LGR4-targeting nanobody NB21 and use thereof in Anti-obesity treatment

WO2025098542A3PCT designated stage Publication Date: 2025-09-25RUIJIN HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/076673
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-01-08
Filing Date
2025-02-10
Publication Date
2025-09-25

AI Technical Summary

Technical Problem

The prior art is difficult to develop a small molecule antagonist against the LGR4 ectodomain (ECD), which is challenging to develop due to the presence of two too smooth curved beta sheets on its concave surface, lacking drug-acting pockets.

Method used

A nanoantibody NB21 targeting LGR4 was developed to specifically bind LGR4 through the complementary determining region (CDR) of its VHH chain, blocking its interaction with RSPO1/2, thereby inhibiting activation of the Wnt signaling pathway.

Benefits of technology

NB21 nanoantibodies can significantly inhibit LGR4 activity, enhance mitochondrial respiration and thermal production of brown adipocytes, providing a new anti-obesity treatment strategy.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

A LGR4-targeting nanobody NB21 and a derivative protein thereof, gene sequences encoding same, and expression vectors and expression systems for producing same. In addition, in-vitro and in-vivo experiments verify that the nanobody NB21 has high affinity and high specificity, and exerts a biological function in promoting thermogenesis and reducing fat.
Need to check novelty before this filing date? Find Prior Art

Description

A nanoantibody NB21 targeting LGR4 and its application in anti-obesity treatment Technical Field

[0001] The present invention belongs to the field of biomedicine, and more specifically, relates to a nano-antibody NB21 targeting LGR4 and its application in anti-obesity treatment. Background Art

[0002] Compared with traditional antibodies, nanobodies have many advantages:

[0003] (1) It is small in size, only one-tenth of the size of ordinary antibodies. It has stronger penetrating power in animal tissues and can pass through human brain tissue to reach high-density tumors, thereby treating certain tumors or brain diseases.

[0004] (2) Stable efficacy. Nanobodies remain in the body longer than ordinary antibodies without being naturally degraded, which means that the efficacy lasts longer. They also have a wide temperature range and can still function at temperatures as high as 90°C, while traditional antibodies will be inactivated under such conditions. They are very stable even at extreme pH values ​​and can even remain effective after passing through the human stomach.

[0005] (3) Good antigen specificity and easy genetic modification; Nanobodies can recognize unique antigen structural epitopes, have a wider antigen binding ability than ordinary antibodies, and are easy to artificially modify to obtain antibodies against different pathogens; Nanobodies can be easily synthesized in microorganisms, can be expressed in large quantities in microorganisms such as phages, Escherichia coli, and yeast, and are easy to produce on a large scale.

[0006] As the incidence of obesity continues to rise, various obesity complications such as diabetes, cardiovascular disease, and cancer are also gradually increasing. From lifestyle interventions to bariatric surgery, various methods are used to prevent and manage obesity, but their effectiveness is low or the risks are high. The discovery of new targets is of great significance for weight loss treatment. Currently, G protein-coupled receptors (GPCRs) are the direction of weight loss drug development. For example, the currently available GLP-1R agonists, GIPR agonists, and GCGR agonists all target GPCRs.

[0007] In 2013, the Genetics of Severe Obesity in Youth (GOCY) cohort in China first discovered a functionally activating LGR4 mutation (A750T) in the leucine repeat-containing G protein-coupled receptor 4 (LGR4, also known as GPR48), significantly increasing the risk of obesity. Almost simultaneously, studies in Iceland showed that over 300 people carrying a rare loss-of-function LGR4 mutation (p.R126X) experienced weight loss. Animal studies have shown that knocking out the LGR4 gene can alleviate obesity caused by a high-fat diet and genetic defects by promoting the transformation of preadipocytes from white adipocytes to brown-like adipocytes, thereby increasing energy expenditure. LGR4 is a new member of the GPCR superfamily and plays an important role in maintaining endocrine and metabolic homeostasis. These findings and perspectives have been widely recognized. Genetic and biological evidence suggest that LGR4 may be a potential target for obesity treatment.

[0008] However, it is generally believed that developing small-molecule antagonists targeting the LGR4 extracellular domain (ECD) is challenging due to the presence of two overly smooth curved β-sheets on its concave surface, which lack drug-action pockets.

[0009] Therefore, there is an urgent need to develop a safer, more efficient and easier to prepare nanoantibody targeting LGR4. Summary of the Invention

[0010] The purpose of the present invention is to provide a safer, more efficient and easier to prepare nanobody against LGR4.

[0011] Another object of the present invention is to provide applications of nanobodies targeting LGR4, particularly for anti-obesity effects.

[0012] In a first aspect of the invention, a Nanobody targeting LGR4 is provided, wherein the complementarity determining region (CDR) of the VHH chain of the Nanobody is selected from the group consisting of:

[0013] The variable region comprises any one or more of CDR1, CDR2 or CDR3 sequences:

[0014] The CDR1 has the amino acid sequence shown in SEQ ID No. 1;

[0015] The CDR2 has the amino acid sequence shown in SEQ ID No. 2;

[0016] The CDR3 has the amino acid sequence shown in SEQ ID No. 3;

[0017] The variable region is an amino acid sequence obtained by replacing, deleting or adding one or more amino acids in any one or more of the amino acid sequences in CDR1, CDR2, and CDR3 sequences, and is an amino acid sequence that has the same function as any one or more of the amino acid sequences in CDR1, CDR2, or CDR3.

[0018] In another preferred example, the CDR region of the Nanobody VHH chain comprises an amino acid sequence that has at least 80%, preferably at least 90%, more preferably at least 95% (e.g. 96%, 97%, 98% or even more preferably at least 99%) sequence identity with any one of SEQ ID NOs: 1-3.

[0019] In another preferred embodiment, the amino acid sequence of the CDR region of the Nanobody VHH chain comprises one or more amino acid substitutions compared to any one of SEQ ID NOs: 1-3, preferably conservative amino acid substitutions.

[0020] In another preferred embodiment, the Nanobody can specifically bind to LGR4.

[0021] In another preferred example, the nanoantibody can specifically bind to LGR4 and block its interaction with RSPO1 / 2.

[0022] In another preferred embodiment, the nanobody can inhibit the activation of the Wnt signaling pathway.

[0023] In another preferred embodiment, the nanobody can enhance mitochondrial respiration and thermogenesis of brown adipocytes.

[0024] In another preferred embodiment, the LGR4 is LGR4 of a human or non-human mammal.

[0025] In another preferred embodiment, the LGR4 is human, mouse or rat LGR4.

[0026] In another preferred embodiment, the variable region has the amino acid sequence shown in SEQ ID No. 7;

[0027] Or an amino acid sequence obtained by substituting, deleting or adding one or more (for example, 2, 3, 4 or 5) amino acids in the amino acid sequence as described in SEQ ID No. 7.

[0028] The second aspect of the present invention provides an antibody targeting LGR4, wherein the antibody targeting LGR4 comprises one or more Nanobodies targeting LGR4 as described in the first aspect of the present invention.

[0029] In another preferred embodiment, the antibody targeting LGR4 can be a monomer, a bivalent antibody, or a multivalent antibody.

[0030] In another preferred embodiment, the antibody targeting LGR4 includes a monospecific antibody, a bispecific antibody, and a multispecific antibody (such as a trispecific antibody).

[0031] The third aspect of the present invention provides a polynucleotide encoding the Nanobody targeting LGR4 as described in the first aspect of the present invention or the antibody targeting LGR4 as described in the second aspect of the present invention.

[0032] In another preferred embodiment, the polynucleotide includes RNA, DNA or cDNA.

[0033] Nucleic acid molecules have:

[0034] (1) the nucleotide sequence shown in SEQ ID No. 8; or

[0035] (ii) a complementary nucleotide sequence to the nucleotide sequence shown in SEQ ID No. 8; or

[0036] (3) a nucleotide sequence that encodes the same protein as the nucleotide sequence in (1) or (2) but differs from the nucleotide sequence in (1) or (2) due to the degeneracy of the genetic code; or

[0037] (4) A nucleotide sequence obtained by replacing, deleting or adding one or two nucleotide sequences to the nucleotide sequence shown in (1), (2) or (3), and a nucleotide sequence that has the same or similar function as the nucleotide sequence shown in (1), (2) or (3).

[0038] The fourth aspect of the present invention provides an expression vector, wherein the expression vector contains the polynucleotide described in the third aspect of the present invention.

[0039] In another preferred embodiment, the vector is selected from the following group: bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus, or other vectors.

[0040] The fifth aspect of the present invention provides a host cell, which contains the expression vector described in the fourth aspect of the present invention, or the polynucleotide described in the third aspect of the present invention is integrated into its genome.

[0041] In another preferred embodiment, the host cell includes a prokaryotic cell or a eukaryotic cell.

[0042] In another preferred embodiment, the host cell is selected from the group consisting of Escherichia coli, yeast cells, and mammalian cells.

[0043] In another preferred embodiment, the mammalian cells include (but are not limited to) HEK293F cells and CHO cells.

[0044] The sixth aspect of the present invention provides an immunoconjugate, wherein the immunoconjugate comprises:

[0045] (a) a Nanobody targeting LGR4 as described in the first aspect of the invention or an antibody targeting LGR4 as described in the second aspect of the invention; and

[0046] (b) a conjugated moiety selected from the group consisting of fluorescein, a small molecule compound, PEG, a radioisotope, a contrast agent, a fatty acid chain, a protein fragment, or a combination thereof.

[0047] In another preferred embodiment, the components (a) and (b) are operably linked.

[0048] In another preferred embodiment, the coupling moiety is a chemical label or a biological label.

[0049] In another preferred embodiment, the chemical label is an isotope, an immunotoxin and / or a chemical drug.

[0050] In another preferred embodiment, the biomarker is biotin, avidin or an enzyme label.

[0051] In another preferred embodiment, the small molecule compound includes but is not limited to drugs or toxins that have clear or potential therapeutic or auxiliary therapeutic effects on tumors or autoimmune diseases.

[0052] In another preferred embodiment, the radioactive isotope includes:

[0053] (i) a diagnostic isotope selected from the group consisting of Tc-99m, Ga-68, F-18, I-123, I-125, I-131, In-111, Ga-67, Cu-64, Zr-89, C-11, Lu-177, Re-188, or a combination thereof; and / or

[0054] (ii) therapeutic isotopes, wherein the therapeutic isotopes are selected from the group consisting of Lu-177, Y-90, Ac-225, As-211, Bi-212, Bi-213, Cs-137, Cr-51, Co-60, Dy-165, Er-169, Fm-255, Au-198, Ho-166, I-125, I-131, Ir-192, Fe-59, Pb-212, Mo-99, Pd-103, P-32, K-42, Re-186, Re-188, Sm-153, Ra223, Ru-106, Na24, Sr89, Tb-149, Th-227, Xe-133, Yb-169, Yb-177, or a combination thereof.

[0055] In another preferred embodiment, the radioactive isotopes include but are not limited to iodine 131, indium 111 and lutetium 177.

[0056] In another preferred embodiment, the contrast agent is used for MRI or CT.

[0057] In another preferred embodiment, the protein fragments include but are not limited to antibody Fc, biotin, avidin, HRP, antibodies, enzymes, cytokines and other biologically active proteins or polypeptides.

[0058] In another preferred embodiment, the coupling moiety is a detectable label.

[0059] In another preferred embodiment, the coupling portion is selected from the following group: fluorescent or luminescent markers, radioactive markers, MRI (magnetic resonance imaging) or CT (computer tomography) contrast agents, or enzymes capable of producing detectable products, radionuclides, biotoxins, cytokines (such as IL-2, etc.), antibodies, antibody Fc fragments, antibody scFv fragments, gold nanoparticles / nanorods, viral particles, liposomes, nanomagnetic particles, prodrug-activating enzymes (for example, DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)) or any form of nanoparticles.

[0060] In a seventh aspect of the present invention, a fusion protein is provided, comprising:

[0061] (i) a Nanobody targeting LGR4 as described in the first aspect of the invention, or an antibody targeting LGR4 as described in the second aspect of the invention;

[0062] (ii) Optional polypeptide molecules or fragments having therapeutic functions.

[0063] In another preferred embodiment, the polypeptide molecules or fragments with therapeutic functions include but are not limited to: polypeptide molecules or fragments targeting PD-1, LGR4, IL-4R, IL-4Rα, TNF-α, VEGF, 4-1BB, CD47, TIM3, CTLA4, IL-17A, CD19, CD22, CD38, IL-5, TSLP, BCMA, GLP-1, Trop2, or TIGIT.

[0064] In another preferred embodiment, the polypeptide molecules or fragments with therapeutic functions include but are not limited to: insulin, IL-2, interferon, calcitonin, GHRH peptide, intestinal peptide analogs, albumin, antibody fragments, and cytokines.

[0065] In another preferred embodiment, the polypeptide molecule or fragment with therapeutic function includes a single-chain antibody (scFv), a double-chain antibody, a monoclonal antibody, or a chimeric antibody.

[0066] In another preferred embodiment, the fusion protein further comprises a tag sequence to assist expression and / or purification.

[0067] In another preferred embodiment, the tag sequence is selected from the following group: 6His tag, GGGS sequence, FLAG tag.

[0068] In another preferred embodiment, the fusion protein further comprises a portion selected from the group consisting of: a histidine His tag, a human influenza hemagglutinin HA tag, a FLAG tag, a Myc tag, a green fluorescent protein, an alkaline phosphatase, a horseradish peroxidase, a luminescent enzyme, a maltose binding protein, a glutathione transferase, a toxin protein, and an antibody Fc fragment.

[0069] In another preferred embodiment, the fusion protein includes a bispecific antibody or a chimeric antibody.

[0070] The eighth aspect of the present invention provides a pharmaceutical composition, comprising:

[0071] (ii) the Nanobody targeting LGR4 as described in the first aspect of the invention, the antibody targeting LGR4 as described in the second aspect of the invention, the immunoconjugate as described in the sixth aspect of the invention, or the fusion protein as described in the seventh aspect of the invention;

[0072] (ii) a pharmaceutically acceptable carrier.

[0073] In a ninth aspect of the present invention, a nanobody complex is provided, comprising:

[0074] (a) the Nanobody targeting LGR4 as described in the first aspect of the invention, or the antibody targeting LGR4 as described in the second aspect of the invention; and

[0075] (b) a modifier that is non-covalently bound to the Nanobody, wherein the modifier is selected from the group consisting of colloidal gold, colloidal silver, or colloidal carbon.

[0076] In the tenth aspect of the present invention, a use of an active ingredient is provided, wherein the active ingredient is selected from the following group: the nanoantibody targeting LGR4 as described in the first aspect of the present invention, the antibody targeting LGR4 as described in the second aspect of the present invention, the immunoconjugate as described in the sixth aspect of the present invention or the fusion protein as described in the seventh aspect of the present invention, or a combination thereof, (a) for the preparation of a drug for treating obesity and related diseases; and / or (b) for the preparation of a reagent, affinity medium product, detection plate or kit for detecting LGR4.

[0077] In another preferred embodiment, the obesity is selected from the group consisting of simple obesity, obesity syndrome, secondary obesity

[0078] In another preferred embodiment, the simple obesity is selected from the group consisting of: appetite-induced obesity, absorption-enhanced obesity, and basal metabolic rate-decreased obesity.

[0079] In another preferred embodiment, the obesity syndrome is selected from the following group: Prader-Willi syndrome, Bardet-Biedl syndrome, Alstrom syndrome and the like.

[0080] In another preferred embodiment, the reagent is used to detect LGR4 or a fragment thereof in a sample.

[0081] In another preferred embodiment, the detection type includes but is not limited to flow cytometry, cell immunofluorescence detection, enzyme-linked immunosorbent assay, and immunoblotting detection.

[0082] In another preferred embodiment, the affinity medium product includes modified polymer microspheres, magnetic microspheres, agarose, dextran, cellulose, and filter membranes.

[0083] In another preferred embodiment, the kit includes an immunochromatography kit, an enzyme-linked immunosorbent assay kit, an immunoturbidimetry kit, and a chemical, electrochemical and bioluminescent kit.

[0084] In an eleventh aspect of the present invention, a method for detecting LGR4 or a fragment thereof in a sample in vitro is provided, the method comprising the steps of:

[0085] (1) in vitro, contacting the sample with the LGR4-targeting Nanobody as described in the first aspect of the present invention, the LGR4-targeting Antibody as described in the second aspect of the present invention, or the immunoconjugate as described in the sixth aspect of the present invention;

[0086] (2) Detecting whether an antigen-antibody complex is formed, wherein the formation of the complex indicates the presence of LGR4 or a fragment thereof in the sample.

[0087] In another preferred embodiment, the detection includes diagnostic or non-diagnostic.

[0088] The thirteenth aspect of the present invention provides a kit, comprising:

[0089] (1) a first container, comprising the Nanobody targeting LGR4 according to the first aspect of the present invention or the Antibody targeting LGR4 according to the second aspect of the present invention; and / or

[0090] (2) A second container, wherein the second container contains a secondary antibody against the Nanobody targeting LGR4 described in the first aspect of the present invention or the antibody targeting LGR4 described in the second aspect of the present invention.

[0091] A fourteenth aspect of the present invention provides a method for preparing a recombinant polypeptide, characterized in that the method comprises:

[0092] (a) culturing the host cell according to the fifth aspect of the present invention under conditions suitable for expression;

[0093] (b) isolating the recombinant polypeptide from the culture, wherein the recombinant polypeptide is the Nanobody targeting LGR4 as described in the first aspect of the invention, the antibody targeting LGR4 as described in the second aspect of the invention, or the fusion protein as described in the seventh aspect of the invention.

[0094] The fifteenth aspect of the present invention provides a method for anti-obesity treatment, characterized in that the method comprises: administering to a subject in need thereof the nanoantibody targeting LGR4 as described in the first aspect of the present invention, the antibody targeting LGR4 as described in the second aspect of the present invention, the immunoconjugate as described in the sixth aspect of the present invention, the fusion protein as described in the seventh aspect of the present invention, the pharmaceutical composition as described in the eighth aspect of the present invention, or a combination thereof.

[0095] In another preferred embodiment, the method further comprises: administering other drugs or treatment methods to a subject in need for combined treatment.

[0096] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0097] Figure 1 shows the generation and characterization of the nanobody NB21: a. NB21 exhibited significant inhibitory effect on LGR4 in the TOPFlash assay; b. NB21 exhibited high affinity for human LGR4-ECD; cd. The epitope of NB21 overlapped with the LGR4-ECD binding site of RSPO1 (c) and RSPO2 (FU) (d).

[0098] Figure 2 shows the cryo-EM structures of LGR4 and its complex with RSPO2(FU): a. Structure of the LGR4-MB52 complex, showing cryo-EM images (left) and atomic models (right); b. Structure of the RSPO2(FU)-LGR4-MB52 complex, showing cryo-EM images (left) and atomic models (right); c. Interface between LGR4 and RSPO2(FU); d. Cryo-EM density map of the interaction interface between LGR4 and RSPO2(FU). Interacting residues are represented by sticks. LGR4 is colored cyan; RSPO2(FU) is colored purple; and MB52 is colored gray.

[0099] Figure 3 shows the cryo-EM structure and analysis of the LGR4-NB21 complex: a. Structure of the NB21-LGR4 complex, showing the cryo-EM image (left) and atomic model (right), with NB21 represented in pink; b. The interface between LGR4 and NB21; c. The cryo-EM density map of the interaction interface between LGR4 and NB21; d. Superposition of LGR4-ECD in the LGR4-RSPO2(FU) complex and the LGR4-NB21 complex.

[0100] Figure 4 shows that NB21-mFc inhibits the Wnt / β-catenin signaling pathway and promotes the transition of white adipocytes to brown adipocytes in vitro:

[0101] (a-C) sWAT-SVFs from WT mice were co-cultured with hRSPO1(FU) (0.1 μg / ml) and / or NB21-mFc (0.1 μM) for 48 h; a. Immunoblotting analysis (left) and quantification (right) of non-phosphorylated (active) and total β-catenin (n = 3); HSP90 was used to normalize the total protein loading; b. Representative images of immunofluorescence staining of β-catenin (green) and DAPI (blue) (top) and quantification of the mean fluorescence intensity of β-catenin in the nucleus (bottom); scale bar, 50 μm; c. qPCR analysis of Wnt target genes (such as Axin2, Wisp2, Tcf7l2, Nkd1, CyclinD1, c-Myc, and Id2) (n = 3);

[0102] (dg) qPCR analysis of brown adipocytes induced by pretreatment with hRSPO1(FU) (0.1 μg / ml) and / or different concentrations of NB21-mFc (0.01, 0.1, and 1.0 μM), including Wnt target genes and thermogenic genes (e.g., Tcf7l2 (d), Ucp1 (e), Cidea (f), and Cox8b (g)) (n = 3). qPCR, quantitative real-time PCR; sWAT, subcutaneous white adipose tissue; SVFs, stromal vascular fraction; ANOVA, analysis of variance.

[0103] Figure 5 shows that NB21-mFc increases energy expenditure and promotes thermogenesis in response to cold stimulation:

[0104] (ad) Eight-week-old female C57BL / 6J mice were fed a high-fat diet (HFD) and treated once daily with intraperitoneal injections of PBS or NB21-mFc (0.2 mg / kg) (n = 8); a, Schematic diagram of the treatment regimen; b, Representative curves of 24-h energy expenditure (EE) at room temperature (22°C) on day 7 (left) and EE normalized to body weight as a covariate (right); c, EE changes in the mice in (a) before and after acute cold exposure (4°C) after the above experiment, recorded for 7 hours, with values ​​between 3 and 4 hours of cold exposure; d, Core body temperature changes in mice after 6 hours of cold exposure (5°C) after 21 days of treatment;

[0105] (ek) 8-week-old female C57BL / 6J mice were fed a HFD and intraperitoneally injected with PBS or NB21-mFc (0.2 mg / kg) daily for 7 days under chronic cold stimulation (5°C) (n=6); e, Schematic diagram of the treatment scheme; f, i, Representative images of H&E staining and immunofluorescence staining of UCP1 (green) and Perilipin (red) in vWAT (f) and sWAT (i), Scale bar, 100 μm; g, j, qPCR analysis of heat production-related genes and mitochondrial respiratory chain complex genes in vWAT (g) and sWAT (j); h, k, Immunoblot analysis of mitochondrial respiratory chain complexes (UQCRC2, MTCO1, and NDUFB8) and heat production genes (UCP1) in vWAT (h) and sWAT (k).

[0106] HFD, high-fat diet; EE, energy expenditure; vWAT, visceral white adipose tissue; sWAT, subcutaneous white adipose tissue; H&E, hematoxylin and eosin staining; ANCOVA, analysis of covariance; ANOVA, analysis of variance.

[0107] Figure 6 shows that NB21-mFc promotes adipose browning in an LGR4-dependent manner:

[0108] (ad) from WT and littermate Lgr4 m / m Brown adipocytes induced by LGR4-deficient mice were treated with hRSPO1(FU) (0.1 μg / ml) and / or NB21-mFc (0.1 μM) from day −2 to day 2; ac, qPCR analysis of heat production-related genes (including Ucp1 (a), Cidea (b), and Cox8b (c)) (n = 4); d, oxygen consumption rate (OCR) (n = 8);

[0109] (ej) 8-week-old female WT and Lgr4 m / m Mice were fed with HFD and treated with PBS or NB21-mFc (0.2 mg / kg) by intraperitoneal injection every two days for 6 weeks (WT group n=6, Lgr4 m / m Group n = 3); e, Schematic diagram of the treatment scheme; fg, Body weight gain (f) and tissue weight of vWAT and sWAT (g) of the two genotypes after 6 weeks of treatment; h, Representative images of H&E staining and immunofluorescence staining of UCP1 (green) and Perilipin (red) of vWAT, Scale bar, 100 μm; i, qPCR analysis of heat production-related genes and mitochondrial respiratory chain complex genes in vWAT; j, Immunoblot analysis (left) and quantification (right) of mitochondrial respiratory chain complexes (UQCRC2, MTCO1 and NDUFB8) and heat production genes (UCP1) in vWAT, HSP90 was used to normalize the amount of total protein loaded.

[0110] WT, wild type; OCR, oxygen consumption rate; HFD, high-fat diet; H&E, hematoxylin and eosin staining; vWAT, visceral white adipose tissue; sWAT, subcutaneous white adipose tissue; qPCR, quantitative real-time polymerase chain reaction; ANOVA, analysis of variance. DETAILED DESCRIPTION

[0111] After extensive and intensive research and extensive screening, the inventors developed NB21, a nanobody targeting LGR4. This nanobody specifically binds to LGR4 and blocks its interaction with RSPO1 / 2, thereby inhibiting activation of the Wnt signaling pathway and enhancing mitochondrial respiration and thermogenesis in brown (and brown-like) adipocytes. Furthermore, in vitro and in vivo experiments demonstrated that NB21 nanobody possesses high affinity, high specificity, and anti-obesity biological functions, providing a new strategy for anti-obesity treatment.

[0112] the term

[0113] In order to facilitate understanding of the present invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention belongs. Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, as such methods and conditions may vary.

[0114] As used herein, the terms "comprise," "include," and "contain" are used interchangeably to include not only closed definitions but also semi-closed and open definitions. In other words, the terms include "consisting of," "consisting essentially of."

[0115] As used herein, the term "optionally" or "optionally" means that the event or situation described subsequently may occur but need not occur. For example, "optionally comprising 1-3 antibody heavy chain variable regions" means that the antibody heavy chain variable regions of a specific sequence may have but need not have, and may have 1, 2, or 3.

[0116] Antibody

[0117] As used herein, the terms "single domain antibody," "VHH," "nanobody," and "single domain antibody" (sdAb, or nanobody) have the same meaning and are used interchangeably. They refer to the cloning of the variable region of an antibody heavy chain to construct a single domain antibody (VHH) consisting of only one heavy chain variable region. This is the smallest antigen-binding fragment with complete function. Typically, an antibody naturally lacking the light chain and heavy chain constant region 1 (CH1) is first obtained, and then the variable region of the antibody heavy chain is cloned to construct a single domain antibody (VHH) consisting of only one heavy chain variable region.

[0118] Nanobodies / single-domain antibodies (Nanobodies) are a new type of small-molecule antibody fragment, cloned from the variable heavy chain region (VHH) of natural camel heavy-chain antibodies. Nanobodies (Nb) possess excellent biological properties, with a molecular weight of 12-15 kDa, one-tenth the size of a complete antibody. They exhibit excellent tissue penetration, high specificity, and good water solubility. Due to their unique structural properties, they combine the advantages of traditional antibodies and small-molecule drugs, almost perfectly overcoming the drawbacks of traditional antibodies, such as their long development cycles, low stability, and demanding storage conditions. They are becoming an emerging force in the next generation of antibody therapies, showing broad application prospects in immune diagnosis and treatment.

[0119] As used herein, the term "variable" refers to certain portions of the variable region in an antibody that differ in sequence, which contribute to the binding and specificity of various specific antibodies to their specific antigens. However, variability is not evenly distributed throughout the variable region of an antibody. It is concentrated in three segments called complementarity determining regions (CDRs) or hypervariable regions in the variable regions of the light and heavy chains. The more conserved portions of the variable region are called framework regions (FRs). The variable regions of native heavy and light chains each contain four FR regions, which are generally in a β-pleated configuration and are connected by three CDRs that form a connecting loop, which in some cases may form a partial β-pleated structure. The CDRs in each chain are closely together through the FR regions and, together with the CDRs of the other chain, form the antigen-binding site of the antibody (see Kabat et al., NIH Publ. No. 91-3242, Vol. 1, pp. 647-669 (1991)). The constant regions do not directly participate in the binding of the antibody to the antigen, but they exhibit different effector functions, such as participating in the antibody's antibody-dependent cytotoxicity.

[0120] As known to those skilled in the art, immunoconjugates and fusion expression products include: drugs, toxins, cytokines (cytokines), radionuclides, enzymes and other diagnostic or therapeutic molecules combined with the antibodies of the present invention or their fragments to form conjugates. The present invention also includes cell surface markers or antigens that bind to the nanobodies or fragments thereof against the new coronavirus.

[0121] As used herein, the terms "heavy chain variable region" and "VH" are used interchangeably.

[0122] As used herein, the terms "variable region" and "complementarity determining region (CDR)" are used interchangeably.

[0123] In a preferred embodiment of the present invention, the heavy chain variable region of the antibody includes three complementarity determining regions CDR1, CDR2, and CDR3.

[0124] In a preferred embodiment of the present invention, the heavy chain of the antibody includes the above-mentioned heavy chain variable region and heavy chain constant region.

[0125] In the present invention, the terms "antibody of the present invention," "protein of the present invention," or "polypeptide of the present invention" are used interchangeably to refer to polypeptides that specifically bind to LGR4, such as proteins or polypeptides having a heavy chain variable region. They may or may not contain an initial methionine.

[0126] The present invention also provides other proteins or fusion expression products comprising the antibodies of the present invention. Specifically, the present invention includes any protein or protein conjugate and fusion expression product (i.e., immunoconjugate and fusion expression product) comprising a heavy chain containing a variable region, as long as the variable region is identical to or at least 90% homologous to the heavy chain variable region of the antibodies of the present invention, preferably at least 95% homologous.

[0127] Generally, an antibody's antigen-binding properties are described by three specific regions within the variable region of the heavy chain, known as the variable regions (CDRs). This region is divided into four framework regions (FRs). The amino acid sequences of the four FRs are relatively conserved and do not directly participate in the binding reaction. These CDRs form a loop structure, spatially close to each other through the β-sheet formed by the FRs between them. The CDRs on the heavy chain and the corresponding CDRs on the light chain constitute the antibody's antigen-binding site. The amino acid sequences of antibodies of the same type can be compared to determine which amino acids constitute the FR or CDR regions.

[0128] The variable regions of the heavy chains of the antibodies of the present invention are of particular interest because they are at least partially involved in antigen binding. Thus, the present invention includes molecules having antibody heavy chain variable regions with CDRs that are 90% or more (preferably 95% or more, and most preferably 98% or more) homologous to the CDRs identified herein.

[0129] The present invention includes not only complete antibodies, but also fragments of antibodies with immunological activity or fusion proteins formed by antibodies and other sequences. Therefore, the present invention also includes fragments, derivatives and analogs of the antibodies.

[0130] As used herein, the terms "fragment," "derivative," and "analog" refer to polypeptides that substantially retain the same biological function or activity as the antibodies of the present invention. A polypeptide fragment, derivative, or analog of the present invention may be (i) a polypeptide having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, where such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide formed by fusion of a mature polypeptide with another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol), or (iv) a polypeptide formed by fusion of an additional amino acid sequence to the polypeptide sequence (e.g., a leader sequence or secretory sequence, a sequence for purifying the polypeptide, a proprotein sequence, or a fusion protein with a 6xHis tag). Based on the teachings herein, these fragments, derivatives, and analogs are well known to those skilled in the art.

[0131] Variant forms of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that can hybridize with the encoding DNA of the antibody of the present invention under high or low stringency conditions, and polypeptides or proteins obtained using the antiserum of the antibody of the present invention.

[0132] The present invention also provides other polypeptides, such as fusion proteins comprising antibodies or fragments thereof. In addition to substantially full-length polypeptides, the present invention also encompasses fragments of the antibodies of the invention. Typically, the fragments comprise at least about 50 contiguous amino acids of the antibodies of the invention, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, and most preferably at least about 100 contiguous amino acids.

[0133] In the present invention, "conservative variants of the antibodies of the present invention" refer to polypeptides in which no more than 10, preferably no more than 8, more preferably no more than 5, and most preferably no more than 3 amino acids are replaced with amino acids having similar or similar properties, compared to the amino acid sequence of the antibodies of the present invention. These conservative variant polypeptides are preferably generated by making amino acid substitutions according to Table A.

[0134] Table A

[0135] Nanobodies targeting LGR4

[0136] As used herein, the terms "Nanoantibodies of the invention", "Nanoantibodies targeting LGR4 of the invention", and "LGR4 Nanoantibodies of the invention" are used interchangeably to refer to Nanoantibodies that specifically recognize and bind to LGR4 (including human LGR4).

[0137] In an embodiment of the present invention, a Nanobody targeting LGR4 is provided, wherein the complementarity determining region (CDR) of the VHH chain of the Nanobody is selected from the following group:

[0138] (a) CDRs determined based on IMGT rules:

[0139] The amino acid sequence of CDR1 is as shown in SEQ ID No: 1,

[0140] The amino acid sequence of CDR2 is as shown in SEQ ID No: 2, and

[0141] The CDR3 of amino acids shown in SEQ ID No: 3; or

[0142] (b) CDRs determined based on Kabat rules:

[0143] The amino acid sequence of CDR1 is as shown in SEQ ID No: 4,

[0144] The amino acid sequence of CDR2 is as shown in SEQ ID No: 5, and

[0145] CDR3 having amino acids as shown in SEQ ID No: 6;

[0146] (c) any one of the above amino acid sequences having LGR4 binding affinity by adding, deleting, modifying and / or replacing at least one (e.g., 1-5, 1-3, preferably 1-2, more preferably 1) amino acid.

[0147] In another preferred embodiment, the sequence formed by adding, deleting, modifying and / or replacing at least one amino acid sequence is preferably an amino acid sequence with a homology of at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95%.

[0148] The antibody of the present invention may be a double-chain or single-chain antibody, and may be selected from animal-derived antibodies (e.g., camel-derived antibodies), chimeric antibodies, humanized antibodies, more preferably humanized antibodies, human-animal chimeric antibodies, and more preferably fully humanized antibodies.

[0149] The antibody derivatives of the present invention can be single-chain antibodies and / or antibody fragments, such as Fab, Fab', (Fab')2 or other antibody derivatives known in the art, as well as any one or more of IgA, IgD, IgE, IgG and IgM antibodies or other subtypes of antibodies.

[0150] In a preferred embodiment of the present invention, any one or more of the above SEQ ID NOs: 1, 2 and 3, or sequences thereof having binding affinity for the N-terminus of LGR4 after addition, deletion, modification and / or substitution of at least one amino acid, are located in the CDR region of the heavy chain variable region (VH).

[0151] In a preferred embodiment of the present invention, any one or more of the above SEQ ID NOs: 4, 5 and 6, or sequences thereof having binding affinity for the C-terminus of LGR4 after addition, deletion, modification and / or substitution of at least one amino acid, are located in the CDR region of the heavy chain variable region (VH).

[0152] In the present invention, the number of added, deleted, modified and / or substituted amino acids is preferably no more than 40% of the total number of amino acids in the initial amino acid sequence, more preferably no more than 35%, more preferably 1-33%, more preferably 5-30%, more preferably 10-25%, more preferably 15-20%.

[0153] In the present invention, the number of amino acids added, deleted, modified and / or substituted is usually 1, 2, 3, 4 or 5, preferably 1-3, more preferably 1-2, and most preferably 1.

[0154] It should be understood that the antibodies of the present invention also include antibodies containing one or more mutations in the FR region and no mutation or only one or two conservative mutations in the CDR region, and still retaining specific binding and affinity to the N-terminus or C-terminus of LGR4.

[0155] Antibody preparation

[0156] Any method suitable for producing antibodies can be used to produce the LGR4-targeting Nanobodies of the present invention. For example, animals can be immunized with linked or naturally occurring LGR4 or fragments thereof. Suitable immunization methods can be used, including adjuvants, immunostimulants, repeated booster immunizations, and one or more routes can be used.

[0157] Any suitable form of LGR4 can be used as an immunogen (antigen) to generate non-human antibodies specific for LGR4 and screen the biological activity of the antibodies. The stimulating immunogen can be recombinant LGR4 or a fragment thereof. The immunogen can be used alone or in combination with one or more immunogenicity enhancers known in the art. The immunogen can be purified from a natural source or produced in genetically modified cells. The DNA encoding the immunogen can be genomic or non-genomic in origin (e.g., cDNA). The DNA encoding the immunogen can be expressed using a suitable genetic vector, including but not limited to adenoviral vectors, adeno-associated viral vectors, baculoviral vectors, plasmids, and non-viral vectors.

[0158] An exemplary method for producing the LGR4 Nanobody of the invention is described in Example 1.

[0159] The antibodies of the present invention can be selected from any type of immunoglobulin of any species, including IgG and IgE. Preferred antibodies are IgG antibodies, such as the IgG1 subtype. Optimization of the necessary constant domain sequences can be readily achieved by screening antibodies using the biological assays described in the examples below to produce desired biological activity.

[0160] Likewise, any type of light chain can be used in the compounds and methods herein. Specifically, kappa, lambda chains, or variants thereof can be used in the compounds and methods of the invention.

[0161] The sequence of the DNA molecule of the antibody of the present invention or its fragment can be obtained by conventional techniques, such as PCR amplification or genomic library screening. In addition, the coding sequences of the light chain and heavy chain can be fused together to form a single-chain antibody.

[0162] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods.

[0163] In addition, artificial synthesis methods can also be used to synthesize relevant sequences, especially when the fragment length is relatively short. Generally, by first synthesizing multiple small fragments and then connecting them, very long fragments of sequence can be obtained. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art.

[0164] The present invention also relates to vectors comprising the above-mentioned appropriate DNA sequence and appropriate promoter or control sequence. These vectors can be used to transform appropriate host cells to enable them to express proteins.

[0165] Host cells can be prokaryotic cells, such as bacterial cells, lower eukaryotic cells, such as yeast cells, or higher eukaryotic cells, such as mammalian cells. Preferred animal cells include (but are not limited to): CHO-S, CHO-K1, HEK-293 cells.

[0166] The steps of transforming host cells with recombinant DNA described in the present invention can be carried out using techniques well known in the art. The transformants obtained can be cultured using conventional methods, and the transformants express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, conventional culture medium is used under appropriate conditions.

[0167] Typically, the transformed host cells are cultured under conditions suitable for expression of the antibodies of the present invention. The antibodies of the present invention are then purified using conventional immunoglobulin purification procedures, such as protein A-Sepharose, hydroxyapatite chromatography, gel electrophoresis, dialysis, ion exchange chromatography, hydrophobic chromatography, molecular sieve chromatography, or affinity chromatography, among other conventional separation and purification methods well known to those skilled in the art.

[0168] The resulting monoclonal antibodies can be characterized by conventional means. For example, the binding specificity of the monoclonal antibodies can be determined by immunoprecipitation or in vitro binding assays such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).

[0169] Pharmaceutical composition

[0170] The present invention also provides a composition. Preferably, the composition is a pharmaceutical composition comprising the above-mentioned antibody, active fragment thereof, or fusion protein thereof, and a pharmaceutically acceptable carrier. Typically, these substances can be formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally about 5-8, preferably about 6-8, although the pH value may vary depending on the properties of the formulated substance and the condition to be treated. The formulated pharmaceutical composition can be administered by conventional routes, including (but not limited to): intratumoral, intraperitoneal, intravenous, or topical administration.

[0171] The pharmaceutical composition of the present invention can be used to directly bind to LGR4 protein molecules, and thus can be used to treat tumors or cancers. In addition, other therapeutic agents can also be used simultaneously.

[0172] The pharmaceutical composition of the present invention contains a safe and effective amount (such as 0.001-99wt%, preferably 0.01-90wt%, more preferably 0.1-80wt%) of the above-mentioned single-domain antibody of the present invention (or its conjugate) and a pharmaceutically acceptable carrier or excipient. Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical preparation should match the mode of administration. The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, by conventional methods using physiological saline or an aqueous solution containing glucose and other adjuvants. Pharmaceutical compositions such as injections and solutions are preferably manufactured under sterile conditions. The dosage of the active ingredient is a therapeutically effective amount, for example, about 10 micrograms / kg body weight to about 50 mg / kg body weight per day. In addition, the antibody or its active fragment or its fusion protein of the present invention can also be used with other therapeutic agents.

[0173] When using a pharmaceutical composition, a safe and effective amount of the immunoconjugate is administered to a mammal, wherein the safe and effective amount is generally at least about 10 μg / kg body weight, and in most cases does not exceed about 50 mg / kg body weight. Preferably, the dose is about 10 μg / kg body weight to about 10 mg / kg body weight. Of course, the specific dose should also take into account factors such as the route of administration and the patient's health status, which are all within the skill of a skilled physician.

[0174] Compared with the prior art, the advantages of the present invention are as follows:

[0175] 1. The present invention develops a specific nanoantibody NB21 targeting LGR4 and clarifies its role in blocking the binding of LGR4 to RSPO1 / 2, thereby inhibiting the Wnt signaling pathway.

[0176] 2. The present invention unexpectedly discovered that NB21 can enhance the thermogenesis of brown adipocytes and has anti-obesity biological effects.

[0177] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0178] Example 1. Construction and screening of nanobody phage display library

[0179] (1) Animal immunization: LGR4 antigen was mixed with Freund's adjuvant in a ratio of 1:1, and then immunized by subcutaneous injection at multiple points on the back of adult alpacas at a dose of 1 mg per time, for a total of 4 immunizations, with an immunization interval of 2 weeks.

[0180] (2) Extracting total RNA: 10 ml of peripheral blood from the immunized animal in step (1) was taken, and the peripheral blood was separated by density gradient centrifugation. 1 ml of peripheral blood from the immunized animal was taken, and total RNA was extracted, and the RNA concentration was adjusted to 1 μg / μl.

[0181] (3) Obtaining the antibody variable region gene: Reverse transcription of cDNA is performed using the RNA obtained in step (2) as a template. Amplification of the antibody variable region gene: The reverse transcribed cDNA is used as a template for polymerase chain reaction. Amplification is performed in two rounds. The primer sequences for the first round of polymerase chain reaction are as follows:

[0182] SEQ ID No.9: GTCCTGGCTGCTCTTCTACAAGG

[0183] SEQ ID No.10:GGTACGTGCTGTTGAACTGTTCC

[0184] The polymerase chain reaction conditions and procedure were as follows: 95°C for 5 minutes; 30 cycles of 95°C for 30 seconds, 57°C for 30 seconds, and 72°C for 30 seconds; and 72°C for 7 minutes. A band of approximately 700 bp was recovered using an agarose gel recovery kit, and the nucleic acid concentration was finally adjusted to 5 ng / μl with water.

[0185] The primer sequences for the second round of polymerase chain are as follows:

[0186] SEQ ID No.11: GATGTGCAGCTGCAGGAGTCTGGRGGAGG

[0187] SEQ ID No.12: CTAGTGCGGCCGCTGGAGACGGTGACCTGGGT

[0188] The polymerase chain reaction conditions and procedures were as follows: 95°C for 5 minutes; 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds, for 15 cycles; and 72°C for 7 minutes, followed by gel excision and recovery of the nanobody fragments using agarose gel.

[0189] (4) Vector construction and clone selection: pMECS vector was double-digested with endonucleases PstI and BstEII; the antibody fragment in step (3) was double-digested with PstI and BstEII; the antibody and vector fragments were ligated using T4 ligase. The purified ligation product was electroporated into E. coli TG1 competent cells, clones were randomly selected, and colony PCR was performed for identification. The library capacity was calculated based on the positive rate of polymerase chain reaction (library capacity = number of clones × dilution factor × [positive rate] PCR identification × 10). The PCR primer sequences are as follows:

[0190] SEQ ID No.13: TTATGCTTCCGGCTCGTATG

[0191] SEQ ID No.14: CCACAGACAGCCCTCATAG

[0192] (5) Phage screening of nanoantibodies: An appropriate amount of the bacterial library from step (4) was inoculated into a culture medium containing tetracycline and ampicillin, and helper phage M13KO7 was added for infection for 30 minutes. Kanamycin and isopropyl-β-D-thiogalactoside, thiogalactoside, isopropylthio-β-D-galactoside, isopropylthiogalactoside, and galactose were added, and the phage display library was obtained by precipitation with polyethylene glycol 8000 / sodium chloride and dissolution with phosphate buffer. The phage display library was coated with LGR4 antigen, blocked with 3% bovine serum albumin, and washed with phosphate buffer. 100 μL of phage was added, incubated at room temperature, washed with phosphate buffer, and the eluted phage was transfected with TG1 and then entered the next round of screening.

[0193] After three rounds of screening, the positive clones were verified using enzyme-linked immunosorbent assay, and finally one clone was selected from 22 clones and sequenced to obtain the nanobody NB21.

[0194] The amino acid sequence of Nanobody NB21 is as follows:

[0195] The encoding nucleic acid sequence of Nanobody NB21 is as follows:

[0196] The CDR sequences of the nanobody are shown in Table 1 below.

[0197] Table 1

[0198] Example 2 Expression, purification and affinity determination of LGR4 antibody

[0199] (1) Antibody expression: NB21 was cloned into the pMECS vector carrying a PeIB signal peptide, a C-terminal HA tag, and a His6 tag, and expressed in the periplasm of E. coli TOP10F' cells.

[0200] (2) Antibody purification: Ni-NTA was used for purification, and the treated samples were subjected to column treatment. The specific operation was as follows: After induction, the bacteria were lysed and the supernatant was collected. The bacterial lysate was diluted in equal times and loaded onto the column at a flow rate of 10 column volumes / hour, and the flow-through was collected. 15 column volumes of HEPES (pH 7.4), sodium chloride, 5% glycerol, and imidazole were used to wash away impurities, and 5 column volumes of HEPES (pH 7.4), sodium chloride, 5% glycerol, and imidazole were used for elution, and the eluate was collected.

[0201] (3) Antibody affinity determination: The StrepAvidin sensor was immersed in PBS buffer for 2 minutes to ensure a stable baseline signal. The biotinylated LGR4 was loaded onto the sensor and reacted at room temperature for 2 minutes until a stable binding response signal was achieved. After loading, the sensor was rinsed with washing buffer to remove unbound LGR4 molecules. Different concentrations of NB21 antibody (3.125nM to 100nM, diluted in the same reaction buffer) were added sequentially, and the binding response at each concentration was recorded for 1 minute, followed by dissociation. The bimolecular model (1:1) in Octet software was used for curve fitting, and the binding and dissociation curves at each concentration were analyzed to calculate the association rate constant, dissociation rate constant, and affinity constant.

[0202] The results showed that NB21 was screened from an established LGR4-targeting nanobody phage display library. This antibody exhibited significant inhibition against LGR4 in a TOPFlash assay (Figure 1a). Its binding kinetics were assessed by biolayer interferometry, revealing a binding affinity of 1.12 nM and competitive blocking of RSPO1 / 2 binding (Figure 1b). NB21 also exhibited a high affinity for mouse LGR4, with a KD of 0.82 ± 0.01 nM (Figures 1c-d).

[0203] Example 3 Structure of LGR4 Antibody-Stabilized LGR4 Complex

[0204] (1) LGR4 expression: Human LGR4 was expressed in HEK293GnTI- cells cultured in FreeStyle™ 293 medium.

[0205] (2) LGR4 purification: 1 μM NB21 was added to form a complex. After lysis, 1% lauryl maltose neopentyl glycol and 0.1% cholesterol hemisuccinate were added to the same buffer and dissolved at 4°C for 2 hours. The supernatant was collected and applied to an anti-dykdddddk affinity chromatography column. The column was washed with the same buffer, gradually reducing the detergent concentration to 0.02% LMNG and 0.002% CHS, and finally eluted with 20 mM HEPES (pH 7.4), 10 mM sodium chloride, 5% glycerol, 0.02% LMNG, 0.002% CHS and 0.2 mg / ml FLAG peptide. Size exclusion chromatography was used Superose TM 6. Perform final purification.

[0206] (3) LGR4 cryosample preparation: To prepare cryo-EM grids, 3 μl of purified complex at a concentration of 2-3 mg / mL was applied to freshly discharged 300-mesh R1.2 / R1.31.3 ultrafoil hole gold grids or ANTcryoTM Au300-1.2 / 1.3, frozen into liquid ethane using a Vitrorok IV (FEI Scientific), and cooled with liquid nitrogen.

[0207] (4) LGR4 cryo-EM data collection: 3885 images of LGR4-NB21 were collected on Titan Krios equipped with a K3 detector.

[0208] (5) LGR4 cryo-EM data processing: The dataset was imported into cryoSPARC v3.3.2 (Structural Biotechnology, Canada). The image stacks were aligned using the patch motion correction module. The contrast transfer function (CTF) parameters of each unweighted micrograph were determined by patch CTF estimation. Based on the CTF estimation results and relative ice thickness, high-quality micrographs were selected to ensure that the estimated CTF fitting resolution exceeded 4 Å for subsequent processing. A manual selector was used, followed by several rounds of 2D classification to generate a specific template for the subsequent automatic selection rounds. The automatically selected particles were extracted by two rounds of 2D classification. Subsequently, the good particles were selected for 3D ab initio reconstruction and several rounds of 3D non-uniform refinement to eliminate low-density classes. The selected good particles underwent additional steps including 3D ab initio reconstruction, uniform refinement, and non-uniform refinement to produce a model and high-quality particles. These particles were then subjected to global CTF refinement and local CTF refinement to generate the final map.

[0209] For the NB21-LGR4 complex, approximately 1,836,475 particles were selected. After 2D classification, particles with good characteristics were selected for 3D classification into five categories. Four categories of particles were combined and retained, and non-uniform refinement and CTF refinement were performed to obtain the NB21-LGR4 complex map with a final resolution of

[0210] Structural analysis showed that NB21 can block the binding of RSPO1 to LGR4 (Figure 2a-d). The extracellular domain (ECD) of LGR4 presents a unique horseshoe shape and contains 17 LRR (leucine-rich repeat) domains. The binding mode of NB21 to LGR4 is as follows (Figure 3a, b). The side chain of K31 of NB21 forms two salt bridges with D137 and D161 of LGR4 (also binding residues of RSPO1 / 2) (Figure 3c). In addition, K31 also forms a σ-π interaction with the aromatic ring of W159 of LGR4. At the same time, the phenolic hydroxyl group of Y32 of NB21 forms a hydrogen bond with D162 of LGR4 (Figure 3c). The aromatic ring of Y32 participates in π-π interactions with H157 of LGR4 and forms a hydrophobic interaction with W159 of LGR4 (Figure 3c). In addition, R100 of NB21 formed a salt bridge with E228 of LGR4, while S102 of NB21 formed two hydrogen bonds with D231 and N233 of LGR4 ( Figure 3 c).

[0211] Superposition of the LGR4-RSPO2(FU) complex with the LGR4-NB21 complex revealed that the binding epitope of NB21 overlaps with the binding site of RSPO1 / 2 on LGR4. This overlap effectively blocks the interaction between LGR4 and RSPO1 / 2, an interaction that is crucial for RSPO1 / 2 to bridge the gap between LGR4 and ZNRF3 / RNF43 to enhance Wnt signaling. Therefore, by disrupting this association, NB21 could theoretically lead to impaired Wnt signaling. Furthermore, these binding residues are identical in human and mouse LGR4, suggesting that NB21 may be a nanobody with cross-species reactivity.

[0212] Example 4 Effect of NB21-Fc fusion protein (NB21-mFc) on adipocyte SVF

[0213] To extend the half-life of NB21 and improve its bioavailability, NB21-mFc (NB21 fused to mouse IgG2) was designed and expressed and applied in in vitro and in vivo functional experiments.

[0214] (1) Single-cell sequencing and analysis: Single-cell RNA-seq matrix of mouse white adipose tissue was obtained from the Gene Expression Omnibus (GEO) database (GSE176171), and the data were processed using the Seurat v5.0.1 package in the R v4.3.2 programming environment.

[0215] (2) Isolation of SVF and differentiation of brown adipocytes: Mouse stromal vascular fractions (SVFs) were isolated from sWAT of 6-8 week old mice and subsequently induced to differentiate into brown adipocytes. The time was 0-2 days, and then growth medium containing insulin, T3 and rosiglitazone was added on days 3-4 according to experimental requirements. To evaluate the effect of NB21 on the browning process, NB21 was administered twice before and during the induction procedure on days -2 and 0, respectively. In the antagonistic experiment, recombinant human RSPO1 (4645-RS, R&D, USA) or RSPO2 (3266-RS, R&D, USA) protein was co-administered with NB21-mFc.

[0216] (3) Cell immunofluorescence staining: SVFs were cultured in 8-well glass chamber slides and treated with hRSPO1 (0.1 μg / ml) and / or NB21-mFc (0.1 μM) for 48 hours and fixed with 4% paraformaldehyde. SVFs were incubated with blocking solution to reduce nonspecific binding of antibodies and then incubated with non-phosphorylated (active) β-catenin (Ser33 / 37 / Thr41) primary antibody at 4°C overnight. After 48 hours, SVFs were incubated with Alexa Fluor 555-conjugated goat anti-rabbit IgG secondary antibody at room temperature for 120 minutes. Slides were then mounted with 4',6-diamidino-2-phenylindole (DAPI) blocking solution and imaged using a confocal microscope.

[0217] (4) RNA Isolation and qPCR Analysis: RNA was isolated from cells or adipose tissue using a total RNA extraction kit. Next, the isolated RNA was reverse transcribed into a cDNA template. The cDNA was measured by quantitative real-time PCR (qPCR).

[0218] (5) Protein preparation and WB experiment: Total protein was extracted from SVFs and adipose tissue using cold radioimmunoprecipitation reagent (RIPA) lysis buffer supplemented with a protease inhibitor cocktail, and the concentration of the extracted protein was determined. The protein samples were separated by SDS-PAGE and then transferred to a 0.45 μm PVDF membrane. The PVDF membrane was blocked with 5% bovine serum albumin (BSA) solution for 90 minutes and then incubated with the primary antibody at 4°C overnight. Incubation with HRP-conjugated secondary antibody was performed at room temperature for 90 minutes. HSP90 was used as an internal control. The following primary antibodies were used: non-phosphorylated (active) β-catenin (Ser45), non-phosphorylated (active) β-catenin (Ser33 / 37 / Thr41), total β-catenin, UCP1 antibody, and UQCRC2 & MTCO1 & NDUFB8. The following secondary antibodies were used: HRP-conjugated rabbit IgG and HRP-conjugated mouse IgG.

[0219] (6) OCR measurement: SVFs were plated on Seahorse XF96 V3 PS cell culture microplates coated with polylysine. Cells were induced to differentiate into brown adipocyte-like cells at 37°C for 3 days under exogenous RSPO1, RSPO2, or NB21 treatment from -2 to 2 days, and then the oxygen consumption rate (OCR) was assessed at 37°C. During the measurement, 1 μM oligomycin (to detect coupled respiration), 2 μM carbonyl cyanide-4-phenylhydrazine (FCCP; to assess uncoupled respiration), and 0.5 μM rotenone / antimycin (to measure non-mitochondrial respiration) were injected sequentially.

[0220] Germline-activating mutations in human RSPO1 and LGR4 partially inhibit the browning ability of white adipocytes through the canonical Wnt pathway, thereby promoting obesity. To assess the potential role of NB21 in this process, stromal vascular fractions (SVFs) of subcutaneous white adipose tissue (sWAT) were treated with human RSPO1 (hRSPO1) and / or NB21-mFc. The experiments showed that hRSPO1 treatment significantly increased the levels of activated (non-phosphorylated) and total β-catenin, an effect significantly attenuated by NB21-mFc (Figure 4a). Furthermore, NB21-mFc inhibited hRSPO1-induced nuclear β-catenin accumulation (Figure 4b) and attenuated its effect on the transcription of Axin2 (a marker of canonical Wnt pathway activation) and its downstream target genes, such as Wisp2, Tcf7l2, Nkd1, CyclinD1, c-Myc, and Id2 (Figure 4c).

[0221] Furthermore, RSPO2(FU) also activated the Wnt signaling pathway and inhibited the browning process of brown adipocytes. NB21, by blocking the shared binding site of RSPO1 / 2 on LGR4, inhibited RSPO1- or RSPO2(FU)-induced Wnt pathway activation and expression of thermogenic genes in brown adipocytes in a dose-dependent manner (Figures 4d-g).

[0222] The above results indicate that NB21-mFc can weaken the effects of RSPO1 / 2 on the Wnt signaling pathway and the expression of thermogenic genes in brown adipocytes.

[0223] Example 5 Effects of NB21-mFc on Obese Mice

[0224] (1) Mouse culture: Male and female mice were used in the study and were treated as described in the figure legends. For metabolic cage and acute cold exposure experiments, 8-week-old female C57BL / 6J mice were provided with a high-fat diet (HFD) and received intraperitoneal injections of PBS or NB21-mFc (0.1 mg / kg) once a day. For chronic cold stimulation, 8-week-old female C57BL / 6J mice received intraperitoneal injections of PBS or NB21-mFc (0.1 mg / kg) daily for 7 days in cages at 4°C. 8-week-old male and female wild-type (WT) and Lgr4m / m mice were provided with a high-fat diet (HFD) and received intraperitoneal injections of PBS or NB21 (0.2 mg / kg) every two days for 6 weeks. For HFD experiments, mice were provided with 60 kcal% HFD. Male ob / ob mice, 8 weeks old, were obtained from the Jackson Laboratory, provided with a normal chow diet (NCD), and received intraperitoneal injections of PBS or NB21 (0.03 mg / kg or 0.1 mg / kg) every two days for 7 weeks.

[0225] (2) Body composition analysis and indirect calorimetry: Body composition, including fat and lean mass, was measured using an Echo MRI-100H composition analyzer. To measure energy expenditure (EE), mice were individually housed in a comprehensive laboratory animal monitoring system (Promethion GAFR, Sable systems international, USA), and their food intake, O2 consumption, CO2 production, and physical activity were assessed either at 22°C or at 4°C. The respiratory exchange ratio (RER) and EE were calculated based on the O2 and CO2 data. EE, O2 consumption, and CO2 production were assessed by analysis of covariance (ANCOVA) with body weight as a covariate. After acclimation to room temperature (22°C) for 24 hours, basal EE data were collected, and then the cage temperature was lowered to 4°C, and data were collected over the next 4 hours.

[0226] (3) Rectal temperature measurement: Before testing, mice were fasted for 6 h and then transferred to individual cages at 4°C without food. Rectal temperature was measured using a petroleum jelly-coated thermal probe and a BAT-12 thermometer.

[0227] (4) H&E staining: Adipose and liver tissues were separated and fixed in 4% paraformaldehyde solution. After fixation, the tissues were embedded in paraffin and cut into 5 μm thick sections for hematoxylin and eosin (H&E) staining. Tissue sections were scanned using a Tissue FAXS system.

[0228] (5) Tissue Immunofluorescence Staining: Paraffin sections of mouse fat samples were sequentially immunostained with anti-UCP1 and anti-perilipin antibodies. CF-488-Tyramide and CF-594-Tyramide were used as tyramide conversion reagents. Antigen retrieval was performed using 1 mM Tris-EDTA solution, pH 9.0. Samples were blocked with DAPI. Whole-slide scanning was performed using the TissueFAXS Plus automated acquisition system.

[0229] 5.1 NB21-mFc Enhances Thermogenesis

[0230] Next, we evaluated whether NB21-mFc could enhance thermogenesis in vivo. Seven days after intraperitoneal injection of NB21-mFc (Figure 5a), ANCOVA analysis with body weight as a covariate revealed a significant increase in total energy expenditure (EE) in NB21-mFc-treated mice (Figure 5b), while no significant differences were observed in cumulative food intake, physical activity, or respiratory exchange ratio (RER) between the two groups.

[0231] Under acute cold exposure, NB21-mFc-treated mice exhibited higher EE and core temperature (Figure 5c, d). After 7 days of chronic cold exposure (Figure 5e), adipocyte volume was reduced in visceral white adipose tissue (vWAT), sWAT, and brown adipose tissue (BAT) in the NB21-mFc-treated group, accompanied by increased UCP1 protein expression in vWAT and sWAT (Figure 5f, i). Consistent with this, mRNA levels of thermogenic genes (such as Ucp1, Cidea, and Dio2) and mitochondrial respiratory genes (such as Pgc1α and Ndufa8) were significantly increased in adipose tissue in the NB21-mFc-treated group (Figure 5g, j). Furthermore, protein levels of UCP1 and mitochondrial respiratory chain complex proteins (including UQCRC2, MTCO1, and NDUFB8) were significantly increased in the NB21-mFc-treated group (Figure 5h, k).

[0232] The above results indicate that NB21-mFc can enhance the heat production and energy expenditure of mouse adipose tissue.

[0233] 5.2 The browning-promoting effect of NB21-mFc is dependent on LGR4

[0234] RSPO1 strongly inhibits fat browning by binding to LGR4, while the effective concentration of RSPO2 is approximately 20 times that of RSPO1, a result consistent with previous studies.

[0235] The changes in the expression of thermogenic genes and mitochondrial respiratory genes (Fig. 6a-c) and the changes in oxygen consumption capacity (Fig. 6d) showed that the neutralization effect of NB21-mFc on the inhibition of adipose browning by RSPO1-LGR4 complex was not observed in brown adipocytes lacking LGR4 (Lgr4 m / m These results suggest that NB21-mFc enhances adipose thermogenesis through an LGR4-dependent mechanism.

[0236] To further validate the ability of NB21-mFc to combat obesity in vivo, its potential weight loss effects were evaluated in a diet-induced obesity model. Eight-week-old female and male mice were intraperitoneally injected with NB21-mFc (0.2 mg / kg) or PBS every other day for 4-6 weeks while on a high-fat diet (HFD) (Figure 6e). Results showed that NB21-mFc significantly reduced body weight in wild-type (WT) female mice (Figure 6f), primarily attributable to a reduction in vWAT and sWAT (Figure 6g), accompanied by a decrease in adipocyte volume and enhanced staining of a browning marker (UCP1) (Figure 6h). Consistent with the in vitro results, NB21-mFc enhanced the expression of thermogenic and mitochondrial respiratory genes in vWAT and sWAT (Figures 6i, j). Similar, but weaker, changes were observed in BAT.

[0237] In addition to reducing diet-induced obesity, NB21-mFc also reduced hepatic lipid accumulation. Importantly, these browning-promoting and anti-obesity effects of NB21-mFc were abolished in Lgr4m / m littermates (Figure 6e-j).

[0238] Taken together, these findings suggest that NB21-mFc alleviates diet-induced obesity primarily by promoting LGR4-dependent thermogenesis.

[0239] This study not only provides new insights into the mechanism of action of LGR4 in obesity but also opens new avenues for the development of novel therapeutic drugs targeting LGR4. Compared with traditional small molecule drugs, nanobodies offer improved targeting, reduced off-target risk, and potentially longer half-lives in vivo, making them a promising safe and effective anti-obesity treatment.

[0240] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A nanobody targeting LGR4, characterized in that: The VHH chain of the Nanobody comprises a heavy chain variable region as shown in SEQ ID No: 7, and the complementarity determining regions CDR1, CDR2 and CDR3 comprised in the heavy chain variable region are defined by Chothia, Abm, Kabat, or IMGT rules.

2. The Nanobody according to claim 1, characterized in that The CDR1, CDR2 and CDR3 are selected from the following group: (a) CDR determined based on IMGT rules: The amino acid sequence of CDR1 is as shown in SEQ ID No: 1, The amino acid sequence of CDR2 is as shown in SEQ ID No: 2, and The amino acid sequence of CDR3 is as shown in SEQ ID No: 3; or (b) CDRs determined based on Kabat rules: The amino acid sequence of CDR1 is as shown in SEQ ID No: 4, The amino acid sequence of CDR2 is as shown in SEQ ID No: 5, and CDR3 having amino acids as shown in SEQ ID No:6; Among them, any one of the above amino acid sequences also includes a derivative sequence that is optionally subjected to addition, deletion, modification and / or substitution of at least one amino acid and can retain the LGR4 binding affinity.

3. An antibody targeting LGR4, characterized in that: Comprising the Nanobody targeting LGR4 as claimed in claim 1.

4. An isolated polynucleotide, characterized in that The polynucleotide encodes a nanobody targeting LGR4 as claimed in claim 1.

5. An expression vector, characterized in that: The expression vector contains the polynucleotide according to claim 4.

6. A host cell, characterized in that The host cell contains the expression vector according to claim 5, or the polynucleotide according to claim 4 is integrated into its genome.

7. An immunoconjugate, characterized in that: The immunoconjugate comprises: (a) a Nanobody targeting LGR4 as claimed in claim 1; and (b) a coupling moiety selected from the group consisting of fluorescein, a small molecule compound, PEG, a radioisotope, a contrast agent, a fatty acid chain, a protein fragment, a colored microsphere, a fluorescent microsphere, a polymer microsphere, a magnetic microsphere, agarose, dextran, cellulose, a filter membrane, or a combination thereof.

8. A fusion protein, characterized in that The fusion protein contains: (a) the Nanobody of claim 1 or 2; (b) Optional polypeptide molecules or fragments having therapeutic functions.

9. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises: (ii) the Nanobody targeting LGR4 according to claim 1 or 2, the antibody targeting LGR4 according to claim 3, the immunoconjugate according to claim 7, or the fusion protein according to claim 8; and (ii) a pharmaceutically acceptable carrier.

10. Use of the nanobody according to claim 1 or 2, the antibody according to claim 3, the immunoconjugate according to claim 7, or the fusion protein according to claim 8, characterized in that: Used for preparing anti-obesity drugs.

Citation Information

Patent Citations

  • Application of monoclonal antibody aiming at human LGR4

    CN118787739A

  • Antibodies that bind LGR4

    US20160046723A1

  • LGR4 specific monoclonal antibodies and methods of their use

    US20180369403A1

  • Monoclonal antibody against human GPR48 and application thereof

    WO2022166780A1