Use1-targeting aptamer, and information provision method for diagnosing solid cancer by using same

Abstract

The present invention relates to a composition for diagnosing or predicting the prognosis of solid cancer (for example, lung cancer). In the present invention, association between the onset of solid cancer and an increase in the expression level of USE1 is identified, and an aptamer sequence capable of detecting USE1 with high specificity is provided. If the aptamer of the present invention is used, solid cancer can be rapidly and simply diagnosed in a non-invasive manner by detecting USE1 with high specificity.

Description

USE1 Target aptamer and information provision method for diagnosing solid cancer using the same

[0001] The present invention confirms that the USE1 protein is a biomarker associated with the development of solid cancer (preferably lung cancer), and provides an aptamer targeting the USE1 protein. Using the USE1 protein-targeting aptamer of the present invention, the expression level of the USE1 protein can be measured with high accuracy, making it effective for the diagnosis or prognosis of solid cancer.

[0002] This invention was carried out with the support of the research project "Lung Cancer Control Laboratory through Ubiquitin Network Regulation" (Project Identification Number: 1711192817, Implementing Organization: Ulsan University Industry-Academic Cooperation Foundation, Research Period: 2023.03.01 ~ 2024.02.29) of the Group Research Support Project supported by the Ministry of Science and ICT, and the research project "Study on Lung Cancer Diagnosis and Control Technology through Identification of the Action Mechanism of TRIM28-SOCS3 Complex" (Project Identification Number: 1711195306, Implementing Organization: Ulsan University Industry-Academic Cooperation Foundation, Research Period: 2023.03.01 ~ 2024.02.29) of the Individual Basic Research Project supported by the Ministry of Science and ICT.

[0003] Cancer is one of the leading diseases, with 10 million new cases diagnosed worldwide each year. In Korea, cancer is the leading cause of death, accounting for approximately 25.5% of all deaths. This trend is expected to continue.

[0004] Among these, lung cancer is a cancer that occurs in the lungs, and it is a type of cancer that is common in developed countries, with smoking and pollution being the biggest causes. It began to increase rapidly in Western countries in the 20th century, and more than 1.3 million people worldwide die from lung cancer every year, accounting for the highest proportion of cancer-related deaths. In Korea, it is reported that approximately 100,000 new cancer cases are diagnosed and approximately 50,000 cancer patients die every year. Moreover, the incidence of cancer has been increasing even more recently, and cancer is currently the second leading cause of death among adults in Korea. In particular, lung cancer accounts for approximately 12% of cancers that occur in Korean adults, ranking third after stomach cancer and liver cancer, and its incidence rate is increasing in both men and women every year. The incidence of lung cancer is significantly higher in men than in women, and the proportion of young patients under 45 years of age is reported to be relatively high. Moreover, lung cancer is a tumor with a very low cure rate, with a 5-year survival rate of only about 5% despite various treatments such as radical resection, chemotherapy, and radiation therapy, as it has already metastasized to other organs at the time of diagnosis or has progressed locally even in the absence of metastasis, and is ranked first in cancer-related deaths.

[0005] Lung cancer is divided into small cell lung cancer and non-small cell lung cancer (NSCLC). NSCLC is the most common type, accounting for approximately 80% of lung cancers. It is further divided into adenocarcinoma, squamous cell carcinoma, and large cell carcinoma. Histological characteristics vary depending on the type of lung cancer, as do prognosis and treatment methods, making accurate diagnosis crucial. Despite recent advances in cancer treatment, the 10-year survival rate for NSCLC remains extremely low, at less than 10%. This is due to the difficulty in diagnosing NSCLC until it reaches an advanced stage.

[0006] Currently, early diagnosis is the best way to increase a patient's chances of survival. Accordingly, various attempts have been made to diagnose lung cancer using biomarkers. Advances in molecular diagnostics and understanding of genomics have led to the discovery of several lung cancer biomarkers that have the potential to complement current screening criteria (Hasan N, Kumar R, Kavuru MS (2014) Lung cancer screening beyond low-dose computed tomography: the role of novel biomarkers. Lung 192: 639-648.; Bigbee WL, Gopalakrishnan V, Weissfeld JL, Wilson DO, Dacic S, et al. (2012) A multiplexed serum biomarker immunoassay panel discriminates clinical lung cancer patients from high-risk individuals found to be cancer-free by CT screening. J Thorac Oncol 7: 698-708.; Daly S, Rinewalt D, Fhied C, Basu S, Mahon B, et al. (2013) Development and validation of a plasma biomarker panel for discerning clinical significance of indeterminate pulmonary nodules. J Thorac Oncol 8: 31-36.; etc.). In particular, overexpression of USE1 significantly increased proliferation, migration, and invasion in both cells and animals, and reduction of USE1 levels in lung cancer cells reversed these effects, suggesting that USE1 is a novel target for cancer therapy.

[0007] Meanwhile, aptamers, novel biomolecules, are selected from a large oligo library. Through a series of selector operations, aptamers targeting specific ligands are expanded and ultimately selected. Aptamers are single-stranded nucleic acids that can be chemically synthesized and easily modified for various purposes. Furthermore, aptamers can be amplified and analyzed by polymerase chain reaction (PCR) and applied to high-throughput DNA array technology.

[0008] Aptamer-based high-throughput quantitative assays have been reported and proven to be excellent platforms for screening multivariate proteomic features to diagnose disease states; however, methods for diagnosing solid tumors, especially lung cancer, using aptamers are currently lacking. Therefore, the present inventors developed an aptamer that targets the USE1 protein with high accuracy.

[0009] The present invention has been conceived to solve the above problems and meet the above needs, and the purpose of the present invention is to confirm that the expression of USE1 is associated with the development of solid cancer and to provide an aptamer targeting USE1.

[0010] In one embodiment of the present invention, the purpose of the present invention is to provide a composition for diagnosing or predicting the prognosis of solid cancer using a USE1 target aptamer.

[0011] In another embodiment of the present invention, the purpose of the present invention is to provide a kit for diagnosing or predicting the prognosis of solid cancer using a USE1 target aptamer.

[0012] To solve the above-described problem, the present invention provides an aptamer specific for USE1 (UBA6-specific E2 conjugating enzyme 1) protein and a composition for diagnosing or predicting the prognosis of solid cancer using the same.

[0013] In the present invention, the aptamer specific for the USE1 (UBA6-specific E2 conjugating enzyme 1) protein comprises any one of the gene sequences represented by SEQ ID NOs: 1 to 4.

[0014] In the present invention, the aptamer specific for the USE1 protein comprises a gene sequence represented by SEQ ID NO: 1 or a partial sequence thereof. Here, the partial sequence of the gene sequence represented by SEQ ID NO: 1 has a size of 30 to 40 mer, preferably a size of 36 mer, and is a sequence including a cysteine ​​binding site of the gene sequence represented by SEQ ID NO: 1.

[0015] In the present invention, the solid cancer is liver cancer, intrahepatic cholangiocarcinoma, colon cancer, colorectal adenocarcinoma, cervical cancer, kidney cancer, stomach cancer, stomach adenocarcinoma, prostate adenocarcinoma, breast cancer, breast invasive ductal carcinoma, brain tumor, lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, uterine cancer, high grade serous ovarian cancer, colon cancer, colon adenocarcinoma, bladder cancer, bladder urothelial carcinoma, cutaneous melanoma, Any one disease selected from the group consisting of cancer of unknown primary, blood cancer, pancreatic cancer, pancreatic adenocarcinoma, glioblastoma multiforme, stomach adenocarcinoma, renal clear cell carcinoma, esophageal adenocarcinoma, and testicular cancer, but is not limited thereto, and most preferably lung cancer.

[0016] The present invention provides a use of an aptamer specific for USE1 (UBA6-specific E2 conjugating enzyme 1) protein for diagnosing or predicting the prognosis of solid cancer.

[0017] The present invention also provides a diagnostic kit for solid cancer, comprising the above diagnostic or prognostic composition.

[0018] In another embodiment of the present invention, a method for providing information for diagnosing solid cancer is provided, comprising the steps of: a) producing a USE1 target aptamer including any one of the gene sequences represented by SEQ ID NOs: 1 to 4; b) measuring the expression level of a USE1 gene or protein in a sample isolated from a subject using the aptamer of step a); c) comparing the expression level of the USE1 protein in the sample isolated from the subject with the expression level of a normal control sample; and c) determining the subject as a solid cancer patient if the expression level of the USE1 protein measured in the subject is higher than the level of the normal control sample.

[0019] In step b) of the above information providing method, the measurement of the expression level of the USE1 gene may use at least one method selected from the group consisting of polymerase chain reaction (PCR), real-time PCR, reverse transcription polymerase reaction (RT-PCR), microarray, northern blotting, rapid kit, DNA chip lateral flow assay (LFA) type test, enzyme-linked immunosorbent assay (ELISA) type test, field-effect transistor (FET) type test, and radioimmunoassay (RIA) type test.

[0020] In addition, in the step b), the expression level of the USE1 protein can be measured by a method selected from enzyme-linked immunosorbent assay, Western blotting, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, immunofluorescence, radioimmunosorbent test, or mass spectrometry.

[0021] In the above information providing method, the sample obtained from the subject includes, but is not limited to, lung tissue, whole blood, serum, plasma, saliva, urine, sputum, lymph, cerebrospinal fluid, or cell fluid.

[0022] The present invention confirms that USE1 expression is associated with the development of solid cancer and utilizes this as a biomarker. The present invention provides an aptamer sequence specific to USE1.

[0023] The present invention also provides a composition for diagnosing or predicting the prognosis of solid cancer using the above aptamer sequence.

[0024] The USE1 targeting aptamer according to the present invention binds to USE1 with high specificity, and when the composition is used, it is possible to noninvasively, simply, and accurately diagnose whether a solid cancer has occurred.

[0025] Figure 1 is a schematic diagram of the SELEX cycle process for developing an aptamer that can specifically bind to the USE1 protein.

[0026] Figure 2 is a schematic diagram showing a fluorescence quenching system implemented in one embodiment of the present invention.

[0027] Figure 3 shows the results of analyzing the binding affinity of the USE1 target aptamer candidate sequence using a fluorescence quenching system.

[0028] Figure 4 shows the results of analyzing the binding affinity of the USE1 aptamer containing the genetic sequence of sequence number 1 using a fluorescence quenching system.

[0029] Figure 5 shows the results of analyzing the binding affinity of the USE1 aptamer containing the genetic sequence of sequence number 2 using a fluorescence quenching system.

[0030] Figure 6 shows the results of analyzing the binding affinity of the USE1 aptamer containing the genetic sequence of sequence number 3 using a fluorescence quenching system.

[0031] Figures 7a to 7d are three-dimensional predicted structural model images of the USE1 aptamer containing the gene sequence of sequence number 1, respectively.

[0032] Figures 8a to 8d are three-dimensional predicted structural model images of the USE1 aptamer containing the gene sequence of sequence number 2, respectively.

[0033] Figures 9a and 9b are three-dimensional predicted structural model images of the USE1 aptamer containing the gene sequence of SEQ ID NO: 3, respectively.

[0034] Figure 10a is a schematic diagram showing the process of cutting out a portion including a cystine binding site in the predicted structural model of the aptamer represented by sequence number 1. Figure 10b is an image showing a cystine binding site in the predicted structural model of the aptamer according to the present invention (top of Figure 10b) and the results of analyzing the binding affinity of the aptamer 1e sequence using the ELONA (enzyme-linked oligonucleotide assay) analysis method (bottom of Figure 10b).

[0035] Figure 11 shows the results of an ELISA analysis of the binding affinity of His-USE1 to A549 lung cancer cells according to the concentration of the aptamer (aptamer1 in Figure 11) represented by sequence number 1 and a partial sequence thereof (1e in Figure 11).

[0036] Figure 12 is a Western blot result confirming the detection of USE1 in lung cancer patients with USE1 target aptamer 1e selected according to one embodiment of the present invention.

[0037] Figure 13 is an ELISA result confirming the detection of USE1 in lung cancer patients by USE1 target aptamer 1e selected according to one embodiment of the present invention.

[0038] Hereinafter, the present invention will be described in detail. The advantages and features of the present invention, as well as the embodiments that achieve them, will become clearer with reference to the embodiments described below. However, the present invention is not limited to the embodiments disclosed below and can be implemented in various different forms. These embodiments are provided solely to ensure the complete disclosure of the present invention and to fully inform those skilled in the art of the scope of the invention. The present invention is defined solely by the scope of the claims. Like reference numerals designate like elements throughout the specification.

[0039] Unless otherwise defined, all terms (including technical and scientific terms) used herein may be used in a sense commonly understood by those of ordinary skill in the art to which the present invention pertains. Furthermore, terms defined in commonly used dictionaries are not to be interpreted ideally or excessively unless explicitly and specifically defined otherwise. The terminology used herein is for the purpose of describing embodiments and is not intended to limit the present invention. In this specification, singular forms also include plural forms, unless specifically stated otherwise.

[0040] The present inventors, while studying an aptamer targeting USE1 based on the fact that overexpression of USE1 (UBA6-specific E2 conjugating enzyme 1) significantly increases cell proliferation, migration, and invasion, and that inhibition of USE1 expression in lung cancer cells affects the reduction of lung cancer cells, identified a gene sequence that binds to USE1 with high specificity, and completed the present invention.

[0041] In the present invention, the term "aptamer" refers to a "chemical antibody" and refers to a short (20-80 bases) single-stranded nucleic acid molecule that has the property of binding to a wide variety of target ligands, ranging from specific compounds to proteins, with high specificity and affinity. Aptamers can be developed in vitro through SELEX (Systematic evolution of ligands by exponential enrichment).

[0042] Aptamers are considered oligonucleic acid molecules with properties similar to antibodies, exhibiting high binding affinity and selectivity for target proteins at the nanomolar (nM) to femtomolar (fM) level. Aptamers manufactured through chemical synthesis are easier to chemically modify than protein-based materials such as antibodies. Selectivity and affinity can be maximized through the SELEX process. Because they are chemically synthesized, they are highly pure, and the resulting materials can be identified through instrumental analysis. They are also heat-stable, allowing for long-term storage at room temperature.

[0043] In the present invention, the term "SELEX (Systematic evolution of ligands by exponential enrichment)" refers to a method for selecting aptamers that bind to a target substance. In a generally known method, a target protein is reacted with an oligonucleotide library (DNA or RNA) having a random base sequence at a certain temperature, and then the DNA / RNA library that does not bind to the target is removed. The nucleotides that bind to the target are isolated and amplified using a genetic amplification method. This process is repeated several times to select aptamers with high binding affinity to the target.

[0044] The aptamer of the present invention may be manufactured using a general SELEX method as described above.

[0045] In the present invention, the term "target molecule" refers to a substance that can be detected by the aptamer of the present invention. Specifically, the target molecule may be one or more selected from the group consisting of proteins, peptides, carbohydrates, polysaccharides, glycoproteins, hormones, receptors, antigens, antibodies, viruses, cofactors, drugs, dyes, growth factors, and controlled substances to which the capture aptamer can bind, but is not limited thereto. For the purposes of the present invention, the target molecule may be the USE1 gene or protein.

[0046] The term "diagnosis" in the present invention includes determining the susceptibility of an object to a specific disease or condition, determining whether an object currently has a specific disease or condition, determining the prognosis of an object suffering from a specific disease or condition, or monitoring the condition of an object to provide information on therametrics, such as treatment efficacy. In one embodiment of the present invention, the diagnosis is to determine whether a solid cancer (preferably lung cancer) has developed and the stage of progression of the cancer, i.e., the stage.

[0047] In the present invention, the term "prognosis" is used interchangeably with "prognosis," and refers to the act of predicting the course and outcome of a disease. More specifically, prognosis can be interpreted as any act of predicting the course of a disease after treatment by comprehensively considering the patient's physiological and environmental conditions, as the course of the disease after treatment can vary depending on the patient's physiological and environmental conditions.

[0048] For the purposes of the present invention, the above prognosis prediction can be interpreted as an act of predicting the course of a disease after treatment of a solid cancer and predicting the risk of cancer progression, cancer recurrence, and / or cancer metastasis. For example, the term "good prognosis" means that the risk of cancer progression, cancer recurrence, and / or cancer metastasis of a patient after treatment of a solid cancer is lower than 1, indicating that the solid cancer patient has a high probability of survival, and is also expressed in another sense as a "positive prognosis." The term "poor prognosis" means that the risk of cancer progression, cancer recurrence, and / or cancer metastasis of a patient after treatment of a solid cancer is higher than 1, indicating that the solid cancer patient has a high probability of death, and is also expressed in another sense as a "negative prognosis."

[0049] In the present invention, the term "risk" means an odds ratio, risk ratio, etc. regarding the probability that a patient will experience cancer progression, recurrence, and / or metastasis after cancer treatment.

[0050] In the present invention, the solid cancer is bladder cancer, colon cancer, stomach cancer, lung cancer, lung adenocarcinoma, breast invasive ductal carcinoma, colon adenocarcinoma, prostate adenocarcinoma, bladder urothelial carcinoma, lung squamous cell carcinoma, cutaneous melanoma, cancer of unknown primary, pancreatic adenocarcinoma, glioblastoma multiforme, colorectal adenocarcinoma, high grade serous ovarian cancer, stomach adenocarcinoma, Including but not limited to renal clear cell carcinoma, esophageal adenocarcinoma, testicular cancer and intrahepatic cholangiocarcinoma, preferably lung cancer.

[0051] The term "marker" as used herein refers to a substance capable of diagnosing and distinguishing between a normal individual and an individual with solid cancer (preferably lung cancer), and includes organic biomolecules such as polypeptides, proteins, nucleic acids, genes, lipids, glycolipids, and glycoproteins, which show an increase or decrease in an individual with solid cancer (lung cancer) of the present invention. In particular, in the present specification, the USE1 gene or protein whose expression level was changed in a biological sample detected from an individual with lung cancer was used as a biomarker.

[0052] In the biological sample of the present invention, the biomarker (USE1) can be detected by a known method for measuring the expression level and activity of USE1, such as Western blot, enzyme-linked immunosorbent assay (ELISA), immunohistochemical staining, immunoprecipitation, or immunofluorescence. The expression level can be analyzed by analyzing this using machine learning techniques.

[0053] In the present invention, the biological sample may be pretreated to detect USE1. For example, this may include filtration, distillation, extraction, separation, concentration, inactivation of interfering components, addition of reagents, etc.

[0054] In the present invention, a "quantitative device" refers to a device that provides quantitative numerical information regarding the presence or absence of a specific metabolite in a biological sample, as well as its relative or absolute amount. Specifically, the quantitative device is a chromatograph, a mass spectroscopy (MS), or a nuclear magnetic resonance (NMR) spectrometer.

[0055] In the present invention, "chromatography" means high performance liquid chromatography (HPLC), liquid-solid chromatography (LSC), paper chromatography (PC), thin-layer chromatography (TLC), gas-solid chromatography (GSC), liquid-liquid chromatography (LLC), foam chromatography (FC), emulsion chromatography (EC), gas-liquid chromatography (GLC), ion chromatography (IC), gel filtration chromatography (GFC), or gel permeation chromatography (GPC). Any quantitative chromatography commonly used in the art can be used, including but not limited to, GPC.

[0056] As used herein, "mass spectrometry (MS)" refers to the process of measuring the mass of a target substance to analyze the chemical composition of the sample. Mass spectrometry generates charged molecules or molecular fragments through ionization of the target substance present in the sample, and measures the mass-to-charge ratio (m / z) and the abundance of gas-phase ions to provide information about the mass. Such mass spectrometry devices include, but are not limited to, for example, MALDI-TOF (Matrix-Assisted Laser Desorption / Ionization Time of Flight), SELDI-TOF (Surface Enhanced Laser Desorption / Ionization Time of Flight), ESI-TOF (Electrospray ionization Time of Flight), liquid chromatography-mass spectrometry (LC-MS), or LC-MS / MS (liquid chromatography-Mass Spectrometry / Mass Spectrometry).

[0057] In the present invention, the term "subject" generally includes not only humans, but may also include other animals, such as other primates, rodents, dogs, cats, horses, sheep, pigs, etc. The term "patient" in the present invention includes a subject other than humans who is diagnosed with or suspected of having a solid cancer.

[0058] The present invention provides a composition for diagnosing or predicting the prognosis of solid cancer, comprising the USE1 target aptamer. The composition of the present invention may further comprise, in addition to the aptamer, pharmacologically or physiologically acceptable carriers, excipients, and diluents. Furthermore, the composition may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, as well as topical preparations, suppositories, and sterile injectable solutions, according to conventional methods.

[0059] Carriers, excipients, and diluents that may be included in the above composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, and mineral oil. When formulating the above composition, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

[0060] In addition, the present invention provides a solid cancer diagnostic kit comprising the DNA aptamer.

[0061] The above kit comprises the aptamer of the present invention that specifically binds to USE1, and the aptamer can be attached with detection labels widely used in the art, such as a biotin moiety. After introducing a label material to the biotin-attached aptamer, it can be used for detection, quantification, and diagnosis of USE1 through analysis. Various known analytical labels can be used as the label material used for biotin, and for example, fluorescence analysis can be performed using streptavidin, avidin, Cy3, Cy5, Alexa, BODIPY, Rhodamine, or Q-dot. In addition to the biotin moiety, the aptamer for detecting USE1 can be labeled with conventional label materials such as other fluorescent substances, magnets, dyes, enzymes, and radioisotopes, and can be detected through conventional detection means, such as a fluorescence microscope and Radioimmunodection (RAID).

[0062] In addition, the kit may further include various tools or reagents that can be used to qualitatively or quantitatively measure the binding of USE1 to an aptamer in a sample, such as a support (substrate), a buffer solution, a reaction terminator, a solubilizer, a detergent, or a stabilizer.

[0063] In the present invention, the substrate on which the aptamer is fixed may be, for example, a solid substrate selected from the group consisting of polymers, glass, gold, paper, and membranes. More specifically, polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluororesin, agarose, cellulose, nitrocellulose, dextran, sephadex, sepharose, liposome, carboxymethyl cellulose, polyacrylamide, polyesterine, gabbro, filter paper, ion exchange resin, plastic film, plastic tube, polyamine-methyl vinyl-ether-maleic acid copolymer, amino acid copolymer, ethylene-maleic acid copolymer, nylon, metal, glass, glass beads, or magnetic particles may be used. Other solid substrates may include cell culture plates, ELISA plates, tubes, and polymeric membranes. The above described substrate may have any possible shape, for example, spherical (bead), cylindrical (inside of a test tube or well), planar (sheet, test strip), more preferably a multi-well plate (e.g., 24-well, 96-well, 192-well, 384-well, 576-well, etc.).

[0064] In addition, the present invention provides a biosensor for diagnosing solid cancer, comprising a USE1 target aptamer; and a substrate on which the aptamer is immobilized.

[0065] The substrate on which the USE1 target aptamer is fixed is composed of a metal electrode layer and a metal nanoparticle layer of a screen printed electrode chip (Screen Printed Gold Electrode). The electrode layer and nanoparticle materials may be any material that can be attracted by an electric field or a magnetic field and change the characteristics of an electric field, and are preferably made of gold (Au), but are not limited thereto.

[0066] In one aspect of the present invention, the aptamer can be combined with a fluorescent substance for molecular imaging to diagnose solid cancer through imaging, and the composition for diagnosis or prognosis can include such substances.

[0067] The above composition for diagnosing or predicting the prognosis of solid cancer can utilize the aptamer, which is a detection probe, as a detection probe for USE1. The labeling method for the aptamer is not particularly limited, and any known method can be applied. Examples of such methods include labeling with radioisotopes, fluorescent dyes or dyes, or fluorescent proteins.

[0068] The above-mentioned fluorescent substance for molecular imaging refers to any substance that generates fluorescence, and may be, for example, a substance that emits red or near infrared fluorescence, or a fluorescent substance with a high quantum yield, but is not limited thereto.

[0069] The fluorescent material for molecular imaging may be, but is not limited to, a fluorescent protein or other imaging material that can specifically bind to the aptamer.

[0070] The fluorescent substance may be, but is not limited to, fluorescein, BODYPY, tetramethylrhodamine, Alexa, cyanine, allophycocyanine or derivatives thereof.

[0071] The fluorescent protein may be, but is not limited to, for example, Dronpa protein, green fluorescent protein (EGFP), red fluorescent protein (DsRFP), Cys3, Cy5.5, which are cyanine fluorophores exhibiting near-infrared fluorescence, or other fluorescent proteins.

[0072] The above other imaging materials may include, but are not limited to, iron oxide, radioactive isotopes, etc., and may be applied to imaging equipment such as MRI and PET.

[0073]

[0074] Hereinafter, in order to help understand the present invention, examples will be given in detail.

[0075] [Example 1]

[0076] Production of USE1 (UBA6-specific E2 conjugating enzyme 1) aptamer and confirmation of its binding affinity to USE1 protein.

[0077] 1-1. Production of USE1 (UBA6-specific E2 conjugating enzyme 1) aptamer

[0078] The USE1 aptamer was discovered as an aptamer that binds to the USE1 (UBA6-specific E2 conjugating enzyme 1) protein through SELE (Systematic evolution of ligands by exponential enrichment), a general process for discovering aptamers (see Figure 1).

[0079] First of all, 1014 After binding a random aptamer nucleic acid sequence library of more than 100, aptamers that did not bind were removed. Aptamers that bound to the USE1 protein were eluted, purified, and then bound to the USE1 protein again. This process was repeated 8 to 15 times to isolate and purify the USE1-specific aptamer sequence. The isolated and purified aptamers were amplified through RT-PCR or PCR depending on the type of nucleic acid, and their characteristics were characterized through sequencing and binding assay.

[0080] The selected sequences were chemically synthesized to produce sequences 1 to 3 (see Table 1 below). The produced aptamers had lengths of 95 mer, 98 mer, and 90 mer, respectively.

[0081] Sequence number size (mer) base sequence (5' - 3')195CACCTAATACGACTCACTATAGCGGATCCGATGGGTGGGGGGGTGGGTAGGATCCGTTCGGGGTTTGGCATAGGGTCTGGCTCGAACAAGCTTGC298CACCTAATACGACTCACTATAGCGGACAGGGCTGGTGTGGCTG GCGTCCGGCTCGAACAAGGCTGGTGTGGCTGGCGTTCTGGCTCGAACAAGCTTGC390CACCTAATACGACTCACTATAGCGGATCCGACAGAATGCCATCACCATGTCTAGACCTATTGGCTTTGCGACTGGCTCGAACAAGCTTGC

[0082]

[0083] 1-2. Analysis of USE1 (UBA6-specific E2 conjugating enzyme 1) binding affinity of aptamer candidate sequences

[0084] In order to confirm the USE1-specific binding affinity of the three aptamer sequences selected through the SELEX process of Example 1-1 above, a fluorescence quenching system was introduced (Fig. 2). When the aptamer binds to the USE1 protein, the quencher (3IABkFQ) fragment in the QDNA that was complementarily bound is detached. This activates the fluorescence (6-FAM) in the quenched FDNA, and the amount of aptamer bound to USE1 can be quantitatively analyzed through the intensity of this fluorescence signal. As a result of this analysis, the dissociation constant (K) of the aptamer of sequence number 1 d ) was the lowest (Fig. 3, Fig. 4 to 6). In Fig. 4 and below, S18 was sequence number 1 (k d : about 10 nM), S1 has sequence number 2 (k d : about 32 nM), S2 has sequence number 3 (k d : The results for the aptamer are approximately 90 nM.

[0085] Among the aptamer candidate sequences, the aptamer of sequence number 1 was confirmed to have the strongest binding affinity to USE1, indicating that the aptamer containing the genetic sequence of sequence number 1 is most specific to USE1.

[0086]

[0087] [Example 2]

[0088] Structural analysis of USE1 (UBA6-specific E2 conjugating enzyme 1) aptamer and production of additional aptamers

[0089] 2-1. Secondary structure prediction modeling of selected aptamers

[0090] Aptamers are essentially single-stranded oligonucleotides, but they possess the unique ability to form unique three-dimensional structures through interactions between complementary sequences. Based on these characteristics, public databases can be used to model the roughly expected three-dimensional structure by inputting the aptamer's base sequence.

[0091] For the aptamer including the gene sequence of sequence number 1, a three-dimensional predicted structural model was formed as in Figs. 7a to 7d, and for the aptamer including the gene sequence of sequence number 2, a three-dimensional predicted structural model was formed as in Figs. 8a to 8d. For the aptamer including the gene sequence of sequence number 3, a three-dimensional predicted structural model was formed as in Figs. 9a and 9b.

[0092]

[0093] 2-2. Truncation and binding analysis of the selected USE1 aptamer

[0094] The aptamers initially selected through SELEX according to Example 1-1 were found to have a size of 90 mer or larger. Because sizes larger than 90 mer are somewhat unsuitable for therapeutic or diagnostic applications, truncating them as small as possible is advantageous. This truncation process can reduce synthesis costs and nonspecific binding reactions, and in particular, facilitate additional modifications, such as those aimed at nuclease resistance.

[0095] To refine the candidate aptamer gene sequence, we first analyzed the USE1 binding structure prediction model of aptamer 1, which showed the strongest binding affinity to the USE1 protein. As a result, we confirmed the binding structure model analysis result predicting that aptamer 1 would bind to the cysteine ​​site where ubiquitin binds in USE1 (Fig. 10a).

[0096] After synthesizing several aptamer sequences of appropriate size and containing the cysteine ​​binding site of aptamer 1, the binding strength was analyzed using the ELONA (enzyme-linked oligonucleotide assay) analysis method that applies the ELISA method. While conventional ELISA uses an antibody with an enzyme attached for color development, ELONA uses an oligonucleotide that can bind to the USE1 protein, i.e., an aptamer, by attaching the enzyme. Among them, the 36mer aptamer with the strongest binding strength (hereinafter referred to as aptamer 1e or Aptamer 1e) was selected and used in subsequent experiments (Fig. 10b).

[0097] The aptamer sequences used as comparative controls in this experiment are Aptamer 1b (SEQ ID NO: 5), Aptamer 1c (SEQ ID NO: 6), and Aptamer 1d (SEQ ID NO: 7). Referring to Figure 10b, Aptamer 1 exhibits the highest binding affinity, and Aptamer 1e also exhibits high binding affinity.

[0098]

[0099] [Example 3]

[0100] Validation of USE1 detection in A549 lung cancer cells

[0101] 3-1. Confirmation of USE1 detection by USE1-targeting aptamer selected from A549 lung cancer cells.

[0102] A549 lung cancer cells were lysed and homogenized with a protein extraction solution, and the protein concentration was quantified. 50 ng and 10 ng of protein extracted from the cells were coated on microtiter plates using a 0.1 M sodium carbonate coating solution, respectively, and washed with PBST (PBS-Tween 0.1%). After blocking with 1% BSA (bovine serum albumin) solution, biotin-conjugated aptamer 1 or 1e was diluted 10-fold from 1 μM to reach a concentration of 1 pM, and washed with PBST solution as before. After treatment with HRP (horse-radish peroxidase)-conjugated streptavidin for 1 hour, the cells were washed again with PBST solution. To induce a colorimetric reaction, TMB (3,3′,5,5′-Tetramethylbenzidine) substrate solution was used, and the cells were incubated in the dark for 30 minutes. The reaction was stopped with a 0.5 M sulfuric acid solution and the absorbance was measured at 456 nm (see Figure 11).

[0103] Referring to FIG. 11, it can be confirmed that both aptamer 1 and aptamer 1e produced according to the present invention bind to USE1 (UBA6-specific E2 conjugating enzyme 1) protein and A549, thereby causing a high color development reaction. In other words, it can be seen that aptamer 1 and aptamer 1e of the present invention specifically bind to USE1, and can be usefully used for diagnosing solid cancer.

[0104]

[0105] 3-2. Western blotting

[0106] Lung cancer and surrounding normal tissues from actual lung cancer patients were homogenized and dissolved in a protein extraction solution. The supernatant containing protein was separated from the samples using a high-speed centrifuge, and the protein concentration was quantified. The protein samples were separated through SDS-PAGE (Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis) and reacted with anti-USE1 antibody and HRP-conjugated secondary antibody. Afterwards, ECL solution was treated to induce luminescence, and the USE1 protein was detected by exposing it to X-ray film, and tubulin was used as a control protein (see Figure 12).

[0107] Referring to Fig. 12, similar to the results of Example 3-2, it can be confirmed that the detection of USE1 is higher in lung cancer tissue (T) than in normal tissue (N) when treated with Aptamer 1e. In other words, both Aptamer 1 and Aptamer 1e of the present invention are specific for USE1, and thus can be used for diagnosing solid cancer (preferably, lung cancer) or predicting prognosis.

[0108]

[0109] 3-3. ELISA analysis of lung cancer patient tissues

[0110] Lung cancer and surrounding normal tissues from actual lung cancer patients were homogenized and dissolved in a protein extraction solution. The supernatant containing proteins was separated from the samples using a high-speed centrifuge, and 500 ng of the protein extracted from the tissues was coated on each microtiter plate using a 0.1 M sodium carbonate coating solution and washed with PBST (PBS-Tween 0.1%) solution. After blocking with 1% BSA (bovine serum albumin) solution, biotin-conjugated aptamer 1e was treated at a concentration of 1 μM and washed with PBST solution as well. After treatment with HRP (horse-radish peroxidase)-conjugated streptavidin for 1 hour, the plate was washed again with PBST solution. To induce a color reaction, TMB (3,3′,5,5′-Tetramethylbenzidine) substrate solution was treated and reacted in a darkroom for 30 minutes. The reaction was stopped with a 0.5 M sulfuric acid solution and the absorbance was measured at 456 nm (see Figure 13).

[0111] Referring to Fig. 13, it can be confirmed that when Aptamer 1e was treated, the detection of USE1 was higher in lung cancer tissue (T) than in normal tissue (N) for all 33 samples. In other words, Aptamer 1e according to the present invention is specific for USE1 and is effective in the diagnosis of solid cancer (preferably, lung cancer).

[0112]

[0113] The above examples are merely illustrative of the present invention, and the scope of the present invention is not limited to these examples. These examples are provided to more fully explain the present invention to those of ordinary skill in the art.

[0114]

[0115] [Sequence List]

[0116] Sequence number 1

[0117] USE1 Aptamer 1

[0118] CACCTAATACGACTCACTATAGCGGATCCGATGGGTGGGGGGGTGGGTAGGATCCGTTCGGGGTTTGGCATAGGGTCTGGCTCGAACAAGCTTGC

[0119]

[0120] Sequence number 2

[0121] USE1 Aptamer 2

[0122] CACCTAATACGACTCACTATAGCGGACAGGGCTGGTGTGGCTGGCGTCCGGCTCGAACAAGGCTGGTGTGGCTGGCGTTCTGGCTCGAACAAGCTTGC

[0123]

[0124] Sequence number 3

[0125] USE1 Aptamer 3

[0126] CACCTAATACGACTCACTATAGCGGATCCGACAGAATGCCATCACCATGTCTAGACCTATTGGCTTTGCGACTGGCTCGAACAAGCTTGC

[0127]

[0128] Sequence number 4

[0129] USE1 Aptamer 1e

[0130] CACCTAACACGATTCACTATAGCTCGGGGTTTGGCA

[0131]

[0132] Sequence number 5

[0133] USE1 Aptamer 1b

[0134] GCATAGGGTCTGGCTCGAACAAGCTTGC

[0135]

[0136] Sequence number 6

[0137] USE1 Aptamer 1c

[0138] CCTAACACGATTCACTATAGCTCGGGGTTTTGG

[0139]

[0140] Sequence number 7

[0141] USE1 Aptamer 1d

[0142] CACCTAATACGACTCACTATAGTTCGGGGTTTTGGCA

Claims

1. An aptamer specific for the USE1 (UBA6-specific E2 conjugating enzyme 1) protein, comprising any one of the gene sequences represented by SEQ ID NOs: 1 to 4.

2. A composition for diagnosing or predicting the prognosis of a solid cancer, comprising an aptamer specific for USE1 (UBA6-specific E2 conjugating enzyme 1) protein.

3. In paragraph 2, A composition for diagnosing or predicting the prognosis of a solid cancer, wherein the solid cancer is any one disease selected from the group consisting of liver cancer, colon cancer, cervical cancer, kidney cancer, stomach cancer, prostate cancer, breast cancer, brain tumor, lung cancer, uterine cancer, colon cancer, bladder cancer, blood cancer, and pancreatic cancer.

4. In paragraph 2, A composition for diagnosing or predicting the prognosis of a solid cancer, wherein the aptamer specific for the USE1 protein comprises any one gene sequence selected from the group consisting of gene sequences of SEQ ID NOs: 1 to 3.

5. In paragraph 2, A composition for diagnosing or predicting the prognosis of a solid cancer, wherein the aptamer specific for the above USE1 protein comprises a gene sequence represented by SEQ ID NO: 1 or a partial sequence thereof.

6. In paragraph 5, A composition for diagnosing or predicting the prognosis of a solid cancer, wherein a part of the gene sequence represented by the above sequence number 1 has a size of 30 to 40 mer.

7. A diagnostic kit for solid cancer, comprising the composition of claim 2. 8.a) A step of producing a USE1 target aptamer comprising any one of the gene sequences represented by SEQ ID NOs: 1 to 4; b) a step of measuring the expression level of the USE1 gene or protein in a sample separated from the subject using the aptamer of step a); c) comparing the expression level of USE1 protein in a sample isolated from the subject with the expression level of a normal control sample; and c) A method for providing information for diagnosing solid cancer, comprising a step of determining that the subject is a solid cancer patient if the expression level of the USE1 protein measured in the subject is higher than that of a normal control sample.

9. In paragraph 8, A method for providing information, wherein in step b), the measurement of the expression level of the USE1 gene is performed using at least one method selected from the group consisting of polymerase chain reaction (PCR), real-time PCR, reverse transcription polymerase reaction (RT-PCR), microarray, northern blotting, rapid kit, DNA chip lateral flow assay (LFA) type test, enzyme-linked immunosorbent assay (ELISA) type test, field-effect transistor (FET) type test, and radioimmunoassay (RIA) type test.

10. In paragraph 8, A method for providing information, wherein in step b), the expression level of the USE1 protein is measured by a method selected from enzyme-linked immunosorbent assay, Western blotting, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, immunofluorescence, radioimmunosorbent test, or mass spectrometry.

11. In paragraph 8, A method for providing information, wherein the sample of step a) above is any one sample selected from the group consisting of lung tissue, whole blood, serum, plasma, saliva, urine, sputum, lymph, cerebrospinal fluid, and cell fluid.

Images