

[0139] Preferably, the linker comprises a 5' blocking group modified end and a 3' hydroxyl end, thereby preventing the linker from self-ligating under the action of a ligase.

[0140] Preferably, the blocking group modification includes at least one of amino modification, dideoxy modification, spacer modification, and hydroxyl modification; further, hydroxyl modification, so that after linker connection (including linker extension), the DNA fragment connected to the linker can be phosphorylated, and then cyclized and rolled circle amplified to achieve PCR-free library construction.

[0141] Preferably, the nucleotide at the 3' end of the linker is a ribonucleotide (ie, rNTP, such as rATP, rGTP, tCTP, rUTP), thereby improving the ligation efficiency between the linker and the DNA fragment.

[0142] Preferably, the other nucleotides other than the nucleotide at the 3' end of the linker are each independently selected from ribonucleotides (rNTP) and deoxyribonucleotides (dNTP); that is, the other nucleotides other than the nucleotide at the 3' end of the linker can be ribonucleotides (rNTP) or deoxyribonucleotides (dNTP), as shown in Figure 2.

[0143] Preferably, the linker comprises a first linker and a second linker.

[0144] Preferably, the first linker comprises a linker sequence.

[0145] Preferably, the first adapter further comprises a sequencing primer sequence.

[0146] Preferably, the first adapter further comprises a sample tag sequence for distinguishing different samples to facilitate subsequent multi-sample mixed sequencing, such as a barcode sequence or an index sequence.

[0147] Preferably, the first adapter further comprises a unique molecular identifier (UMI) sequence for counting the copy number of the nucleic acid molecule in the sample.

[0148] Preferably, the second linker comprises a linker sequence.

[0149] Preferably, the linker sequence of the second linker is the same as or different from the linker sequence of the first linker.

[0150] Preferably, the second adapter further comprises a sequencing primer sequence.

[0151] Preferably, the sequencing primer sequence of the second adapter is the same as or different from the sequencing primer sequence of the first adapter.

[0152] Preferably, the second adapter further comprises a sample tag sequence for distinguishing different samples to facilitate subsequent multi-sample mixed sequencing, such as a barcode sequence or an index sequence.

[0153] Preferably, the sample tag sequence of the second adapter is the same as or different from the sample tag sequence of the first adapter.

[0154] Preferably, the second adapter further comprises a unique molecular identifier (UMI) sequence for counting the copy number of the nucleic acid molecule in the sample.

[0155] Preferably, the unique molecular index (UMI) sequence of the second adapter is the same as or different from the unique molecular index (UMI) sequence of the first adapter.

[0156] Preferably, the length of the sample tag sequence is 5 to 20 bp.

[0157] Preferably, the length of the unique molecular tag is 5 to 20 bp.

[0158] Preferably, the first linker and the second linker have different sequences.

[0159] Preferably, the end repair enzyme comprises a polymerase.

[0160] Preferably, the end repair enzyme further comprises a polynucleotide kinase, which is used to dephosphorylate the 3' end and phosphorylate the 5' end of the DNA fragment when the end of the DNA fragment is not a 5' terminal phosphate and / or a 3' terminal hydroxyl.

[0161] Preferably, the polynucleotide kinase comprises T4 polynucleotide kinase.

[0162] Preferably, the polymerase comprises at least one of T4 DNA polymerase, DNA polymerase I (Klenow) large fragment (Klenow fragment), T7 DNA polymerase, and DNA polymerase I; and further comprises at least one of T4 DNA polymerase and DNA polymerase I (Klenow) large fragment (Klenow fragment).

[0163] Preferably, the ligase comprises at least one of T4 RNA ligase 1, TS2126 RNA ligase, single-stranded DNA / RNA circular ligase (ssDNA / RNA CircLigase), and a truncated version of T4 RNA ligase 2; and further comprises: T4 RNA ligase 1.

[0164] Preferably, the nucleic acid elongase comprises at least one of an RNA-dependent DNA polymerase (ie, reverse transcriptase) and a DNA-dependent DNA polymerase; further, the nucleic acid elongase is a DNA-dependent DNA polymerase.

[0165] Preferably, the RNA-dependent DNA polymerase comprises at least one of M-MLV reverse transcriptase and AMV reverse transcriptase.

[0166] Preferably, the DNA-dependent DNA polymerase is a DNA polymerase that depends on DNA containing ribonucleotides; further comprising at least one of Tth DNA polymerase, BGI Golden U+ polymerase, BGI Platinum polymerase, BGI Golden polymerase, Q5 high-fidelity DNA polymerase, KAPA high-fidelity polymerase, and KAPA U+ high-fidelity polymerase.

[0167] Preferably, the reagent combination further comprises: a buffer, wherein the buffer comprises: dNTP; and

[0168] At least one of ATP and GTP; and

[0169] Metal ions;

[0170] It is used for end-repair reactions, adapter ligation reactions, and adapter extension reactions.

[0171] Preferably, the metal ions include at least one of magnesium ions and manganese ions, and further include magnesium ions.

[0172] Preferably, the buffer comprises at least one of citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloric acid buffer; and further comprises Tris hydrochloric acid buffer.

[0173] Preferably, the pH of the buffer solution is 6-8.

[0174] Preferably, the reagent combination is used for DNA end repair-adapter ligation of DNA fragments.

[0175] Preferably, the DNA fragments can be subjected to DNA end repair-adapter ligation without undergoing shearing treatment (those skilled in the art can determine whether shearing treatment is required based on common knowledge and / or conventional technical means).

[0176] Preferably, the DNA fragment is less than 1000 bp.

[0177] Preferably, the DNA fragments comprise at least one of naturally occurring small molecule DNA (e.g., cfDNA, DNA in formalin-fixed paraffin-embedded samples), amplified DNA fragments (e.g., MDA products, cDNA products, amplicons, etc.), and sheared DNA fragments (the shearing method can be a chemical shearing method (e.g., enzymatic cleavage) or a physical shearing method (e.g., ultrasonic shearing and mechanical shearing)).

[0178] Preferably, the reagent combination is used to perform DNA end repair-adapter ligation in the same reaction system; wherein the same reaction system is specifically performed in the same reaction vessel.

[0179] Preferably, the reagent combination is used for one-step library construction.

[0180] Preferably, the sequence of the linker is shown as SEQ ID NO. 1 or 2.

[0181] Preferably, the reagent combination further comprises instructions, which describe the method for using the reagent combination: mixing DNA fragments, linkers, end-repair enzymes, ligases and nucleic acid extension enzymes, and reacting the obtained system.

[0182] Preferably, the system further comprises the above-mentioned buffer.

[0183] Preferably, the concentration of the buffer in the system is 10-100 mM.

[0184] Preferably, the concentration of magnesium ions and / or manganese ions in the buffer in the system is 1 to 50 mM.

[0185] Preferably, the concentration of dNTP in the buffer in the system is 0.05-5 mM.

[0186] Preferably, the concentration of ATP and / or GTP in the buffer in the system is 0.1-10 mM.

[0187] Preferably, the concentration of the DNA fragment in the system is 1 nM to 100 nM.

[0188] Preferably, the concentration of the linker in the system is 100 nM to 10 μM; further 200 nM to 800 nM.

[0189] Preferably, the concentration of the polynucleotide kinase in the end repair enzyme in the system is 0.01 U / μL to 1 U / μL.

[0190] Preferably, the concentration of the polymerase in the end repair enzyme in the system is 0.01 U / μL to 1 U / μL; further 0.0725 U / μL to 0.29 U / μL.

[0191] Preferably, the concentration of the ligase in the system is 0.1 U / μL to 10 U / μL; further 0.1 U / μL to 0.4 U / μL.

[0192] Preferably, the concentration of the nucleic acid extender in the system is 0.005 U / μL to 1 U / μL; further 0.005 U / μL to 0.02 U / μL.

[0193] Preferably, the reaction procedure comprises: reacting at 16-40° C. for 10-60 min, so that the end-repair enzyme can excise the 3' overhang of the DNA fragment and / or fill in the 5' overhang of the DNA fragment to ultimately form a double-stranded DNA fragment with a blunt end (which can also include dephosphorylating the 3' end of the DNA fragment and phosphorylating the 5' end) (i.e., an end-repair reaction occurs), and allowing the ligase to connect the end-repaired DNA fragment with the adapter (i.e., an adapter ligation reaction); reacting at 50-75° C. for 5-60 min, so that the nucleic acid extension enzyme can extend the complementary chain of the adapter connected to the DNA fragment (extending the complementary chain using the adapter as a template, i.e., an adapter extension reaction), thereby obtaining a DNA fragment with a double-stranded adapter at both ends, and simultaneously inactivating the end-repair enzyme and the ligase.

[0194] A second aspect of the present invention provides a reagent combination for DNA shearing-end repair-adapter ligation, comprising: a shearing enzyme for fragmenting DNA to obtain DNA fragments;

[0195] and the agent combination of the first aspect of the invention.

[0196] The above reagent combination fragments DNA (e.g., genomic DNA) into DNA fragments of different sizes using a fragmentation enzyme. The 3' overhangs of the DNA fragments are removed and / or the 5' overhangs of the DNA fragments are blunted using an end-repair enzyme to ultimately form blunt-ended double-stranded DNA fragments. The end-repaired DNA fragments are ligated to adapters using a ligase. The complementary strands of the adapters connecting the DNA fragments are extended by a nucleic acid extension enzyme (using the adapters as templates to extend the complementary strands), thereby obtaining DNA fragments with double-stranded adapters at both ends. DNA fragmentation, end repair, and adapter ligation are then achieved in a single reaction system. Compared with the existing DNA fragmentation-end repair-adapter ligation method for library construction in enzyme digestion, the end-addition step of A addition is eliminated. At the same time, DNA fragmentation, end repair, and adapter ligation can be achieved in a single reaction system. DNA is directly reacted in a single step and then adapters are added, achieving a one-step library construction method. This can greatly reduce the steps of library preparation, reduce the number of purification times, improve DNA utilization efficiency, and directly prepare DNBs, greatly reducing library construction time.

[0197] Preferably, the breaking enzyme comprises a nuclease; further comprises a non-specific nuclease; further comprises at least one of nuclease DNase I, micrococcal nuclease (MNase), nuclease dsDNase, salt-active nuclease SAN, and nuclease Vvn; further comprises nuclease DNase I.

[0198] Preferably, the metal ions further include calcium ions, which are used for DNA fragmentation reaction.

[0199] Preferably, the reagent combination is used for DNA shearing-end repair-adapter ligation of DNA.

[0200] Preferably, the DNA needs to be sheared and then end-repaired and connected to an adapter (those skilled in the art can determine whether shearing is required based on common knowledge and / or conventional techniques).

[0201] Preferably, the DNA is greater than or equal to 1000 bp.

[0202] Preferably, the reagent combination is used to perform DNA shearing-end repair-adapter ligation in the same reaction system; wherein the same reaction system is specifically performed in the same reaction vessel.

[0203] Preferably, the reagent combination is used for one-step library construction.

[0204] Preferably, the reagent combination further comprises instructions, which describe the method for using the reagent combination: mixing DNA, linker, fragmentation enzyme, end repair enzyme, ligase and nucleic acid extension enzyme, and reacting the obtained system.

[0205] Preferably, the system further comprises the buffer solution according to the first aspect of the present invention.

[0206] Preferably, the concentration of the buffer in the system is 10-100 mM.

[0207] Preferably, the concentration of magnesium ions and / or manganese ions in the buffer in the system is 1 to 50 mM.

[0208] Preferably, the concentration of calcium ions in the buffer in the system is 0.001 to 50 mM; further 0.004 to 0.8 mM.

[0209] Preferably, the concentration of ATP and / or GTP in the buffer in the system is 0.1-10 mM.

[0210] Preferably, the concentration of dNTP in the buffer in the system is 0.05-5 mM.

[0211] Preferably, the concentration of the disrupting enzyme in the system is 0.00001 U / μL to 0.1 U / μL; further 0.00002 U / μL to 0.004 U / μL; further 0.0002 U / μL.

[0212] Preferably, the concentration of the DNA in the system is 1 nM to 100 nM.

[0213] Preferably, the concentration of the linker in the system is 100 nM to 10 μM; further 200 nM to 800 nM.

[0214] Preferably, the concentration of the polynucleotide kinase in the end repair enzyme in the system is 0.01 U / μL to 1 U / μL.

[0215] Preferably, the concentration of the polymerase in the end repair enzyme in the system is 0.01 U / μL to 1 U / μL; further 0.0725 U / μL to 0.29 U / μL.

[0216] Preferably, the concentration of the ligase in the system is 0.1 U / μL to 10 U / μL; further 0.1 U / μL to 0.4 U / μL.

[0217] Preferably, the concentration of the nucleic acid extender in the system is 0.005 U / μL to 1 U / μL; further 0.005 U / μL to 0.02 U / μL.

[0218] Preferably, the reaction procedure comprises: reacting at 16-40° C. for 10-60 min, so that the breaking enzyme can fragment the DNA, and the end-repair enzyme can remove the 3' overhang of the DNA fragment and / or fill the 5' overhang of the DNA fragment to ultimately form a double-stranded DNA fragment with a blunt end (which can also include dephosphorylating the 3' end and phosphorylating the 5' end of the DNA fragment) (i.e., an end-repair reaction occurs), and the ligase can connect the end-repaired DNA fragment with the adapter (i.e., an adapter ligation reaction); reacting at 50-75° C. for 5-60 min, so that the nucleic acid extension enzyme can extend the complementary chain of the adapter connected to the DNA fragment (extending the complementary chain using the adapter as a template, i.e., an adapter extension reaction), thereby obtaining a DNA fragment with a double-stranded adapter at both ends, and at the same time, inactivating the breaking enzyme, the end-repair enzyme, and the ligase.

[0219] Preferably, the reaction procedure comprises: reaction at 37°C for 10 min; reaction at 65°C for 10 min.

[0220] The third aspect of the present invention provides a library construction kit comprising the reagent combination of the first aspect of the present invention or the reagent combination of the second aspect of the present invention.

[0221] Preferably, the kit further comprises: a DNB preparation reagent for preparing the linear library into DNA nanoballs (DNBs).

[0222] Preferably, the DNB preparation reagent is a substance selected from any one of the following DNB preparation methods: a1) single-chain cyclization (cyclization reaction), linear single-chain digestion, purification, and rolling circle replication (rolling circle amplification) are performed in sequence to obtain DNA nanoballs; a2) single-chain cyclization and rolling circle replication are completed in one step to obtain DNA nanoballs; further preferably, the DNB preparation reagent is a substance selected from the following DNB preparation methods: a2) single-chain cyclization and rolling circle replication are completed in one step to obtain DNA nanoballs.

[0223] Preferably, the DNB preparation reagent comprises: polynucleotide kinase (preferably T4 polynucleotide kinase), which is used to phosphorylate the 5' end of the linker to facilitate circularization reaction.

[0224] Preferably, the DNB preparation reagent comprises: a splint nucleic acid molecule, the splint nucleic acid molecule comprises a complementary sequence of the 5' end sequence of one linker and a 5' end sequence of another linker (the splint nucleic acid molecule comprises a complementary sequence of the 5' end sequence of one linker and a 5' end sequence of another linker from 5'-3': and / or the splint nucleic acid molecule comprises a complementary sequence of the 5' end sequence of one linker and a complementary sequence of the 5' end sequence of another linker from 5'-3'); it is used for circularization of DNA fragments connected to two different linkers. Based on this, it can also be used to screen DNA fragments connected to two different linkers, and as a primer for rolling circle amplification (RCA) to prepare DNBs. However, for DNA fragments connected to two identical linkers, since they cannot be circularized, RCA cannot be performed to prepare DNBs.

[0225] Preferably, the kit may further comprise: a PCR reaction reagent for linearly amplifying the DNA fragment connected to the adapter.

[0226] A fourth aspect of the present invention provides a method.

[0227] b1) A method for DNA end repair and linker ligation, comprising the steps of using the reagent combination of the first aspect of the present invention, further specifically as follows: mixing DNA fragments, linkers, end repair enzymes, ligases and nucleic acid extension enzymes, and reacting the resulting system.

[0228] b2) A method for constructing a nucleic acid library, comprising the steps of using the reagent combination of the first aspect of the present invention, further specifically as follows: mixing DNA fragments, linkers, end repair enzymes, ligases and nucleic acid extension enzymes, and reacting the resulting system.

[0229] b3) A method for DNA shearing-end repair-adapter ligation, comprising the steps of using the reagent combination of the second aspect of the present invention, further specifically as follows: DNA, an adaptor, a shearing enzyme, an end repair enzyme, a ligase, and a nucleic acid extension enzyme are mixed, and the resulting system is reacted.

[0230] b4) A method for constructing a nucleic acid library, comprising the steps of using the reagent combination of the second aspect of the present invention, further specifically as follows: DNA, a linker, a breaking enzyme, an end repair enzyme, a ligase and a nucleic acid extension enzyme are mixed, and the resulting system is reacted.

[0231] In b1) and b2), the 3' overhang of the DNA fragment is excised and / or the 5' overhang of the DNA fragment is blunted by an end-repair enzyme, thereby ultimately forming a double-stranded DNA fragment with a blunt end (which may also include 3'-end dephosphorylation and 5'-end phosphorylation of the DNA fragment). The end-repaired DNA fragment is ligated to a linker by a ligase, and the complementary strand of the linker connecting the DNA fragment is extended by a nucleic acid extender (using the linker as a template to extend the complementary strand), thereby obtaining a DNA fragment with a double-stranded linker at both ends, thereby achieving DNA end-repair and linker ligation in a single reaction system. Compared with the existing DNA end-repair-linker ligation method for library construction in enzyme digestion, the end-A addition step is reduced. At the same time, DNA end-repair and linker ligation can be achieved in a single reaction system. The DNA fragment is directly reacted in a single step and then the linker is added, achieving a one-step library construction method, which can greatly reduce the steps of library preparation and directly prepare DNBs, greatly reducing library construction time.

[0232] In b3) and b4), DNA (e.g., genomic DNA) is fragmented by a shearing enzyme to break the DNA into DNA fragments of different sizes. The 3' overhangs of the DNA fragments are removed and / or the 5' overhangs of the DNA fragments are filled with an end-repair enzyme to ultimately form double-stranded DNA fragments with blunt ends (this may also include 3' end dephosphorylation and 5' end phosphorylation of the DNA fragments). The end-repaired DNA fragments are ligated to adapters by a ligase. The complementary chains of the adapters connecting the DNA fragments are extended by a nucleic acid extension enzyme (using the adapters as templates to extend the complementary chains), thereby obtaining DNA fragments with double-stranded adapters at both ends. DNA shearing, end repair, and adapter ligation are then achieved in one reaction system. Compared with the existing enzyme digestion-end repair-adapter ligation method for library construction, the number of terminal A additions is reduced. At the same time, DNA shearing, end repair and adapter connection can be achieved in one reaction system. DNA is directly reacted in one step and then adapters are added to achieve one-step library construction, which can greatly reduce the steps of library preparation. At the same time, it reduces the number of purification times, improves the utilization efficiency of DNA, and can directly prepare DNB, greatly reducing the library construction time.

[0233] Preferably, the systems in b1), b2), b3) and b4) further comprise a buffer (b1). b2) is preferably the buffer in the first aspect of the present invention, and b3) and b4) are preferably the buffer in the second aspect of the present invention).

[0234] In b1), b2), b3) and b4):

[0235] Preferably, the concentration of the buffer in the system is 10-100 mM.

[0236] Preferably, the concentration of magnesium ions and / or manganese ions in the buffer in the system is 1 to 50 mM.

[0237] Preferably, the concentration of dNTP in the buffer in the system is 0.05-5 mM.

[0238] Preferably, the concentration of ATP and / or GTP in the buffer in the system is 0.1-10 mM.

[0239] Preferably, the concentration of the linker in the system is 100 nM to 10 μM; further 200 nM to 800 nM.

[0240] Preferably, the concentration of the polynucleotide kinase in the end repair enzyme in the system is 0.01 U / μL to 1 U / μL.

[0241] Preferably, the concentration of the polymerase in the end repair enzyme in the system is 0.01 U / μL to 1 U / μL; further 0.0725 U / μL to 0.29 U / μL.

[0242] Preferably, the concentration of the ligase in the system is 0.1 U / μL to 10 U / μL; further 0.1 U / μL to 0.4 U / μL.

[0243] Preferably, the concentration of the nucleic acid extender in the system is 0.005 U / μL to 1 U / μL; further 0.005 U / μL to 0.02 U / μL.

[0244] In b1) and b2):

[0245] Preferably, the concentration of the DNA fragment in the system is 1 nM to 100 nM.

[0246] Preferably, the DNA fragment is the DNA fragment in the first aspect of the present invention.

[0247] Preferably, the reaction procedure comprises: reaction at 16-40° C. for 10-60 min; reaction at 50-75° C. for 5-60 min.

[0248] In b3), b4):

[0249] Preferably, the concentration of the disrupting enzyme in the system is 0.00001 U / μL to 0.1 U / μL; further 0.00002 U / μL to 0.004 U / μL; further 0.0002 U / μL.

[0250] Preferably, the concentration of calcium ions in the buffer in the system is 0.001 to 50 mM; further 0.004 to 0.8 mM.

[0251] Preferably, the concentration of the DNA in the system is 1 nM to 100 nM.

[0252] Preferably, the DNA is the DNA in the second aspect of the present invention.

[0253] Preferably, the reaction procedure comprises: reaction at 16-40°C for 10-60 min; reaction at 50-75°C for 5-60 min; further comprises: reaction at 37°C for 15 min; reaction at 65°C for 5-10 min.

[0254] In b2) and b4):

[0255] Preferably, the method further comprises: performing an amplification reaction on the DNA fragments connected to the adapter.

[0256] Preferably, the amplification reaction is at least one of linear amplification and rolling circle amplification; further, rolling circle amplification (ie, the nucleic acid library construction method is a PCR-free nucleic acid library construction method).

[0257] Preferably, when the amplification reaction is linear amplification and rolling circle amplification, linear amplification is performed first and then rolling circle amplification.

[0258] Preferably, the rolling circle amplification further comprises a circularization reaction.

[0259] Preferably, the rolling circle amplification and cyclization reaction use the DNB preparation reagent in the third aspect of the present invention, that is, the cyclization reaction and rolling circle amplification can be completed in one step or in multiple steps.

[0260] Preferably, the cyclization reaction further includes a phosphorylation reaction (preferably a 5' end phosphorylation reaction).

[0261] Preferably, the phosphorylation reaction uses polynucleotide kinase (preferably T4 polynucleotide kinase).

[0262] Preferably, the linear amplification uses a PCR reaction reagent (preferably the PCR reaction reagent in the third aspect of the present invention).

[0263] The fifth aspect of the present invention provides a nucleic acid library obtained by the nucleic acid library construction method of the fourth aspect of the present invention.

[0264] The sixth aspect of the present invention provides a reaction system.

[0265] c1) A DNA end-repair-adapter ligation reaction system comprising a DNA fragment and the adaptor, end-repair enzyme, ligase and nucleic acid extender according to the first aspect of the present invention.

[0266] c2) A reaction system for constructing a nucleic acid library, comprising DNA fragments and the linker, end-repair enzyme, ligase and nucleic acid extender according to the first aspect of the present invention.

[0267] c3) A DNA shearing-end repair-adapter ligation reaction system, comprising DNA and the adaptor according to the second aspect of the present invention, a shearing enzyme, an end repair enzyme, a ligase, and a nucleic acid extender.

[0268] c4) A reaction system for constructing a nucleic acid library, comprising DNA and the linker, the breaking enzyme, the end-repair enzyme, the ligase and the nucleic acid extension enzyme according to the second aspect of the present invention.

[0269] In c1) and c2), the 3' overhangs of the DNA fragments are excised and / or the 5' overhangs of the DNA fragments are blunted by an end-repair enzyme, thereby ultimately forming double-stranded DNA fragments with blunt ends (this may also include 3'-end dephosphorylation and 5'-end phosphorylation of the DNA fragments). The end-repaired DNA fragments are ligated to adapters by a ligase, and the complementary strands of the adapters connecting the DNA fragments are extended by a nucleic acid extender (using the adapters as templates to extend the complementary strands), thereby obtaining DNA fragments with double-stranded adapters at both ends, thereby achieving DNA end-repair and adapter ligation in a single reaction system. Compared with the existing DNA end-repair-adapter ligation method for library construction in enzyme digestion, this method reduces the step of end-addition of A. At the same time, DNA end-repair and adapter ligation can be achieved in a single reaction system. The DNA fragments are directly reacted in a single step and then adapters are added, achieving a one-step library construction method, which can greatly reduce the steps of library preparation and directly allow for the preparation of DNBs, greatly reducing library construction time.

[0270] In c3) and c4), the DNA (e.g., genomic DNA) is fragmented by a shearing enzyme to break the DNA into DNA fragments of different sizes, the 3' overhangs of the DNA fragments are removed and / or the 5' overhangs of the DNA fragments are filled with an end-repair enzyme to ultimately form double-stranded DNA fragments with blunt ends (this may also include dephosphorylating the 3' ends and phosphorylating the 5' ends of the DNA fragments), the end-repaired DNA fragments are ligated to a linker by a ligase, and the complementary strands of the linkers connecting the DNA fragments are extended by a nucleic acid extension enzyme (extending the complementary strands using the linker as a template), thereby DNA fragments with double-stranded adapters at both ends are obtained, and DNA shearing, end repair and adapter ligation are then achieved in one reaction system. Compared with the existing enzyme digestion library construction method of DNA shearing-end repair-adapter ligation, the step of adding A at the end is reduced. At the same time, DNA shearing, end repair and adapter ligation can be achieved in one reaction system. The DNA is directly reacted in one step and then the adapter is added to realize one-step library construction, which can greatly reduce the steps of library preparation. At the same time, it reduces the number of purification times, improves the utilization efficiency of DNA, and can directly prepare DNBs, which greatly reduces the library construction time.

[0271] Preferably, the reaction systems described in c1), c2), c3) and c4) are used for one-step library construction.

[0272] Preferably, the reaction system in c1), c2), c3) and c4) further comprises a buffer (c1). c2) is preferably the buffer in the first aspect of the present invention, and c3) and c4) are preferably the buffer in the second aspect of the present invention).

[0273] In c1), c2), c3), and c4):

[0274] Preferably, the concentration of the buffer in the reaction system is 10-100 mM.

[0275] Preferably, the concentration of magnesium ions and / or manganese ions in the buffer in the reaction system is 1 to 50 mM.

[0276] Preferably, the concentration of dNTP in the buffer in the reaction system is 0.05-5 mM.

[0277] Preferably, the concentration of ATP and / or GTP in the buffer in the system is 0.1-10 mM.

[0278] Preferably, the concentration of the linker in the reaction system is 100 nM to 10 μM; further 200 nM to 800 nM.

[0279] Preferably, the concentration of the polynucleotide kinase in the end repair enzyme in the reaction system is 0.01 U / μL to 1 U / μL.

[0280] Preferably, the concentration of the polymerase in the end repair enzyme in the reaction system is 0.01 U / μL to 1 U / μL; further 0.0725 U / μL to 0.29 U / μL.

[0281] Preferably, the concentration of the ligase in the reaction system is 0.1 U / μL to 10 U / μL; further 0.1 U / μL to 0.4 U / μL.

[0282] Preferably, the concentration of the nucleic acid extender in the reaction system is 0.005 U / μL to 1 U / μL; further 0.005 U / μL to 0.02 U / μL.

[0283] In c1) and c2):

[0284] Preferably, the concentration of the DNA fragment in the reaction system is 1 nM to 100 nM.

[0285] Preferably, the DNA fragment is the DNA fragment in the first aspect of the present invention.

[0286] In c3) and c4):

[0287] Preferably, the concentration of the disrupting enzyme in the reaction system is 0.00001 U / μL to 0.1 U / μL; further 0.00002 U / μL to 0.004 U / μL; further 0.0002 U / μL.

[0288] Preferably, the concentration of calcium ions in the buffer in the reaction system is 0.001 to 50 mM; further 0.004 to 0.8 mM.

[0289] Preferably, the concentration of the DNA in the reaction system is 1 nM to 100 nM.

[0290] Preferably, the DNA is the DNA in the second aspect of the present invention.

[0291] The seventh aspect of the present invention provides a sequencing method, comprising the following steps: obtaining a nucleic acid library; sequencing; the nucleic acid library is the nucleic acid library of the fifth aspect of the present invention.

[0292] Preferably, the sequencing further includes the following steps: library quality inspection.

[0293] The present invention is further described in detail below through specific examples.

[0294] It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0295] The experimental methods in the following examples, where specific conditions are not specified, were generally performed under conventional conditions or the conditions recommended by the manufacturers. The materials and reagents used in these examples were commercially available unless otherwise specified.

[0296] Example 1 A method for rapidly constructing a nucleic acid library

[0297] A method for rapidly constructing a nucleic acid library comprises the following steps (the flowchart is shown in FIG1 ):

[0298] DNA fragmentation & end repair and adapter ligation and extension, as follows:

[0299] 1) Prepare 200 ng of NA12878 commercial standard DNA according to Table 1;

[0300] Table 1 Reaction system

[0301] Note: DNase I was purchased from NEB, product number M0303S (pre-diluted 200-fold before use, containing calcium ions), where the final concentration of DNase I in the reaction system was 0.0002 U / μL, and the final concentration of calcium ions in the reaction system was 0.04 mM; Klenow Fragment was purchased from BGI, product number 01E013MS, and its final concentration in the reaction system was 0.025 U / μL; T4 DNA Polymerase was purchased from BGI, product number 01E007MM, and its final concentration in the reaction system was 0.12 U / μL; T4 RNA ligase 1 was purchased from NEB, product number M0204L, containing ATP (10 mM), and the final concentration of T4 RNA ligase 1 in the reaction system was 0.2 U / μL, and the final concentration of ATP in the reaction system was 1 mM; Platinum High-Fidelity DNA Polymerase was purchased from BGI, catalog number 1000028946, with a final concentration of 0.01 U / μL in the reaction system. RNase inhibitor was purchased from BGI, catalog number 1000014382. Adapter A: GAACGACATGGCTACGATCCGACTrU (SEQ ID NO. 1, r represents ribonucleotide), with a final concentration of 0.4 μM in the reaction system. Adapter B: TGTGAGCCAAGGAGTTGATCGGACCTATTGTCTTCCTAAGACCGCTTGGCCTCCGACTrU (SEQ ID NO. 2, r represents ribonucleotide), with a final concentration of 0.4 μM in the reaction system. The final concentration of magnesium ions in T4 RNA Ligase Reaction Buffer (10X) was 10 mM.

[0302] 2) Place the prepared reaction system on a PCR instrument and perform the reaction according to the procedure in Table 2;

[0303] Table 2 Reaction procedure

[0304] 3) After the reaction is complete, remove the PCR tube from the PCR instrument and centrifuge briefly to collect the reaction solution at the bottom of the PCR tube;

[0305] 4) Then add 25 μL of purified magnetic beads, vortex and shake to mix thoroughly, and incubate at room temperature for 10 minutes;

[0306] 5) After centrifugation, place the PCR tube on a magnetic stand and let it stand for 5 minutes until the liquid becomes clear. Use a pipette to aspirate and discard the supernatant.

[0307] 6) Add 200 μL of 80% ethanol to the PCR tube to wash the beads. Let stand for 30 seconds. Use a pipette to aspirate and discard the supernatant. Repeat this process.

[0308] 7) Try to drain the liquid in the tube. If there is a small amount of liquid remaining on the tube wall, centrifuge the PCR tube briefly and separate it on a magnetic rack.

[0309] 8) Open the PCR tube cap, dry at room temperature, and add 26 μL of enzyme-free water to elute the DNA;

[0310] 9) Incubate at room temperature for 5 minutes, centrifuge briefly, place the PCR tube on a magnetic stand, let it stand for 5 minutes until the liquid becomes clear, and transfer 25 μL of the supernatant to a new PCR tube to obtain the linear library.

[0311] 10) Use ssDNA Assay Kit fluorescence quantitative kit, purify the product and quantify it according to the operating instructions of the quantitative kit.

[0312] Example 2 A method for rapidly constructing a nucleic acid library

[0313] A method for rapidly constructing a nucleic acid library comprises the following steps (the flowchart is shown in FIG1 ):

[0314] DNA fragmentation & end repair and adapter ligation and extension, as follows:

[0315] 1) Prepare 200 ng of NA12878 commercial standard DNA according to Table 3;

[0316] Table 3 Reaction system

[0317] Note: DNase I was purchased from NEB, catalog number M0303S, with a final concentration of 0.004 U / μL and a final concentration of 0.8 mM calcium ion in the reaction system. Klenow Fragment was purchased from BGI, catalog number 01E013MS, with a final concentration of 0.05 U / μL. T4 DNA Polymerase was purchased from BGI, catalog number 01E007MM, with a final concentration of 0.24 U / μL. T4 RNA ligase 1 was purchased from NEB, catalog number M0204L, including 10 mM ATP. The final concentration of 0.4 U / μL and 1 mM ATP were used in the reaction. Platinum High-Fidelity DNA Polymerase was purchased from BGI, catalog number 1000028946, with a final concentration of 0.02 U / μL. RNase Inhibitor was purchased from BGI, catalog number 1000014382; adapter A: GAACGACATGGCTACGATCCGACTrU (SEQ ID NO. 1, r represents ribonucleotide), its final concentration in the reaction system was 0.8 μM; adapter B: TGTGAGCCAAGGAGTTGATCGGACCTATTGTCTTCCTAAGACCGCTTGGCCTCCGACTrU (SEQ ID NO. 2, r represents ribonucleotide), its final concentration in the reaction system was 0.8 μM; the final concentration of magnesium ions in the reaction system in T4 RNA Ligase Reaction Buffer (10X) was 10 mM.

[0318] 2) Place the prepared reaction system on a PCR instrument and perform the reaction according to the procedure in Table 4;

[0319] Table 4 Reaction procedure

[0320] 3) After the reaction is complete, remove the PCR tube from the PCR instrument and centrifuge briefly to collect the reaction solution at the bottom of the PCR tube;

[0321] 4) Then add 25 μL of purified magnetic beads, vortex and shake to mix thoroughly, and incubate at room temperature for 10 minutes;

[0322] 5) After centrifugation, place the PCR tube on a magnetic stand and let it stand for 5 minutes until the liquid becomes clear. Use a pipette to aspirate and discard the supernatant.

[0323] 6) Add 200 μL of 80% ethanol to the PCR tube to wash the beads. Let stand for 30 seconds. Use a pipette to aspirate and discard the supernatant. Repeat this process.

[0324] 7) Try to drain the liquid in the tube. If there is a small amount of liquid remaining on the tube wall, centrifuge the PCR tube briefly and separate it on a magnetic rack.

[0325] 8) Open the PCR tube cap, dry at room temperature, and add 26 μL of enzyme-free water to elute the DNA;

[0326] 9) Incubate at room temperature for 5 minutes, centrifuge briefly, place the PCR tube on a magnetic stand, let it stand for 5 minutes until the liquid becomes clear, and transfer 25 μL of the supernatant to a new PCR tube to obtain the linear library.

[0327] 10) Use The ssDNA Assay Kit fluorescent quantitative kit was used to purify the product and quantify it according to the operating instructions of the quantitative kit. The yield of the obtained library was 86 ng.

[0328] Example 3 A method for rapidly constructing a nucleic acid library

[0329] A method for rapidly constructing a nucleic acid library comprises the following steps (the flowchart is shown in FIG1 ):

[0330] DNA fragmentation & end repair and adapter ligation and extension, as follows:

[0331] 1) Prepare 50 ng of NA12878 commercial standard DNA according to Table 5;

[0332] Table 5 Reaction system

[0333] Note: DNase I was purchased from NEB, product number M0303S, where the final concentration of DNase I in the reaction system was 0.00002U / μL, and the final concentration of calcium ions in the reaction system was 0.004mM; Klenow Fragment was purchased from BGI, product number 01E013MS, and its final concentration in the reaction system was 0.0125U / μL; T4 DNA Polymerase was purchased from BGI, product number 01E007MM, and its final concentration in the reaction system was 0.06U / μL; T4 RNA ligase 1 was purchased from NEB, product number M0204L, including ATP (10mM), and the final concentration of T4 RNA ligase 1 in the reaction system was 0.1U / μL, and the final concentration of ATP in the reaction system was 1mM; Platinum High-Fidelity DNA Polymerase was purchased from BGI, catalog number 1000028946, with a final concentration of 0.005 U / μL in the reaction system. RNase inhibitor was purchased from BGI, catalog number 1000014382. Adapter A: GAACGACATGGCTACGATCCGACTrU (SEQ ID NO. 1, r represents ribonucleotide), with a final concentration of 0.2 μM in the reaction system. Adapter B: TGTGAGCCAAGGAGTTGATCGGACCTATTGTCTTCCT AAGACCGCTTGGCCTCCGACTrU (SEQ ID NO. 2, r represents ribonucleotide), with a final concentration of 0.2 μM in the reaction system. The final concentration of magnesium ions in T4 RNA Ligase Reaction Buffer (10X) was 10 mM.

[0334] 2) Place the prepared reaction system on a PCR instrument and perform the reaction according to the procedure in Table 6;

[0335] Table 6 Reaction procedure

[0336] 3) After the reaction is complete, remove the PCR tube from the PCR instrument and centrifuge briefly to collect the reaction solution at the bottom of the PCR tube;

[0337] 4) Then add 25 μL of purified magnetic beads, vortex and shake to mix thoroughly, and incubate at room temperature for 10 minutes;

[0338] 5) After centrifugation, place the PCR tube on a magnetic stand and let it stand for 5 minutes until the liquid becomes clear. Use a pipette to aspirate and discard the supernatant.

[0339] 6) Add 200 μL of 80% ethanol to the PCR tube to wash the beads. Let stand for 30 seconds. Use a pipette to aspirate and discard the supernatant. Repeat this process.

[0340] 7) Try to drain the liquid in the tube. If there is a small amount of liquid remaining on the tube wall, centrifuge the PCR tube briefly and separate it on a magnetic rack.

[0341] 8) Open the PCR tube cap, dry at room temperature, and add 26 μL of enzyme-free water to elute the DNA;

[0342] 9) Incubate at room temperature for 5 minutes, centrifuge briefly, place the PCR tube on a magnetic stand, let it stand for 5 minutes until the liquid becomes clear, and transfer 25 μL of the supernatant to a new PCR tube to obtain the linear library.

[0343] 10) Use The ssDNA Assay Kit fluorescent quantitative kit was used to purify the product and quantify it according to the operating instructions of the quantitative kit. The yield of the obtained library was 15 ng.

[0344] Comparative Example 1 A method for constructing a nucleic acid library

[0345] A method for constructing a nucleic acid library using a library construction kit from Shanghai Yisheng Biotechnology Co., Ltd. (Hieff OnePot II DNA Library Prep Kit for MGI, Catalog No. 13321ES96) was used to prepare the library strictly according to the instructions.

[0346] Effect embodiment

[0347] (1) One-step preparation of DNB

[0348] The linear libraries obtained in Example 1 and Comparative Example 1 were respectively subjected to one-step DNB preparation using the DNBSEQ One-Step DNB Preparation Kit V2.0 (OS-SB) (MGI, Catalog No. 940-000035-00), wherein the splint nucleic acid molecule was GCCATGTCGTTCTGTGAGCCAAGG (SEQ ID NO. 3). The difference was that in addition to DNB polymerase mix I (OS-V2.0) and DNB polymerase mix II (OS), 1 μL of T4 PNK (BGI, Catalog No. 01E016MM) was added to prepare DNB reaction system 2 (schematic diagram shown in FIG3 , T4 PNK was not required for the linear library obtained in Comparative Example 1). The remaining steps were performed according to the instructions, and the obtained product was quantified using the Qubit ssDNA kit (Thermo Fisher, Q10212) for DNB quantification.

[0349] (2) Sequencing

[0350] The qualified DNBs were sequenced using the MGISEQ-2000 sequencer and the MGISEQ-2000 High-Throughput Sequencing Reagent Set (PE150) (MGI, 1000012555). The sequencing type was PE150, the sequencing data volume was 90G, and the sequencing depth was approximately 30× the whole genome.

[0351] (3) Data Analysis

[0352] The data from the machine was statistically analyzed, and then standard analysis software such as BMA and GATK was used to obtain performance analysis including data utilization, alignment rate, repetition rate, GC preference, etc. The results were compared and compared with the sequencing data using the same default parameters. The results are shown in Tables 7, 8, and 9: The sequencing data obtained in Example 1 (method of the present invention) performed well in all indicators, with no significant difference from Comparative Example 1 (conventional method), and even better than Comparative Example 1 (conventional method) in some indicators (e.g., genome coverage (Coverage at least 20X), indel detection (Indel F-measure)), and Example 1 (method of the present invention) greatly simplified the experimental steps (no purification step, no need for end addition of A), reduced costs, and had huge advantages. The linear library obtained in Examples 2 and 3 was prepared using a one-step method for DNB, machine sequencing, and data analysis (method as above). The results were similar to those in Example 1: The sequencing data obtained in Examples 2 and 3 performed well in all indicators, with no significant difference from the conventional method, and even better than the conventional method in some indicators.

[0353] Table 7 Statistics of offline data

[0354] Table 8 Analysis of comparison rate and coverage

[0355] Table 9 Mutation analysis

[0356] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A reagent combination for DNA end repair-adapter ligation, comprising: A connector, the connector being a single-strand connector; and end repair enzymes; and A ligase that can catalyze the formation of a phosphodiester bond between a 5'-P terminus and a 3'-OH terminus of a single-stranded oligonucleotide or a single nucleotide between or within a molecule; and Nucleic acid elongase.

2. The reagent combination according to claim 1, characterized in that: The nucleotide at the 3' end of the linker is a ribonucleotide; Preferably, the other nucleotides other than the nucleotide at the 3' end of the linker are each independently selected from ribonucleotides and deoxyribonucleotides; Preferably, the linker comprises a 5' blocking group modified end and a 3' hydroxyl end; Preferably, the blocking group modification includes at least one of amino modification, dideoxy modification, spacer modification, and hydroxyl modification.

3. The reagent combination according to claim 1, characterized in that: The ligase is selected from at least one of T4 RNA ligase 1, TS2126 RNA ligase, single-stranded DNA / RNA circular ligase, and T4 RNA ligase 2 truncated form; preferably, the ligase is T4 RNA ligase 1.

4. The reagent combination according to claim 1, characterized in that: The end repair enzyme comprises a polymerase; Preferably, the end repair enzyme further comprises polynucleotide kinase; Preferably, the polynucleotide kinase is T4 polynucleotide kinase; Preferably, the polymerase is selected from at least one of T4 DNA polymerase, DNA polymerase I (Klenow) large fragment, T7 DNA polymerase, and DNA polymerase I.

5. The reagent combination according to claim 1, characterized in that: The nucleic acid elongase comprises at least one of an RNA-dependent DNA polymerase and a DNA-dependent DNA polymerase; Preferably, the RNA-dependent DNA polymerase comprises at least one of M-MLV reverse transcriptase and AMV reverse transcriptase; Preferably, the DNA-dependent DNA polymerase is a DNA polymerase that depends on DNA comprising ribonucleotides.

6. The reagent combination according to claim 1, characterized in that: The joint comprises a first joint and a second joint; Preferably, the first linker comprises a linker sequence; Preferably, the first adapter further comprises a sequencing primer sequence; Preferably, the first adapter further comprises a sample tag sequence; Preferably, the first linker further comprises a unique molecular tag sequence; Preferably, the second linker comprises a linker sequence; Preferably, the second adapter further comprises a sequencing primer sequence; Preferably, the second linker further comprises a sample tag sequence; Preferably, the second linker further comprises a unique molecular tag sequence; Preferably, the length of the sample tag sequence is 5 to 20 bp; Preferably, the length of the unique molecular tag is 5 to 20 bp; Preferably, the first linker and the second linker have different sequences.

7. The reagent combination according to claim 1, characterized in that: The reagent combination further comprises: a buffer, wherein the buffer comprises: dNTP; and At least one of ATP, GTP; and Metal ions; Preferably, the metal ions include at least one of magnesium ions and manganese ions; Preferably, the buffer comprises at least one of a citrate buffer, a MES buffer solution, a phosphate buffer, a Bis-tris buffer, and a Tris hydrochloric acid buffer; Preferably, the pH of the buffer is 6 to 8; Preferably, the reagent combination is used for DNA end repair-adapter ligation of DNA fragments; Preferably, the reagent combination is used to perform DNA end repair-adapter ligation in the same reaction system; wherein the same reaction system is specifically performed in the same reaction container; Preferably, the reagent combination is used for one-step library construction.

8. A reagent combination for DNA shearing-end repair-adapter ligation, comprising: a shearing enzyme; and A connector, the connector being a single-strand connector; and end repair enzymes; and A ligase that can catalyze the formation of a phosphodiester bond between a 5'-P terminus and a 3'-OH terminus of a single-stranded oligonucleotide or a single nucleotide between or within a molecule; and Nucleic acid elongase.

9. The reagent combination according to claim 8, characterized in that: The nucleotide at the 3' end of the linker is a ribonucleotide; Preferably, the other nucleotides other than the nucleotide at the 3' end of the linker are each independently selected from ribonucleotides and deoxyribonucleotides; Preferably, the linker comprises a 5' blocking group modified end and a 3' hydroxyl end; Preferably, the blocking group modification includes at least one of amino modification, dideoxy modification, spacer modification, and hydroxyl modification; Preferably, the ligase is selected from at least one of T4 RNA ligase 1, TS2126 RNA ligase, single-stranded DNA / RNA circular ligase, and T4 RNA ligase 2 truncated form; Preferably, the end repair enzyme comprises a polymerase; Preferably, the end repair enzyme further comprises polynucleotide kinase; Preferably, the polynucleotide kinase is T4 polynucleotide kinase; Preferably, the polymerase is selected from at least one of T4 DNA polymerase, DNA polymerase I (Klenow) large fragment, T7 DNA polymerase, and DNA polymerase I; Preferably, the nucleic acid elongase comprises at least one of an RNA-dependent DNA polymerase and a DNA-dependent DNA polymerase; Preferably, the RNA-dependent DNA polymerase comprises at least one of M-MLV reverse transcriptase and AMV reverse transcriptase; Preferably, the DNA-dependent DNA polymerase is a DNA polymerase that depends on DNA containing ribonucleotides; Preferably, the connector comprises a first connector and a second connector; Preferably, the first linker comprises a linker sequence; Preferably, the first adapter further comprises a sequencing primer sequence; Preferably, the first adapter further comprises a sample tag sequence; Preferably, the first linker further comprises a unique molecular tag sequence; Preferably, the second linker comprises a linker sequence; Preferably, the second adapter further comprises a sequencing primer sequence; Preferably, the second linker further comprises a sample tag sequence; Preferably, the second linker further comprises a unique molecular tag sequence; Preferably, the length of the sample tag sequence is 5 to 20 bp; Preferably, the length of the unique molecular tag is 5 to 20 bp; Preferably, the first linker and the second linker have different sequences; The reagent combination further comprises: a buffer, wherein the buffer comprises: dNTP; and At least one of ATP, GTP; and Metal ions; Preferably, the metal ions include at least one of magnesium ions and manganese ions; Preferably, the metal ions further comprise calcium ions; Preferably, the buffer comprises at least one of a citrate buffer, a MES buffer solution, a phosphate buffer, a Bis-tris buffer, and a Tris hydrochloric acid buffer; Preferably, the pH of the buffer solution is 6-8.

10. The reagent combination according to claim 8, characterized in that: The breaking enzyme comprises an endonuclease; further comprises a non-specific endonuclease; further comprises at least one of endonuclease DNase I, micrococcal nuclease, endonuclease dsDNase, salt-active endonuclease SAN, and endonuclease Vvn; Preferably, the reagent combination is used for DNA shearing-end repair-adapter ligation of DNA; Preferably, the reagent combination is used to perform DNA shearing-end repair-adapter ligation in the same reaction system; wherein the same reaction system is specifically performed in the same reaction container; Preferably, the reagent combination is used for one-step library construction.

11. A library construction kit comprising: A connector, the connector being a single-strand connector; and end repair enzymes; and A ligase that can catalyze the formation of a phosphodiester bond between a 5'-P terminus and a 3'-OH terminus of a single-stranded oligonucleotide or a single nucleotide between or within a molecule; and Nucleic acid elongase; Preferably, the kit further comprises: a DNB preparation reagent.

12. The library construction kit according to claim 11, characterized in that: The kit further comprises: a disrupting enzyme; Preferably, the breaking enzyme comprises an endonuclease; further comprises a non-specific endonuclease; further comprises at least one of endonuclease DNase I, micrococcal nuclease, endonuclease dsDNase, salt-active endonuclease SAN, and endonuclease Vvn; Preferably, the nucleotide at the 3' end of the linker is a ribonucleotide; Preferably, the other nucleotides other than the nucleotide at the 3' end of the linker are each independently selected from ribonucleotides and deoxyribonucleotides; Preferably, the linker comprises a 5' blocking group modified end and a 3' hydroxyl end; Preferably, the blocking group modification includes at least one of amino modification, dideoxy modification, spacer modification, and hydroxyl modification; Preferably, the connector comprises a first connector and a second connector; Preferably, the first linker comprises a linker sequence; Preferably, the first adapter further comprises a sequencing primer sequence; Preferably, the first adapter further comprises a sample tag sequence; Preferably, the first linker further comprises a unique molecular tag sequence; Preferably, the second linker comprises a linker sequence; Preferably, the second adapter further comprises a sequencing primer sequence; Preferably, the second linker further comprises a sample tag sequence; Preferably, the second linker further comprises a unique molecular tag sequence; Preferably, the length of the sample tag sequence is 5 to 20 bp; Preferably, the length of the unique molecular tag is 5 to 20 bp; Preferably, the first linker and the second linker have different sequences.

13. The library construction kit according to claim 11, characterized in that: The ligase is selected from at least one of T4 RNA ligase 1, TS2126 RNA ligase, single-stranded DNA / RNA circular ligase, and T4 RNA ligase 2 truncated form; Preferably, the end repair enzyme comprises a polymerase; Preferably, the end repair enzyme further comprises polynucleotide kinase; Preferably, the polynucleotide kinase is T4 polynucleotide kinase; Preferably, the polymerase is selected from at least one of T4 DNA polymerase, DNA polymerase I (Klenow) large fragment, T7 DNA polymerase, and DNA polymerase I; Preferably, the nucleic acid elongase comprises at least one of an RNA-dependent DNA polymerase and a DNA-dependent DNA polymerase; Preferably, the RNA-dependent DNA polymerase comprises at least one of M-MLV reverse transcriptase and AMV reverse transcriptase; Preferably, the DNA-dependent DNA polymerase is a DNA polymerase that depends on DNA comprising ribonucleotides.

14. The library construction kit according to claim 11, characterized in that: The library construction kit further comprises: a buffer, wherein the buffer comprises: dNTPs; and At least one of ATP, GTP; and Metal ions; Preferably, the metal ions include at least one of magnesium ions and manganese ions; Preferably, the metal ions further comprise calcium ions; Preferably, the buffer comprises at least one of a citrate buffer, a MES buffer solution, a phosphate buffer, a Bis-tris buffer, and a Tris hydrochloric acid buffer; Preferably, the pH of the buffer solution is 6-8.

15. The library construction kit according to claim 11, characterized in that: The DNB preparation reagent is a substance selected from any one of the following DNB preparation methods: a1) single-strand cyclization (cyclization reaction), linear single-strand digestion, purification, rolling circle replication (rolling circle amplification) are sequentially performed to obtain DNA nanospheres; a2) single-strand cyclization and rolling circle replication are completed in one step to obtain DNA nanospheres; Further preferably, the DNB preparation reagent is a substance selected from the following DNB preparation methods: a2) single-stranded circularization and rolling circle replication are completed in one step to obtain DNA nanoballs.

16. The library construction kit according to claim 11, characterized in that: The DNB preparation reagent comprises: polynucleotide kinase; Preferably, the polynucleotide kinase is T4 polynucleotide kinase; Preferably, the DNB preparation reagent comprises: a splint nucleic acid molecule, the splint nucleic acid molecule comprising a complementary sequence to the 5' end sequence of one adapter and a 5' end sequence of another adapter; Preferably, the splint nucleic acid molecule comprises, from 5' to 3', a complementary sequence to the 5' end sequence of one linker and a 5' end sequence of another linker: and / or the splint nucleic acid molecule comprises, from 5' to 3', a 5' end sequence of one linker and a complementary sequence to a 5' end sequence of another linker; Preferably, the kit may further comprise: PCR reaction reagents.

17. Any of the following methods: b1) A method for constructing a nucleic acid library, comprising mixing DNA fragments, linkers, end repair enzymes, ligases and nucleic acid extension enzymes, and reacting the resulting system; b2) A method for constructing a nucleic acid library, comprising mixing DNA, a linker, a breaking enzyme, an end repair enzyme, a ligase and a nucleic acid extension enzyme, and reacting the obtained system; The joints described in b1) and b2) are single-chain joints; The ligase in b1) and b2) can catalyze the formation of a phosphodiester bond between the 5'-P end and the 3'-OH end of a single-stranded oligonucleotide or between or within a single nucleotide molecule.

18. The method according to claim 17, characterized in that: The nucleotide at the 3' end of the linker in b1) and b2) is a ribonucleotide; Preferably, the other nucleotides other than the nucleotide at the 3' end of the linker are each independently selected from ribonucleotides and deoxyribonucleotides; Preferably, the linker comprises a 5' blocking group modified end and a 3' hydroxyl end; Preferably, the blocking group modification includes at least one of amino modification, dideoxy modification, spacer modification, and hydroxyl modification; Preferably, the connector comprises a first connector and a second connector; Preferably, the first linker comprises a linker sequence; Preferably, the first adapter further comprises a sequencing primer sequence; Preferably, the first adapter further comprises a sample tag sequence; Preferably, the first linker further comprises a unique molecular tag sequence; Preferably, the second linker comprises a linker sequence; Preferably, the second adapter further comprises a sequencing primer sequence; Preferably, the second linker further comprises a sample tag sequence; Preferably, the second linker further comprises a unique molecular tag sequence; Preferably, the length of the sample tag sequence is 5 to 20 bp; Preferably, the length of the unique molecular tag is 5 to 20 bp; Preferably, the first linker and the second linker have different sequences.

19. The method according to claim 17, characterized in that: b1) and b2) wherein the ligase is selected from at least one of T4 RNA ligase 1, TS2126 RNA ligase, single-stranded DNA / RNA circular ligase, and T4 RNA ligase 2 truncated form; Preferably, the end repair enzyme in b1) and b2) comprises a polymerase; Preferably, the terminal repair enzyme in b1) and b2) further comprises polynucleotide kinase; Preferably, the polynucleotide kinase is T4 polynucleotide kinase; Preferably, the polymerase is selected from at least one of T4 DNA polymerase, DNA polymerase I (Klenow) large fragment, T7 DNA polymerase, and DNA polymerase I; Preferably, the nucleic acid elongase in b1) and b2) comprises at least one of an RNA-dependent DNA polymerase and a DNA-dependent DNA polymerase; Preferably, the RNA-dependent DNA polymerase comprises at least one of M-MLV reverse transcriptase and AMV reverse transcriptase; Preferably, the DNA-dependent DNA polymerase is a DNA polymerase that depends on DNA containing ribonucleotides; Preferably, the breaking enzyme in b2) comprises a nuclease; further comprises a non-specific nuclease; and further comprises at least one of a nuclease DNase I, a micrococcal nuclease, a nuclease dsDNase, a salt-active nuclease SAN, and a nuclease Vvn.

20. The method according to claim 17, characterized in that: The system in b1) and b2) further comprises a buffer, wherein the buffer comprises: dNTP; and At least one of ATP, GTP; and Metal ions; Preferably, the metal ions in b1) and b2) include at least one of magnesium ions and manganese ions; Preferably, the metal ions in b2) further include calcium ions; Preferably, the concentration of magnesium ions and / or manganese ions in the buffer in b1) and b2) in the system is 1 to 50 mM; Preferably, the concentration of dNTP in the buffer in b1) and b2) in the system is 0.05-5 mM; Preferably, the concentration of ATP and / or GTP in the buffer in b1) and b2) in the system is 0.1-10 mM; Preferably, the concentration of calcium ions in the buffer in b2) in the system is 0.001 to 50 mM; Preferably, the concentration of the linker in b1) and b2) in the system is 100 nM to 10 μM; Preferably, the concentration of the ligase in b1) and b2) in the system is 0.1U / μL to 10U / μL; Preferably, the concentration of the nucleic acid elongase in b1) and b2) in the system is 0.005U / μL to 1U / μL; Preferably, the concentration of the disrupting enzyme in b2) in the system is 0.00001 U / μL to 0.1 U / μL.

21. The method according to claim 17, characterized in that: The method described in b1) and b2) further comprises: performing an amplification reaction on the DNA fragment connected to the adapter; Preferably, the amplification reaction is: at least one of: linear amplification and rolling circle amplification; further: rolling circle amplification; Preferably, the rolling circle amplification further comprises a circularization reaction; Preferably, the rolling circle amplification and cyclization reaction use DNB to prepare reagents; Preferably, the DNB preparation reagent is a substance selected from any one of the following DNB preparation methods: a1) single-strand cyclization (cyclization reaction), linear single-strand digestion, purification, rolling circle replication (rolling circle amplification) are sequentially performed to obtain DNA nanoballs; a2) single-strand cyclization and rolling circle replication are completed in one step to obtain DNA nanoballs; Preferably, the cyclization reaction further comprises a phosphorylation reaction; Preferably, the phosphorylation reaction uses polynucleotide kinase; Preferably, the linear amplification uses PCR reaction reagents.

22. A nucleic acid library obtained by the nucleic acid library construction method according to any one of claims 17 to 21.

23. Any one of the reaction systems c1) and c2): c1) a reaction system for constructing a nucleic acid library, comprising DNA fragments, adapters, end repair enzymes, ligases and nucleic acid extension enzymes; c2) a reaction system for constructing a nucleic acid library, comprising DNA, a linker, a shearing enzyme, an end repair enzyme, a ligase, and a nucleic acid extension enzyme; The joints in c1) and c2) are single-chain joints; The ligase in c1) and c2) can catalyze the formation of a phosphodiester bond between the 5'-P end and the 3'-OH end of a single-stranded oligonucleotide or between or within a single nucleotide molecule.

24. The reaction system according to claim 23, characterized in that: The nucleotide at the 3' end of the linker in c1) and c2) is a ribonucleotide; Preferably, the other nucleotides other than the nucleotide at the 3' end of the linker are each independently selected from ribonucleotides and deoxyribonucleotides; Preferably, the linker comprises a 5' blocking group modified end and a 3' hydroxyl end; Preferably, the blocking group modification includes at least one of amino modification, dideoxy modification, spacer modification, and hydroxyl modification; Preferably, the connector comprises a first connector and a second connector; Preferably, the first linker comprises a linker sequence; Preferably, the first adapter further comprises a sequencing primer sequence; Preferably, the first adapter further comprises a sample tag sequence; Preferably, the first linker further comprises a unique molecular tag sequence; Preferably, the second linker comprises a linker sequence; Preferably, the second adapter further comprises a sequencing primer sequence; Preferably, the second linker further comprises a sample tag sequence; Preferably, the second linker further comprises a unique molecular tag sequence; Preferably, the length of the sample tag sequence is 5 to 20 bp; Preferably, the length of the unique molecular tag is 5 to 20 bp; Preferably, the first linker and the second linker have different sequences.

25. The reaction system according to claim 23, characterized in that: c1) and c2) wherein the ligase is selected from at least one of T4 RNA ligase 1, TS2126 RNA ligase, single-stranded DNA / RNA circular ligase, and T4 RNA ligase 2 truncated form; Preferably, the end repair enzyme in c1) and c2) comprises a polymerase; Preferably, the terminal repair enzyme in c1) and c2) further comprises polynucleotide kinase; Preferably, the polynucleotide kinase is T4 polynucleotide kinase; Preferably, the polymerase is selected from at least one of T4 DNA polymerase, DNA polymerase I (Klenow) large fragment, T7 DNA polymerase, and DNA polymerase I; Preferably, the nucleic acid elongase in c1) and c2) comprises at least one of an RNA-dependent DNA polymerase and a DNA-dependent DNA polymerase; Preferably, the RNA-dependent DNA polymerase comprises at least one of M-MLV reverse transcriptase and AMV reverse transcriptase; Preferably, the DNA-dependent DNA polymerase is a DNA polymerase that depends on DNA containing ribonucleotides; Preferably, the breaking enzyme in c2) comprises a nuclease; further comprises a non-specific nuclease; and further comprises at least one of a nuclease DNase I, a micrococcal nuclease, a nuclease dsDNase, a salt-active nuclease SAN, and a nuclease Vvn.

26. The reaction system according to claim 23, characterized in that: The reaction system in c1) and c2) further comprises a buffer, wherein the buffer comprises: dNTP; and At least one of ATP, GTP; and Metal ions; Preferably, the metal ions in c1) and c2) include at least one of magnesium ions and manganese ions; Preferably, the metal ions in c2) further include calcium ions; Preferably, the concentration of magnesium ions and / or manganese ions in the buffer in c1) and c2) in the system is 1 to 50 mM; Preferably, the concentration of dNTP in the buffer in c1) and c2) in the system is 0.05-5 mM; Preferably, the concentration of ATP and / or GTP in the buffer in c1) and c2) in the system is 0.1-10 mM; Preferably, the concentration of calcium ions in the buffer in c2) in the system is 0.001 to 50 mM; Preferably, the concentration of the linker in c1) and c2) in the reaction system is 100 nM to 10 μM; Preferably, the concentration of the ligase in c1) and c2) in the reaction system is 0.1U / μL to 10U / μL; Preferably, the concentration of the nucleic acid extension enzyme in c1) and c2) in the reaction system is 0.005U / μL to 1U / μL; Preferably, the concentration of the disrupting enzyme in c2) in the reaction system is 0.00001 U / μL to 0.1 U / μL.

Images