FSCB gene for controlling synthesis of lignin in capsicum stalks, and protein, primer pair and use thereof

Abstract

Provided are an FSCB gene for controlling the synthesis of lignin in Capsicum stalks, and a protein and the use thereof. The FSCB gene has a cDNA sequence with the full length of 2385 bp, and has the the highest relative expression level in the root of Capsicum. The gene encodes a protein sequence composed of 794 amino acid residues. The biological information analysis of the gene has great significance for deepening the understanding of FSCB in Capsicum, and lays an important foundation for the subsequent screening and breeding of varieties with a high mechanical strength.

Description

A FSCB gene for controlling pepper stem lignin synthesis, its protein, primer pair and application Technical Field

[0001] The invention belongs to the technical field of plant genes, and in particular relates to an FSCB gene for controlling lignin synthesis in pepper stems, a protein thereof, a primer pair and an application thereof. Background Art

[0002] Stem mechanical strength plays a crucial role in plant production. Insufficient mechanical strength can lead to plant lodging, a significant problem in crop production. It not only reduces yield and quality, but also increases harvesting difficulty and costs. This phenomenon is common in grain crops such as rice, corn, and wheat, as well as important cash crops such as rapeseed and pepper. Stem mechanical strength and elasticity are important breeding parameters. Stem morphology and physiological characteristics are closely linked to lodging resistance. The stem not only provides rigidity and strength to the plant but also ensures water and nutrient transport. Improving stem mechanical strength can significantly improve crop lodging resistance. Stem lodging has been reported to cause yield losses of 5% to 43% in corn, 10% to 30% in rapeseed (up to 50% or more in severe cases), and a 10% to 30% reduction in oil content. Stem mechanical strength is a crucial agronomic trait influencing normal crop development, as lodging early in development can lead to significant losses.

[0003] From a cytological perspective, the mechanical strength of plant stems is primarily related to the cell wall, of which cellulose, hemicellulose, and lignin are the primary components. Lignin is crucial for plant mechanical strength, providing mechanical strength to the stem. Lignin is the second most abundant, hard, rigid, and complex aromatic polymer in vascular plants and a crucial component of the cell wall. High accumulation of lignin in basal internodes can lead to lodging in wheat. It plays an important role in enhancing plant rigidity, protecting the plant from pathogens and mechanical stress, and strengthens the cell wall by cross-linking with cellulose and hemicellulose. High lignin content in vascular bundles strengthens the cell wall and enhances the physical strength of the plant stem. The total lignin content of the second basal internode of wheat and rice is significantly correlated with stem fracture stability and elasticity. High lignin accumulation enhances the physical stability of wheat culm internodes. During secondary cell wall formation, lignin accumulates within the carbohydrate matrix of the cell wall, strengthening the entire plant and enabling upright growth. Previous studies have reported a correlation between higher concentrations of lignin, pectin, cellulose, and protein in plant stems and stem strength. Therefore, it is clear that lignin is important in maintaining upright plant growth. Genomic and molecular studies have identified several transcription factors involved in lignin synthesis. Xylem NAC Domain 1 (XND 1) negatively regulates secondary wall deposition in xylem vessels by inhibiting VND (Vascular-Related NAC Domain proteins). In addition, studies have found that the NACs transcription factors SWNs and MYB46 in rice and maize are target genes directly activated by the master transcriptional activators of the secondary wall biosynthesis program, leading to the ectopic deposition of xylan and lignin, and increasing the mechanical strength of the stem.

[0004] Chili peppers are an important cash crop in my country, with their cultivated area increasing annually. However, insufficient support often leads to broken branches or even entire plant collapses during cultivation. These conditions can lead to flower and fruit drop, disease infection, and rot, severely impacting yield and quality. These conditions can also be environmentally unfriendly and increase labor and production costs. Consequently, these conditions have become a significant limiting factor in pepper yield and quality.

[0005] Summary of the Invention

[0006] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide a FSCB gene and protein thereof for controlling the synthesis of lignin in pepper stems and applications thereof.

[0007] In order to solve the above technical problems, the technical solution proposed by the present invention is:

[0008] In a first aspect, the present invention provides a FSCB gene for controlling lignin synthesis in pepper stems. The cDNA sequence of the FSCB gene is shown in SEQ ID NO: 1.

[0009] In a second aspect, the present invention provides a FSCB protein for regulating the synthesis of pepper stem lignin, wherein the amino acid sequence of the FSCB protein is shown in SEQ ID NO: 2.

[0010] The above-mentioned FSCB protein is preferably encoded by the nucleotide sequence shown in SEQ ID NO: 1.

[0011] In a third aspect, the present invention provides an application of regulating lignin synthesis by knocking out / silencing the FSCB gene according to claim 1.

[0012] In the above application, preferably, the plant is pepper or tomato, and the FSCB gene in the plant is knocked out / silenced to obtain a silent pepper or an editing-positive tomato plant.

[0013] More preferably, when the plant is tomato, the application method specifically comprises the following steps:

[0014] (1) PCR amplification of the FSCB gene, and the resulting PCR product was then constructed into the final CRISPR expression vector PKSE401-TRNA by homologous recombination;

[0015] (2) The constructed CRISPR expression vector PKSE401-TRNA was electroporated into Escherichia coli DH5α, and positive clones were screened by colony PCR;

[0016] (3) The positive clones screened were sequenced, and the plasmids of the clones with correct sequencing were extracted and transformed into Agrobacterium competent GV3101, which was then used to infect tomato cotyledons to complete the knockout of the FSCB gene in tomato plants;

[0017] (4) Cultivate tomato plants with FSCB gene knockout, detect whether the target gene is successfully knocked out by agarose gel electrophoresis, and select tomato plants with successful gene knockout to obtain tomato editing-positive plants.

[0018] More preferably, the primers used for PCR amplification are 22KN16-T1s, 22KN16-T2as, and 22KN16-inf-T2as, whose nucleotide sequences are shown in SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15, respectively; the primers for detecting positive clones are U6-261DF and 22KN15-inf-T2as, whose nucleotide sequences are shown in SEQ ID NO: 16 and SEQ ID NO: 17, respectively.

[0019] In a fourth aspect, the present invention provides amplification primers for the FSCB gene, wherein the upstream primer FSCB-F is shown in SEQ ID NO: 3, and the downstream primer FSCB-R is shown in SEQ ID NO: 4.

[0020] In a fifth aspect, the present invention provides a quantitative PCR primer for the FSCB gene, wherein the upstream primer qFSCB-F is shown in SEQ ID NO: 5, and the downstream primer qFSCB-R is shown in SEQ ID NO: 6.

[0021] In a sixth aspect, the present invention provides a VIGS-specific primer for the FSCB gene, wherein the upstream primer VIGS-CaFSCBF is shown in SEQ ID NO: 9, and the downstream primer VIGS-CaFSCBR is shown in SEQ ID NO: 10.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention provides a stably inherited creeping stem mutant obtained by EMS mutagenesis of a pepper stem parent. Whole-genome resequencing of the wild type and mutant revealed a gene related to plant fibrous sheaths, the fibrous sheath CABYR-binding protein (FSCB). The FSCB gene cDNA sequence is 2385 bp long and has the highest relative expression in pepper roots. The gene encodes a protein sequence consisting of 794 amino acid residues. The FSCB gene can regulate lignin synthesis in pepper stems. Biological information analysis of this gene and the design of related primers are of great significance for deepening the role of FSCB in pepper.

[0024] 2. The present invention provides the application of the FSCB gene in peppers and tomatoes, which is simple to operate and has a high success rate, laying the foundation for further in-depth understanding of the function of the FSCB gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] FIG1 is the FSCB gene amplification result in Example 1;

[0027] Figure 2 is a comparative analysis of protein sequences in Example 1;

[0028] FIG3 is a hydrophobicity analysis of FSCB in Example 1;

[0029] FIG4 is a prediction of the FSCB protein signal peptide in Example 1;

[0030] FIG5 is a prediction of the transmembrane domain of the FSCB protein in Example 1;

[0031] FIG6 is the prediction and analysis of the secondary structure of the FSCB protein in Example 1;

[0032] FIG7 is a prediction of the tertiary structure of the FSCB protein in Example 1;

[0033] FIG8 is a prediction of the conserved domain of the FSCB protein in Example 1;

[0034] FIG9 is a phylogenetic tree of the FSCB protein in Example 1;

[0035] FIG10 is the relative expression levels of the FSCB gene at different sites in Example 1;

[0036] FIG11 is the specific sequence of silencing CaFSCB in Example 1 (the 300 bp gray shading area);

[0037] Figure 12 is the relative expression level of TRV2-CaFSCB after silencing in Example 1;

[0038] FIG13 is the lignin content of TRV2-CaFSCB in Example 1;

[0039] Figure 14 is the internode length of the TRV2-CaFSCB stem in Example 1;

[0040] Figure 15 is the internode thickness of the TRV2-CaFSCB stem in Example 1;

[0041] FIG16 is a comparison of the amino acid sequence of the FSCB protein in Example 1 with the amino acid sequences of FSCB in potato, tea, sesame, and coffee;

[0042] FIG17 is a comparison of the lignin content of the edited tomato plants in Example 2 and the wild type. DETAILED DESCRIPTION

[0043] To facilitate understanding of the present invention, the present invention will be described in more comprehensive and detailed form below in conjunction with the accompanying drawings and preferred embodiments. However, the protection scope of the present invention is not limited to the following specific embodiments.

[0044] Unless otherwise defined, all technical terms used hereinafter have the same meanings as those generally understood by those skilled in the art. The technical terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0045] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0046] Example 1:

[0047] This study used EMS-induced mutagenesis of the pepper stem parent, 6421, to generate the creeping stem mutant sp1 (stemprostrate1). Whole-genome resequencing of 6421 and the mutant revealed a gene associated with the fibrous sheath, fibrous sheath CABYR-binding protein (FSCB). This gene had not been previously reported in pepper. Therefore, biological analysis of this gene is crucial for furthering our understanding of FSCB in plants.

[0048] The cDNA sequence of the FSCB gene is shown in SEQ ID NO: 1, and the amino acid sequence encoded by the FSCB gene is shown in SEQ ID NO: 2. In order to further explore and confirm the biological role of the FSCB gene in pepper, the present invention conducted the following experiments.

[0049] 1 Materials and Methods

[0050] 1.1 Plant materials

[0051] In this experiment, the wild type pepper "6421" was used as the experimental material. Total RNA was extracted from different tissue parts (roots, stems, leaves, flowers, fruits and anthers). After reversing cDNA, the expression level of FSCB was determined by qRT-PCR for expression analysis.

[0052] 1.2 Methods

[0053] 1.2.1 FSCB gene cloning

[0054] Using the FSCB sequence as a reference, specific primers were designed using Premier 5 (Table 1), and gene amplification was performed using DNA polymerase from Acryl Biotech. The FSCB gene was cloned by PCR using reverse transcribed cDNA as a template. The PCR reaction procedure was as follows: 94°C for 1 minute, 98°C for 10 seconds, 60°C for 15 seconds, 68°C for 2 minutes, 35 cycles, and 4°C for 5 minutes. The PCR product was recovered using a DNA gel recovery kit from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the recovered product was then mixed with a DNA gel recovery kit from Beijing Quanshijin Biotechnology Co., Ltd. The Zero Cloning Kit vector was connected and transformed into E. coli competent cells. The positive recombinant plasmid was selected and the single clone was sent to Qingke Bio (Beijing) Co., Ltd. for sequencing.

[0055] Table 1 Primers for gene cloning

[0056] 1.2.2 Bioinformatics analysis of the FSCB gene

[0057] The amino acid sequence was aligned and analyzed using the sequence analysis software DNAMAN and BioEdit. The physicochemical properties of the FSCB protein were analyzed using the online website Prot-Param (https: / / web.expasy.org / protparam / ). The signal peptide was predicted using SignalP (http: / / www.cbs.dtu.dk / services / SignalP / ). The conserved domain of the protein was predicted using NCBI's BlastP. The secondary structure of the protein was predicted using SOPM (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.pl?page=npsa_sopma.html). The tertiary structure of the FSCB protein and the function of the protein encoded by the FSCB gene were predicted using SWISS-MODEL (http: / / swissmodel.expasy.org / ); the subcellular localization was predicted using WoLF-PSORT (https: / / www.genscript.com / wolf-psort.html); the hydrophobicity was analyzed using ProtScale (https: / / web.expasy.org / protscale / ); the protein transmembrane domain was predicted using TMpred (https: / / embnet.vital-it.ch / software / TMPRED_form.html); and the phylogenetic tree was constructed using the Neighbor-Joining (NJ) method of MEGA 6 software, and the constructed phylogenetic tree was evaluated using the Bootstrap method (repeated 1000 times).

[0058] 1.2.3 Gene expression analysis

[0059] Quantitative PCR primers (Table 2) were designed online using the NCBI Primer Designing Tool (nih.gov). RNA was extracted using the SteadyPure Plant RNA Extraction Kit from Acryl Biosciences and reverse transcribed into cDNA using the PrimeScript RT Master Mix (cat. No. RR036A, TaKaRa). Quantitative PCR was performed using the Touch Fluorescent Quantitative PCR Detection System (Bio-Rad). The PCR reaction system consisted of 10 μL of PCR, 0.1 μL of template, 0.4 μL of forward and reverse primers, and 5 μL of 2× SYBR Green PCR Master Mix, supplemented with ddH2O to 10 μL. The amplification protocol was as follows: total denaturation at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 60°C for 30 s, and 72°C for 30 s. The pepper actin gene was used as an internal reference gene to determine relative gene expression in different tissues.

[0060] Table 2 Quantitative PCR primers

[0061] 1.2.4 Virus-induced gene silencing (VIGS)

[0062] To verify the role of this gene in pepper stems, we primarily used virus-induced gene silencing (VIGS). The VIGS vectors pTRV1, pTRV2, and pTRV2:PDS were maintained in our laboratory. We searched for the CaFSCB gene cDNA using an online tool (vigs.solgenomics.net) and constructed VIGS-specific primers:

[0063] VIGS-CaFSCBF: ctgtgagtaaggttaccgaattc ATGGCCACTGATACTGTTTCATC (as shown in SEQ ID NO: 9);

[0064] VIGS-CaFSCBR: cgcgtgagctcggtaccggatcc CACTTGGGATGATTCTTCTGC (the lowercase letters represent the homology arms of the vector TRV2, and the sequence is shown in SEQ ID NO: 10).

[0065] PCR was performed using the target cDNA as a template to obtain a PCR product of 300 bp in length. The PCR product was recovered using the DNA gel recovery kit of Tiangen Biochemical Technology (Beijing) Co., Ltd., and the purified fragment was constructed into a linearized pTRV2 vector. The purified target fragment and the linearized vector were connected using T4 ligase using the homologous recombination method. The vectors constructed above were respectively transformed into Escherichia coli competent cells DH5α, 5-6 single clones were picked for PCR identification, and 2-3 positive clones were selected for sequencing. After the sequence was correct, the recombinant plasmid was extracted and transformed into Agrobacterium competent cells GV3101. After that, the upright wild-type plants were injected using Agrobacterium-mediated genetic transformation. The positive plant phenotype was identified 4-5 weeks after inoculation, and the expression of the CaFSCB gene in the positive plants after inoculation was analyzed by RT-qPCR.

[0066] 2 Results and Analysis

[0067] 2.1 Cloning of the FSCB gene and analysis of its encoded amino acid sequence

[0068] The gene was cloned by PCR amplification using pepper '6421' cDNA as a template, as shown in Figure 1. The cDNA of the gene is 2385 bp in length (shown in SEQ ID NO: 1) and encodes a protein sequence consisting of 794 amino acid residues (shown in SEQ ID NO: 2).

[0069] DNAMAN 8.0 software was used to perform homology analysis on the protein sequences of FSCB and those of Capsicum chinense, Capsicum baccatum, and Solanum tuberosum. The results ( FIG2 ) showed that the FSCB protein had a similarity of 93.87% with those of Capsicum chinense, Capsicum baccatum, and Solanum tuberosum.

[0070] 2.2 Primary structure and physicochemical properties of FSCB protein

[0071] The physicochemical properties of the FSCB protein sequence were obtained using ProtParam in the ExPASy server, as shown in Table 3. The results showed that the molecular formula of the FSCB protein was C 3725 H 6097 N 953 O 1401S5 contains 232 negatively charged amino acid residues and 108 positively charged amino acid residues, with a molecular weight of 86810.24 Da, a theoretical isoelectric point of 4.33, an instability coefficient of 67.83, and an overall average hydrophilicity of -1.085. It is presumed to be a hydrophilic and unstable protein with no signal peptide. The protein contains 25 amino acids, with Glu (glutamic acid) being the most abundant, accounting for 23.2%.

[0072] Table 3 Physicochemical properties of proteins

[0073] The amino acid sequence hydrophilicity / hydrophobicity prediction plot (Figure 3) was generated using ProtScale online software. The results indicate that the average hydrophilicity coefficient (GRAVY) for the FSCB protein is -1.085. The lowest score (-3.122) is for aspartic acid (D) at position 218 and glutamic acid (E) at position 260 in the polypeptide chain, indicating the highest hydrophilicity. The highest score (1.444) is for isoleucine (I) at position 209, indicating the highest hydrophobicity. The presence of hydrophilic amino acids (negative values) outnumbers hydrophobic amino acids (positive values), suggesting that the protein encoded by the FSCB gene amino acid sequence is hydrophilic.

[0074] 2.3 Analysis of subcellular localization, signal peptide, and transmembrane domain of FSCB protein

[0075] The online software WoLF PSORT was used to predict the subcellular localization of FSCB, and the results showed that FSCB was most likely localized in the cell nucleus.

[0076] The online software SignaIP-5.0 was used to predict the signal peptide of the protein encoded by the FSCB gene. The results are shown in FIG4 . The probability that the protein has a signal peptide is 0.075%, indicating that the FSCB protein does not have a signal peptide region.

[0077] The TMHMMServer v.2.0 online tool predicted the transmembrane domain of the FSCB protein using its amino acid sequence as input (Figure 5). The predicted transmembrane domain map showed no peaks, confirming that the FSCB protein lacks a transmembrane domain and is likely non-transmembrane, primarily located in the extramembrane region. In summary, based on the signal peptide and transmembrane domain analyses, it is speculated that this protein is neither a secreted protein nor a membrane protein.

[0078] 2.4 FSCB protein domain and secondary and tertiary structure prediction

[0079] SOPM software was used to predict and analyze the secondary structure of the protein. The secondary structure of the FSCB protein is primarily composed of 47.86% alpha helix, 2.64% beta sheet, 5.16% extended strand, and 44.33% random coil (Figure 6). The alpha helix is ​​the most predominant structural element in the secondary structure of the FSCB protein (Table 3).

[0080] Table 3 Secondary structure of proteins

[0081] The protein's tertiary structure was predicted using the online software SWISS-MODEL (Figure 7). The FSCB protein's polypeptide chain further coils or folds within various secondary structures to form a regular three-dimensional structure. The protein structure was constructed using a structure with PDB number 4v6w.7.A as a template. The sequence similarity is 0.29, with a range of 761-787 aa and a coverage of 0.04.

[0082] 2.5 Conserved domains and function prediction of FSCB proteins

[0083] Protein Blast analysis of the FSCB protein was performed to identify possible conserved domains. The results are shown in Figure 8. The FSCB protein belongs to the PTZ00121 supergene family and contains the PTZ00121 conserved domain. Comparison using UniProt (https: / / www.uniprot.org / tool-dashboard) revealed that the FSCB protein is of unknown identity in pepper.

[0084] 2.6 Construction of the FSCB gene phylogenetic tree

[0085] A Blastp comparison search was performed on the NCBI website using the full-length FSCB protein sequence. A phylogenetic tree was constructed between FSCB and protein sequences from different plants. The results showed that the FSCB protein belonged to the same branch as the proteins from Capsicum chinense and Capsicum baccatum, sharing the highest homology. When compared in NCBI, Solanum tuberosum and Camellia sinensis were both annotated as FSCB proteins (Figure 9).

[0086] 2.7 FSCB gene expression analysis

[0087] Real-time fluorescence quantitative qRT-PCR was used to analyze the differential expression of the FSCB gene in different plant parts. As shown in Figure 10, FSCB was highly expressed in roots, stems, and fruits, with the highest expression in roots and lower expression in anthers. The expression level in roots was 4.4, 8.4, 8.5, 2.2, and 162.8 higher than that in stems, leaves, flowers, fruits, and anthers, respectively.

[0088] 2.8 FSCB gene silencing analysis

[0089] To verify the function of this gene, we further utilized virus-induced gene silencing (VIGS). Based on the cDNA sequence of the CaFSCB gene, we mapped it to the NCBI database and found a CaFSCB-specific sequence (shown in SEQ ID NO: 1). Primers were designed based on this sequence to amplify a 300-bp fragment from the cDNA and silence this sequence in pepper (Figure 11). Erect wild-type pepper lines were infected, and phenotypes began to appear 4-5 weeks after silencing. qRT-PCR analysis revealed reduced gene expression in the upright wild-type lines (Figure 12), confirming successful gene silencing. To determine how lignin content in the silenced lines changes, we measured lignin in TRV2 and TRV2-CaFSCB and examined changes in stem internode length and diameter. Results showed that lignin content in silenced lines was significantly reduced by 2.1% compared to controls (Figure 13), while the length and diameter of the first and second internodes of the stem remained unchanged (Figures 14 and 15). This shows that CaFSCB can affect the synthesis of lignin and thus affect the lignin content in pepper stems.

[0090] 3 Discussions

[0091] The mechanical support ability of plants during growth is not only regulated by a single signal transduction, but also interacts under a complex regulatory system. The present invention performed bioinformatics analysis on the obtained FSCB gene, and the results showed that the FSCB gene cDNA sequence is 2385bp in length and encodes a protein sequence composed of 794 amino acid residues. The isoelectric point (pI) of the FSCB protein is 4.33, the molecular weight is 86810.24Da, and its instability coefficient is 67.83, which is an unstable protein. The predicted FSCB protein is a hydrophilic protein without a transmembrane structure, and its subcellular localization is predicted to be located in the cell nucleus. Expression analysis in different parts found that the relative expression level of the gene in the root was the highest. FSCB is related to the synthesis of lignin and can regulate the content of lignin in pepper stems.

[0092] In addition, the amino acid sequence of the FSCB protein obtained in the present invention was compared with the FSCB amino acid sequence in potato, tea plant, sesame and coffee, and the similarity was only 41.68%. The comparison results are shown in FIG16 .

[0093] Example 2:

[0094] An application of the FSCB gene in editing tomato plants comprises the following steps:

[0095] (1) Based on the provided sequence information and sequence alignment results, combined with the target site design website http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR, the CRISPR target site was designed. The target site sequences were 22KN16T1: AGAGAGTGTTCCCCTTACCA (as shown in SEQ ID NO: 11) and 22KN16T2: AAATCAGTGGAAGTTGACGA (as shown in SEQ ID NO: 12). Target site PCR amplification primers were designed based on the target site: 22KN16-T1s: CGATTCCCGGCTGGTGCAAGAGAGTGTTCCCCTTACCAGTTTTAGAGCTAGAAATA (as shown in SEQ ID NO: 13), 22KN16-T2as: TTCTAGCTCTAAAACTCGTCAACTTCCACTGATTTTGCACCAGCCGGGAA (as shown in SEQ ID NO: 14), and 22KN16-inf-T2as: TTCTAGCTCTAAAACTCGTCAACTTCCACTGATTT (as shown in SEQ ID NO: 15). The primers were synthesized by Tianyi Huiyuan Biotechnology Co., Ltd. After primer synthesis, amplification was performed using the PGTR plasmid as a template, and the resulting PCR product was constructed into the final CRISPR expression vector PKSE401-TRNA by homologous recombination.

[0096] (2) The constructed CRISPR vector was electroporated into Escherichia coli DH5α, and positive clones were screened by colony PCR. The positive clone detection method is as follows:

[0097] ①PCR system:

[0098] ②PCR procedure:

[0099] (3) After the target site fragment and the expression vector were recombined, they were electroporated into Escherichia coli DH5α, and clones were selected. 22KN15 was verified by colony PCR using primers U6-261DF: TGTCCCAGGATTAGAATGATTAGGC (as shown in SEQ ID NO: 16) and 22KN15-inf-T2as: TTCTAGCTCTAAAACTCGTCAACTTCCACTGATTT (as shown in SEQ ID NO: 17). The positive colonies were sent to the company for sequencing. The plasmids of the correctly sequenced colonies were extracted and transformed into Agrobacterium competent GV3101. The infection solution was then prepared to infect tomato cotyledons to complete the knockout of the FSCB gene in tomato plants.

[0100] (4) Cultivate edited tomatoes, detect whether the target gene is successfully knocked out by agarose gel electrophoresis, select successfully edited tomatoes, and measure the lignin content in their stems.

[0101] The lignin content was determined by acetylation method; the lignin content in its stems was lower than that in the control group.

[0102] As shown in FIG17 , the lignin content of the edited tomato plants was extremely significant compared with that of the wild type, and the lignin content of the edited plants was significantly reduced.

[0103] The above measurement results show that after knocking out the FSCB gene as shown in SEQ ID NO: 1 in tomato plants, the lignin content in the stems of the edited tomato plants is significantly reduced.

Claims

1. A FSCB gene for controlling lignin synthesis in pepper stems, characterized in that: The cDNA sequence of the FSCB gene is shown in SEQ ID NO:

1.

2. A FSCB protein for controlling lignin synthesis in pepper stems, characterized in that: The amino acid sequence of the FSCB protein is shown in SEQ ID NO:

2.

3. An application of regulating the lignin content in plant stems by knocking out / silencing the FSCB gene described in claim 1.

4. An application of regulating stem lignin synthesis by knocking out / silencing the FSCB gene described in claim 1.

5. The use according to claim 4, characterized in that: The plant is pepper or tomato, and the FSCB gene in the plant is knocked out / silenced to obtain a pepper silenced plant or a tomato editing positive plant.

6. The use according to claim 5, characterized in that: When the plant is a tomato, the application method specifically comprises the following steps: (1) PCR amplifying the FSCB gene, and constructing the PCR product into the final CRISPR expression vector PKSE401-TRNA by homologous recombination; (2) The constructed CRISPR expression vector PKSE401-TRNA was electroporated into Escherichia coli DH5α, and positive clones were screened by colony PCR; (3) Sequencing the positive clones screened, extracting plasmids from the clones with correct sequencing, and transferring them into Agrobacterium competent GV3101, which then infects tomato cotyledons to complete the knockout of the FSCB gene in tomato plants; (4) Cultivate tomato plants with FSCB gene knockout, detect whether the target gene is successfully knocked out by agarose gel electrophoresis, and select tomato plants with successful gene knockout, that is, tomato editing-positive plants.

7. The use according to claim 6, characterized in that: The primers used for PCR amplification are 22KN16-T1s, 22KN16-T2as, and 22KN16-inf-T2as, and their nucleotide sequences are shown in SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15, respectively; the detection primers for the positive clones are U6-261DF and 22KN15-inf-T2as, and their nucleotide sequences are shown in SEQ ID NO: 16 and SEQ ID NO: 17, respectively.

8. A primer for amplifying the FSCB gene according to claim 1, characterized in that: The upstream primer FSCB-F is shown in SEQ ID NO:3, and the downstream primer FSCB-R is shown in SEQ ID NO:

4.

9. A quantitative PCR primer for the FSCB gene according to claim 1, characterized in that: The upstream primer qFSCB-F is shown in SEQ ID NO:5, and the downstream primer qFSCB-R is shown in SEQ ID NO:

6.

10. A VIGS-specific primer for the FSCB gene according to claim 1, characterized in that: The upstream primer VIGS-CaFSCBF is shown in SEQ ID NO:9, and the downstream primer VIGS-CaFSCBR is shown in SEQ ID NO:10.

Images