Compositions, methods, and systems for genomic editing

WO2025101994A3PCT designated stage expired Publication Date: 2025-07-10INTELLIA THERAPEUTICS INC
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/055256
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-04
Filing Date
2024-11-08
Publication Date
2025-07-10

AI Technical Summary

Technical Problem

Current methods for generating templated genomic edits are limited by the restriction of homology-directed repair (HDR) to actively dividing cells, making it inefficient for editing in non-dividing cells.

Method used

The use of a SpyCas9 nickase, DNA-dependent DNA polymerase, and template guide RNA (tgRNA) system, which includes a template sequence and a DNA-dependent DNA polymerase recruiting sequence (DRS), to facilitate templated genome editing without relying on the HDR pathway.

Benefits of technology

This system enables efficient and robust templated genome editing in both dividing and non-dividing cells, overcoming the limitations of traditional HDR-based methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024055256_10072025_PF_FP_ABST
    Figure US2024055256_10072025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure relates to compositions, methods, and systems for genomic editing. In certain aspects, the compositions, methods, and systems provided herein can incorporate a SpyCas9 nickase, a DNA-dependent DNA polymerase, and / or a template guide RNA for template-based genome editing applications.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITIONS, METHODS, AND SYSTEMS FOR GENOMIC EDITINGCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to US Provisional Application No. 63 / 598,064 filed November 10, 2023; US Provisional Application No. 63 / 660,308 filed June 14, 2024; US Provisional Application No. 63 / 694,651 filed September 13, 2024; and US Provisional Application No. 63 / 716,220 filed November 4, 2024, the content of each of which is herein incorporated by reference in its entirety.INTRODUCTION AND SUMMARY

[0002] The present disclosure relates to compositions, methods, and systems for genomic editing.

[0003] The ability to introduce precise and reproducible edits into the genome of a cell is of interest for gene editing and clinical therapeutic applications. The ability to generate a templated edit at a disease-associated locus — thereby replacing the endogenous, pathogenic sequence with a non-pathogenic, exogenous sequence — is therefore of great therapeutic interest.

[0004] CRISPR / Cas9 genome editing has been demonstrated to be highly efficient; however, it has been challenging to generate templated genomic edits. Conventional approaches for generating targeted genomic modifications often exploit the ability of the homology-directed repair (HDR) pathway to repair DNA breaks using a synthetic repair template comprising an insertion, deletion, or substitution. However, HDR is largely restricted to actively dividing cells, limiting its efficacy (Cox et al., Nature Medicine, 21:121-131 (2015). Thus, there is a need for a more robust and efficient approach for generating templated edits within the genome of a cell.

[0005] The methods provided herein comprise using a SpyCas9 nickase, DNA-dependent DNA polymerase, and template guide RNA (tgRNA) for template-based genome editing applications, providing substantial advantages over traditional methods.

[0006] In some aspects, the present disclosure provides a system comprising a DNA- dependent DNA polymerase (e.g., a T5 DNA polymerase or a PolK DNA polymerase), a SpyCas9 nickase (e.g., a SpyCas9 comprising a mutation in the HNH nuclease domain, e.g., a H840A substitution), and a template guide RNA (tgRNA) comprising a spacer, a scaffold, a template, and a DNA-dependent DNA polymerase recruiting sequence (DRS). In some embodiments, thesystem further comprises one or more accessory factors (e.g., nicking guide RNA (ngRNA), Fen1 or VPX). In some embodiments the system further comprises a chromatin remodeler (e.g., HMGB1). Such systems can be provided in a variety of configurations, as described herein. These components can be used in the compositions and methods described herein.

[0007] Accordingly, in some embodiments, the present disclosure provides for a system comprising a DNA-dependent DNA polymerase, a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS of the tgRNA comprises RNA nucleotides.

[0008] In some embodiments, the DRS of the tgRNA is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length. In some embodiments, the DRS of the tgRNA comprises DNA nucleotides. In some embodiments, the DRS of the tgRNA comprises both RNA nucleotide(s) and DNA nucleotide(s). In some embodiments, the DRS of the tgRNA comprises both DNA nucleotides and RNA nucleotides. In some embodiments, the DRS comprises at least one of: (1) a sequence not fully complementary to the DRS-complementary region of the non- target strand of the DNA duplex target nucleic acid; (2) a 1-5 nucleotide, optionally a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide; or (3) a 5’ terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage.

[0009] Iin some embodiments, the present disclosure provides for a system comprising a DNA-dependent DNA polymerase, a SpyCas9 nickase (nCas9), and a template guide RNA(tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises DNA nucleotides; and wherein the DRS comprises at least one of: (1) a sequence not fully complementary to the DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid; (2) a 1-5 nucleotide, optionally a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide; or (3) a 5’ terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage. In some embodiments, the DRS of the tgRNA is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length.

[0010] In some embodiments, the present disclosure provides for a system comprising a DNA-dependent DNA polymerase, a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and whereinthe DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides; and wherein the DRS comprises at least one of: (1) a sequence not fully complementary to the DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid; (2) a 1-5 nucleotide, optionally a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide; or (3) a 5’ terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage.

[0011] In some embodiments, the present disclosure provides for a system comprising a DNA polymerase kappa (polΚ), a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is about 6-18 nucleotides in length, optionally about 8-18 or 10-12 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS of the tgRNA comprises RNA nucleotides. In some embodiments, the DRS of the tgRNA comprises DNA nucleotides. In some embodiments, the DRS of the tgRNA comprises both RNA nucleotide(s) and DNA nucleotide(s).

[0012] In some embodiments, the present disclosure provides for a system comprising a DNA polymerase kappa (polΚ), a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) ascaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is about 6-18 nucleotides in length, optionally about 8-18 or 10-12 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides.

[0013] In some embodiments, the present disclosure provides for a system comprising a DNA polymerase kappa (polΚ), a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is about 6-18 nucleotides in length, optionally about 8-18 or 10-12 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises DNA nucleotides.

[0014] In some embodiments, the present disclosure provides for a system comprising a T5 DNA polymerase (T5 pol), a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide andcomprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length, and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid comprising nucleotides 5-105’ of the PAM in the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS of the tgRNA comprises DNA nucleotides. In some embodiments, the DRS of the tgRNA comprises both RNA nucleotide(s) and DNA nucleotide(s).

[0015] In some embodiments, the present disclosure provides for a system comprising a T5 DNA polymerase (T5 pol), a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length, and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid comprising nucleotides 5-105’ of the PAM in the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides.

[0016] In some embodiments, the present disclosure provides for a system comprising a T5 DNA polymerase (T5 pol), a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that iscomplementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length, and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid comprising nucleotides 5-105’ of the PAM in the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises DNA nucleotides.

[0017] In some embodiments, the present disclosure provides for a fusion polypeptide comprising a polΚ comprising GE411-412RV mutations (i.e., mutations at G411R and E412V) relative to SEQ ID NO: 1021 (referred to herein as “polK (GE411-412RV)”), a SpyCas9 nickase (nCas9), and a heterologous nuclear localization signal (NLS), or a nucleic acid encoding the fusion polypeptide.

[0018] In some embodiments, the present disclosure provides for a fusion polypeptide comprising a T5 DNA polymerase comprising D164A and E166A mutations relative to SEQ ID NO: 1021, a SpyCas9 nickase (nCas9), and a heterologous nuclear localization signal (NLS), or a nucleic acid encoding the fusion polypeptide.

[0019] In some embodiments, the present disclosure provides for a fusion polypeptide comprising a T5 DNA polymerase comprising D164A and E166A mutations relative to SEQ ID NO: 1116, a SpyCas9 nickase (nCas9), and a heterologous nuclear localization signal (NLS), or a nucleic acid encoding the fusion polypeptide.

[0020] In some embodiments, the present disclosure provides for a guide RNA comprising the sequence of GUUUUAGA(L3)AAGUUAAAAUAAGGCUAGUCCGUUAUCAC(L1)GGGCACCGAGUC GGUGCU (SEQ ID NO: 370), wherein L1 denotes that the linker is S18, and L3 denotes that the linker is S6.FIGURE LEGENDS

[0021] Fig. 1 shows the steps of template-based genomic editing by SpyCas9 nickase, DNA-dependent DNA polymerase, and a template guide RNA, including subsequent repair of the nick site.

[0022] Figs. 2A-2B show schematics of an exemplary template guide RNA complexed with a DNA duplex target nucleic acid indicated as being present in genomic DNA. The guide RNA spacer is complementary to the target strand of the DNA duplex target nucleic acid and the DNA polymerase recruiting sequence (DRS) is complementary to the non-target strand of the DNA duplex target nucleic acid at a site 5’ of the nick in the non-target strand of the DNA duplex target nucleic acid. The template sequence represents incorporation of two templated edits in the target nucleic acid.

[0023] Figs.3A-3D show exemplary systems for template-based genomic editing. Fig.3A shows an exemplary complex comprising (1) a fusion protein comprising a SpyCas9 nickase and DNA-dependent DNA polymerase, (2) a template guide RNA including the DNA polymerase recruiting sequence (DRS) and the template sequence encoding an edit, and (3) the target strand of the DNA duplex target nucleic acid complementary to the guide RNA spacer and the non-target strand of the DNA duplex target nucleic acid complementary to the DRS. Fig. 3B shows an exemplary complex comprising (1) a fusion protein comprising a SpyCas9 nickase, DNA- dependent DNA polymerase, and aptamer-binding domain (ABD), (2) an sgRNA, (3) a separable 3’ extension comprising a DRS, template sequence encoding an edit, and an aptamer, and (4) the target strand of the DNA duplex target nucleic acid complementary to the guide RNA spacer and the non-target strand of the DNA duplex target nucleic acid complementary to the DRS. Fig.3C shows an exemplary complex comprising (1) a SpyCas9 nickase, (2) a DNA-dependent DNA polymerase and ABD, (3) an sgRNA, (4) a separable 3’ extension comprising a DRS, template sequence encoding an edit, and an aptamer, and (5) the target strand of the DNA duplex target nucleic acid complementary to the guide RNA spacer and the non-target strand of the DNA duplex target nucleic acid complementary to the DRS.

[0024] Fig. 3D shows the steps of template-based genome editing in the presence of enhancers that (1) promote efficient DNA synthesis (indicated as “AF1”) and (2) mediate the removal of a flap 3’ of a nick (indicated as “AF2”).

[0025] Fig.4 shows a schematic of an exemplary 3’ extension. The MS2 aptamer sequence with the exemplary chemical modifications is a generic structure, whereas the template and DRS sequences are directed to a particular target site to generate a particular edit. RNA nucleotides are indicated in black text, DNA nucleotides are indicated in gray text, 2’-O-Me modified nucleotides are shown in circles and phosphorothioate (PS) linkages are shown with “*”.

[0026] Fig.5 shows a schematic of an exemplary template guide RNA. Dashed black lines indicate nucleotides that the upper stem portion may be shortened, while the arrow indicates nucleotides that may be replaced with an internal linker.

[0027] Fig.6A shows a spacer and a scaffold of an exemplary guide RNA (which may or may not further comprise a 3’ extension) with a first internal linker represented by the line between nucleotides 28 and 41; and a second internal linker represented by the line between nucleotides 69 and 80 (SEQ ID NO: 371). Nucleotide numbering is based on the exemplary SpyCas9 Guide RNA as shown in Table 5B (SEQ ID NO: 115).2’-O-Me modified nucleotides are shown in circles and phosphorothioate (PS) linkages are shown with “*”.

[0028] Fig. 6B shows a schematic of an exemplary template guide RNA (including the SpyCas9 guide RNA sequence of SEQ ID NO: 312). 2’-O-Me modified nucleotides are shown in circles and phosphorothioate (PS) linkages are shown with “*”.

[0029] Fig. 6C shows a schematic of an exemplary template guide RNA (including the SpyCas9 guide RNA sequence of SEQ ID NO: 434). 2’-O-Me modified nucleotides are shown in circles and phosphorothioate (PS) linkages are shown with “*”.

[0030] Fig. 6D shows a schematic of an exemplary template guide RNA (including the SpyCas9 guide RNA sequence of SEQ ID NO: 349). Black curved lines indicate an internal linker (S18 PEG linker) replacing nucleotides.2’-O-Me modified nucleotides are shown in circles and phosphorothioate (PS) linkages are shown with “*”.

[0031] Fig. 6E shows a schematic of an exemplary template guide RNA (including the SpyCas9 guide RNA sequence of SEQ ID NO: 348). Black curved lines indicate an internal linker (S18 PEG linker) replacing nucleotides.2’-O-Me modified nucleotides are shown in circles and phosphorothioate (PS) linkages are shown with “*”.

[0032] Fig. 6F shows a schematic of an exemplary template guide RNA (including the SpyCas9 guide RNA sequence of SEQ ID NO: 347). Black curved lines indicate an internal linker(S18 PEG linker) replacing nucleotides.2’-O-Me modified nucleotides are shown in circles and phosphorothioate (PS) linkages are shown with “*”.

[0033] Fig. 6G shows a schematic of an exemplary template guide RNA (including the SpyCas9 guide RNA sequence of SEQ ID NO: 438). Black curved lines indicate an internal linker (S18 PEG linker) replacing nucleotides.2’-O-Me modified nucleotides are shown in circles and phosphorothioate (PS) linkages are shown with “*”.

[0034] FIG.6H shows a schematic of an exemplary template guide RNA (including the SpyCas9 guide RNA sequence of SEQ ID NO: 320).2’-O-Me modified nucleotides are shown in circles, phosphorothioate (PS) linkages are shown with “*”, and 2’-F modified nucleotides are shown as “fN,” where “N” may be any nucleotide.

[0035] FIG. 6I shows a schematic of an exemplary template guide RNA (including the SpyCas9 guide RNA sequence of SEQ ID NO: 319).2’-O-Me modified nucleotides are shown in circles, phosphorothioate (PS) linkages are shown with “*”, and 2’-F modified nucleotides are shown as “fN,” where “N” may be any nucleotide.

[0036] Fig. 7 shows an exemplary nicking guide RNA (SEQ ID NO: 310). 2’-O-Me modified nucleotides are shown in circles and phosphorothioate (PS) linkages are shown with “*”.

[0037] Fig.8 shows the mean percent indels measured at the HEK3 locus for a guide RNA scaffold screen with SpyCas9 mRNA in Huh7 cells.

[0038] Fig. 9 shows editing at the VEGFA locus with sgRNA (G034491; SEQ ID NO: 482) and MS2-loop-linked 3’-extensions comprising various RNA / DNA compositions, in the absence of a nicking guide RNA (ngRNA).

[0039] Fig.10 shows editing at the VEGFA locus with sgRNA (G034491) and MS2-loop- linked 3’-extensions comprising various RNA / DNA compositions in the presence of ngRNA (G034622; SEQ ID NO: 527)

[0040] Fig.11 shows the mean percent indels at the HEK3 locus or at the VEGFA locus in Huh7 cells using SpyCas9 mRNA with a sgRNA (G033301 targeting HEK3 or G034491 targeting VEGFA) and MS2-loop-linked 3’-extensions encoding various edits.

[0041] Figs. 12A and 12B show the mean percent editing at the HEK3 locus or at the VEGFA locus in Huh7 cells using template based editing with nCas9-T5Pol(D164A,E166A)- MCP (FIG.12A) or MCP-PolK-nCas9 (Fig.12B).

[0042] Fig.13 shows the mean percent editing at the HEK3 locus or at the VEGFA locus as encoded by MS2-loop-linked 3’-extensions in Huh7 cells using MCP-PolK-nCas9 without an ngRNA.

[0043] Fig.14 shows the mean percent templated edits at the HEK3 locus or at the VEGFA locus as encoded by 3’-extensions in Huh7 cells using MCP-PolK-nCas9 in the presence of an ngRNA.

[0044] Fig.15 shows the percent indels at the HEK3 locus in Huh7 cells using SpyCas9 mRNA and a tgRNA with or without an ngRNA, wherein tgRNAs with varying numbers of 2’-O- methyl chemical modifications in the 3’-extension were used.

[0045] Fig. 16 shows the percent G-to-C editing at the HEK3 locus using tgRNAs comprising 3’ extensions with different DNA / RNA compositions, in the absence of ngRNA.

[0046] Fig. 17 shows the percent G-to-C editing at the HEK3 locus using tgRNAs comprising 3’ extensions with different DNA / RNA compositions, in the presence of ngRNA (G025992; SEQ ID NO: 481).

[0047] Fig. 18 shows G-to-C editing at the HEK3 locus in the absence of ngRNA (G025992) 3 days post LNP treatment with a guide RNA comprising a chimeric RNA / DNA 3’ extension and a mRNA encoding different nCas9-polymerase fusion proteins.

[0048] Fig. 19A shows G-to-C editing at the HEK3 locus in the absence of ngRNA (G025992) 6 days post LNP treatment with a guide RNA comprising a chimeric RNA / DNA 3’ extension and a mRNA encoding different nCas9-polymerase fusion proteins.

[0049] Fig. 19B shows G-to-C editing at the HEK3 locus in the presence of ngRNA (G025992) 3 days post LNP treatment with a guide RNA comprising a chimeric RNA / DNA 3’ extension and a mRNA encoding different nCas9-polymerase fusion proteins.

[0050] Fig. 20A shows G-to-C editing at the HEK3 locus in the presence of ngRNA (G025992) 6 days post LNP treatment with a guide RNA comprising a chimeric RNA / DNA 3’ extension and a mRNA encoding different nCas9-polymerase fusion proteins.

[0051] Fig. 20B shows G-to-C editing at the HEK3 locus in the absence of ngRNA (G025992) using MessengerMax™ delivery of a guide RNA comprising a chimeric RNA / DNA 3’ extension and a mRNA encoding different nCas9-polymerase fusion proteins.

[0052] Fig. 21 shows G-to-C editing at the HEK3 locus in the presence of ngRNA (G025992) using MessengerMax™ delivery of a guide RNA comprising a chimeric RNA / DNA 3’ extension and a mRNA encoding different nCas9-polymerase fusion proteins.

[0053] Fig. 22 shows G-to-C editing at the HEK3 locus in the absence of ngRNA, with DNA dependent polymerases using guides containing different DRS and template lengths.

[0054] Fig.23 shows G-to-C editing at the HEK3 locus in the presence of ngRNA, with DNA dependent polymerases using guides containing different DRS and template lengths.

[0055] Fig.24 shows the percentage of G-to-C editing at the HEK3 locus achieved with various ratios of mRNA to tgRNA.

[0056] Fig.25 shows the percent G-to-C editing at the HEK3 locus obtained with nCas9- DNA polymerase fusion proteins with different T5 variants and a tgRNA (G031157).

[0057] Fig. 26 shows the percent G-to-C editing at the HEK3 locus using nCas9-DNA polymerase fusion proteins with T5 variant moieties and a tgRNA (G031157) and a nicking guide RNA (G025992).

[0058] Fig. 27 shows the percent G-to-C editing at the HEK3 locus using nCas9-DNA polymerase fusion proteins with T5 variant moieties and guides with varied template and DRS lengths.

[0059] Fig. 28 shows template-based editing at the HEK3 locus in Huh7 cells using mRNAs encoding different nCas9-polymerase fusion proteins and guide RNAs with 3’ extension sequences composed of RNA and DNA bases.

[0060] Fig. 29 shows template-based editing at the HEK3 locus in Huh7 cells using mRNAs encoding different nCas9-polymerase fusion proteins and guide RNAs with 3’ extension sequences composed of RNA and DNA bases.

[0061] Fig. 30 shows template-based editing at the HEK3 locus in Huh7 cells using mRNAs encoding different nCas9-polymerase fusion proteins and guide RNAs with 3’ extension sequences composed of RNA and DNA bases

[0062] Fig. 31 shows template-based editing at the HEK3 locus in Huh7 cells using different combinations of tgRNAs and mRNAs encoding different nCas9-polymerase fusion proteins.

[0063] Fig. 32 shows editing efficiency at the HEK3 locus in Huh7 cells using mRNAs encoding different nCas9-polymerase fusion proteins and guide RNAs with hybrid RNA / DNA 3’ extensions having different template and DRS lengths.

[0064] Fig. 33 shows editing efficiency at the HEK3 locus in Huh7 cells using mRNAs encoding different nCas9-polymerase fusion proteins and guide RNAs with hybrid RNA / DNA 3’ extensions having different template and DRS lengths, in the presence of ngRNA.

[0065] Fig. 34 shows editing efficiency at the HEK3 locus in HEK293T cells using mRNAs encoding different nCas9-polymerase fusion proteins and guide RNAs with hybrid RNA / DNA 3’ extensions having different template and DRS lengths.

[0066] Fig. 35 shows editing efficiency at the HEK3 locus in HEK293T cells using mRNAs encoding different nCas9-polymerase fusion proteins and guide RNAs with hybrid RNA / DNA 3’ extensions having different template and DRS lengths, in the presence of ngRNA.

[0067] Fig. 36 shows template-based editing at the HEK3 locus in Huh7 cells using mRNAs encoding different nCas9-polymerase fusion proteins.

[0068] Fig. 37 shows template-based editing at the HEK3 locus in Huh7 cells using mRNAs encoding different nCas9-polymerase fusion proteins.

[0069] Figs.38A and 38B show template-based editing at the HEK3 locus in HEK293T cells using mRNAs encoding different nCas9-polymerase fusion proteins in the absence (Fig.38A) or presence (Fig.38B) of ngRNA.

[0070] Fig.39 shows template-based editing at the VEGFA locus in human CD34+ cells using different amounts of mRNA encoding nCas9-POLK (GE411-412RV), with or without a ngRNA.

[0071] Fig. 40 shows template-based editing at the HEK3 locus in Huh7 cells using mRNAs encoding different nCas9-polymerase fusion proteins and a guide RNA with a 3’ RNA extension.

[0072] Fig. 41 shows template-based editing at the VEGFA locus in Huh7 cells using mRNAs encoding different nCas9-polymerase fusion proteins and a guide RNA with a 3’ RNA extension.

[0073] Fig. 42 shows template-based editing at the VEGFA locus in primary human hepatocytes using mRNAs encoding different nCas9-polymerase fusion proteins and a guide RNA with a 3’ RNA extension.

[0074] Fig.43 shows templated G-to-C editing at the HEK3 locus in Huh7 cells using (1) mRNAs encoding different polymerase-aptamer binding domain (ABD) fusion proteins, (2) mRNAs encoding nCas9, (3) an sgRNA, and (4) a separable 3’ extension comprising an aptamer.

[0075] Fig.44 shows the percent indels at the HEK3 locus in Huh7 cells using (1) mRNAs encoding different polymerase-ABD fusion proteins, (2) mRNAs encoding nCas9, (3) an sgRNA, and (4) a separable 3’ extension comprising an aptamer.

[0076] Fig.45A shows the editing efficiency at the VEGFA locus in Huh7 treated with an mRNA encoding MCP-PolK-nCas9, an sgRNA, and a separable MS2-loop-linked 3’ extension encoding a point correction at various positions of the template, with or without an ngRNA.

[0077] Fig.45B shows the indel analysis at the VEGFA locus in Huh7 cells treated with SpyCas9 mRNA, a sgRNA, and a separable MS2-loop-linked 3’ extension encoding a point correction at various positions of the template.

[0078] Fig.46A shows editing efficiency at the VEGFA locus in Huh7 cells treated with an mRNA encoding MCP-PolK-nCas9, an sgRNA, and separable MS2-loop-linked 3’ extensions encoding insertion edits of various lengths, with or without ngRNA.

[0079] Fig.46B shows the indel analysis at the VEGFA locus in Huh7 cells treated with SpyCas9 mRNA, a sgRNA, and a separable MS2-loop-linked 3’ extension encoding insertion edits of various lengths.

[0080] Fig.47A shows editing efficiency at the VEGFA locus in Huh7 cells treated with an mRNA encoding MCP-PolK-nCas9, an sgRNA, and separable MS2-loop-linked 3’ extensions encoding deletion edits of various lengths, with or without ngRNA.

[0081] Fig.47B shows the indel analysis at the VEGFA locus in Huh7 cells treated with SpyCas9 mRNA, a sgRNA, and a separable MS2-loop-linked 3’ extension encoding deletion edits of various lengths.

[0082] Fig.48A shows templated editing at the VEGFA locus in Huh7 cells treated with an mRNA encoding MCP-PolK-nCas9, an sgRNA, and separable MS2-loop-linked 3’ extensions differing in the number and position of MS2 loops and internal linkers, with or without ngRNA.

[0083] Fig.48B shows the indel analysis at the VEGFA locus in Huh7 cells treated with SpyCas9 mRNA, a sgRNA, and a separable MS2-loop-linked 3’ extension differing in the number and position of MS2 loops and internal linkers.

[0084] Fig.49A shows editing efficiency at the VEGFA locus in Huh7 cells treated with an mRNA encoding MCP-PolK-nCas9, an sgRNA, and separable MS2-loop-linked 3’ extensions encoding the GAGG>CACT edit with an additional mismatch in the DRS at varying positions, with or without ngRNA.

[0085] Fig.49B shows the indel analysis at the VEGFA locus in Huh7 cells treated with an mRNA encoding SpyCas9, an sgRNA, and separable MS2-loop-linked 3’ extensions encoding the GAGG>CACT edit with an additional mismatch in the DRS at varying positions.

[0086] Fig.50 shows templated editing at the VEGFA locus in primary human hepatocytes treated with an nCas9-polymerase fusion protein, (2) chemically modified tgRNAs, and (3) Vpx.

[0087] Fig.51 shows the indel analysis at the VEGFA locus in primary human hepatocytes treated with SpyCas9, (2) chemically modified tgRNAs, and (3) Vpx.

[0088] Fig. 52 shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with an nCas9-polymerase fusion protein, (2) chemically modified tgRNAs, (3) Vpx, and (4) FEN1.

[0089] Fig.53 shows the indel analysis at the VEGFA locus in primary human hepatocytes treated with SpyCas9, (2) chemically modified tgRNAs, (3) Vpx, and (4) FEN1.

[0090] Fig. 54 shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with an nCas9-polymerase fusion protein, (2) a tgRNA, and (3) Vpx.

[0091] Fig. 55 shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with an nCas9-polymerase fusion protein, (2) a tgRNA and (3) FEN1.

[0092] Fig. 56 shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with an nCas9-polymerase fusion protein, (2) a tgRNA and (3) MLH1-dn.

[0093] Fig. 57 shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with an nCas9-polymerase fusion protein, (2) a tgRNA and (3) MLH1-NTD.

[0094] Fig. 58 shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with an nCas9-polymerase fusion protein, (2) a tgRNA, and (3) Vpx, FEN1, or a combination of Vpx and FEN1.

[0095] Fig. 59 shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with an nCas9-polymerase fusion protein, (2) a tgRNA, and (3) Vpx, FEN1, or a combination of Vpx and FEN1.

[0096] Fig.60 shows the editing efficiency at the VEGFA locus in Huh7 cells treated with an nCas9-polymerase fusion protein.

[0097] Fig. 61 shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with an nCas9-polymerase fusion protein.

[0098] Fig.62 shows templated editing at the VEGFA locus in primary human hepatocytes treated with one of hFEN1 or hFEN1 w / o heterologous NLS, in combination with nCas9- T5pol(v3).

[0099] Fig.63 shows templated editing at the VEGFA locus in primary human hepatocytes treated with one of hFEN1, cynoFEN1, or pictaFEN1, in combination with nCas9-T5pol(v3).

[0100] Fig.64 shows templated editing at the VEGFA locus in primary human hepatocytes treated with one of hFEN1, hFEN1-KI, or hFEN1-EI, in combination with one of nCas9- T5pol(v3), nCas9-T5-EI, or nCas9-T5-KI.

[0101] Fig.65 shows templated editing at the VEGFA locus in primary human hepatocytes treated with one of hFEN1, hFEN1-KI, or hFEN1-EI, along with one of nCas9-T5pol(v3), nCas9- T5-EI, or nCas9-T5-KI.

[0102] Fig. 66 shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with nCas9-T5pol(v3) in the presence of serial dilutions of hFEN1 and Vpx.

[0103] Fig. 67A shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with nCas9-T5-KI in the presence of serial dilutions of hFEN1-EI and Vpx.

[0104] Fig. 67B shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with nCas9-T5-EI in the presence of serial dilutions of hFEN1-KI and Vpx.

[0105] Fig. 68 shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with nCas9-T5pol(v3) in the presence of serial dilutions of hFEN1 and M97.

[0106] Fig. 69A shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with nCas9-T5-KI in the presence of hFEN1-EI and M97.

[0107] Fig. 69B shows the editing efficiency at the VEGFA locus in primary human hepatocytes treated with nCas9-T5-KI in the presence of hFEN1-EI and M97.

[0108] Fig.70 shows the editing at the VEGFA locus in primary human hepatocytes treated with an nCas9-polymerase fusion protein, Vpx and FEN1, and in huh7 cells treated with an nCas9- polymerase fusion protein and MLH1-dn.

[0109] Fig. 71A shows editing in 16HBE cells treated with SpyCas9 or a fusion protein comprising a SpyCas9 nickase moiety and a polymerase moiety.

[0110] Fig. 71B shows indel in 16HBE cells treated with SpyCas9 or a fusion protein comprising a SpyCas9 nickase moiety and a polymerase moiety.

[0111] Figs.72A and 72B show editing using guides designs varying the position, number and chemical modifications on or surrounding the MS2-loop feature treated with the MCP-PolK- nCas9 or nCas9-T5Pol(D164A,E166A)-MCP construct, respectively.

[0112] Figs. 73A and 73B show editing using guide designs varying the number of phosphorothioate bonds treated with the MCP-PolK-nCas9 or nCas9-T5Pol(D164A,E166A)-MCP construct, respectively.

[0113] Figs. 74A and 74B show editing using guide designs varying the position of phosphorothioate bonds treated with the MCP-PolK-nCas9 or nCas9-T5Pol(D164A,E166A)-MCP construct, respectively.

[0114] Figs. 75A and 75B show editing using guide designs with varying number of nucleotides with a 2’ O-methyl modification treated with the MCP-PolK-nCas9 or nCas9- T5Pol(D164A,E166A)-MCP construct, respectively.

[0115] Figs.76A and 76B show editing using guide designs varying the position of 2’ O- methyl modification treated with the MCP-PolK-nCas9 or nCas9-T5Pol(D164A,E166A)-MCP construct, respectively.

[0116] Figs. 77A and 77B show editing using guide designs incorporating deoxynucleotides at various positions relative to the template:DRS junction treated with the MCP- PolK-nCas9 or nCas9-T5Pol(D164A,E166A)-MCP construct, respectively.

[0117] Figs.78A and 78B show editing using guide designs with varying template lengths, varying DRS lengths, or the incorporation of deoxyuracil at select positions treated with the MCP- PolK-nCas9 or nCas9-T5Pol(D164A,E166A)-MCP construct, respectively.

[0118] Figs.79A-79C show editing at the VEGFA locus using various guide designs with nCas9-T5Pol (D164A,E166A) (Fig.79A), nCas9-polK (Fig.79B), and SpyCas9 (Fig.79C).

[0119] Figs.80A-80B show templated editing at the TTR locus in PCH cells treated with nCas9-T5pol(v3) and a tgRNA (G037455) in the presence or absence of HIV-Vpx-1, SIV-Vpx, M97, or MLH1 (Fig.80A), or huFEN1 or cynoFEN1 (Fig.80B).

[0120] Fig.81 shows templated editing at the TTR locus in PCH cells treated with a tgRNA (G037455), nCas9-T5pol(v3) or nCas9-T5-EI, and FEN1 or FEN1-KI.

[0121] Fig.82 shows templated editing at the TTR locus in PCH cells treated with nCas9- T5pol(v2), FEN1 and Vpx, and different concentrations of a tgRNA (G037455).

[0122] Fig.83 shows templated editing at the DNMT1 locus in mice treated with an mRNA encoding nCas9-PolK(1-526, GE411-412RV), a ngRNA (G035722), and a tgRNA (G034987; SEQ ID NO: 427), delivered via LNPs with different formulations.

[0123] Fig.84 shows a Western blot of rat liver protein lysates immunostained with anti- SpyCas9 antibodies. Liver tissue was collected 2.5 hours after in vivo delivery in trans of an mRNA encoding a SpyCas9 nickase fused to a split intein, and an mRNA encoding a polymerase fused to a complementary split intein.

[0124] Fig.85A shows editing at the TTR locus in PCH treated with a tgRNA (G036237; SEQ ID NO: 477), along with nCas9-PolK(1-526, GE411-412RV), or a combination of nCas9- CfaN and Cfa-PolK(1-526, GE411-412RV), in the presence of Vpx.

[0125] Fig.85B shows editing at the TTR locus in PCH treated with a tgRNA (G036237), along with nCas9-T5pol(v4), or a combination of nCas9-CfaN and Cfa-T5pol(v4), in the presence of Vpx.

[0126] Fig.86 shows templated editing at the DNMT1 locus in PMH treated with a tgRNA (G034987), along with nCas9-PolK(1-526, GE411-412RV) or a combination of nCas9-CfaN and Cfa-PolK(1-526, GE411-412RV) in a nCas9-CfaN:CfaC-PolK(1-526, GE411-412RV) mass ratio of 5:1, 3:1, 1:1, or 1:3.

[0127] Fig.87shows templated editing at the DNMT1 locus in PMH treated with a tgRNA (G034987), along with (i) nCas9-T5(D164A, E166A), (ii) a combination of nCas9-CfaN and CfaC-L30(SV40)-T5(D164A, E166A) in a 5:1 or 1:1 mass ratio, or (iii) a combination of nCas9- CfaN and CfaC-L49(SV40)-T5(D164A, E166A) in a 5:1 or 1:1 mass ratio.

[0128] Figs.88A and 88B show editing at the TTR locus in PCH treated with a tgRNA (G039268), along with (i) nCas9-PolKv2, (ii) nCas9-T5(D164A, E166A, (iii) a combination of nCas9-CfaN and Cfa-PolK(1-526, GE411-412RV) at a 5:1 mass ratio, (iv) a combination of Spy(2- 713)-CfaN with either one of CfaC-Spy(714-1368)-PolKvariant or CfaC-Spy(714-1368)- T5polvariant, at a 1:1 mass ratio, or (v) a combination of HMGB1dT-Spy(2-713)-CfaN and CfaC- Spy(714-1368)-PolKvariant at a 1:1 mass ratio, in the presence of Vpx. In the context of Fig.88,“HMGB1dt” indicates an HMGB1 polypeptide comprising the HMGB1 Box A domain and Box B domain and lacking an acidic tail domain (“HMGB1_dTail”).

[0129] Fig.89 shows templated editing at the DNMT1 locus in mice treated with a fusion protein comprising a nCas9 moiety and a polymerase Kappa variant moiety, or a combination of a nCas9-CfaN fusion protein and a CfaC-PolK(1-526, GE411-412RV), along with a tgRNA (G034987), and a ngRNA (G035727; SEQ ID NO: 428).

[0130] Fig. 90 shows editing efficiencies at the DNMT1 locus in mice treated with a combination of a nCas9-CfaN fusion protein and a CfaC-PolK(1-526, GE411-412RV), along with a tgRNA (G034987), and a ngRNA (G035727).

[0131] Fig. 91 shows editing efficiencies obtained at the VEGFA locus in PHH treated with a tgRNA (G032596; SEQ ID NO: 417), along with split intein constructs comprising a nCas9 and a polymerase delivered in trans, with editing enhancers delivered in trans or in cis with the split intein constructs.

[0132] Fig.92 shows editing efficiencies obtained at the TTR locus in PCH treated with tgRNA (G039267) and a ngRNA (G032630), along with split intein constructs comprising a nCas9 and a polymerase delivered in trans, with editing enhancers delivered in trans or in cis with the split intein constructs.

[0133] Fig. 93 shows editing efficiencies obtained at the VEGFA locus in PHH treated with a tgRNA (G032596), along with split intein constructs comprising a nCas9 fused with an HMGB1 polypeptide, and a polymerase delivered in trans, with editing enhancers delivered in trans or in cis with the split intein constructs. In the context of Fig.93, “HMGB1dt” indicates an HMGB1 polypeptide comprising the HMGB1 Box A domain and Box B domain and lacking an acidic tail domain (alternatively referred elsewhere herein as “HMGB1_dTail”).

[0134] Fig.94 shows editing efficiencies obtained at the TTR locus in PCH treated with a tgRNA (G039267) and a ngRNA (G032630), along with split intein constructs comprising a nCas9 fused with a HMGB1 polypeptide and a polymerase delivered in trans, with editing enhancers delivered in trans or in cis with the split intein constructs. In the context of Fig.94, “HMGB1dt” indicates an HMGB1 polypeptide comprising the HMGB1 Box A domain and Box B domain and lacking an acidic tail domain (“HMGB1_dTail”).

[0135] Figs. 95A and B shows templated editing at the HEK3 locus in PHH for cells treated with G032574 (SEQ ID NO: 528), along with nCas9-PolK(1-526, GE411-412RV) ,HMGB1dT-nCas9-PolK(1-526, GE411-412RV) , nCas9-T5pol(v2), or HMGB1dT- nCas9- T5pol(v2) , in the absence or presence of Vpx. In the context of Fig.95, “HMGB1dt” indicates an HMGB1 polypeptide comprising the HMGB1 Box A domain and Box B domain and lacking an acidic tail domain (“HMGB1_dTail”).

[0136] Fig.96 shows templated editing at the VEGFA locus in huh7 cells treated with a mRNA encoding a nCas9-polymerase fusion protein selected from nCas9-PolKv2, nCas9- T5(WT), or nCas9-T5(D164A, E166A), and with tgRNAs encoding a GAGG-to-CACT edit, and comprising different dNTP / rNTP compositions at the template:DRS junction.

[0137] Figs.97A and B shows editing at the VEGFA locus in huh7 cells treated with a mRNA encoding a nCas9-polymerase fusion (nCas9-PolKv2 or nCas9-T5(D164A, E166A)) and with tgRNAs encoding a GAGG-to-CACT edit, and comprising different dNTP / rNTP compositions in the DRS region.

[0138] Fig. 98 shows editing at the VEGFA locus in huh7 cells treated with a mRNA encoding a nCas9-polymerase fusion (nCas9-PolKv2 or nCas9-T5(D164A, E166A)) and with tgRNAs encoding a GAGG-to-CACT edit, and comprising different dNTP / rNTP compositions and 2’Ome modifications in the spacer sequence.

[0139] Fig. 99 shows editing at the VEGFA locus in huh7 cells treated with a mRNA encoding a nCas9-polymerase fusion protein selected from nCas9-PolKv2, nCas9-T5(WT), or nCas9-T5(D164A, E166A), and with tgRNAs encoding a GAGG-to-CACT edit, and comprising different dNTP / rNTP compositions in the DRS region, and various modifications of the nucleotides in the spacer region.

[0140] Figs.100A and B show the editing results at the VEGFA locus in PHH treated with tgRNAs comprising different dNTP / rNTP compositions at the template:DRS junction, along with nCas9-PolKv2 (FIG.100A) or nCas9-T5(D164A, E166A) (FIG.100B).

[0141] Figs.101A and B show the editing results at the VEGFA locus in PHH treated with tgRNAs comprising different dNTP / rNTP compositions in the DRS region, along with nCas9- PolKv2 (FIG.101A) or nCas9-T5(D164A, E166A) (FIG.101B).

[0142] Figs.102A and B show the editing results at the VEGFA locus in PHH treated with tgRNAs comprising different dNTP / rNTP compositions and 2’Ome modifications in the spacer sequence, along with nCas9-PolKv2 (FIG.102A) or nCas9-T5(D164A, E166A) (FIG.102B).

[0143] Figs. 103A-103B show templated editing at the TTR locus in PCH treated with nCas9-T5pol(v3) or nCas9-PolK(1-526, GE411-412RV) , in the presence of Vpx and FEN-1, and with tgRNAs designed with the scaffold structure shown in Fig.6F, and with different template lengths.

[0144] Fig.104 shows editing at the TTR locus in PCH treated with nCas9-T5pol(v2), in the presence of Vpx and FEN-1, and with tgRNAs designed with the scaffold structure shown in Fig.6F, and with different template lengths.

[0145] Figs. 105A-105B show templated editing at the TTR locus in PCH treated with nCas9-T5pol(v2) or nCas9-PolK(1-526, GE411-412RV), in the presence of Vpx and FEN-1, and with tgRNAs designed with the scaffold structure shown in Fig.6F, and with different template lengths.

[0146] Fig.106A shows a one-site guide ligation approach to produce a tgRNA by ligating two split fragments of the desired final tgRNA product.

[0147] Fig.106B shows a one-step two-site guide ligation approach to produce a tgRNA by ligating three split fragments of the desired final tgRNA product.

[0148] Fig.106C shows a one-step two-site guide ligation approach compared to a one- site guide ligation approach for the same 179-nt desired ligated tgRNA product (LS = ligation site). RNA nucleotides are indicated in black text, DNA nucleotides are indicated in gray text, 2’- O-Me modified nucleotides are shown in circles and phosphorothioate (PS) linkages are shown with “*”

[0149] Fig.107 shows a gel analysis of the elute mix from one batch following purification by precipitation.

[0150] Fig. 108 shows a UPLC-UV chromatogram of the elute batches obtained after purification by precipitation.

[0151] Fig. 109 shows a UPLC-UV chromatogram of the final ligated tgRNA product following RP-HPLC purification.

[0152] Fig.110 shows gel analysis of the resuspended solution following purification by precipitation.

[0153] Fig. 111 shows a UPLC-UV chromatogram obtained after purification by precipitation.

[0154] Fig.112 shows an HPLC-UV chromatogram showing the fractionation and sample pools obtained during the purification of the ligated tgRNA product (FLP).

[0155] Fig 113 shows a UPLC-UV chromatogram of the final ligated tgRNA product after purification by HPLC.

[0156] Fig.114 shows a gel analysis of the resuspended solution following purification by precipitation.

[0157] Fig. 115 shows a UPLC-UV chromatogram obtained after purification by precipitation.

[0158] Fig.116 shows an HPLC-UV chromatogram showing the fractionation and sample pools obtained during the purification of the ligated tgRNA product (FLP).

[0159] Fig.117 shows a UPLC-UV chromatogram of the final ligated tgRNA product after purification by HPLC.

[0160] Fig.118 shows a structure of wild-type HMGB1, including various domains therein.

[0161] Fig. 119 shows domains of exemplary fusion proteins comprising an HMGB1 polypeptide and a programmable DNA-binding protein domain. In the context of Fig.114, “DNA binding domain” refers to a SpyCas9 nickase.

[0162] Fig.120 shows domains of exemplary fusion proteins described herein. DETAILED DESCRIPTION

[0163] The present disclosure provides, e.g., compositions, methods, and systems for template-based genome editing. In some embodiments, the compositions, methods, and systems provide for generating templated insertions, deletions, or substitutions within the genome of a cell without the involvement of the HDR pathway.

[0164] In some embodiments, the compositions, methods, and systems disclosed herein comprise a SpyCas9 nickase, DNA-dependent DNA polymerase, and template guide RNA (tgRNA).

[0165] Without being bound by theory, an exemplary tgRNA according to the present disclosure may comprise a SpyCas9 guide RNA that is capable of binding to the SpyCas9 nickase (via a scaffold sequence) and a target region of a target strand of a DNA duplex target nucleic acid (via a spacer sequence) (see, e.g., Fig.1 (top panel)). The SpyCas9 guide RNA thereby facilitates binding of the SpyCas9 nickase to the target region. The SpyCas9 nickase preferably comprises asubstitution in the HNH nuclease domain (e.g., a H840A substitution). Once bound to the target region, the SpyCas9 nickase may generate a nick in a non-target strand of the DNA duplex target nucleic acid. The nicked strand of the DNA duplex target nucleic acid may comprise a flap 5’ of the nick (the 3’ end flap) and a flap 3’ of the nick (the 5’ end flap) (see Figs.2A and 2B, which show the 3’ end of the flap 5’ of the nick and the 5’ end of the flap 3’ of the nick).

[0166] An exemplary tgRNA according to the present disclosure may further comprise a 3’ extension comprising (from 5’ to 3’) a template sequence and a DNA polymerase-recruiting sequence (DRS). The DRS may be designed to hybridize to the 3’ end of the flap 5’ of the nick in the non-target strand of the DNA duplex target nucleic acid, thereby forming a duplex (see, e.g., Figs.1 (top panel), 2A, and 2B). Subsequently, the DNA-dependent DNA polymerase may bind to the duplex formed by the DRS and 3’ end of the flap 5’ of the nick. The 3’ end of the flap 5’ of the nick may serve as a primer for synthesis of a new DNA strand that is complementary to the template sequence. The template sequence may include one or more of an insertion, deletion, or substitution (e.g., a transition or a transversion) relative to an endogenous nucleotide sequence. For example, Figs. 2A and 2B show an exemplary template comprising a two-nucleotide substitution relative to the endogenous nucleotide sequence. Following DNA synthesis, the newly synthesized DNA strand may include one or more of an insertion, deletion, or substitution relative to the endogenous nucleotide sequence (see Fig. 1, which shows the newly synthesized DNA strand with an edit relative to the endogenous DNA sequence). As shown in Fig.1 (bottom panel), the newly synthesized DNA strand and the flap 3’ of the nick may competitively bind to the target strand. The flap 3’ of the nick may be excised, for example by FEN1 or EXO1, and the newly synthesized DNA strand may anneal to the target strand. Subsequent mismatch repair may result in either (1) repair of the unedited strand using the newly synthesized DNA strand, thereby incorporating the insertion, deletion, or substitution into the genomic sequence; or (2) repair of the edited strand using the unedited strand, thereby preserving the original sequence.

[0167] As shown in Fig.3D, the compositions and methods provided herein further may comprise one or more enhancers of template-based genome editing. In some embodiments, such enhancers may promote DNA synthesis by increasing the concentration of dNTPs within the cell, e.g., by inhibiting a deoxynucleotide triphosphohydrolase protein (see AF1 in Fig.3D). In some embodiments, such enhancers may promote the hybridization of the newly synthesized DNA strand and the target strand. For example, DNA repair proteins may remove the flap 3’ of the nick(see AF2 in Fig.3D). Removal of the flap 3’ of the nick may promote hybridization of the newly synthesized DNA strand to the target strand of the DNA duplex target nucleic acid.

[0168] Compositions comprising (1) a SpyCas9 nickase, (2) an RNA-dependent DNA polymerase (e.g., a reverse transcriptase), and (3) a guide RNA comprising an RNA-based template sequence have previously been shown to install templated edits into genomic sequences. However, such compositions and methods can produce unintended genetic modifications. Thus, the utility of such compositions and methods is currently limited. For example, after synthesizing a new DNA strand that is complementary to the template sequence, RNA-dependent DNA polymerases may continue DNA synthesis, using the scaffold of the SpyCas9 guide RNA as a template and thereby creating unintended modifications whereby a portion of the scaffold sequence is inadvertently incorporated into the DNA. Accordingly, there is a need for compositions and methods that do not run the risk of incorporating the SpyCas9 guide RNA scaffold sequence into the newly sequenced DNA strand.

[0169] Exemplary compositions according to the present disclosure comprise DNA- dependent DNA polymerases instead of RNA-dependent DNA polymerases. DNA-dependent DNA polymerases such as T5 polymerase and PolK polymerase have a strong preference for DNA templates, and may therefore exhibit a reduced propensity to continue DNA synthesis past a DNA- RNA boundary, such as the boundary between a template sequence comprising a plurality of DNA nucleotides and a SpyCas9 guide RNA scaffold sequence comprising RNA nucleotides.

[0170] Additionally, there is a need for enzymes (e.g., SpyCas9 nickases and DNA- dependent DNA polymerases) with robust templated editing activity at physiological temperatures, e.g., 37°C. Additionally, the production or synthesis of sufficiently pure polynucleotides (e.g., tgRNAs) over 110 nucleotides in length has proved challenging. Thus, there is a need for methods of producing or synthesizing such polynucleotides.

[0171] In some embodiments, the present disclosure provides for a system comprising a DNA-dependent DNA polymerase, a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary toat least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS of the tgRNA comprises DNA nucleotides. In some embodiments, the DRS of the tgRNA comprises both RNA nucleotide(s) and DNA nucleotide(s).

[0172] In some embodiments, the present disclosure provides for a system comprising a DNA-dependent DNA polymerase, a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid, the DRS comprises DNA nucleotides; and wherein the DRS comprises at least one of: (1) a sequence not fully complementary to the DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid; (2) a 1-5 nucleotide, optionally a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide; or (3) a 5’ terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage.

[0173] In some embodiments, the present disclosure provides for a system comprising a DNA-dependent DNA polymerase, a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides; and wherein the DRS comprises at least one of: (1) a sequence not fully complementary to the DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid; (2) a 1-5 nucleotide, optionally a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide; or (3) a 5’ terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage.

[0174] In some embodiments, the present disclosure provides for a system comprising a DNA polymerase kappa (polΚ), a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is about 6-18 nucleotidesin length, optionally about 8-18 or 10-12 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS of the tgRNA comprises DNA nucleotides. In some embodiments, the DRS of the tgRNA comprises both RNA nucleotide(s) and DNA nucleotide(s).

[0175] In some embodiments, the present disclosure provides for a system comprising a DNA polymerase kappa (polΚ), a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is about 6-18 nucleotides in length, optionally about 8-18 or 10-12 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides.

[0176] In some embodiments, the present disclosure provides for a system comprising a T5 DNA polymerase (T5 pol), a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides inlength, optionally 6-17 or 10-14 nucleotides in length, and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid comprising nucleotides 5-105’ of the PAM in the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS of the tgRNA comprises DNA nucleotides. In some embodiments, the DRS of the tgRNA comprises both RNA nucleotide(s) and DNA nucleotide(s).

[0177] In some embodiments, the present disclosure provides for a system comprising a T5 DNA polymerase (T5 pol), a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length, and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid comprising nucleotides 5-105’ of the PAM in the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides..

[0178] In some embodiments, the first polynucleotide and the second polynucleotide are covalently linked. In some embodiments, the first polynucleotide and the second polynucleotide are not covalently linked. In some embodiments, the template guide RNA further comprises an affinity tag, wherein the first polynucleotide or the second polynucleotide are bound to a peptide or a peptide complex comprising a SpyCas9 nickase, and a DNA-dependent DNA polymerase by the affinity tag.

[0179] In some embodiments, the composition further comprises a SpyCas9 nickase. In some embodiments, the scaffold of the SpyCas9 guide RNA binds to a SpyCas9 nickase. In someembodiments, the SpyCas9 nickase generates a nick on the same strand of the DNA duplex target nucleic acid as a nickase comprising an H840A mutation, i.e., the SpyCas9 nickase cleaves the strand of the DNA duplex target nucleic acid opposite to the strand of the DNA duplex target nucleic acid that hybridizes to the spacer (i.e., the nickase cleaves the non-target strand of the DNA duplex target nucleic acid). In some embodiments, the SpyCas9 nickase generates a nick on the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the SpyCas9 nickase comprises a catalytically inactive HNH domain. In some embodiments, the SpyCas9 nickase comprises a D839K, D839Q, D839N, D839A, H840S, H840T, H840Q, H840D, H840R, H840K, H840Y, H840N, N863S, N863T, N863A, N863E, or K866A mutation within its HNH- like nuclease domain. In some embodiments, the SpyCas9 nickase comprises an H840A point mutation. Throughout the present disclosure, it is to be understood that, when the term “point mutation” is used in the context of an amino acid sequence, it refers to a substitution of a single amino acid residue in the amino acid sequence.

[0180] In some embodiments, the composition further comprises a DNA-dependent DNA polymerase. In some embodiments, the DRS bound to the non-target strand of the DNA duplex target nucleic acid forms a binding site for DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a eukaryotic DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a mammalian DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a human DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a cynomolgus DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a mouse DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a bacterial DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises an E. coli DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a viral DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a phage DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises human DNA polymerase K, cynomolgus DNA polymerase K, mouse DNA polymerase K, human DNA polymerase θ, human DNA polymerase Ν, E. coli DNA polymerase I, phage T5 DNA polymerase, or phage Phi29 DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises human DNApolymerase K. In some embodiments, the DNA-dependent DNA polymerase comprises phage T5 DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase does not comprise phage Phi29 DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a point mutation(s) or deletion(s). In some embodiments, the DNA- dependent DNA polymerase comprises a point mutation(s) or deletion(s) within an exonuclease domain. In some embodiments, the point mutation(s) or deletion(s) within the exonuclease domain abolishes exonuclease activity.

[0181] In some embodiments, the SpyCas9 nickase is operably linked to the DNA- dependent DNA polymerase. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase comprise a single polypeptide. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase comprise a single polypeptide expressed from a single open reading frame (ORF). In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase comprise a single polypeptide expressed from separate open reading frames (ORFs). In some embodiments, wherein the SpyCas9 nickase and DNA-dependent DNA polymerase comprise a single polypeptide expressed from separate open reading frames (ORFs), the ORF encoding the SpyCas9 nickase can further encode a first intein and the ORF encoding the DNA- dependent DNA polymerase can further encode a second intein capable of binding the first intein (z.e. participating in a trans-splicing reaction with the first intein). In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase are provided as separate polypeptides. In some embodiments, wherein the SpyCas9 nickase and DNA-dependent DNA polymerase comprise a single polypeptide expressed form separate open reading frames (ORFs), the ORF encoding the SpyCas9 nickase can further encode a first intein and the ORF encoding the DNA- dependent DNA polymerase can further encode a second intein capable of binding the first intein (z.e. participating in a trans-splicing reaction with the first intein). In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase are provided as separate polypeptides. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase directly interact through non-covalent interactions. In some embodiments, the SpyCas9 nickase and DNA- dependent DNA polymerase do not directly interact. As a first example, in some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase may both non-covalently bind a single polynucleotide such as a template guide RNA. As a second example, in some embodiments, the SpyCas9 nickase may bind a first polynucleotide comprising a guide RNA and the DNA-dependent DNA polymerase may bind a second polynucleotide comprising a separable 3’ extension, wherein the first and second polynucleotides target the SpyCas9 nickase and DNA- dependent DNA polymerase to proximal genomic loci.

[0182] In some embodiments, the composition comprises (a) a single polypeptide comprising a SpyCas9 nickase and a DNA-dependent DNA polymerase; and (b) a single polynucleotide comprising, from 5’ to 3’, (i) a SpyCas9 guide RNA comprising a spacer and a scaffold; and (ii) a template sequence and a DRS.

[0183] In some embodiments, the composition comprises (a) a single polypeptide comprising a SpyCas9 nickase and a DNA-dependent DNA polymerase; (b) a first polynucleotide comprising a SpyCas9 guide RNA comprising, from 5’ to 3’, a spacer and a scaffold; and (c) a second polynucleotide comprising, from 5’ to 3’, a template sequence and a DRS, wherein the first and second polynucleotide are provided as separate molecules, optionally wherein the second polynucleotide comprises an affinity tag, optionally an aptamer, for binding to the DNA-dependent DNA polymerase.

[0184] In some embodiments, the composition comprises (a) a first polypeptide comprising a SpyCas9 nickase; (b) a second polypeptide comprising a DNA-dependent DNA polymerase; and (c) a single polynucleotide comprising, from 5’ to 3’, (i) a SpyCas9 guide RNA comprising a spacer and a scaffold; and (ii) a template sequence and a DRS, wherein the first and second polypeptide are provided as separate molecules, optionally wherein the second polynucleotide comprises an affinity tag, optionally an aptamer, for binding to a 3’ extension- recruiting domain on the DNA-dependent DNA polymerase. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase directly interact through non-covalent interactions. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase do not directly interact. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase may both non-covalently bind a single polynucleotide such as a template guide RNA.

[0185] In some embodiments, the composition comprises (a) a first polypeptide comprising a SpyCas9 nickase; (b) a second polypeptide comprising a DNA-dependent DNA polymerase and a 3’ extension-recruiting domain; (c) a first polynucleotide comprising a SpyCas9 guide RNA comprising, from 5’ to 3’, a spacer and a scaffold; and (d) a second polynucleotide comprising, from 5’ to 3’, a template sequence and a DRS, and further comprising an affinity tag; wherein the first and second polypeptide and first and second polynucleotide are provided asseparate molecules. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase directly interact through non-covalent interactions. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase do not directly interact. In some embodiments, the SpyCas9 nickase may bind a first polynucleotide comprising a guide RNA and the DNA-dependent DNA polymerase may bind a second polynucleotide comprising a separable 3’ extension, wherein the first and second polynucleotides target the SpyCas9 nickase and DNA- dependent DNA polymerase to proximal genomic loci.

[0186] In some embodiments, the composition further comprises a nicking guide RNA (ngRNA; see, e.g., Fig.7). The ngRNA comprises a spacer that hybridizes to a sequence such that the nick site of the ngRNA is within 200 nucleotides 5’ or 3’ from the nick site of the template guide RNA and on the target strand of the DNA duplex target nucleic acid, i.e., the strand to which the spacer of the tgRNA hybridizes. In other words, the ngRNA / SpyCas9 complex nicks the strand opposite to the strand nicked by the tgRNA / SpyCas9 complex. In some embodiments, the nick site of the ngRNA is about 20-200 nucleotides 5’ or 3’ from the nick site of the template guide RNA and on the target strand of the DNA duplex target nucleic acid. In some embodiments, the nick site of the ngRNA is within the genomic locus targeted by the spacer sequence of the template guide RNA. In some embodiments, the nick site of the ngRNA is preferably outside of the genomic locus targeted by the spacer sequence of the template guide RNA.

[0187] In some embodiments, the composition further comprises an enhancer of template- based genome editing. In some embodiments, the enhancer is an inhibitor of deoxynucleotide triphosphohydrolase. In some embodiments, wherein the enhancer is an inhibitor of deoxynucleotide triphosphohydrolase, the deoxynucleotide triphosphohydrolase comprises SAM domain and HD domain-containing protein 1 (SAMHD1). In some embodiments, inhibiting SAMHD1 comprises contacting the SAMHD1 with a Vpx, BGLF4, M97, or KSHV ORF36 protein, or expressing the Vpx, BGLF4, M97, or KSHV ORF36 protein in a cell. In some embodiments, inhibiting SAMHD1 comprises contacting an mRNA encoding the SAMHD1 with a microRNA, shRNA, or siRNA that hybridizes to the mRNA, or expressing the microRNA, shRNA, or siRNA in a cell. In some embodiments, inhibiting SAMHD1 comprises contacting the SAMHD1 with a small molecule SAMHD1 inhibitor. In some embodiments, the enhancer is a DNA repair protein. In some embodiments, the DNA repair protein is a single-stranded endonuclease that removes flaps comprising a free 5’ end, i.e., flaps 3’ of a nick. In someembodiments, the DNA repair protein is a single-stranded endonuclease that removes flaps 5’ of a nick. In some embodiments, the DNA repair protein is flap structure-specific endonuclease 1 (FEN1) or a polynucleotide encoding FEN1. In some embodiments, the DNA repair protein is mutL homolog 1 (MLH1) or a polynucleotide encoding MLH1. In some embodiments, the enhancer comprises a dNTP synthetic enzyme. In some embodiments, the enhancer comprises a kinase. In some embodiments, the kinase comprises a nucleoside kinase, deoxynucleoside kinase, deoxynucleoside monophosphate kinase, or deoxynucleotide diphosphate. In some embodiments, the enhancer comprises Vpx, BGLF4, M97, KSHV1 ORF36, or FEN1. In some embodiments, the enhancer comprises Vpx and FEN1. In some embodiments, the enhancer comprises M97 and FEN1. In some embodiments, the FEN1 comprises a heterodimerization domain, e.g., a self- assembling coiled coil heterodimerization domain, for binding to a DNA-dependent DNA polymerase having the sequence of the other portion of the heterodimerization domain.

[0188] In some embodiments, the composition comprises a lipid nanoparticle composition comprising (a) a first polynucleotide encoding a SpyCas9 nickase and a DNA-dependent DNA polymerase; and (b) a second polynucleotide comprising, from 5’ to 3’, a spacer, a scaffold, a template sequence, and a DRS.

[0189] In some embodiments, the composition comprises a lipid nanoparticle composition comprising (a) a first polynucleotide encoding a SpyCas9 nickase and a DNA-dependent DNA polymerase; (b) a second polynucleotide comprising, from 5’ to 3’, a spacer and a scaffold; and (c) a third polynucleotide comprising, from 5’ to 3’, a template sequence and a DRS, wherein the second and third polynucleotide are provided as separate molecules, optionally wherein the third polynucleotide comprises an affinity tag, optionally an aptamer, for binding to the DNA-dependent DNA polymerase.

[0190] In some embodiments, the composition comprises a lipid nanoparticle composition comprising (a) a first polynucleotide encoding a SpyCas9 nickase; (b) a second polynucleotide encoding a DNA-dependent DNA polymerase; and (c) a third polynucleotide comprising, from 5’ to 3’, a spacer, a scaffold, a template sequence, and a DRS, wherein the first and second polynucleotide are provided as separate molecules, optionally wherein the third polynucleotide comprises an affinity tag, optionally an aptamer, for binding to the DNA-dependent DNA polymerase.

[0191] In some embodiments, the composition comprises a lipid nanoparticle composition comprising (a) a first polynucleotide encoding a SpyCas9 nickase; (b) a second polynucleotide encoding a DNA-dependent DNA polymerase; (c) a third polynucleotide comprising, from 5’ to 3’, a spacer and a scaffold; and (d) a fourth polynucleotide comprising, from 5’ to 3’, a template sequence and a DRS, wherein the first, second, third, and fourth polynucleotides are provided as separate molecules, optionally wherein the fourth polynucleotide comprises an affinity tag, optionally an aptamer, for binding to the DNA-dependent DNA polymerase.

[0192] In some embodiments, use of the composition results in template-based genome editing. In some embodiments, template-based genome editing results in edits comprising an insertion or deletion in a nucleotide sequence. In some embodiments, template-based genome editing results in edits comprising a substitution in a nucleotide sequence. In some embodiments, template-based genome editing results in at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, optionally at least 50%, 55%, 60%, 65%, optionally at least 70%, 75%, or 80%, optionally at least 85%, 90%, 95%, 99% or more templated edits as a percent of total edits in the target nucleic acid. It is understood that non-templated edits, may occur during template-based genome editing, either alone or in conjunction with a templated edit. Non-templated edits include byproduct edits (i.e., mismatches or indels at or near the target site of the tgRNA or the nicking guide RNA, within the sequence analyzed by NGS, that are not encoded in the template). In determining the percent of template-based edits, the number of sequence reads with template-based edits, including byproduct edits, is determined as a percent of the total number of sequence reads. The number of template-based edits without byproduct edits, which are sometimes referred to herein as “perfect edits” or “templated edits” can be similarly determined. The percent of “perfect edits” or “templated edits” as a percent of total template-based edits can also be readily determined.

[0193] In some embodiments, use of the composition results in template-based genome editing in a cell or population of cells. In some embodiments, the cell is in vitro. In some embodiments, the cell is ex vivo. In some embodiments, the cell is in vivo. In some embodiments, the cell is a quiescent cell. In some embodiments, the cell is a quiescent cell selected from a hepatocyte, an inactivated T-cell, a muscle cell, a neuronal cell, and a lung cell. In some embodiments, the cell is a typically non-dividing cell type, i.e., a cell type that in adults does not typically divide in the absence of injury or tissue damage, e.g., liver cell, nerve cell, muscle cell. In some embodiments, the cell is a liver cell, such as a hepatocyte. In some embodiments, the cellis an immune cell such as a T cell. In some embodiments, at least 5% of the cells in the cell population comprise a template-based edit in the target nucleic acid. In some embodiments, at least 50% of the cells in the cell population comprise a desired genome edit in the target nucleic acid. In some embodiments, the cell is in vivo and at least 5% of the cells in the cell population comprise a desired genome edit in the target nucleic acid. In some embodiments, the cell is a typically non- dividing cell type in vivo and at least 5% of the cells in the cell population comprise a desired genome edit in the target nucleic acid. In some embodiments, the cell is a hepatocyte in vivo and at least 5% of the cells in the cell population comprise a desired genome edit in the target nucleic acid. In some embodiments, the cell is an immune cell and at least 50% of the cells in the cell population comprise a desired genome edit in the target nucleic acid. In some embodiments, the cell is a T cell and at least 50% of the cells in the cell population comprise a desired genome edit in the target nucleic acid.

[0194] In some embodiments, a method of producing a cell or a population of cells is provided. In some embodiments, the method comprises an insertion, deletion, or substitution in the genome of the target cell or cells, the method comprising contacting the cell or cells with (a) a SpyCas9 nickase or a nucleic acid encoding the same, (b) a DNA-dependent DNA polymerase or a nucleic acid encoding the same, and (c) a template guide RNA for template-based genome editing.

[0195] In some embodiments, the present disclosure provides, e.g., a system comprising a DNA-dependent DNA polymerase, a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length, and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises DNA nucleotides; and wherein the DRS comprises at least one of: (1) a sequence not fully complementary to the DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid; (2) a 1-5 nucleotide, optionally a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide; or (3) a 5’ terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage.

[0196] In some embodiments, the present disclosure provides, e.g., a system comprising a DNA-dependent DNA polymerase, a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length, and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides; and wherein the DRS comprises at least one of: (1) a sequence not fully complementary to the DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid; (2) a 1-5 nucleotide, optionally a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide; or (3) a 5’ terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage.

[0197] In some embodiments, the template sequence is at least 10-10,000 nucleotides in length. In some embodiments, the template sequence is at least 10, 1000, 2000, 3000, 4000, 5000,6000, 7000, 8000, 9000, or 10,000 nucleotides in length. In some embodiments, the template sequence is at least 10-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000- 7000, 7000-8000, 8000-9000, or 9000-10,000 nucleotides in length. In some embodiments, the template sequence is at least 10-10,000, 1000-10,000, 2000-10,000, 3000-10,000, 4000-10,000, 5000-10,000, 6000-10,000, 7000-10,000, 8-10,000, or 9-10,000 nucleotides in length. In some embodiments, the template sequence is at least 10-1000, 10-2000, 10-3000, 10-4000, 10-5000, 10- 6000, 10-7000, 10-8000, 10-9000, or 10-10,000 nucleotides in length.

[0198] In some embodiments, the template sequence is about 10-10,000 nucleotides in length. In some embodiments, the template sequence is about 10, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10,000 nucleotides in length. In some embodiments, the template sequence is about 10-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000- 7000, 7000-8000, 8000-9000, or 9000-10,000 nucleotides in length. In some embodiments, the template sequence is about 10-10,000, 1000-10,000, 2000-10,000, 3000-10,000, 4000-10,000, 5000-10,000, 6000-10,000, 7000-10,000, 8-10,000, or 9-10,000 nucleotides in length. In some embodiments, the template sequence is about 10-1000, 10-2000, 10-3000, 10-4000, 10-5000, 10- 6000, 10-7000, 10-8000, 10-9000, or 10-10,000 nucleotides in length.

[0199] In some embodiments, the template sequence comprises DNA nucleotides, wherein the plurality of nucleotides in the template sequence are DNA nucleotides. In some embodiments, 1-3 nucleotides at the 3’ end of the template (T1-T3), optionally only 1 RNA nucleotide at the 3’ end of the template (T1) are RNA nucleotides. In some embodiments, the template sequence consists of DNA nucleotides.

[0200] In some embodiments, the DRS comprises 6-20 nucleotides in length, the DRS is 6-17, 8-17, 10-12, 10-14, 10-16, or 12-14 nucleotides in length. In some embodiments, wherein the DRS comprises 6-17 nucleotides in length, the DRS is about 6-17, 8-17, 10-12, 10-14, 10-16, or 12-14 nucleotides in length. In some embodiments, the DRS is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length.

[0201] In some embodiments, the DRS is 75-100% complementary to the DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS is 100% complementary to the DRS-complementary region of the non- target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS is fully complementary to the DRS-complementary region of the non-target strand of the DNA duplextarget nucleic acid. In some embodiments, the DRS is not fully complementary to the DRS- complementary region of the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS has 0, 1, 2, 3, or 4 mismatches to the DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS comprises 0, 1, 2, 3, or 4 mismatches to the DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the first 50% of nucleotides at the 5’ end of the DRS have 0 mismatches to the corresponding genomic sequence. In some embodiments, the first 50% of nucleotides at the 5’ end of the DRS have 1, 2, or 3 mismatches to the corresponding genomic sequence. In some embodiments, the first four nucleotides at the 5’ end of the DRS have 0, 1, 2, or 3 mismatches to the corresponding genomic sequence. In some embodiments, the first four nucleotides at the 5’ end of the DRS have 0 mismatches to the corresponding genomic sequence. In some embodiments, the first four nucleotides at the 5’ end of the DRS have 1 or 2 mismatches to the corresponding genomic sequence. In some embodiments, the first three nucleotides at the 5’ end of the DRS have 0 mismatches to the corresponding genomic sequence. In some embodiments, the first three nucleotides at the 5’ end of the DRS have 1 mismatch to the corresponding genomic sequence. In some embodiments, the first 6 nucleotides at the 5’ end of the DRS have 0, 1, or 2 mismatches to the corresponding genomic sequence. In some embodiments, the first 10 nucleotides at the 5’ end of the DRS have 0, 1, or 2 mismatches to the corresponding genomic sequence. In some embodiments, 70%-100% of the nucleotides in the first 10 nucleotides at the 5’ end of the DRS are complementary to the corresponding genomic sequence. In some embodiments, the DRS comprises, e.g., further comprises, one or more mismatches in the 3’ half of the DRS.

[0202] In some embodiments, the DRS comprises a 1-5 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide. In some embodiments, the DRS comprises a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide. In some embodiments, the 3’ terminal tail is 1, 2, or 3 nucleotides in length.

[0203] In some embodiments, wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage, the DRS comprises a 5’ terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide. In some embodiments, the 5’ terminal nucleotide in the DRS (D1) is a DNA nucleotide. In some embodiments, the penultimate 5’ nucleotide (D2) in the DRS is an RNA nucleotide. Insome embodiments, each nucleotide from the penultimate 5’ nucleotide (D2) to the 3’ end nucleotide in the DRS is an RNA nucleotide.

[0204] In some embodiments, the first polynucleotide and the second polynucleotide are covalently linked. In some embodiments, the first polynucleotide and the second polynucleotide are not covalently linked. In some embodiments, the template guide RNA further comprises an affinity tag, wherein the first polynucleotide or the second polynucleotide are bound to a peptide or a peptide complex comprising a SpyCas9 nickase and a DNA-dependent DNA polymerase by the affinity tag.

[0205] In some embodiments, the method further comprises contacting the cell with a SpyCas9 nickase. In some embodiments, the scaffold of the SpyCas9 guide RNA binds to a SpyCas9 nickase. In some embodiments, the SpyCas9 nickase generates a nick on the same strand of a DNA duplex target nucleic acid as a nickase comprising an H840A mutation, i.e., the SpyCas9 is a nickase that cleaves the strand opposite to the strand that hybridizes to the spacer (i.e., the nickase cleaves the non-target strand of the DNA duplex target nucleic acid). In some embodiments, the SpyCas9 nickase generates a nick on the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the SpyCas9 nickase comprises a catalytically inactive HNH domain. In some embodiments, the SpyCas9 nickase comprises a D839K, D839Q, D839N, D839A, H840S, H840T, H840Q, H840D, H840R, H840K, H840Y, H840N, N863S, N863T, N863A, N863E, or K866A mutation within its HNH-like nuclease domain. In some embodiments, the SpyCas9 nickase comprises an H840A point mutation.

[0206] In some embodiments, the method further comprises contacting the cell with a DNA-dependent DNA polymerase. In some embodiments, the DRS bound to the non-target strand of the DNA duplex target nucleic acid forms a binding site for a DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a eukaryotic DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a mammalian DNA-dependent DNA polymerase. In some embodiments, the DNA- dependent DNA polymerase comprises a human DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a cynomolgus DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a mouse DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a bacterial DNA-dependent DNA polymerase. In some embodiments, theDNA-dependent DNA polymerase comprises an E. coli DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a viral DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a phage DNA-dependent DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises human DNA polymerase K, cynomolgus DNA polymerase K, mouse DNA polymerase K, human DNA polymerase θ, human DNA polymerase Ν, E. coli DNA polymerase I, phage T5 DNA polymerase, or phage Phi29 DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises human DNA polymerase K. In some embodiments, the DNA-dependent DNA polymerase comprises phage T5 DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase does not comprise phage Phi29 DNA polymerase. In some embodiments, the DNA-dependent DNA polymerase comprises a point mutation(s) or deletion(s). In some embodiments, the DNA-dependent DNA polymerase comprises a point mutation(s) or deletion(s) within an exonuclease domain. In some embodiments, the one or more point mutation(s) or deletion(s) within the exonuclease domain abolishes exonuclease activity.

[0207] In some embodiments, the SpyCas9 nickase is operably linked to the DNA- dependent DNA polymerase. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase comprise a single polypeptide. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase comprise a single polypeptide expressed from a single open reading frame (ORF). In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase comprise a single polypeptide expressed from separate open reading frames (ORFs). In some embodiments, wherein the SpyCas9 nickase and DNA-dependent DNA polymerase comprise a single polypeptide expressed form separate open reading frames (ORFs). In some embodiments, the ORF encoding the SpyCas9 nickase further encodes a first intein and the ORF encoding the DNA-dependent DNA polymerase further encodes a second intein capable of binding the first intein (or capable of participating in a trans-splicing reaction with the first intein). In some embodiments, a first ORF encodes an N-terminal portion of the SpyCas9 nickase further encodes a first intein and a second ORF encodes a second intein the remainder of the SpyCas9 nickase (i.e., a C-terminal portion of SpyCas9) and a polymerase. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase are provided as separate polypeptides. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase directly interact through non-covalent interactions. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase do not directly interact. As a first example, in some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase may both non-covalently bind a single polynucleotide such as a template guide RNA. As a second example, in some embodiments, the SpyCas9 nickase may bind a first polynucleotide comprising a guide RNA and the DNA- dependent DNA polymerase may bind a second polynucleotide comprising a separable 3’ extension, wherein the first and second polynucleotides target the SpyCas9 nickase and DNA- dependent DNA polymerase to proximal genomic loci.

[0208] In some embodiments, the method comprises contacting a cell with a composition comprising (a) a single polypeptide comprising a SpyCas9 nickase and a DNA-dependent DNA polymerase; and (b) a single polynucleotide comprising, from 5’ to 3’, (i) a SpyCas9 guide RNA comprising a spacer and a scaffold; and (ii) a template sequence and a DRS.

[0209] In some embodiments, the method comprises contacting a cell with a composition comprising (a) a single polypeptide comprising a SpyCas9 nickase and a DNA-dependent DNA polymerase; (b) a first polynucleotide comprising a SpyCas9 guide RNA comprising, from 5’ to 3’, a spacer and a scaffold; and (c) a second polynucleotide comprising, from 5’ to 3’, a template sequence and a DRS, wherein the first and second polynucleotide are provided as separate molecules, optionally wherein the second polynucleotide comprises an affinity tag, optionally an aptamer, for binding to the DNA-dependent DNA polymerase.

[0210] In some embodiments, the method comprises contacting a cell with a composition comprising (a) a first polypeptide comprising a SpyCas9 nickase; (b) a second polypeptide comprising a DNA-dependent DNA polymerase; and (c) a single polynucleotide comprising, from 5’ to 3’, (i) a SpyCas9 guide RNA comprising a spacer and a scaffold; and (ii) a template sequence and a DRS, wherein the first and second polypeptide are provided as separate molecules, optionally wherein the second polynucleotide comprises an affinity tag, optionally an aptamer, for binding to a 3’ extension-recruiting domain on the DNA-dependent DNA polymerase. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase directly interact through non-covalent interactions. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase do not directly interact. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase may both non-covalently bind a single polynucleotide such as a template guide RNA.

[0211] In some embodiments, the method comprises contacting a cell with a composition comprising (a) a first polypeptide comprising a SpyCas9 nickase; (b) a second polypeptidecomprising a DNA-dependent DNA polymerase and a 3’ extension-recruiting domain; (c) a first polynucleotide comprising a SpyCas9 guide RNA comprising, from 5’ to 3’, a spacer and a scaffold; and (d) a second polynucleotide comprising, from 5’ to 3’, a template sequence and a DRS, and further comprising an affinity tag; wherein the first and second polypeptide and first and second polynucleotide are provided as separate molecules. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase directly interact through non-covalent interactions. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase do not directly interact. In some embodiments, the SpyCas9 nickase may bind a first polynucleotide comprising a guide RNA and the DNA-dependent DNA polymerase may bind a second polynucleotide comprising a separable 3’ extension, wherein the first and second polynucleotides target the SpyCas9 nickase and DNA-dependent DNA polymerase to proximal genomic loci.

[0212] In some embodiments, the method further comprises contacting the cell with a nicking guide RNA (ngRNA). The ngRNA comprises a spacer that hybridizes to a sequence such that the nick site of the ngRNA is within 200 nucleotides 5’ or 3’ from the nick site of the template guide RNA and on the target strand of the DNA duplex target nucleic acid. In some embodiments, the nick site of the ngRNA is about 20-200 nucleotides 5’ or 3’ from the nick site of the template guide RNA and on the target strand of the DNA duplex target nucleic acid. In some embodiments, the nick site of the ngRNA is within the genomic locus complementary to the spacer sequence of the template guide RNA. In some embodiments, the nick site of the ngRNA is preferably outside of the genomic locus complementary to the spacer sequence of the template guide RNA.

[0213] In some embodiments, the method further comprises contacting the cell with an enhancer of template-based genome editing. In some embodiments, the enhancer is an inhibitor of deoxynucleotide triphosphohydrolase. In some embodiments, wherein the enhancer is an inhibitor of deoxynucleotide triphosphohydrolase, the deoxynucleotide triphosphohydrolase comprises SAM domain and HD domain-containing protein 1 (SAMHD1). In some embodiments, inhibiting SAMHD1 comprises contacting the SAMHD1 with a Vpx, BGLF4, M97, or KSHV ORF36 protein or expressing the Vpx, BGLF4, M97, or KSHV ORF36 protein in a cell. In some embodiments, inhibiting SAMHD1 comprises contacting an mRNA encoding the SAMHD1 with a microRNA, shRNA, or siRNA that hybridizes to the mRNA, or expressing the microRNA, shRNA, or siRNA in a cell. In some embodiments, inhibiting SAMHD1 comprises contacting the SAMHD1 with a small molecule SAMHD1 inhibitor. In some embodiments, the enhancer is aDNA repair protein. In some embodiments, the DNA repair protein is a single-stranded endonuclease that removes flaps 5’ of a nick. In some embodiments, the DNA repair protein is flap structure-specific endonuclease 1 (FEN1) or a polynucleotide encoding FEN1. In some embodiments, the DNA repair protein is mutL homolog 1 (MLH1) or a polynucleotide encoding MLH1. In some embodiments, the enhancer comprises a dNTP synthetic enzyme. In some embodiments, the enhancer comprises a kinase. In some embodiments, the kinase comprises a nucleoside kinase, deoxynucleoside kinase, deoxynucleoside monophosphate kinase, or deoxynucleotide diphosphate. In some embodiments, the enhancer comprises Vpx, BGLF4, M97, KSHV ORF36, FEN1, or MLH1. In some embodiments, the enhancer comprises Vpx and FEN1. In some embodiments, the enhancer comprises M97 and FEN1. In some embodiments, the FEN1 comprises a heterodimerization domain, e.g., a self-assembling coiled coil heterodimerization domain, for binding to a DNA-dependent DNA polymerase having the sequence of the other portion of the heterodimerization domain.

[0214] In some embodiments, the method comprises contacting the cell with a composition comprising a lipid nanoparticle composition comprising (a) a first polynucleotide encoding a SpyCas9 nickase and a DNA-dependent DNA polymerase; and (b) a second polynucleotide comprising, from 5’ to 3’, a spacer, a scaffold, a template sequence, and a DRS.

[0215] In some embodiments, the method comprises contacting the cell with a composition comprising (a) a first polynucleotide encoding a SpyCas9 nickase and a DNA-dependent DNA polymerase; (b) a second polynucleotide comprising, from 5’ to 3’, a spacer and a scaffold; and (c) a third polynucleotide comprising, from 5’ to 3’, a template sequence and a DRS, wherein the second and third polynucleotide are provided as separate molecules, optionally wherein the third polynucleotide comprises an affinity tag, optionally an aptamer, for binding to the DNA-dependent DNA polymerase.

[0216] In some embodiments, the method comprises contacting the cell with a composition comprising a lipid nanoparticle composition comprising (a) a first polynucleotide encoding a SpyCas9 nickase; (b) a second polynucleotide encoding a DNA-dependent DNA polymerase; and (c) a third polynucleotide comprising, from 5’ to 3’, a spacer, a scaffold, a template sequence, and a DRS, wherein the first and second polynucleotide are provided as separate molecules, optionally wherein the third polynucleotide comprises an affinity tag, optionally an aptamer, for binding to the DNA-dependent DNA polymerase.

[0217] In some embodiments, the method comprises contacting the cell with a composition comprising a lipid nanoparticle composition comprising (a) a first polynucleotide encoding a SpyCas9 nickase; (b) a second polynucleotide encoding a DNA-dependent DNA polymerase; (c) a third polynucleotide comprising, from 5’ to 3’, a spacer and a scaffold; and (d) a fourth polynucleotide comprising, from 5’ to 3’, a template sequence and a DRS, wherein the first, second, third, and fourth polynucleotides are provided as separate molecules, optionally wherein the fourth polynucleotide comprises an affinity tag, optionally an aptamer, for binding to the DNA- dependent DNA polymerase.

[0218] In some embodiments, the method further comprises contacting the cell with a composition comprising a lipid nanoparticle comprising a polynucleotide encoding an enhancer of template-based genome editing. In certain embodiments, the polynucleotide encodes an shRNA for inhibiting expression of SAMHD1. In certain embodiments, the enhancer comprises Vpx. In certain embodiments, the enhancer comprises BGLF4. In certain embodiments, the enhancer comprises M97. In certain embodiments, the enhancer comprises KSHV ORF36. In certain embodiments, the enhancer comprises FEN1. In certain embodiments, the enhancer comprises mutL homolog 1 (MLH1).

[0219] In certain embodiments, contacting the cell with an enhancer comprises contacting the cell with Vpx and FEN1. In certain embodiments, Vpx and FEN1 are encoded on separate polynucleotides. In certain embodiments, Vpx and FEN1 are encoded on the same polynucleotide. In certain embodiments, Vpx and FEN1 are encoded on the same polynucleotide, e.g., on the same polynucleotide as a fusion protein. In some embodiments, wherein Vpx and FEN1 are encoded on the same polynucleotide as a fusion protein, the fusion protein comprises a peptide cleavage site between Vpx and FEN1.

[0220] In certain embodiments, contacting the cell with an enhancer comprises contacting the cell with M97 and FEN1. In certain embodiments, M97 and FEN1 are encoded on separate polynucleotides. In certain embodiments, M97 and FEN1 are encoded on the same polynucleotide. In certain embodiments, M97 and FEN1 are encoded on the same polynucleotide, e.g., on the same polynucleotide as a fusion protein.

[0221] In some embodiments, provided herein is a method of editing a cell, comprising contacting the cell with (a) a SpyCas9 nickase or a nucleic acid encoding the same, (b) a DNA- dependent DNA polymerase or a nucleic acid encoding the same, and (c) a template guide RNAfor template-based genome editing, thereby inserting an exogenous DNA sequence near a cleavage site cleaved by the SpyCas9 nickase. In some embodiments, provided herein is a method of editing a cell, comprising contacting the cell with (a) a SpyCas9 nickase or a nucleic acid encoding the same, (b) a DNA-dependent DNA polymerase or a nucleic acid encoding the same, and (c) a template guide RNA for template-based genome editing, thereby deleting an endogenous DNA sequence near a cleavage site cleaved by the SpyCas9 nickase. In some embodiments, provided herein is a method of editing a cell, comprising contacting the cell with (a) a SpyCas9 nickase or a nucleic acid encoding the same, (b) a DNA-dependent DNA polymerase or a nucleic acid encoding the same, and (c) a template guide RNA for template-based genome editing, thereby replacing one or more nucleotides near a cleavage site cleaved by the SpyCas9 nickase.

[0222] In some embodiments, template-based genome editing results in edits comprising an insertion or deletion in a nucleotide sequence. In some embodiments, template-based genome editing results in edits comprising a substitution in a nucleotide sequence.In some embodiments, template-based genome editing results in at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, optionally at least 50%, 55%, 60%, 65%, optionally 70%, 75%, or 80% templated edits as a percent of total edits in the target nucleic acid (i.e., the number of NGS reads “templated edits” without byproduct edits divided by (the number of NGS reads with “templated edits” with or without byproduct edits plus the number of reads with indels without “templated edits”).

[0223] In some embodiments, use of the composition results in template-based genome editing in a cell or population of cells. In some embodiments, the cell is in vitro. In some embodiments, the cell is ex vivo. In some embodiments, the cell is in vivo. In some embodiments, the cell is a hepatocyte. In some embodiments, the cell is an immune cell such as a T cell. In some embodiments, at least 5% of the cells in the cell population comprise a desired genome edit in the target nucleic acid. In some embodiments, the cell is a hepatocyte and at least 5% of the cells in the cell population comprise a desired genome edit in the target nucleic acid. In some embodiments, the hepatocyte is in vivo. In some embodiments, the cell is an immune cell and at least 50% of the cells in the cell population comprise a desired genome edit in the target nucleic acid. In some embodiments, the cell is a T cell and at least 50% of the cells in the cell population comprise a desired genome edit in the target nucleic acid.

[0224] The present disclosure also relates to manufacturing methods to prepare cells in vitro or ex vivo for subsequent therapeutic administration to a subject. In some embodiments, the platform relates to genome editing via simultaneous or sequential administration of lipid nanoparticles (LNPs) comprising (a) a SpyCas9 nickase or a nucleic acid encoding the same, (b) a DNA-dependent DNA polymerase or a nucleic acid encoding the same, and (c) a template guide RNA for template-based genome editing. The systems and methods disclosed herein are relevant to any cell type but are particularly advantageous in preparing cells that require insertion, deletion, or substitution of a defined genomic sequence for full therapeutic applicability, e.g., in primary immune cells, e.g., T cells, B cells, NK cells; or stem cells including hematopoietic stem cells. As provided herein, the platform methods apply to “a cell” or to “a cell population” (or “population of cells”). When referring to delivery or gene editing methods for “a cell” herein, it is understood that the methods may be used for delivery or gene editing to “a cell population.”

[0225] In some embodiments, provided herein is use of any cell, population of cells, or composition disclosed herein for treating cancer or autoimmune disease. In some embodiments, provided herein is use of any cell, population of cells, or composition disclosed herein for preparation of a medicament for treating cancer or autoimmune disease. In some embodiments, provided herein is an engineered cell modified by the methods disclosed herein, and the engineered cell comprises at least one genomic modification, e.g., insertion, deletion, or substitution of nucleotides.

[0226] In some embodiments, provided herein is a cell treated in vitro with any method or composition disclosed herein. In some embodiments, provided herein is a cell treated in vivo with any method or composition disclosed herein. In some embodiments herein, a cell treated in vivo is a liver cell. In some embodiments herein, a cell treated in vivo is not a liver cell. In some embodiments, provided herein is a population of cells comprising any cell disclosed herein.

[0227] The section headings used herein are for organizational purposes only and are not to be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference contradicts any term defined in this specification or any other express content of this specification, this specification controls. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.Definitions

[0228] Unless stated otherwise, the following terms and phrases as used herein are intended to have the following meanings:

[0229] “Template-based genome editing”, “template-based editing”, “templated editing”, and the like, as used herein, is understood as a specific change to a nucleotide sequence, e.g., insertion, deletion, change in nucleotide sequence, dependent upon the sequence of an exogenous nucleotide template sequence and a polymerase delivered to the cell. As used herein, template- based editing uses an exogenously provided polynucleotide template and a DNA-templated DNA polymerase delivered to the cell. The nucleotide sequence of the template, and a complement thereof, is integrated into the genome (See, e.g., Fig.1).

[0230] As used herein, a “transition” is a substitution mutation in which a purine nucleotide is replaced with a different purine nucleotide or a pyrimidine nucleotide is replaced with a different pyrimidine nucleotide. Exemplary transition mutations include A-to-G, G-to-A, C-to-T, and T-to- C.

[0231] As used herein, a “transversion” is a substitution mutation in which a purine nucleotide is replaced with a pyrimidine nucleotide or a pyrimidine nucleotide is replaced with a purine nucleotide. Exemplary transversion mutations include A-to-C, C-to-A, G-to-T, T-to-G, A- to-T, T-to-A, G-to-C, and C-to-G.

[0232] As used herein, “indel” refers to an insertion or deletion mutation consisting of a number of nucleotides that are either inserted, deleted, or inserted and deleted, e.g., at the site of a nick or double-strand break (DSB), in a target nucleic acid. As used herein, when indel formation results in an insertion, the insertion is a random insertion at the site of a nick or DSB and is not directed by or based on a template sequence.

[0233] As used herein, “base editing” is understood as a change in a nucleotide sequence promoted by a deamination reaction close to the site of a nick in a double stranded DNA molecule. That is, the change in the nucleotide sequence resulting from base editing is template independent and is not dependent on a polymerase. Deaminase reactions are catalyzed, for example, by a cytosine deaminase or an adenosine deaminase. The editing method is limited by both the nucleotide sequence present in the genome and the base changes that can be made through deamination, e.g., C to T and A to G. The compositions and methods provided herein do not include a deaminase.

[0234] As used herein, the term “operably linked” is understood as a juxtaposition of at least two components, e.g., polypeptide chain components or polynucleotide chain components, in a manner to allow one component to exert an effect on the other, or to allow the components when operably linked to have an effect that the two components could not exert individually or as a mixture of the components. In certain embodiments, two components may be operably linked by a covalent linkage, e.g., a peptide bond between two polypeptide chains encoded by a single open reading frame. In certain embodiments, the linkage can be mediated by a linker, e.g., a peptide linker. In certain embodiments, the linker is covalently attached to at least one of the components. In certain embodiments, the linker is covalently attached to both components. In certain embodiments, e.g., polynucleotides, the components can be joined by one or more phosphodiester or phosphorothioate bonds, e.g., a single PO or PS bond, or a polynucleotide linker sequence, or by other types of linkages, or any combination thereof.

[0235] In certain embodiments, components are joined by a linker not covalently attached to either component, e.g., two polypeptides bound to a single nucleic acid with binding sites for two distinct polypeptides, e.g., a guide RNA scaffold and an aptamer. In certain embodiments, polynucleotides, optionally polynucleotides bound to polypeptides, can be operably linked by being targeted to genomic loci with sufficient proximity to each other, typically on opposite strands of the DNA duplex target nucleic acid. For example, a nickase is recruited to a genomic locus by a first polynucleotide sequence comprising a spacer sequence 5’ of a guide scaffold sequence wherein the spacer sequence is complementary to the target strand of the DNA duplex target nucleic acid. Similarly, a polymerase is recruited to the non-target strand (opposite strand) of the DNA duplex target nucleic acid by a second polynucleotide sequence comprising a DNA polymerase recruiting sequence (DRS) complementary to the non-target strand of the DNA duplex target nucleic acid and a sequence to mediate binding of the second polynucleotide to the polymerase, e.g., an aptamer, 3’ of the DRS. The non-target strand of the DNA duplex target nucleic acid is available for hybridization to the DRS by the binding of the spacer sequence to the genomic locus and the nicking of the non-target strand by the nickase. The second polynucleotide further comprises a template sequence 5’ of the DRS.

[0236] In certain embodiments, components are joined directly by a non-covalent linkage. For example, each of the components can include a domain, e.g., a heterodimerization domain (or heterodimer domain, which is interchangeably used herein with a heterodimerization domain), thatmediates the binding of the components to each other. In some embodiments, each of the components is a polypeptide chain and each polypeptide chain comprises a fusion protein comprising the heterodimer domain. In some embodiments, the heterodimer domains comprise leucine zipper domains, PDZ domains, streptavidin and streptavidin binding protein domains, foldon domains, hydrophobic polypeptides, an antibody or one or more binding fragments thereof (e.g., scFv, VHH domain) on one component that binds an epitope, either naturally occurring or inserted, in the other component. The position of the heterodimer domain is selected independently for each component. In some embodiments, the heterodimerization domain comprises a coiled coil heterodimerization domain, e.g., a self-assembling coiled coil heterodimerization domain. In some embodiments, the heterodimerization domain comprises an EBV, EI, KV, or KI domain, which may form a heterodimer with a corresponding self-assembling coiled coil heterodimerization domain. In some embodiments, the heterodimerization domain comprises an EI or KI domain. In some embodiments, the heterodimerization domain comprises an EI domain. In some embodiments, the heterodimerization domain comprises a KI domain. In some embodiments, the heterodimerization domain is SEQ ID NO: 1589, SEQ ID NO: 1593, or SEQ ID NO: 1595.

[0237] In certain embodiments, two polynucleotide chain components are operably linked by polypeptide binding, e.g., by two polynucleotide chains binding to a single polypeptide or two polynucleotide chains binding to a heterodimer.

[0238] As used herein, the term “system” refers to at least two operably linked elements, e.g., polypeptides or polynucleotides. In some embodiments, the system may comprise any two or more of a SpyCas9 nickase, a DNA-dependent DNA polymerase, a SpyCas9 guide RNA, and a 3’ extension. In some embodiments, the SpyCas9 nickase and DNA-dependent DNA polymerase may be covalently linked in a fusion protein. In some embodiments, the SpyCas9 nickase may be operably linked to a first split intein and the DNA-dependent DNA polymerase may be operably linked to a second split intein capable of participating in a trans-splicing reaction with the first intein. In some embodiments, the SpyCas9 nickase operably linked to the first intein and the DNA- dependent DNA polymerase operably linked to the second intein may be present as two separate polypeptides (pre-splicing). In some embodiments, the SpyCas9 nickase operably linked to the first intein and the DNA-dependent DNA polymerase operably linked to the second intein may be present as a single polypeptide (post-splicing). In some embodiments, the system may further comprise a nucleic acid encoding the SpyCas9 nickase or DNA-dependent DNA polymerase. Insome embodiments, the SpyCas9 guide RNA may be covalently linked to the 3’ extension. In some embodiments, the SpyCas9 guide RNA may not be covalently linked to the 3’ extension. In some embodiments, the system may further comprise one or more enhancers of genomic editing, or one or more nucleic acids encoding the one or more enhancers of genomic editing.

[0239] As used herein, a “template guide”, “template guide RNA”, “tgRNA” or the like comprises a first polynucleotide sequence comprising a spacer sequence and a guide scaffold sequence, e.g., a guide RNA, wherein the spacer sequence is positioned 5’ of the guide scaffold sequence, and wherein the spacer sequence is targeted to a target strand of a DNA duplex target nucleic acid at a genomic locus (See, e.g., Fig. 2). The first polynucleotide sequence is operably linked to a second polynucleotide sequence, referred to herein as a 3’ extension, comprising a template sequence and a DNA-polymerase recruiting sequence (DRS), wherein the template sequence is positioned 5’ to the DRS, wherein the DRS is complementary, e.g., 75-100% complementary, to the non-target (i.e., opposite) strand of the double-stranded DNA molecule for at least six consecutive nucleotides within the spacer genomic target sequence, e.g., complementary over 6 -20 consecutive nucleotides of the same genomic locus of the target locus of the spacer sequence. In certain embodiments, the DRS is less than 100% complementary to the non-target strand of the DNA duplex target nucleic acid. In certain embodiments, the DRS is 100% complementary to the genomic sequence across at least 3 base pairs, optionally at least 4 base pairs. In certain embodiments, the DRS has at least 6 base pairs with the genomic sequence across the length of the DRS. Mismatches between the DRS and the genomic sequence typically do not direct changes in the genomic sequence. Mismatches only at the 5’ end of the DRS can direct changes in the genomic sequence when the polymerase binds upstream of the mismatch(es) between the DRS and the genomic sequence such that the 5’ end of the DRS can act as a template. In certain embodiments, the DRS can direct a template based edit at one or more of positions D1, D2, and D3, optionally at position D1. In certain embodiments, the DRS position directing an edit is a DNA nucleotide. In certain embodiments, an edit directed by a nucleotide in the DRS is less efficient than an edit directed by the template. In certain embodiments, the positions that are less than 100% complementary to the non-target strand of the DNA duplex target nucleic acid that can direct template-based edits do not introduce changes into the amino acid sequence of the corresponding protein after template-based genome editing, i.e., silent mutations. It is understood that reducing the complementarity of the DRS to the non-target strand of the DNA duplex targetnucleic acid will similarly reduce the complementarity of the DRS to the spacer sequence of the guide RNA. In certain embodiments, one or more mismatches between the DRS and the genomic target sequence are at the 5’ end of the DRS, e.g., within the first three nucleotides of the DRS.

[0240] In certain embodiments, the DRS further includes a 3’ tail that is not complementary to the genomic sequence, i.e., the mismatch is not flanked by nucleotides complementary to the genomic sequence. In certain embodiments, the 3’ tail of the DRS is 1-5 nucleotides in length, optionally 1, 2, or 3 nucleotides in length. In preferred embodiments, the most 3’ nucleotide in the 3’ tail is a uridine nucleotide. In certain embodiments, all of the nucleotides of the 3’ tail are uridine nucleotides. For the purpose of determining percent complementarity between the DRS and the genomic sequence, mismatches between the tail and the genomic sequence are not considered in percent identity.

[0241] The template sequence is less than 100% complementary to the non-target strand of the DNA duplex target nucleic acid. After polymerase-mediated extension, the nucleotide mismatch within the template sequence is incorporated into the genomic sequence such that the genomic sequence contains at least one template-based edit as compared to the unedited genomic sequence. The DRS and template sequence can further include mismatches to the guide RNA spacer sequence that do not result in changes in the corresponding amino acid sequence following template-based editing. Such mismatches may reduce the formation of DNA-RNA duplexes between the DRS and template sequence, and the guide RNA spacer sequence, that can be susceptible to cleavage by RNaseH. Such mismatches may reduce nuclease recruitment by the spacer sequence to genomic target sequence after template-based editing by changing the nucleotide sequence in the genomic locus to which the spacer sequence is targeted.

[0242] In certain embodiments, the first polynucleotide sequence, the guide RNA, and the second polynucleotide sequence, the 3’ extension, are operably linked by being in a single polynucleotide chain. In certain embodiments, the first polynucleotide sequence is 5’ of the second polynucleotide sequence in the polynucleotide chain. In certain embodiments, the first polynucleotide sequence is operably linked to the second polynucleotide sequence by a linker. In certain embodiments, the polynucleotide sequences are linked in the following orientation: 5’-first polynucleotide sequence-3’-linker-5’-second polynucleotide sequence-3’. In certain embodiments, the first polynucleotide sequence and the second polynucleotide sequence, optionally with the polynucleotide sequences bound to polypeptides, can be operably linked bybeing targeted to genomic loci with sufficient proximity to each other, typically on opposite strands of the DNA duplex target nucleic acid. In certain embodiments, the first polynucleotide sequence and the second polynucleotide sequence are in separate polynucleotide chains operably linked by being bound to a single polypeptide or a single polypeptide heterodimer. In certain embodiments, a first polynucleotide comprising the first polynucleotide sequence comprising the guide scaffold sequence is bound to a SpyCas9 enzyme portion of a polypeptide; and a second polynucleotide comprising the second polynucleotide sequence comprises an affinity tag polynucleotide sequence for binding to a corresponding polypeptide sequence in the polypeptide or polypeptide heterodimer. In certain embodiments, the affinity tag is 5’ to the template sequence. In certain embodiments, the affinity tag is 3’ to the DRS sequence. In certain embodiments, there is more than one affinity tag in the second polynucleotide. In certain embodiments, the affinity tag is operably linked to the template sequence or the DRS by a linker. In certain embodiments, the template sequence and affinity tag are linked in the following orientation: In certain embodiments, the template sequence and affinity tag are linked in one of the following orientations: 5'-affinity tag-template-DRS-3'; 5'-template-DRS-affinity tag; or 5'-affinity tag-template-DRS-affinity tag- 3'. In certain embodiments, one or more linkers are present between the one or more of the DRS, affinity tag, and template. In certain embodiments, the corresponding polypeptide sequence for binding the affinity tag is present on a DNA dependent DNA polymerase or SpyCas9.

[0243] As used herein, “ligated template guide RNA,” “ligated tgRNA,” and the like are used herein to refer to a tgRNA produced by ligating at least two or at least three separate polynucleotides, e.g., two or three separate polynucleotides.

[0244] As fused herein, a “splint oligonucleotide” is an oligonucleotide that comprises a first region of complementarity to a first polynucleotide and a second, immediately adjacent region of complementarity to a second polynucleotide. The splint oligonucleotide is therefore capable of simultaneously annealing to the ends of two polynucleotides that flank a ligation site, thereby bringing them into proximity so that they may be ligated together (e.g., via a ligase).

[0245] “Guide RNA”, “gRNA”, and “guide” are used herein interchangeably to refer to either a crRNA (also known as CRISPR RNA), or the combination of a crRNA and a trRNA (also known as tracrRNA). The crRNA and trRNA may be associated as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (dual guide RNA, dgRNA). “Guide RNA”or “gRNA” refers to each type. The trRNA may be a naturally occurring sequence, or a trRNA sequence with modifications or variations compared to naturally occurring sequences.

[0246] As used herein, a “nicking guide RNA” is a guide RNA, typically an sgRNA, that can bind to the same Cas9 enzyme, e.g., a SpyCas9 enzyme, as the template guide, but that does not contain a DRS or a template sequence. The target site for the spacer sequence in a nicking guide RNA is about 1-200 nucleotides, preferably about 1-100 nucleotides 5’ or 3’ from the nicking site for the template guide, on the opposite DNA strand in the genome i.e., the non-target strand of the DNA duplex target nucleic acid. In certain embodiments, the nicking guide RNA facilitates SpyCas9 nicking between 20-200 nucleotides 5’ or 3’ from the nicking site for the template guide on the opposite DNA strand of the DNA duplex target nucleic acid. In cases where the target site for the nicking guide RNA is within 20 nucleotides of the template guide RNA nicking site, the targeting sequence of the nicking guide RNA preferably already has the intended edits. In preferred embodiments, the nicking guide RNA does not promote editing at its target site.

[0247] “Internal linker” as used herein describes a non-nucleotide segment joining two nucleotides within a guide RNA. If the guide RNA contains a spacer region, the internal linker is located outside of the spacer region (e.g., in the scaffold or conserved region of the guide RNA). Exemplary structures of guide RNA scaffolds with internal linkers are provided in WO2022261292, the content of which is incorporated by reference. In some embodiments, an internal linker may join two nucleotides within a template guide RNA. For example, an internal linker may join the guide RNA and 3’ extension, the template sequence and an affinity tag, or the DRS and an affinity tag. In some cases, the non-nucleotide linker having the same structure as an internal linker may be also used to join two nucleotides elsewhere and may be referred to as a non-nucleotide linker.

[0248] As used herein, a “spacer,” “spacer sequence,” “guide sequence,” “guide region,” “targeting sequence” and the like refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct a guide RNA to a target sequence for binding or modification (e.g., cleavage) by an RNA-guided nickase. A guide sequence can be 20 nucleotides in length, e.g., in the case of Streptococcus pyogenes (i.e., SpyCas9 (also referred to as SpCas9)) and related Cas9 homologs / orthologs. Shorter or longer sequences can also be used as guides, e.g., 17-, 18-, 19-, or 21-nucleotides in length.

[0249] Exemplary “scaffold” or “conserved region” of a S. pyogenes Cas9 (“spyCas9” (also referred to as “spCas9”)) sgRNA” is shown in Tables 5A-5B. The first row shows the numbering of the nucleotides; the second row shows the sequence (e.g., SEQ ID NO: 22 or 115); and the third row shows the regions. Various SpyCas9 guide RNA scaffold sequences and chemical modifications are known in the art including, but not limited to, those provided in WO2018107028, WO2019237069, WO2021119275, and WO2022261292, the contents of each of which are herein incorporated by reference.

[0250] As used herein, a “3’ extension,” “3’ extension polynucleotide,” or the like is understood as a polynucleotide containing, at least a template sequence 5’ to a DNA-dependent DNA polymerase recruiting sequence (DRS), wherein the 3’ extension is operably linked to a spacer sequence and a guide scaffold sequence, e.g., a guide RNA (See, e.g., Figs.2-6I). In certain embodiments, the 3’ extension is covalently linked to the 3’ end of the guide scaffold sequence. In certain embodiments, the covalent linkage is a phosphodiester bond or a phosphorothioate bond, and can include a polynucleotide linker sequence. In certain embodiments, the covalent linkage is a non-nucleotide linkage. In certain embodiments, the linkage is a non-covalent linkage, e.g., an operable linkage as provided herein. As used herein, a 3’ extension that is not covalently linked to a guide scaffold sequence may be referred to as a separable 3’ extension.

[0251] In the context of the 3’ extension, the boundary between the template sequence and the DRS may be defined relative to the position of the nick generated by the SpyCas9 nickase. The nucleotide at the 5’ end of the flap 3’ of the nick is complementary to the nucleotide at the 3’ end of the template (unless an edit is to be introduced at position T1), while the nucleotide at the 3’ end of the flap 5’ of the nick is complementary to the nucleotide at the 5’ end of the DRS. Accordingly, the boundary between the template sequence and the DRS may be described relative to the extension activity of the DNA-dependent DNA polymerase, with the first nucleotide of the template (T1; the nucleotide immediately 5’ of the boundary between the template sequence and the DRS) being complementary to the first nucleotide of the newly synthesized DNA strand.

[0252] As used herein, the term “3’ extension-recruiting domain” (or “template-recruiting domain,” “aptamer-binding domain,” and the like) is understood as a polypeptide sequence or a polynucleotide sequence, a small molecule, or the like that binds to a cognate affinity tag covalently linked to a 3’ extension disclosed herein. In some embodiments, the 3’ extension- recruiting domain is at the C-terminal of the DNA-dependent DNA polymerase. In someembodiments, the 3’ extension-recruiting domain is at the N-terminal of the DNA-dependent DNA polymerase.

[0253] As used herein, a “chimeric DNA / RNA 3’ extension” or “chimeric DNA / RNA 3’ extension polynucleotide”, or “3’ extension”, is understood as a 3’ extension polynucleotide having a template portion with a sufficient number of DNA nucleotides (2’-H and 3’-OH) to permit extension by a DNA-dependent DNA polymerase when a DRS portion having independently at each position a DNA nucleotide, an RNA nucleotide or modified RNA nucleotide wherein the modification is tolerated in the scaffold of a guide RNA (e.g., 2’-OH, 2’-Ome, 2’F modified nucleotide) has formed a duplex region with the 3’ end of the flap formed by a nick in the genomic DNA (the flap 5’ of the nick). In certain embodiments, the template portion of the chimeric DNA / RNA 3’ extension includes all DNA nucleotides. In certain embodiments, the DRS portion of the chimeric DNA / RNA 3’ extension includes all DNA nucleotides. In certain embodiments, the 3’ end of the DRS includes all RNA nucleotides, e.g., modified RNA nucleotides, and the 5’ end of the DRS includes DNA nucleotides. In certain embodiments, 1-3 nucleotides on the 5’ end of the DRS (D1-D3) are DNA nucleotides. In certain embodiments, 0-7 nucleotides on the 5’ end of the DRS (D1- D7) are DNA nucleotides. In certain embodiments, the 3’ nucleotide of the DRS is an RNA nucleotide or modified RNA nucleotide and the remaining nucleotides are DNA nucleotides. In certain embodiments, the template portion of the chimeric DNA / RNA 3’ extension includes all DNA nucleotides and the 3’ end of the DRS includes all RNA or modified RNA nucleotides, and the 5’ end of the DRS includes DNA nucleotides. In certain embodiments, 1-3 nucleotides on the 3’ end of the DRS are modified nucleotides, e.g., 2’-Ome modified nucleotides. In certain embodiments, the 3’ end of the DRS has 1-3 phosphorothioate modifications, preferably with a single phosphorothioate, e.g., between the most 3’ nucleotides. In certain embodiments, 1- 3 nucleotides on the 3’ end of the DRS are modified nucleotides, e.g., independently 2’-Ome and phosphorothioate modified nucleotides. In certain embodiments, the DRS has a 3’ tail. In certain embodiments, the 3’ tail of the DRS is 1-5 nucleotides in length, optionally 1, 2, or 3 nucleotides in length. In preferred embodiments, the most 3’ nucleotide in the 3’ tail is a uridine nucleotide. In certain embodiments, all of the nucleotides of the 3’ tail are uridine nucleotides. In certain embodiments, the most 3’ uridine nucleotide of the 3’ extension is a modified uridine nucleotide. In certain embodiments, all of the nucleotides of the 3’ tail are modified uridine nucleotides.

[0254] “Template sequence” as used herein is a nucleotide sequence 5’ to the DRS, wherein the template sequence provides a nucleotide sequence different from the nucleotide sequence in the strand of genomic DNA prior to editing, wherein the template directs incorporation of at least one nucleotide sequence change into the genome, i.e., template-based genome editing. Such incorporations can come in the form of nucleotide substitutions, insertions or deletions. In some embodiments, the template sequence is at least 5 nucleotides in length, preferably at least 10 nucleotides in length. In preferred embodiments, the template sequence is 100% complementary to the genomic sequence for at least 4 consecutive nucleotides prior to template-based genome editing. In certain embodiments, the 3’ portion of the template sequence includes the nucleotide sequence that is different from the nucleotide sequence in the strand of the genomic DNA prior to template-based genome editing. In certain embodiments, the most 3’ position of the template sequence is a nucleotide that is different from the nucleotide sequence of the strand of the DNA duplex target nucleic acid prior to template-based genome editing. In certain embodiments, the 5’ terminal portion of the template sequence is 100% complementary to the non-target strand of the DNA duplex target nucleic acid across four consecutive nucleotides. The template sequence preferably directs at least one change in the genomic sequence that alters the expression or sequence of an encoded polypeptide, e.g., a change in at least one encoded amino acid, or a change in a promoter or other regulatory element that alters expression of the sequence under control of the regulatory element. In certain embodiments, the positions of the template that are less than 100% complementary to the non-target strand of the DNA duplex target nucleic acid do not introduce changes into a protein sequence after template-based genome editing, i.e., silent mutations. In certain embodiments, the template sequence directs the incorporation of a change in the genomic sequence within the PAM, i.e., by altering the identity or position of one of the G nucleotides relative to the spacer binding site in the non-target strand. In certain embodiments, the incorporation of a change within the genomic sequence of the PAM is a silent mutation. In certain embodiments, the template sequence directs the incorporation of a change in the genomic sequence within the spacer sequence, e.g., within the seed sequence of the spacer, i.e., within the 3-7 nucleotides adjacent to the 5’ end of the PAM sequence in the non-target strand. In certain embodiments, the incorporation of a change within the genomic sequence of the spacer sequence is silent mutation. The introduction of silent mutations within the spacer or PAM sequence can be used to reduce nickase recruitment to the target site.

[0255] As used herein, “a DNA polymerase-recruiting sequence” or “DRS” is located 3’ of a template sequence in a 3’ extension. In some embodiments, the DRS can be about 6-20 nucleotides in length, e.g., 6-17, 8-17, 10-12, 10-14, 10-16, or 12-14 nucleotides in length. In certain embodiments, the DRS is complementary or partially complementary to the flap 5’ of the nick, e.g., contains no more than one mismatch within the first 6 nucleotides at the 5’ end of the DRS in the genomic DNA 5’ to the site for nicking by the nickase. However, it is understood that the length and sequence to which the DRS is complementary is determined, in part, by the nucleotide sequence of the genomic locus to be edited and the availability of a PAM to permit nicking of the genomic DNA. In certain embodiments, the DRS is less than 100% complementary to the non-target strand of the genome. It is understood that reducing the complementarity of the DRS to the non-target strand of the DNA duplex target nucleic acid similarly reduces the complementarity of the DRS to the spacer sequence of the guide RNA. In certain embodiments, the DRS is 100% complementary to the genomic sequence across at least 3 base pairs, optionally at least 4 base pairs. In certain embodiments, the DRS has at least 6 base pairs with the genomic sequence across the length of the DRS. In certain embodiments, the DRS comprises 1 or 2 mismatches within the 5’ half of the DRS, i.e., the end closer to the DRS-template sequence junction. In certain embodiments, the DRS comprises 1 or 2 mismatches within the four most 5’ nucleotides in the DRS. In certain embodiments, the DRS comprises, e.g., further comprises, one or more mismatches in the 3’ half of the DRS. In certain embodiments, the DRS further includes a 3’ tail that is not complementary to the genomic sequence, i.e., the mismatch is not flanked by nucleotides complementary to the genomic sequence. In certain embodiments, the 3’ tail of the DRS is 1-5 nucleotides in length, optionally 1, 2, or 3 nucleotides in length. In preferred embodiments, the most 3’ nucleotide in the 3’ tail is a uridine nucleotide. In certain embodiments, all of the nucleotides of the 3’ tail are uridine nucleotides. For the purpose of determining percent complementarity between the DRS and the genomic sequence, mismatches between the tail and the genomic sequence are not considered in percent identity. In some embodiments, one to three consecutive nucleotides from the 5’ end of the DRS is a DNA nucleotide (2’-H). In other embodiments, the DRS contains entirely DNA nucleotides. In some embodiments, the DRS contains a mixture of DNA and RNA nucleotides. In some embodiments, the 3’ end of the DRS can include non-DNA nucleotides, RNA nucleotides including modified RNA nucleotides, e.g.,2’-OH, 2’-Ome, 2’F, 3’-amine, abasic nucleotides, and 3’-PEG nucleotides; dideoxynucleotides and non-nucleotide linkers.

[0256] As used herein, the term “affinity tag” is understood to refer to a structural element that binds to a polynucleotide sequence, polypeptide sequence, small molecule, or the like. In certain embodiments, affinity tags may be used to mediate binding of polynucleotides such as guide RNAs to a corresponding polypeptide. In certain embodiments, an affinity tag may be an aptamer. In certain embodiments, an affinity tag may be a small molecule such as biotin, desthiobiotin, or digoxigenin.

[0257] As used herein, the term “aptamer” is understood to refer to a structural polynucleotide that binds to a polypeptide sequence, small molecule, or the like. In certain embodiments, aptamers may be used to mediate binding of polynucleotides such as guide RNAs to a corresponding polypeptide. Aptamers may be naturally occurring. For example, some viral nucleic acids bind viral proteins, e.g., the MS2 hairpin that binds to the bacteriophage MS2 coat protein (MCP). As an additional example, bacterial nucleic acids may bind portions of bacterial proteins, e.g., domains from CRISPR endonucleases that bind guide RNAs. Other aptamers may be designed or generated through molecular evolution using known methods in the art. As used herein, the term aptamer does not include the portion of a guide RNA scaffold that binds to a SpyCas9 enzyme.

[0258] As used herein, aptamers are single-stranded oligonucleotides that fold into well- defined three-dimensional shapes, allowing them to bind their targets, preferably with high affinity and specificity. Aptamers fold into defined three-dimensional shapes determined by their primary sequences that are usually about 10–80 nt long. Aptamer structures include binding pockets and clefts through which they bind their respective targets by a combination of van der Waals, hydrogen bonding, salt bridges, hydrophobic and electrostatic interactions for specific recognition. (see, e.g., Banerjee and Nilsen-Hamilton, 2013. Aptamers: multifunctional molecules for biomedical research. Journal of Molecular Medicine.91:1333–1342.)

[0259] In certain embodiments, an aptamer may be the MS2 hairpin (alternatively referred to herein as a MS2-loop, MS2 aptamer, or MS2 RNA loop), which binds the bacteriophage MS2 coat protein (MCP), both of which are well known in the art. The coat protein dimer of bacteriophage MS2 binds specifically to an RNA hairpin in the viral genome, thereby repressing the translation of the viral replicase. This hairpin / translational operator (TR) corresponds tonucleotide positions –15 to +4 relative to the start of the replicase gene and is 19 nt in length. The wild-type TR consists of a 7 base pair stem, interrupted by one unpaired residue between base pairs five and six, and is closed by a 4-nt loop. Various MS2 hairpin and MCP sequences are provided, for example, in Helgstrand et al., 2002. Investigating the structural basis of purine specificity in the structures of MS2 coat protein RNA translational operator hairpins NAR 30:2678-2685; and Lim et al., 1994. Altering the RNA binding specificity of a translational repressor.269:9006-9010. Thus, the structures and requirements for binding of the MS2 hairpin and MCP are well known in the art.

[0260] In certain embodiments, the aptamer may be a cognate RNA for binding the PP7 coat protein, which is well characterized. The structure of the cocrystal of the PP7 coat protein and its cognate RNA reveals the molecular basis of the interaction, and it demonstrates that the conserved beta-sheet surface is a flexible architecture that can evolve to recognize diverse RNA hairpins. Various sequences for the PP7 coat protein and cognate RNA and requirements for binding are known in the art. (see, e.g., Chao et al., 2008. Structural basis for the coevolution of a viral RNA–protein complex www.nature.com / doifinder / 10.1038 / nsmb1327).

[0261] In certain embodiments, aptamers and their cognate binding peptides can be derived from bacterial proteins, including portions of CRISPR proteins and nucleic acids, e.g., polypeptide sequences from CRIPSR endonucleases that bind to portions of cognate guide RNAs sequences. Structural studies have defined these interactions between CRISPR endonucleases and guide RNAs see, e.g., Haurwitz et al., Science. 2010;329:1355-8. doi: 10.1126 / science.1192272 and Mulepati et al., Science.2014;345:1479-84. doi: 10.1126 / science.1256996. Based on these studies, as well as others, those of skill in the art could identify RNA sequences for use as aptamers with their cognate protein binding sequences.

[0262] “Polypeptide” as used herein refers to a multimeric compound comprising amino acid residues that can adopt a three-dimensional conformation. Polypeptides include but are not limited to enzymes, enzyme precursor proteins, regulatory proteins, structural proteins, receptors, nucleic acid binding proteins, antibodies, etc. Polypeptides may, but do not necessarily, comprise post-translational modifications, non-natural amino acids, prosthetic groups, and the like. In some embodiments, a polypeptide may comprise an amino acid sequence provided by a SEQ ID NO listed herein (e.g., in Table 6) that includes an N-terminal methionine. In some embodiments, such a polypeptide may comprise the SEQ ID NO comprising the N-terminal methionine. In otherembodiments, the polypeptide may comprise the SEQ ID NO: as listed, but without the N-terminal methionine. For example, a SEQ ID NO provided herein may, in some embodiments, be operably linked to another moiety at the N-terminus (e.g., a nuclear localization signal, a second polypeptide, etc.). In such embodiments, a person of skill in the art will recognize that the N- terminal methionine is optional. Accordingly, in SEQ ID NOs provided herein that contain an N- terminal methionine residue, the N-terminal methionine residue should be considered an optional feature. Likewise, for nucleic acid sequences provided herein which encode a protein or polypeptide that comprises an N-terminal methionine residue, the nucleotides encoding the N- terminal methionine residue should be considered an optional feature.

[0263] As used herein, “Cas nuclease”, also called “Cas protein” as used herein, encompasses Cas cleavases, Cas nickases, and dCas DNA binding agents. Cas cleavases / nickases and dCas DNA binding agents include a Csm or Cmr complex of a type III CRISPR system, the Cas10, Csm1, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases. As used herein, a “Class 2 Cas nuclease” is a single- chain polypeptide with RNA-guided DNA binding activity. Class 2 Cas nucleases include Class 2 Cas cleavases, Class 2 Cas nickases (e.g., H840A, D10A, or N863A variants), which further have RNA-guided DNA cleavases or nickase activity, and Class 2 dCas DNA binding agents, in which cleavase / nickase activity is inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof. Cpf1 protein, Zetsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like nuclease domain. Cpf1 sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables S1 and S3. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015). In certain embodiments, the Cas9 is a Streptococcus pyogenes Cas9 (SpyCas9)

[0264] As used herein, a “nickase” is an enzyme that creates a single-strand break (also known as a “nick”) in double strand DNA, i.e., cuts one strand but not the other of the DNA double helix. As used herein, an “RNA-guided nickase” means a polypeptide or complex of polypeptides having DNA nickase activity, wherein the DNA nickase activity is sequence-specific and depends on the sequence of the RNA. Exemplary RNA-guided nickases include Cas nickases particularlySpy Cas9 nickases. Cas nickases include, but are not limited to, nickase forms of a Csm or Cmr complex of a type III CRISPR system, the Cas10, Csm1, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases. Class 2 Cas nickases include Class 2 Cas nuclease variants in which only one of the two catalytic domains is inactivated, which have RNA-guided DNA nickase activity. Class 2 Cas nickases include, for example, Cas9 (e.g., H840A, D10A, or N863A variants of SpyCas9), Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof. Cpf1 protein, Zetsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like protein domain. Cpf1 sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables S1 and S3. “Cas9” encompasses S. pyogenes (Spy) Cas9, the variants of Cas9 listed herein, and equivalents thereof. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722- 36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0265] As used herein, a “DNA-dependent DNA polymerase” or “DNA-templated DNA polymerase” (DDP) synthesizes DNA opposite a nucleic acid template preferentially comprised of DNA over RNA. In some embodiments, the extension activity of a DDP on DNA templates consisting only of DNA nucleotides is at least 4-fold higher than the extension activity of the DDP on RNA templates consisting only of RNA nucleotides, as measured, for example using the method provided in Example 3 below. Editing is compared between a template guide having a fully RNA DRS and a fully RNA template against a template guide having a fully RNA DRS and a fully DNA template. Consequently, editing by the editors disclosed herein (a complex comprising a SpyCas9 nickase operably linked to a DDP using a template guide RNA) is at least 10-fold, optionally 20-fold higher than editing with tgRNAs containing RNA template sequences. In some embodiments, repair DDPs such as human DNA polymerase Κ may tolerate a template in which fewer than 100% of the nucleotides are DNA nucleotides. For example, in some embodiments, repair DDPs such as human DNA polymerase Κ may tolerate a template in which 1, 2, or 3 of the nucleotides are RNA nucleotides.

[0266] In certain embodiments, DNA-dependent DNA polymerases are prokaryotic DNA polymerases. In certain embodiments, DNA-dependent DNA polymerases are viral DNApolymerases. In certain embodiments, DNA-dependent DNA polymerases are eukaryotic DNA polymerases.

[0267] In certain embodiments, DNA-dependent DNA polymerases are wild-type DNA polymerases. In certain embodiments, DNA-dependent DNA polymerases are variant DNA polymerases, i.e., not wild-type DNA polymerases. In certain embodiments, a variant DNA polymerase has altered activity as compared to the wild-type polymerase. For example, in certain embodiments, the processivity of the variant polymerase may be increased as compared to the wild-type polymerase. In certain embodiments, an exonuclease or certain exonuclease activity of the variant polymerase may be decreased or abolished as compared to the wild-type polymerase.

[0268] As used herein, an “enhancer” or an “enhancer of template-based genome editing” is a nucleic acid, e.g., siRNA or shRNA, or protein for increasing the efficiency of template-based genome editing. In certain embodiments, one or more enhancers may be used to increase template- based genome editing. See, e.g., Fig. 3D, which shows exemplary mechanisms of action for different enhancers.

[0269] In certain embodiments, an enhancer of template-based genome editing is a DNA repair protein, e.g., an mRNA encoding a DNA repair protein or a DNA repair protein. In certain embodiments, the DNA repair protein is a single-strand endonuclease responsible for removing flaps generated at 3’ of a nick. In certain embodiments, removal of flaps 3’ of a nick includes expression of flap structure-specific endonuclease 1 (FEN1) protein (see, e.g., www.ncbi.nlm.nih.gov / gene / 2237 which is incorporated herein by reference in the version available as of the earliest filing date of this application). The FEN1 protein removes 5' overhanging flaps in DNA repair and processes the 5' ends of Okazaki fragments in lagging strand DNA synthesis. Direct physical interaction between this protein and AP endonuclease 1 during long-patch base excision repair provides coordinated loading of the proteins onto the substrate, thus passing the substrate from one enzyme to another. In certain embodiments, the DNA repair protein is mutL homolog 1 (MLH1) (see, e.g., www. ncbi.nlm.nih.gov / gene / 4292 / , incorporated herein by reference in the version available on the earliest filing date of the instant application). The MLH1 protein can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. In certain embodiments,such an enhancer is used in a dividing cell, e.g., a T cell, e.g., an activated T cell. In certain embodiments, such enhancers are used in a cell that is typically a non-dividing cell, e.g., a liver cell, a monocyte, a neuron, a hematopoietic stem cell, or a muscle cell.

[0270] In certain embodiments, an enhancer of template-based genome editing increases the availability of deoxynucleoside triphosphate (dNTP), e.g., the concentration of dNTP in the nucleus relative to a cell not contacted with such an enhancer, particularly in a cell that is typically a non-dividing cell, e.g., a liver cell. In certain embodiments, increasing the dNTP concentration in the cell comprises inhibiting a deoxynucleotide triphosphate triphosphohydrolase in the cell. In certain embodiments, the deoxynucleotide triphosphate triphosphohydrolase comprises SAM domain and HD domain-containing protein 1 (SAMHD1) (see, e.g., ncbi.nlm.nih.gov / gene / 25939, which is incorporated herein by reference in the version available as of the earliest filing date of this application). In certain embodiments, inhibiting SAMHD1 comprises contacting the SAMHD1 with a Vpx protein, or expressing the Vpx protein in the cell (see, e.g., www. ncbi.nlm.nih.gov / gene / 1724714, which is incorporated herein by reference in the version available as of the earliest filing date of this application). In various aspects, inhibiting SAMHD1 comprises contacting the SAMHD1 with a BGLF4 protein, or expressing the BGLF4 protein in the cell (see, e.g., www.ncbi.nlm.nih.gov / gene / 3783704, which is incorporated herein by reference in the version available as of the earliest filing date of this application). In various aspects, inhibiting SAMHD1 comprises contacting the SAMHD1 with an M97 protein, or expressing the M97 protein in a cell (see, e.g., www.ncbi.nlm.nih.gov / gene / 80532996, which is incorporated herein by reference in the version available as of the earliest filing date of this application). In various aspects, inhibiting SAMHD1 comprises contacting the SAMHD1 with an KSHV ORF36 protein, or expressing the KSHV ORF36 protein in a cell. In various aspects, inhibiting SAMHD1 comprises contacting an mRNA encoding the SAMHD1 with a microRNA, shRNA, or siRNA that hybridizes to the mRNA, or expressing the microRNA, shRNA or siRNA in the cell. In certain embodiments, inhibiting SAMHD1 comprises contacting the SAMHD1 with a small molecule SAMHD1 inhibitor. In certain embodiments, increasing the dNTP concentration in the cell comprises administering dNTPs to the cell. In certain embodiments, administering dNTPs to the cell comprises administering dNTPs to a subject comprising the cell. In various aspects, increasing the dNTP concentration in the cell comprises administering nucleosides or nucleotides to the cell. The nucleosides or nucleotides may include deoxynucleosides (dNs), deoxynucleosidemonophosphates (dNMPs), or nucleoside triphosphates (NTPs). In certain embodiments, the nucleosides or nucleotides are not dNTPs, or do not include dNTPs. In certain embodiments, administering nucleosides or nucleotides to the cell comprises administering the nucleosides or nucleotides to a subject comprising the cell. In certain embodiments, increasing the dNTP concentration in the cell comprises delivering a dNTP synthetic enzyme to the cell. In various aspects, the dNTP synthetic enzyme comprises a kinase. In certain embodiments, the kinase comprises a nucleoside kinase, deoxynucleoside kinase, deoxynucleoside monophsphase kinase, or deoxynucleotide diphosphate kinase. Such enhancers to increase availability of dNTP in a cell are known in the art.

[0271] In certain embodiments, a DNA repair protein-based enhancer is used in combination with an enhancer to increase the availability of dNTP in a cell.

[0272] In some embodiments, the presence of one or more enhancers may increase the efficiency of template-based genome editing by at least five-fold, optionally by at least 10-fold.

[0273] The term “chromatin remodeler,” as used herein, is a polypeptide that is capable of interacting with chromatin and mediating changes in chromatin. The chromatin remodeler may alter the interaction between DNA and DNA binding proteins, thereby increasing chromatin accessibility. In some embodiments, target genomic sequences located in a chromatin-dense region, in particular, may be less susceptible to genome editing. For example, it is known that Cas9 can exhibit reduced editing of targets whose protospacer adjacent motifs (PAMs) are located within nucleosomes. A system or fusion protein comprising a chromatin remodeler may therefore show increased editing efficiency at loci that are positioned within compacted chromatin.

[0274] The term “High Mobility Group Box 1” or “HMGB1,” as used herein in the context of the HMGB1 protein, refers to a non-histone, nuclear DNA-binding protein belonging to the High Mobility Group-Box superfamily, or a portion thereof. The wildtype HMGB1 protein is composed of 215 amino acids in three structural domains: a Box A DNA-binding domain (alternatively referred to as an HMGB1 Box A domain elsewhere herein), an Box B DNA-binding domain (alternatively referred to elsewhere herein as an HMGB1 Box B domain elsewhere herein), and an acidic tail domain. The wildtype HMGB1 protein comprising SEQ ID NO: 1783 may be understood to comprise, from N-terminus to C-terminus, a HMGB1 Box A DNA-binding domain comprising the sequence of amino acid residues 2-78 of SEQ ID NO: 1783, a HMGB1 Box B DNA-binding domain comprising the sequence of amino acid residues 89-162 of SEQ ID NO:1783, a cryptic nuclear localization signal (NLS) comprising the sequence of amino acid residues 179-185 of SEQ ID NO: 1783, and an acidic tail corresponding to amino acid residues 186-215 of SEQ ID NO: 1783. FIG.120 shows an exemplary schematic of the wildtype HMGB1 protein. The term “HMGB1 polypeptide” as used herein refers to a polypeptide comprising the amino acid sequence of HMGB1, or a portion or fragment thereof. For example, in some embodiments, an HMGB1 polypeptide can comprise one or more HMGB1 domains (such as an HMGB1 Box B domain, an HMGB1 Box A domain, and an acidic tail domain). It is understood that, when an HMGB1 polypeptide is present as part of a fusion protein, the HMGB1 polypeptide may be referred as “HMGB1” (e.g., “a fusion protein comprising, from N-terminus to C-terminus, deaminase-first linker-DNA-binding domain-heterologous NLS-second linker-HMGB1”). In some embodiments, the acidic tail may serve as a transcription stimulatory domain. “HMGB1” as used herein in the context of nucleic acids refers to a nucleic acid (e.g., DNA or mRNA) encoding an HMGB1 polypeptide. The human HMGB1 gene has accession number NC_000013.11 (30456704..30617597). It is understood that, when an HMGB1 polypeptide (e.g., an HMGB1 protein of SEQ ID NO: 1783) is present as part of a fusion protein, the N-terminal methionine residue of HMGB1 may be omitted.

[0275] As used herein, in the context of the wildtype HMGB1 protein, the term “Box A” refers to an amino acid sequence comprising or consisting of SEQ ID NO: 1785. In some embodiments, the HMGB1 Box A domain may comprise or consist of amino acid residues 2-78 of SEQ ID NO: 1783. In some embodiments, the HMGB1 Box A domain may have DNA binding activity.

[0276] As used herein, in the context of the wildtype HMGB1 protein, the term “Box B” refers to an amino acid sequence comprising or consisting of SEQ ID NO: 1786. In some embodiments, the HMGB1 Box B domain may comprise or consist of amino acid residues 89-162 of SEQ ID NO: 1783. In some embodiments, the HMGB1 Box B domain may have DNA binding activity.

[0277] As used herein, in the context of the wildtype HMGB1 protein, the term “cryptic nuclear localization signal” or “cryptic NLS” refers to an amino acid sequence comprising or consisting of EKSKKKK (SEQ ID NO: 1787) or a variant thereof. In some embodiments, the cryptic NLS may comprise amino acid residues 179-185 of SEQ ID NO: 1783. In some embodiments, the cryptic NLS may comprise additional amino acid residues. In someembodiments, the cryptic NLS may comprise a part of or all of amino acid residues 166-185 of SEQ ID NO: 1783. In some embodiments, the cryptic NLS disclosed herein comprises a variant of EKSKKKK (SEQ ID NO: 1787) wherein one amino acid residue of SEQ ID NO: 1787 comprises a conservative substitution thereof. As used herein, a cryptic NLS, as provided by SEQ ID NO: 1787, or as a variant thereof, is not a heterologous NLS described herein.

[0278] In some embodiments, the cryptic NLS may have constitutive NLS activity (that is, act as a signal fragment that mediates the nuclear import of the HMGB1 protein). In some embodiments, the cryptic NLS may not have constitutive NLS activity.

[0279] As used herein, in the context of the wildtype HMGB1 protein, the term “receptor for advanced glycation end-products (RAGE) binding domain” or “RAGE binding domain” refers to an amino acid sequence comprising amino acid residues 150-183 of SEQ ID NO: 1783. See also FIG. 120. In some embodiments, the HMGB1 polypeptide described herein comprises a RAGE binding domain, or portion thereof, C-terminal to the HMGB1 Box B domain. In some embodiments, the RAGE binding domain comprises the amino acid sequence of SEQ ID NO: 1803 C terminal to the Box B domain.

[0280] As used herein, in the context of the wildtype HMGB1 protein, the term “acidic tail domain” of an amino acid sequence comprising or consisting of SEQ ID NO: 1788. In some embodiments, the acidic tail domain may comprise or consist of amino acid residues 186-215 of SEQ ID NO: 1783. In some embodiments, the acidic tail domain may have transcriptional stimulatory function.

[0281] As used herein, the term “fusion protein” (or “fusion polypeptide”) refers to a hybrid polypeptide which comprises polypeptides from at least two different proteins or sources. One polypeptide may be located at the amino-terminal (N-terminal) portion of the fusion protein or at the carboxy-terminal (C- terminal) protein thus forming an “amino-terminal fusion protein” or a “carboxy-terminal fusion protein,” respectively. It is understood that, if one or more of the polypeptides includes an N-terminal methionine corresponding to a start codon, the methionine may be omitted from the fusion protein. For example, a polypeptide that is not located at the N- terminal portion in some cases may lack an N-terminal methionine and its coding sequence may similarly lack a start codon in its open reading frame that ordinarily would encode an N-terminal methionine. Any of the proteins provided herein may be produced by any method known in the art. For example, a fusion protein may be expressed in the cell where the activity of the fusionprotein is desired, e.g., in a mammalian cell from an mRNA or expression vector. A fusion protein may be present in a cell. For example, the proteins provided herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker. Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual(4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), the entire contents of which are incorporated herein by reference.

[0282] The term “linker,” as used herein, refers to a chemical group or a molecule linking two adjacent molecules or moieties. Typically, the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond. In some embodiments, the linker is a peptide linker comprising an amino acid or a plurality of amino acids (e.g., a peptide or protein) such as a 16-amino acid residue “XTEN” linker, or a variant thereof (See, e.g., the Examples; and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol.27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 1601), SGSETPGTSESA (SEQ ID NO: 1602), SGSETPGTSESATPEGGSGGS (SEQ ID NO: 1603), or GAPESATESGGTSTESEGSAGPKKKRKVTSTESEGSAGSAGSTSGSSSG (SEQ ID NO: 1600). In some embodiments, the linker comprises an amino acid sequence selected from SEQ ID NOs: 1596-1603, 1604-1665, 1735, 1738, 1815, 1825, 1827, and 1829-1830.

[0283] The term “intein,” as used herein refers to a protein domain capable of mediating a process known as protein splicing. In certain instances, the intein may be one formed from two separate but complementary split inteins that are capable of ligating together to mediate a trans- protein splicing reaction. The term “split intein” refers to an intein that may exist as two separate polypeptide fragments – an N-split-intein (N-intein) and a C-split-intein (C-intein) – where the two polypeptide fragments are capable of ligating together and undergoing a protein trans-splicing reaction culminating in the formation of a peptide bond between polypeptide sequences flanking each split intein. For example, a first split intein positioned at the C-terminus of a first polypeptide (the N-terminal intein or N-intein) and a second split intein positioned at the N-terminus of a second polypeptide (the C-terminal intein or C-intein) may undergo a chemical reaction culminating in the formation of a peptide bond between the first polypeptide and the second polypeptide and the excision of the first and second intein domains. Intein-mediated proteinsplicing is known in the art, and represents a well-established technique for generating a single protein from two separate polypeptides (see, e.g., Shah and Muir. Inteins: Nature’s Gift to Protein Chemists. Chem. Sci., 5(1), 446-461 (2014)).

[0284] The term “heterodimerization domain” can include coiled coil polypeptides capable of self-assembling into stable heterodimers with other coiled coil polypeptides referred to herein as “coiled coil heterodimerization domains.” The coiled coil heterodimerization domain is a ubiquitous protein folding and assembly motif which has been identified in well over 200 natural proteins. Structurally, it is made of α-helices wrapping around each other forming a supercoil, either right- or left-handed. Such structures are well known in the art. In some embodiments, coiled coil heterodimerization domains may comprise EV, EI, KV, and KI domains, where E, V, I, and K are aspartic acid, valine, isoleucine, and lysine, respectively. Exemplary coiled coil heterodimerization domains may comprise, from N-terminus to C-terminus, the sequence EVSALEKEVSALEKENSALEWEVSALEK (EV domain, SEQ ID NO: 1590), KVSALKEKVSALKEKNSALKWKVSALKE (KV domain, SEQ ID NO: 1591), IAALEKEIAALEKENAALEWEIAALEK (EI domain, SEQ ID NO: 1589), EIAALEKEIAALEKENAALEWEIAALEK (EI domain, SEQ ID NO: 1593), or KIAALKEKIAALKEKNAALKWKIAALKE (KI domain, SEQ ID NO: 1595). Coiled coil heterodimerization domains are known in the art and associate with their binding domain (see, e.g., Aronsson C, Dånmark S, Zhou F, Öberg P, Enander K, Su H, Aili D. Self-sorting heterodimeric coiled coil heterodimerization domains with defined and tuneable self-assembly properties. Sci Rep.2015 Sep 15;5:14063. doi: 10.1038 / srep14063). KI domains interact with EI domains to form heterodimers, while KV domains interact with EV domains to form heterodimers.

[0285] As used herein, the terms “nuclear localization signal” (NLS) or “nuclear localization sequence” refers to an amino acid sequence which induces transport of molecules comprising such sequences or linked to such sequences into the nucleus of eukaryotic cells. The nuclear localization signal may form part of the molecule to be transported. In some embodiments, the NLS may be fused to the molecule by a covalent bond, hydrogen bonds, or ionic interactions. In some embodiments, the NLS may be fused to the molecule via a linker.

[0286] As used herein, the term “genomic locus,” when used in the context of a genomic locus being targeted by a guide RNA, includes one or more parts of a genome, the targeting of which affects the expression of the gene that is associated with the locus. For example, a genomiclocus may include a coding sequence of a gene, an intron sequence of a gene, a regulatory sequence, a transcriptional control sequence of a gene, a translational control sequence of a gene, a splicing site, or a non-coding sequence between genes (e.g., intergenic space).

[0287] As used herein, a “target sequence” or “genomic target sequence” refers to a sequence of nucleic acid in a target genomic locus, in either the positive or the negative strand, that has complementarity to the guide sequence of the guide RNA, i.e., that is sufficiently complementary to the guide sequence of the guide RNA to permit specific binding of the guide to the target sequence. The interaction of the target sequence and the guide scaffold sequence directs an RNA-guided DNA binding agent, e.g., a SpyCas9 nickase, to bind, and potentially nick or cleave (depending on the activity of the agent), within the target sequence. The specific length of the target sequence and the number of mismatches possible between the target sequence and the guide sequence depend, for example, on the identity of the Cas9 nickase being directed by the guide RNA. Target sequences for Cas proteins include both the positive and negative strands of genomic DNA (i.e., the sequence given and the sequence’s complement), as a nucleic acid substrate for a Cas protein is a double stranded nucleic acid. Accordingly, where a guide sequence is said to be “complementary to a target sequence,” it is to be understood that the guide sequence may direct SpyCas9 nickase to bind to the complement of a target sequence. Thus, in some embodiments, where the guide sequence binds the complement of a target sequence, the guide sequence is identical to certain nucleotides of the target sequence (e.g., the target sequence which does not include the PAM) except for the substitution of U for T in the guide sequence.

[0288] In some embodiments, the target sequence is in a genomic locus or on a chromosome, for example, and is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence may be about 80%, 85%, preferably about 90%, 95%, or 100%. In some embodiments, the guide sequence and the target sequence may be 100% complementary or identical. In other embodiments, the guide sequence and the target sequence may contain at least one mismatch. For example, the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, where the total length of the duplex formed between the guide sequence and the target sequence in the genome is typically across at least 20 base pairs, with mismatches possible across the base paired region. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence is at least 80%, 85%, preferably at least 90%, or 95%, forexample when, the guide sequence comprises a sequence 20 consecutive nucleotides. In other embodiments, the guide sequence and the target sequence may contain at least one mismatch, i.e., one nucleotide that is not identical or not complementary, depending on the reference sequence.

[0289] As used herein, a “target strand” refers to the strand (positive or negative) of the DNA duplex target nucleic acid that comprises the target sequence.

[0290] As used herein, a “non-target strand” refers to the strand (positive or negative) of the DNA duplex target nucleic acid that comprises a sequence that is complementary to the target sequence.

[0291] As used herein, a “first sequence” is considered to “comprise a sequence that is at least X% identical to” a second sequence if an alignment of the first sequence to the second sequence shows that X% or more of the positions of the second sequence in its entirety are matched by the first sequence. For example, the sequence AAGA comprises a sequence with 100% identity to the sequence AAG because an alignment would give 100% identity in that there are matches to all three positions of the second sequence. The differences between RNA and DNA (generally the exchange of uridine for thymidine or vice versa) and the presence of nucleoside analogs such as modified uridines do not contribute to differences in identity or complementarity among polynucleotides as long as the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine as a complement). Thus, for example, the sequence 5’-AXG where X is any modified uridine, such as pseudouridine, N1-methyl pseudouridine, or 5-methoxyuridine, is considered 100% identical to AUG in that both are perfectly complementary to the same sequence (5’-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well-known in the art. One skilled in the art will understand what choice of algorithm and parameter settings are appropriate for a given pair of sequences to be aligned; for sequences of generally similar length and expected identity >50% for amino acids or >75% for nucleotides, the Needleman-Wunsch algorithm with default settings of the Needleman-Wunsch algorithm interface provided by the EBI at the www.ebi.ac.uk web server is generally appropriate.

[0292] As used herein, “knockdown” or “knockout” refers to a decrease or loss in expression of a particular gene product (e.g., protein, mRNA, or both). Knockdown of a protein can be measured either by detecting protein secreted by tissue or population of cells (e.g., in serumor cell media) or by detecting total cellular amount of the protein from a tissue or cell population of interest. Methods for measuring knockdown of mRNA are known and include sequencing of mRNA isolated from a tissue or cell population of interest. In some embodiments, “knockdown” may refer to some loss of expression of a particular gene product, for example a decrease in the amount of mRNA transcribed or a decrease in the amount of protein expressed or secreted by a population of cells (including in vivo populations such as those found in tissues). In some embodiments, “knockdown” may refer to a decrease of expression to below the level of detection of the assay used.

[0293] As used herein, “reduces or eliminates” (or “reduced or eliminated”) expression of a protein on a cell refers to a partial or complete loss (i.e., to below the limit of detection of the assay used) of expression of the protein, respectively, relative to an unmodified cell. The terms can be used individually or in conjunction. In some embodiments, the surface expression of a protein on a cell is measured by flow cytometry and has “reduced or eliminated” surface expression relative to an unmodified cell as evidenced by a reduction in fluorescence signal upon staining with the same antibody against the protein. A cell that has “eliminated” surface expression of a protein by flow cytometry relative to an unmodified cell may be referred to as “negative” for expression of that protein as evidenced by a fluorescence signal similar to a cell stained with an isotype control antibody. The “reduction or elimination” of protein expression can be measured by other known techniques in the field with appropriate controls known to those skilled in the art, e.g., western blot, ELISA, or immunohistochemistry. In certain embodiments, expression is assayed in a subject sample, e.g., a tissue or body fluid, e.g., urine, blood, or serum or plasma derived therefrom. In certain embodiments, reduction of expression can be assessed in the same subject sample that may not represent reduction at all sites of expression systemically. For example, a protein may be expressed in multiple tissues, but treatment results in reduction of expression predominantly in a single tissue, e.g., in liver. In certain embodiments, reduction can be assessed by an activity assay, or by the level of a surrogate marker present in a subject sample, e.g., urine or blood, that correlates with reduction of protein expression. In certain embodiments, reduction can include a greater reduction of expression of a protein containing a mutation as compared to reduction of expression of the wild-type protein in a subject heterozygous at a particular genomic sequence. In certain embodiments, reduction can include reduction of expression of a protein containing a mutation relative to expression of the wild-type protein. Theratio may be changed, for example, by preferentially reducing the expression of the protein containing a mutation or altering the genomic sequence encoding the protein containing a mutation to the wild-type sequence. In certain embodiments, reduction can include reducing expression of an endogenous protein relative to expression of a protein having a desired polypeptide sequence that may not be a wild-type protein. As used herein, “eliminated” expression is understood as a reduction of expression to below the level of detection of the protein by the method used. It is understood that reduction of expression can include elimination of expression.

[0294] As used herein, “increased” (or “increases”) expression of a protein on a cell refers to an increase in expression of the protein relative to an unmodified cell. In some embodiments, the surface expression of a protein on a cell is measured by flow cytometry and has “increased” surface expression relative to an unmodified cell as evidenced by an increase in fluorescence signal upon staining with the same antibody against the protein. The “increase” of protein expression can be measured by other known techniques in the field with appropriate controls known to those skilled in the art, e.g., western blot, ELISA, or immunohistochemistry. In certain embodiments, expression is assayed in a subject sample, e.g., a tissue or body fluid, e.g., urine, blood, or serum or plasma derived therefrom. In certain embodiments, increase of expression can be assessed in the same subject sample that may not represent increase in all sites of expression systemically. For example, a protein may be expressed in multiple tissues, but treatment results in reduction of expression predominantly in a single tissue, e.g., in liver. In certain embodiments, increase can be assessed by an activity assay, or by the level of a surrogate marker present in a subject sample, e.g., urine or blood, that correlates with an increase of protein expression. In certain embodiments, increase can include a greater increase of expression of a protein a wild-type protein as compared to expression of the protein containing a mutation as in a subject heterozygous at a particular genomic sequence. In certain embodiments, increase can include increase of expression of a wildtype protein relative to expression of the protein containing a mutation. The ratio may be changed, for example, by preferentially increasing the expression of the wild-type protein by altering the genomic sequence encoding the protein containing a mutation to the wild-type sequence.

[0295] “Messenger RNA” or “mRNA” is used herein to refer to a polynucleotide that comprises an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by a ribosome and amino-acylated tRNAs). mRNA can comprise one or more chemically modified nucleosides such as 5-methyl-cytidine (5mC), 2-thio-uridine (2sU), Nl-methylpseudouridine (m1 ψU) and pseudo-uridine (ψU), or a modified cap structure as provided below.

[0296] As used herein, “open reading frame” or “ORF” of a gene refers to a sequence consisting of a series of codons that specify the amino acid sequence of the protein that the gene codes for. The ORF generally begins with a start codon (e.g., ATG in DNA or AUG in RNA) and ends with a stop codon, e.g., TAA, TAG or TGA in DNA or UAA, UAG, or UGA in RNA. The ORF sequences described herein may or may not include a start codon encoding an N-terminal methionine. Thus, in some cases, an ORF described in a SEQ ID NO herein comprises a start codon and the ORF includes the start codon. In other cases, an ORF comprises the sequence of the listed SEQ ID NO but without the start codon provided in the sequence of the listed SEQ ID NO. In some cases, an ORF described in a SEQ ID NO herein comprises a stop codon and the ORF includes the stop codon. In other cases, an ORF comprises the sequence of the listed SEQ ID NO but without the stop codon provided in the sequence of the listed SEQ ID NO.

[0297] “Polynucleotide” and “nucleic acid” are used herein to refer to a multimeric compound comprising nucleosides or nucleoside analogs which have nitrogenous heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof. A nucleic acid “backbone” can be made up of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide- nucleic acid bonds (“peptide nucleic acids” or PNA; PCT No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. Sugar moieties of a nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2’ methoxy, 2’ halide, or 2’-O-(2-methoxyethyl) (2’-O-moe) substitutions. Nitrogenous bases can be conventional bases (A, G, C, T, U), analogs thereof (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine, or others); inosine; derivatives of purines or pyrimidines (e.g., N4- methyl deoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituent groups at the 5 or 6 position (e.g., 5-methylcytosine), purine bases with a substituent at the 2, 6, or 8 positions, 2-amino-6-methylaminopurine, O6-methylguanine, 4-thio-pyrimidines, 4-amino-pyrimidines, 4-dimethylhydrazine-pyrimidines, and O4-alkyl-pyrimidines; US Pat. No. 5,378,825 and PCT No. WO 93 / 13121). For general discussion see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11thed., 1992). Nucleic acids can include one or more “abasic” residues where the backbone includes no nitrogenous base for position(s) of the polymer(US Pat. No. 5,585,481). A nucleic acid can comprise only conventional RNA or DNA sugars, bases and linkages, or can include both conventional components and substitutions (e.g., conventional bases with 2’ methoxy linkages, or polymers containing both conventional bases and one or more base analogs). Nucleic acid includes “locked nucleic acid” (LNA), an analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation, which enhance hybridization affinity toward complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). Nucleic acid includes “unlocked nucleic acid” enables the modulation of the thermodynamic stability and also provides nuclease stability. RNA and DNA have different sugar moieties and can differ by the presence of uridine or analogs thereof in RNA and thymine or analogs thereof in DNA. It is understood that depending on the function of the polynucleotide, certain nucleosides or nucleoside analogs may be preferred, or certain nucleosides or nucleoside analogs may not be tolerated.

[0298] As used herein, a “population of cells comprising edited cells” (or “population of cells comprising engineered cells”) or the like refers to a cell population that comprises edited cells (or engineered cells), however not all cells in the population must be edited. A cell population comprising edited cells may also include non-edited cells. The percentage of edited cells within a cell population comprising edited cells may be determined by counting the number of cells within the population that are edited in the population as determined by standard cell counting methods, e.g., cell sorting, immunohistochemistry, NGS. For example, in some embodiments, a cell population comprising edited cells comprising a single genome edit will have at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, preferably at least 50%, 60%, 70%, 80%, 90%, or 95% of the cells in the population with the single edit. As used herein, the population of cells comprising edited cells can be a population of cells comprising a template-based edited cells. In certain embodiments, the template-based edited cells may further include non-template based edits, e.g., byproduct edits not encoded by the template.

[0299] As used herein, a “subject” refers to any member of the animal kingdom. In some embodiments, “subject” refers to humans. In some embodiments, “subject” refers to non-human animals. In some embodiments, “subject” refers to primates. In some embodiments, a subject may be a transgenic animal, genetically engineered animal, or a clone. In certain embodiments of the present disclosure the subject is an adult, an adolescent, or an infant. In some embodiments, terms “individual” or “patient” are used and are intended to be interchangeable with “subject”.

[0300] As used herein, a “control” is understood as an appropriate matched sample or subject for comparison. For example, a control can be a cell population treated in the same manner as the test population except that the treatment used for the control population lacks at least one active agent, e.g., a guide RNA, an mRNA encoding a SpyCas9 nickase, an insertion construct, a lipid formulation. In certain embodiments, a control may be an internal control, e.g., a cell population or subject prior to treatment.

[0301] As used herein, the term “contact” refers to providing at least one component so that the component physically contacts a cell, including physically contacting the cell surface, cytosol, or nucleus of the cell. “Contacting” a cell with a polypeptide encompasses, for example, contacting the cell with a nucleic acid that encodes the polypeptide and allowing the cell to express the polypeptide.

[0302] As used herein, “delivering” and “administering” are used interchangeably, and include ex vivo and in vivo applications.

[0303] Co-administration, as used herein, means that a plurality of substances are administered sufficiently close together in time so that the agents act together. Co-administration encompasses administering substances together in a single formulation and administering substances in separate formulations close enough in time so that the agents act together.

[0304] As used herein, “treatment” refers to any administration or application of a therapeutic for disease or disorder in a subject, and includes inhibiting the disease, arresting its development, relieving one or more symptoms of the disease, curing the disease, or preventing one or more symptoms of the disease, including reoccurrence of the symptom.

[0305] As used herein, the phrase “pharmaceutically acceptable” means that which is useful in preparing a pharmaceutical composition that is generally non-toxic and is not biologically undesirable and that are not otherwise unacceptable for pharmaceutical use. Pharmaceutically acceptable generally refers to substances that are non-pyrogenic. Pharmaceutically acceptable can refer to substances that are sterile, especially for pharmaceutical substances that are for injection or infusion.

[0306] Before describing the present teachings in detail, it is to be understood that the disclosure is not limited to specific compositions or process steps, as such may vary. It should be noted that, as used in this specification and the appended claims, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. Thus, for example,reference to “a conjugate” includes a plurality of conjugates and reference to “a cell” includes a plurality of cells and the like.

[0307] The term “about” or “approximately” means an acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, or a degree of variation that does not substantially affect the properties of the described subject matter, or within the tolerances accepted in the art, e.g., within 10%, 5%, 2%, or 1% or within two standard deviations of a set of values. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. When “about” is present before the first value of a series, it is understood to modify each value in the series.

[0308] Numeric ranges are inclusive of the numbers defining the range. Measured and measurable values are understood to be approximate, taking into account significant digits and the error associated with the measurement. Also, the use of “comprise”, “comprises”, “comprising”, “contain”, “contains”, “containing”, “include”, “includes”, and “including” are not intended to be limiting. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the teachings.

[0309] Unless specifically noted in the specification, embodiments in the specification that recite “comprising” various components are also contemplated as “consisting of” or “consisting essentially of” the recited components; embodiments in the specification that recite “consisting of” various components are also contemplated as “comprising” or “consisting essentially of” the recited components; and embodiments in the specification that recite “consisting essentially of” various components are also contemplated as “consisting of” or “comprising” the recited components (this interchangeability does not apply to the use of these terms in the claims).

[0310] The term “or” is used in an inclusive sense, i.e., equivalent to “and / or” unless the context clearly indicates otherwise.

[0311] Ranges are understood to include the numbers at the end of the range and all logical values therebetween. For example, 5-10 nucleotides is understood as 5, 6, 7, 8, 9, or 10 nucleotides, whereas 5-10% is understood to contain 5% and all possible values through 10%.

[0312] At least 17 nucleotides of a 20 nucleotide sequence is understood to include 17, 18, 19, or 20 nucleotides of the sequence provided, thereby providing a upper limit even if one is not specifically provided as it would be clearly understood. Similarly, up to 3 nucleotides would be understood to encompass 0, 1, 2, or 3 nucleotides, providing a lower limit even if one is not specifically provided. When “at least,” “up to,” or other similar language modifies a number, it is understood to modify each number in the series.

[0313] As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex region of “no more than 2 nucleotide base pairs” has a 2, 1, or 0 nucleotide base pairs. When “no more than” or “less than” is present before a series of numbers or a range, it is understood that each of the numbers in the series or range is modified.

[0314] In the event of a conflict between a sequence in the application and an indicated accession number or position in an accession number, the sequence in the application predominates.

[0315] As used herein, “detecting an analyte” and the like is understood as performing an assay in which the analyte can be detected, if present, wherein the analyte is present in an amount above the level of detection of the assay.

[0316] As used herein, it is understood that when the maximum amount of a value is represented by 100% (e.g., 100% inhibition or 100% encapsulation) that the value is limited by the method of detection. For example, 100% inhibition is understood as inhibition to a level below the level of detection of the assay, and 100% encapsulation is understood as no material intended for encapsulation can be detected outside the vesicles.

[0317] As used herein, “consecutive” is understood as following one after another without interruption; successive, contiguous.

[0318] Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the invention is described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the invention as defined by the appended claims and included embodiments.Template Guide RNA

[0319] Provided here are a template guide RNA (tgRNA) comprising a first polynucleotide and a second polynucleotide, wherein: (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is reverse complementary to at least 6 nucleotides of a DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS is 6-20 nucleotides in length, optionally 10-14 nucleotides in length. In some embodiments, the DRS comprises at least one of: (a) a sequence not fully complementary to the DRS-complementary region of the non- target strand of the DNA duplex target nucleic acid; (b) a 1-5 nucleotide, optionally a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide; or a terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage. In some embodiments, the DRS of the tgRNA comprises DNA nucleotides. In some embodiments, the DRS of the tgRNA comprises both RNA nucleotide(s) and DNA nucleotide(s).

[0320] Provided here are systems comprising a template guide RNA (tgRNA) comprising a first polynucleotide and a second polynucleotide, wherein: (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) having a 3’ end and a 5’ end; wherein the 5’ end of the DRS iscovalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is reverse complementary to at least 6 nucleotides of a DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides.

[0321] In some embodiments, the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid; and wherein the DRS comprises at least one of: (1) a sequence not fully complementary to the DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid; (2) a 1-5, optionally a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide; or (3) a 5’ terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage. In some embodiments, the DRS of the tgRNA comprises DNA nucleotides. In some embodiments, the DRS of the tgRNA comprises both RNA nucleotide(s) and DNA nucleotide(s).

[0322] In some embodiments, the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the templatecomprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides; and wherein the DRS comprises at least one of: (1) a sequence not fully complementary to the DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid; (2) a 1-5, optionally a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide; or (3) a 5’ terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage.

[0323] In some embodiments, the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is about 6-18 nucleotides in length, optionally about 8-18 or 10-12 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS of the tgRNA comprises DNA nucleotides. In some embodiments, the DRS of the tgRNA comprises both RNA nucleotide(s) and DNA nucleotide(s).

[0324] In some embodiments, the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the firstpolynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is about 6-18 nucleotides in length, optionally about 8-18 or 10-12 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides.

[0325] In some embodiments, the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length, and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid comprising nucleotides 5-105’ of the PAM in the non-target strand of the DNA duplex target nucleic acid. In some embodiments, the DRS of the tgRNA comprises DNA nucleotides. In some embodiments, the DRS of the tgRNA comprises both RNA nucleotide(s) and DNA nucleotide(s).

[0326] In some embodiments, the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein (a) the first polynucleotide comprises a SpyCas9 guide RNA comprising: (i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and (ii) a scaffold; and (b) the second polynucleotide is operably linked to the first polynucleotide and comprises: (i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid,wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and (ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 6-17 or 10-14 nucleotides in length, and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid comprising nucleotides 5-105’ of the PAM in the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides.

[0327] In some embodiments, the first region in the target strand and the second region in the non-target strand each base pair with a strand of the DNA duplex independently for 6-20 consecutive nucleotides within the spacer genomic target sequence. In some embodiments, the first region in the target strand and the second region in the non-target strand base pair with a strand of the DNA duplex independently for 6-16 consecutive nucleotides within the spacer genomic target sequence. In some embodiments, the first region in the target strand and the second region in the non-target strand base pair with a strand of the DNA duplex independently for 6-10 consecutive nucleotides within the spacer genomic target sequence. In some embodiments, the first region in the target strand and the second region in the non-target strand each base pair with a strand the DNA duplex independently for at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides within the spacer genomic target sequence.

[0328] In some embodiments, the first polynucleotide is covalently linked to the second polynucleotide. In some embodiments, the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide. In some embodiments, the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphodiester bond or a phosphorothioate (PS) bond. In some embodiments, the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphodiester bond. In some embodiments, the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate bond. In some embodiments, the first polynucleotide is linked to the second polynucleotide by a non-nucleotide linker. In some embodiments, the first polynucleotide is linked to the second polynucleotide by an internal linker. In some embodiments, the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by an internal linker.

[0329] Provided herein are guide RNAs that in some embodiments include an operably linked 3’ extension sequence, referred to herein as template guides (tgRNA). As used herein, a guide RNA (gRNA) is understood to include at least a spacer (targeting) sequence that is complementary to a target sequence in a genomic locus; and a scaffold sequence for binding a SpyCas9 nickase. The spacer and scaffold can be in a single polynucleotide, i.e., a single guide RNA (sgRNA), or in two polynucleotides, i.e., a dual guide RNA (dgRNA) in which the crRNA and tracrRNA are separate polynucleotides.

[0330] In certain embodiments, the guide RNA may be operably linked to a 3’-extension (i.e., a template guide RNA (tgRNA)). A 3’ extension includes, 5’ to 3’, a template and a DNA polymerase recruiting sequence (DRS). The template and DRS are covalently linked by a polynucleotide backbone linkage, e.g., a phosphodiester or phosphorothioate linkage, preferably a phosphorothioate linkage. When covalently attached, the 3’ extension is covalently attached, directly or indirectly, to the 3’ end of the scaffold. When the 3’ extension is not covalently attached to the 3’ end of the scaffold, it is referred to herein as a separable 3’ extension as it provides the same features at a site of template-based genome editing. When the 3’ extension is not covalently linked to the 3’ end of the scaffold, it can be retained at the site of template-based genome editing by binding to the polymerase, e.g., via an affinity tag to a 3’ extension-recruiting domain in the polymerase.

[0331] It is understood that each the spacer and scaffold, the template, and the DRS have distinct functions. These distinct functions result in different tolerances for various nucleotides including chemically modified nucleotides and are provided herein. Therefore, as discussed herein, the terms “unmodified nucleotide” or “modified nucleotide” can be understood differently depending on the particular structure in which the nucleotide is present. Similarly, modified nucleotides for inclusion in an ORF or mRNA are different from those for inclusion in a guide RNA. Such considerations are well understood in the art.

[0332] In some embodiments, the first polynucleotide sequence and the second polynucleotide sequence are provided as part of separate polynucleotide chains (i.e., the 3’ extension is a separable 3’ extension). In some embodiments, the separate polynucleotide chains comprising the first and second polynucleotide sequences, optionally with the first polynucleotide sequence complexed with SpyCas9 and the second polynucleotide sequence complexed with a DNA-dependent DNA polymerase, may be operably linked by being targeted to at least partiallycomplementary sequences on opposite DNA strands of a genomic locus, i.e., nucleotide sequences that would base pair in the DNA duplex in the absence of disruption of the duplex, e.g., by a tgRNA. In some embodiments, the second polynucleotide sequence may be complexed to the DNA-dependent DNA polymerase through an affinity tag that binds to a corresponding domain on the DNA-dependent DNA polymerase.

[0333] In some embodiments, the separate polynucleotide chains comprising the first and second polynucleotide sequences may be operably linked by forming a complex with a single polypeptide or a single polypeptide heterodimer, optionally wherein the polypeptide or single polypeptide heterodimer comprises SpyCas9 and a DNA-dependent DNA polymerase. In some embodiments, the first polynucleotide sequence may be complexed with SpyCas9 and the second polynucleotide sequence may be complexed with the DNA-dependent DNA polymerase. In some embodiments, the second sequence may be complexed with the DNA-dependent DNA polymerase through an affinity tag that binds to a corresponding 3’ extension recruiting domain on the single polypeptide or single polypeptide heterodimer. Guide RNAs Target / Spacer Sequences and Genes

[0334] In some embodiments, the methods and compositions of the present disclosure utilize a SpyCas9 nickase, and a SpyCas9 guide RNA. In some embodiments, the target region of the target strand complementary to the spacer of the SpyCas9 guide RNA is complementary to the non-target region of the non-target strand. The non-target region of the non-target strand, in turn, may be complementary to the DRS independently over at least six consecutive nucleotides, e.g. over 6-20 consecutive nucleotides, e.g., over 5-20, 2-10, or 2-16 consecutive nucleotides relative to the target site of the spacer genomic target sequence in the DNA duplex target nucleic acid (See, e.g., Figs.2A and B). In other words, the sequence of the target region of the target strand may be identical to or partially identical to the sequence of the DRS independently over at least six consecutive nucleotides, e.g., over 6-20 consecutive nucleotides, e.g., over 5-20 2-10, or 2-16 consecutive nucleotides. In some embodiments, the SpyCas9 guide RNA spacer and scaffold target the SpyCas9 nickase to nick the non-target strand of the DNA duplex target nucleic acid.

[0335] For example, a non-target strand of a DNA duplex target nucleic acid may be nicked by a SpyCas9 nickase by being directed to the target site by a guide RNA. A target sequence for aCas nuclease is located near its cognate PAM sequence. A SpyCas9 nickase may be directed by a guide RNA to a target sequence of a gene, where the guide RNA hybridizes with and the SpyCas9 nicks the non-target strand adjacent to its cognate PAM. The target sequence may be complementary or have identity to a spacer sequence (i.e., targeting sequence) of the guide RNA, and the cleavage may occur on one or both strands, preferably on a non-target strand, depending on the activity of the SpyCas9 nuclease. In some embodiments, the target sequence may have complementarity to a spacer sequence (i.e., targeting sequence) of the guide RNA, and the cleavage may occur on a non-target strand. In some embodiments, the degree of complementarity between a targeting sequence of a guide RNA and the portion of the corresponding target sequence that hybridizes to the guide RNA may be about 80%, 85%, preferably about 90%, 95%, or 100%. In some embodiments, the percent identity between a targeting sequence of a guide RNA and the portion of the corresponding target sequence that hybridizes to the guide RNA may be about 80%, 85%, preferably about 90%, 95%, or 100%. The homology region of the target is adjacent to a cognate PAM sequence. In some embodiments, the target sequence may comprise a sequence 100% complementary or 100% identical with the targeting sequence of the guide RNA. In other embodiments, the target sequence may comprise at least one mismatch, deletion, or insertion, as compared to the targeting sequence of the guide RNA.

[0336] The length of the target sequence may depend on the nuclease system used. For example, the targeting sequence of a guide RNA for a CRISPR / SpyCas9 system may be 16, 17, 18, 19, 20, 21, or 22 nucleotides in length and the target sequence is a corresponding length, adjacent to a PAM sequence. In some embodiments, the target sequence is 16-22 nucleotides in length. In preferred embodiments, the target sequence is 18-20 nucleotides in length, e.g., 20 nucleotides in length.

[0337] The target nucleic acid molecule may be any DNA molecule that is endogenous or exogenous to a cell, e.g., a DNA molecule of a pathogen, e.g., a virus. In some embodiments, the target nucleic acid molecule is a genomic DNA. In some embodiments, the target sequence of the gene may be a genomic sequence from a cell or in a cell, including a human cell. In some embodiments, the target sequence of the gene may be a genomic sequence from a pathogen.

[0338] In further embodiments, the target sequence may be a viral sequence. In further embodiments, the target sequence may be a pathogen sequence. In further embodiments, the target sequence may be a genomic sequence. In certain embodiments, the target sequence may comprisea translocation junction, e.g., a translocation associated with a cancer. In some embodiments, the target sequence may be on a eukaryotic chromosome, such as a human chromosome.

[0339] In some embodiments, the target sequence may be located in a genomic locus; for example, the target sequence may be located in a coding sequence of a gene, an intron sequence of a gene, a regulatory sequence, a transcriptional control sequence of a gene, a translational control sequence of a gene, a splicing site, or a non-coding sequence between genes (e.g., intergenic space). In some embodiments, the gene may be a protein coding gene. In other embodiments, the genomic locus may be at a non-coding locus. In some embodiments, the target sequence may be in a disease-associated gene. In some embodiments, the target sequence may be located in a non-genic functional site in the genome, for example a site that controls aspects of chromatin organization, such as a scaffold site or locus control region.

[0340] In some embodiments involving a Cas nuclease, such as a Class 2 Cas nuclease, the target sequence may be adjacent to a protospacer adjacent motif (“PAM”). In some embodiments, the PAM may be adjacent to or within 1, 2, 3, or 4, nucleotides of the 3’ end of the target sequence. The length and the sequence of the PAM may depend on the Cas protein used. For example, the PAM may be selected from a consensus or a particular PAM sequence for a specific SpyCas9 protein or SpyCas9 ortholog, including those disclosed in Figure 1 of Ran et al., Nature, 520: 186- 191 (2015), and Figure S5 of Zetsche 2015, the relevant disclosure of each of which is incorporated herein by reference. In some embodiments, the PAM may be 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. Non-limiting exemplary PAM sequences include NGG, NGGNG, NG, NAAAAN, NNAAAAW, NNNNACA, GNNNCNNA, TTN, and NNNNGATT (wherein N is defined as any nucleotide, and W is defined as either A or T). In some embodiments, the PAM sequence may be NGG. In some embodiments, the PAM sequence may be NGGNG. In some embodiments, the PAM sequence may be TTN. In some embodiments, the PAM sequence may be NNAAAAW. It is understood that SpyCas9 nucleases can be modified to alter PAM recognition. It is understood that the use of SpyCas9 nuclease with altered PAM recognition is within the scope of the disclosure provided herein. Guide RNA Scaffolds

[0341] In some embodiments, the guide RNA is a SpyCas9 guide RNA. In the case of a SpyCas9 single guide RNA (sgRNA), the above guide sequences may further comprise additionalnucleotides to form a sgRNA, e.g., with the following exemplary nucleotide sequence following the 3’ end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 22) in 5’ to 3’ orientation.

[0342] In the case of a sgRNA, the above guide sequences may further comprise additional nucleotides to form a sgRNA, e.g., with any one of the following exemplary nucleotide sequence following the 3’ end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 4) in 5’ to 3’ orientation; or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAUGG CACCGAGUCGGUGCU (SEQ ID NO: 26) in 5’ to 3’ orientation.

[0343] In the case of a sgRNA, the guide sequences may be integrated into the following modified motif: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 309) where “N” may be any natural or non-natural nucleotide, preferably an RNA nucleotide; sugar moieties of the nucleotide can be ribose, deoxyribose, or similar compounds with substitutions; m is a 2’-O-methyl modified nucleotide, and * is a phosphorothioate linkage to the adjacent nucleotide residue; and wherein the N’s are collectively the nucleotide sequence of a guide sequence. In the context of a modified sequence, unless otherwise indicated, A, C, G, and U are an unmodified adenine, cytosine, guanine, and uridine, respectively, RNA nucleotides, i.e., a 2’-OH sugar moiety with a phosphodiesterase linkage to the adjacent nucleotide residue, or a 5’- terminal PO4; and N is any of A, C, G, and U.

[0344] In the case of an sgRNA, the guide sequences may further comprise a SpyCas9 sgRNA scaffold sequence (also referred to herein as the conserved portion of a SpyCas9 sgRNA sequence) disclosed herein (See e.g., Tables 1A and 1C). Thus, in some embodiments, the sgRNA may comprise, from 5’ to 3’, the guide sequence and the conserved portion of the SpyCas9 sgRNA sequence described herein. An example of a SpyCas9 sgRNA sequence is shown in Table 5 (SEQ ID NO: 22: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC – “Exemplary SpyCas9 sgRNA-1”), included at the 3’ end of the guide sequence, and provided with the domains as shown in Table 5A below. LS is lower stem. B is bulge. US is upper stem. H1 and H2 are hairpin 1 and hairpin 2, respectively. Collectively H1 and H2 are referred to as the hairpin region. A model of the structure is provided in Figure 10A of WO2019237069 which is incorporated herein by reference.

[0345] The nucleotide sequence of Exemplary SpyCas9 sgRNA-1 may serve as a template or a backbone sequence for specific chemical modifications, sequence substitutions and truncations.

[0346] In certain embodiments, the guide RNA is an sgRNA or a dgRNA, for example, and it optionally comprises a chemical modification. In some embodiments, the modified sgRNA comprises a guide sequence and a SpyCas9 sgRNA sequence, e.g., Exemplary SpyCas9 sgRNA- 1. A guide RNA, such as an sgRNA, may include modifications on the 5’ end of the guide sequence or on the 3’ end of the SpyCas9 sgRNA sequence, such as, e.g., Exemplary SpyCas9 sgRNA-1 at one or more of the terminal nucleotides, e.g., at 1, 2, 3, or 4 of the nucleotides at the 3’ end or at the 5’ end. In certain embodiments, the modified nucleotide is selected from a 2’-O-methyl (2’- Ome or 2’-O-Me) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, or an inverted abasic modified nucleotide; or a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-Ome modified nucleotide. In certain embodiments, the modified nucleotide includes a PS linkage. In certain embodiments, the modified nucleotide includes a 2’- Ome modified nucleotide and a PS linkage.

[0347] In certain embodiments, using SEQ ID NO: 22 (“Exemplary SpyCas9 sgRNA-1”) as an example, the Exemplary SpyCas9 sgRNA-1 further includes one or more of: (A) a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein (1) at least one of the following pairs of nucleotides are substituted in hairpin 1 with Watson-Crick pairing nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, and the hairpin 1 region optionally lacks (a) any one or two of H1-5 through H1-8, (b) one, two, or three of the following pairs of nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or (c) 1-8 nucleotides of hairpin 1 region; or (2) the shortened hairpin 1 region lacks 4-8 nucleotides, preferably 4-6 nucleotides, and (a) one or more of positions H1-1, H1-2, or H1-3 is deleted or substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 22), or (b) one ormore of positions H1-6 through H1-10 is substituted relative to Exemplary SpyCas9 sgRNA- 1(SEQ ID NO: 22); or (3) the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 22); or (B) a shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include less than or equal to 4 substitutions relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 22); or (C) a substitution relative to Exemplary SpyCas9 sgRNA- 1 (SEQ ID NO: 22) at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2 and H2-14, wherein the substituent nucleotide is neither a pyrimidine that is followed by an adenine, nor an adenine that is preceded by a pyrimidine; or (D) an Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 22) with an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US1-US12 in the upper stem region, wherein (1) the modified nucleotide is optionally selected from a 2’-O-methyl (2’-Ome) modified nucleotide, a 2’-O-(2- methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or a combination thereof; or (2) the modified nucleotide optionally includes a 2’-Ome modified nucleotide.

[0348] In some embodiments, the unmodified sgRNA comprises the following sequence: (N)20GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGA AAGGGCACCGAGUCGGUGC (SEQ ID NO: 176 or 120); or (N)20GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGA AAGGGCACCGAGUCGGUGCU (SEQ ID NO: 105).

[0349] In some embodiments, the sgRNA comprises a modified motif disclosed herein, including any modified motif shown in Tables 1A, 1B, 1C, and 1D, where a guide RNA, or “N” may be any natural or non-natural nucleotide, preferably an RNA nucleotide; sugar moieties of the nucleotide can be ribose, deoxyribose, or similar compounds with substitutions; m is a 2’-O-methyl modified nucleotide, and * is a phosphorothioate linkage to the adjacent nucleotide residue; and wherein the N’s are collectively the nucleotide sequence of a guide sequence.

[0350] In the context of a modified sequence, unless otherwise indicated, A, C, G, and U are an unmodified adenine, cytosine, guanine, and uridine, respectively, RNA nucleotide, i.e., a2’-OH sugar moiety with a phosphodiester linkage to the adjacent nucleotide residue, or a 5’- terminal PO4; and N is any of A, C, G, and U.

[0351] In some embodiments, the guide RNA that directs the SpyCas9 nickase to a genomic locus is a SpyCas9 guide RNA. In some embodiments, the SpyCas9 guide RNA is a single guide RNA comprising: a conserved portion of an sgRNA comprising an upper stem and hairpin region, wherein every nucleotide in the upper stem region is modified with 2’-O-Me, and every nucleotide in the hairpin region is modified with 2’-O-Me; a 3’ end modification comprising 2’-O-Me modified nucleotides at the last three nucleotides of the 3’ end and phosphorothioate (PS) bonds between the last four nucleotides of the 3’ end; and 5’ end modification comprising 2’-O- Me modified nucleotides at the first three nucleotides of the 5’ end; and phosphorothioate (PS) bonds between the first four nucleotides of the 5’ end.

[0352] In some embodiments, the SpyCas9 guide RNA is a short-single guide RNA (short- sgRNA) comprising a conserved portion of an sgRNA comprising a hairpin region, wherein the hairpin region lacks at least 5-10 nucleotides and wherein the short-sgRNA comprises (i) a 5’ end modification or (ii) a 3’ end modification.

[0353] In some embodiments, the first guide RNA is a SpyCas9 guide RNA that is a single guide RNA comprising a nucleotide sequence selected from SEQ ID NOs: 159-167, 170-177, and 180-194, or a nucleotide sequence that is at least 85%, 90%, or 95% identical to SEQ ID NOs: 159-167, 170-177, and 180-194.

[0354] In some embodiments, the first guide RNA is a SpyCas9 guide RNA that is a single guide RNA comprising a nucleotide sequence selected from SEQ ID NOs: 1-39 or 101-130, or a nucleotide sequence that is at least 85%, 90%, or 95% identical to SEQ ID NOs: 1-39 or 101-130. In some embodiments, the first guide RNA is a SpyCas9 guide RNA that is a single guide RNA comprising a nucleotide sequence of SEQ ID NO: 27.

[0355] In some embodiments, the sgRNA comprises Exemplary SpyCas9 sgRNA-1 or the modified versions thereof provided herein, or a version as provided in Tables 1B or 1D, where the totality of the N’s comprise a guide sequence that directs a SpyCas9 nickase to a target sequence. Each N is independently modified or unmodified. In certain embodiments, in the absence of an indication of a modification, the nucleotide is an unmodified RNA nucleotide residue, i.e., a ribose sugar and a phosphodiester backbone.

[0356] In some embodiments, the guide RNA comprises a nucleotide sequence selected from the SpyCas9 guide RNA sequences in Table 1B, wherein the (N)20’s are collectively a guide sequence. In some embodiments, each nucleotide of the Spy guide RNA Sequences in Table 1B is any natural or nonnatural nucleotide. In some embodiments, the guide RNA comprises a nucleotide sequence of SEQ ID NO: 120. Table 1B: Exemplary Unmodified SpyCas9 Guide RNA Sequenceswherein the Ns collectively are a guide sequence provided herein. Within the table, in the context of an unmodified sequence, A, C, G, U, and N are, independently, any natural or non-natural adenine, cytosine, guanine, uridine, and any nucleotide (e.g., A, C, G, or U), respectively.

[0357] In some embodiments of the SpyCas9 guide RNA disclosed herein, the guide sequence may be integrated into the following modified guide scaffold (Table 1C). The #mer refers to the length of the guide RNA when a 20-nucleotide guide sequence, either a modified or unmodified sequence, is included 5’ to the scaffold sequence provided in Table 1C: Table 1C: Exemplary Modified Spy Guide Scaffold Sequences

[0358] In some embodiments, the guide RNA comprises a nucleotide sequence selected from the SpyCas9 guide RNA sequences in Table 1D, wherein the mN*mN*mN*(N)17 or (mN*)3 N17 are collectively a guide sequence. Table 1D. Exemplary Modified SpyCas9 Guide RNA Sequences

[0359] In Tables 1A-1D, SEQ ID NOs: 29-34, 36-37, 121-128, 251-268, 270-271, 300, 335-346, 375-383, and 446-454 comprise a guide RNA scaffold sequence and a 3’ extension sequence as described herein. SEQ ID NOs: 1-28, 35, 38-39, 40, 101-120, 129-130, 131, 201-218, 225-250, 269, 272-273, 274-276, 301-318, 323-325, 326-334, 347-349, 372-374, 431-433, 434- 446 comprise a guide RNA scaffold sequence but do not comprise a 3’ extension. In some embodiments, the guide RNA comprises a guide RNA scaffold sequence comprising any one of SEQ ID NOs: 1-28, 35, 38-39, 40, 101-120, 129-130, 131, 201-218, 225-250, 269, 272-273, 274- 276, 301-318, 323-325, 326-334, 347-349, 372-374, 431-433, 434-446. In some embodiments, the guide RNA comprises a nucleotide sequence comprising any one of SEQ ID NOs: 29-34, 36-37, 121-128, 251-268, 270-271, 300, 335-346, 375-383, and 446-454, but lacking the 3’ extension of that sequence. For example, in some embodiments, the guide RNA may comprise a guide RNA scaffold sequence of any one of SEQ ID NOs: 29-34, 36-37, 121-128, 251-268, 270-271, 300, 335-346, 375-383, and 446-454, but with a different 3’ extension sequence than that provided in the above sequences. As will be apparent from the disclosure provided herein, the sequence of a 3’ extension can vary depending on the desired edit to be introduced into a genomic sequence. A 3’ extension can be designed for the desired edit, according to the principles set forth herein, and the 3’ extension can, in some embodiments, be linked to a guide RNA scaffold sequence, e.g., the guide RNA scaffold sequences provided in Tables 1A-1D, e.g., SEQ ID NOs: 1-28, 35, 38-39, 40,101-120, 129-130, 131, 201-218, 225-250, 269, 272-273, 274-276, 301-318, 323-325, 326-334, 347-349, 372-374, 431-433, 434-446. In some embodiments, where any of the sequences in Tables 1A-1D comprise a 3’ terminal uridine, the guide RNA comprising the sequence does not comprise a 3’ terminal uridine. In some embodiments, where any of the sequences in Tables 1C-1D comprise one or more phosphorothioate (PS) bonds between the last four nucleotides of the 3’ end, the guide RNA comprising the sequence does not comprise the PS bonds between the last four nucleotides when the 3’ end of the guide RNA is covalently linked to the 3’ extension.

[0360] As used herein throughout the present disclosure for modified sequences, (mN*)3 represents three consecutive nucleotides each having any base, a 2’-OMe, and a 3’ PS linkage to the next nucleotide; and N17 or (N)17 represent 17 consecutive N (any nucleotide), respectively. As used herein throughout the present disclosure for modified sequences, including Tables 1C and 1D or elsewhere, “m” indicates a 2’-O-Me modification, “f” indicates a 2’-fluoro modification, a “*” indicates a phosphorothioate linkage between nucleotides, “T” indicates a thymine nucleotide, “(L1)” an S18 internal linker disclosed herein (see Table 7), “(L2)” an S9 internal linker disclosed herein (see Table 7), “(L3)” denotes an S6 internal linker disclosed herein (see Table 7), “(L4)” denotes an S3 internal linker disclosed herein (see Table 7), a “(dS)” indicates an abasic site having 1’,2’-dideoxyribose modification (e.g., dSpacer from IDT). As used herein, “S3” indicates a 5’-O- CH2-CH2-CH2-O-PO3-3’ internal linker, “S6” indicates a 5’-O-(CH2O)2-PO3- 3’ internal linker, “S9” indicates a 5’-O-(CH2O)3-PO3- 3’ internal linker, “S18” indicates a 5’-O-(CH2O)6-PO3- 3’ internal linker (the structure of such internal linkers are shown in Table 7), and no modification in the context of a modified sequence indicates an RNA (2’-OH) and phosphodiesterase linkage to the 3’ nucleotide when one is present.

[0361] In certain embodiments, the guide sequence is a chemically modified sequence. In certain embodiments, the chemically modified guide sequence is (mN*)3(N)13-17. In certain embodiments, the guide sequence is (mN*)3(N)17, i.e., mN*mN*mN*NNNNNNNNNNNNNNNNN. In certain embodiments, each N of the (N)13-17 or the (N)17 is unmodified, i.e., an RNA (2’-OH and phosphodiesterase linkage to the 3’ nucleotide when one is present). In certain embodiments, each N in the (N)13-17 or the (N)17 is independently modified, e.g., independently modified with a 2’-O-methyl modification.

[0362] In some embodiments, the sgRNA disclosed herein may be modified as shown herein or in the sequence mN*mN*mN*NNNNNNNNNNNNNNNNN GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (SEQ ID NO: 193 or 330). In some embodiments, the sgRNA disclosed herein may be modified as shown herein or in the sequence mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGmU* mG*mC*mU (SEQ ID NO: 194 or 310).

[0363] In the case of a sgRNA, the guide sequences may further comprise a SpyCas9 sgRNA scaffold sequence. An example of a SpyCas9 sgRNA scaffold sequence is shown in the Table 5A below (SEQ ID NO: 22: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC – “Exemplary SpyCas9 sgRNA-1”), included at the 3’ end of the guide sequence, and provided with the domains as shown in the table below. LS is lower stem. B is bulge. US is upper stem. H1 and H2 are hairpin 1 and hairpin 2, respectively. Collectively H1 and H2 are referred to as the hairpin region. A model of the structure containing both a guide sequence and a scaffold sequence is provided in Figure 10A of WO2019237069, which is incorporated herein by reference. As will be apparent from the disclosure provided herein, the present disclosure provides various alternatives to the Exemplary SpyCas9 sgRNA-1, modifications, and equivalents, as will be appreciated by those of skill in the art.

[0364] The nucleotide sequence of Exemplary SpyCas9 sgRNA-1 may serve as a template sequence for specific chemical modifications, sequence substitutions and truncations.

[0365] In certain embodiments, the guide RNA is an sgRNA or a dgRNA, for example, and it optionally comprises a chemical modification. In some embodiments, the modified sgRNA comprises a guide sequence and a SpyCas9 sgRNA sequence, e.g., Exemplary SpyCas9 sgRNA- 1. A guide RNA, such as an sgRNA, may include modifications on the 5’ end of the guide sequence or on the 3’ end of the SpyCas9 sgRNA sequence, such as, e.g., Exemplary SpyCas9 sgRNA-1 at one or more of the terminal nucleotides, e.g., at 1, 2, 3, or 4 of the nucleotides at the 3’ end or at the 5’ end. In certain embodiments, the modified nucleotide is selected from a 2’-O-methyl (2’- Ome) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro(2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, or an inverted abasic modified nucleotide; or a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-Ome modified nucleotide. In certain embodiments, the modified nucleotide includes a PS linkage. In certain embodiments, the modified nucleotide includes a 2’- Ome modified nucleotide and a PS linkage.

[0366] In certain embodiments, using SEQ ID NO: 22: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC “Exemplary SpyCas9 sgRNA-1,” see WO2019237069, the contents of which are incorporated herein by reference). The portions of the Exemplary SpyCas9 sgRNA-1 and position numbering scheme are set forth in Table 5A below.

[0367] As an example, the Exemplary SpyCas9 sgRNA-1 further includes one or more of: A. a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein 1. at least one of the following pairs of nucleotides are substituted in hairpin 1 with Watson-Crick pairing nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, and the hairpin 1 region optionally lacks a. any one or two of H1-5 through H1-8, b. one, two, or three of the following pairs of nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or c. 1-8 nucleotides of hairpin 1 region; or 2. the shortened hairpin 1 region lacks 4-8 nucleotides, preferably 4-6 nucleotides; and a. one or more of positions H1-1, H1-2, or H1-3 is deleted or substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 22) or b. one or more of positions H1-6 through H1-10 is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 22); or 3. the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 22); orB. a shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include less than or equal to 4 substitutions relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 22); or C. a substitution relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 22) at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2 and H2-14, wherein the substituent nucleotide is neither a pyrimidine that is followed by an adenine, nor an adenine that is preceded by a pyrimidine; or D. an Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 22) with an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US1-US12 in the upper stem region, wherein 1. the modified nucleotide is optionally selected from a 2’-O-methyl (2’-Ome) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or a combination thereof; or 2. the modified nucleotide optionally includes a 2’-Ome modified nucleotide.

[0368] Other SpyCas9 spacer and scaffold sequences and chemical modification patterns are provided, for example in WO2018107028, WO2019237069, and WO 2021119275, each of which is incorporated herein by reference.

[0369] In some embodiments, the scaffold of the guide RNA comprises the nucleotides of SEQ ID NO: 27 or 40. In some embodiments, (a) nucleotides 5’- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAU-3’ or 5’- GUUUUAGACGUAGAAAUACGAAGUUAAAAU-3’ constitute a repeat / antirepeat (R / AR) region, wherein nucleotides 1-6 (LS1-LS6) and 25-30 (LS7-LS12) of the R / AR constitute a lower stem (LS) region, nucleotides 7-8 (B1-B2) and 21-24 (B3-B6) of the R / AR constitute a bulge region; and nucleotides 9-20 (US1-US12) of the R / AR constitute an upper stem (US) region; (b) nucleotides 5’-AAGGCUAGUCCGUUAUCA-3’ constitute a nexus region (N1-N18); (c) nucleotides 5’-CGAAAG-3’ constitute a hairpin 1 (H1) region (from 5’ to 3’, H1-2, H1-5 to H1- 8, and H1-11); (d) nucleotides 5’-GCACCGAGUCGGUGC-3’ constitute a hairpin 2 (H2) region H2-1 to H2-15); and (e) a G nucleotide between H1 region and H2 region constitutes nucleotiden; wherein the scaffold comprises at least one region with unmodified and modified nucleotides selected from: (i) the lower stem region comprising modified nucleotides at LS1, LS8, LS10, and LS12; nucleotides not modified with 2’-O-Me at LS2, LS3, LS4, LS5; (ii) the bulge region comprising nucleotides not modified with 2’-O-Me at B5 and B6; (iii) the upper stem region comprising modified nucleotides at at least 10 positions selected from US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12, optionally at all positions US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12; (iv) the nexus region comprising modified nucleotides at N1, N2, N4, N7, N11, N12, and N17; and nucleotides not modified with 2’-O-Me at N6, N8, N9, N10, N13, and N14; (v) the hairpin 1 (H1) region, comprising modified nucleotides at H1-2, H1-6, H1-7, H1-8, and H1-11; and nucleotides not modified with 2’-O-Me at H1-5; (vi) the hairpin 2 (H2) region comprising modified nucleotides at H2-1, H2-2, H2-3, H2-4, H2-5, H2- 6, H2-7, H2-12, H2-13, H2-14, and H2-15; and nucleotides not modified with 2’-O-Me at H2-8, H2-9, and H2-10; and (vii) the n is a modified or unmodified nucleotide.

[0370] In some embodiments, the scaffold comprises at least one region with unmodified and modified nucleotides selected from: (a) the lower stem region comprising modified nucleotides at LS1, LS8, LS10, and LS12; nucleotides not modified with 2’-O-Me at LS2, LS3, LS4, LS5, and LS6; (b) the bulge region comprising nucleotides not modified with 2’-O-Me at B5 and B6; (c) the upper stem region comprising modified nucleotides at at least 10 positions selected from US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12, optionally at all positions US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12; (d) the nexus region comprising modified nucleotides at N1, N2, N4, N7, N11, N12, and N17; and nucleotides not modified with 2’-O-Me at N6, N8, N9, N10, N13, N14, and N16; (e) the hairpin 1 (H1) region, comprising modified nucleotides at H1-2, H1-6, H1-7, H1-8, and H1-11; and nucleotides not modified with 2’-O-Me at H1-5; (f) the hairpin 2 (H2) region comprising modified nucleotides at H2-1, H2-2, H2-3, H2-4, H2-5, H2-6, H2-7, H2-11, H2-12, H2-13, H2-14, and H2-15; and nucleotides not modified with 2’-O-Me at H2-8, H2-9, and H2-10; and (g) the n is a modified or unmodified nucleotide.

[0371] In some embodiments, the scaffold comprises at least one region with unmodified and modified nucleotides selected from: (a) the lower stem region comprising modified nucleotides at LS1, LS8, LS10, and LS12; nucleotides not modified with 2’-O-Me at LS2, LS3, LS4, LS5, LS6, and LS9; (b) the bulge region comprising nucleotides not modified with 2’-O-Meat B5 and B6; (c) the upper stem region comprising modified nucleotides at at least 10 positions selected from US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12, optionally at all positions US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12; (d) the nexus region comprising modified nucleotides at N1, N2, N4, N7, N11, N12, N16, and N17; and nucleotides not modified with 2’-O-Me at N6, N8, N9, N10, N13, N14, and N16; (e) the hairpin 1 (H1) region, comprising modified nucleotides at H1-2, H1-6, H1-7, H1-8, and H1-11; and nucleotides not modified with 2’-O-Me at H1-5; (f) the hairpin 2 (H2) region comprising modified nucleotides at H2-1, H2-2, H2-3, H2-4, H2-5, H2-6, H2-7, H2-11, H2-12, H2-13, H2-14, and H2-15; and nucleotides not modified with 2’-O-Me at H2-8, H2-9, and H2-10; and (g) the n is a modified or unmodified nucleotide. In some embodiments, the lower stem region comprises modified nucleotides at LS1, LS8, LS10, and LS12; nucleotides not modified with 2’- O-Me at LS2, LS3, LS4, LS5, LS6, LS7, LS9, and LS11.

[0372] In some embodiments, the lower stem region comprises unmodified nucleotides at LS2, LS3, LS4, and LS5, optionally at LS2, LS3, LS4, LS5, LS6, LS7, LS9, and LS11. In some embodiments, the lower stem region comprises unmodified nucleotides at LS7, LS9, and LS11. In certain embodiments, the sgRNA comprises a modified nucleotide at one or more positions L1, L8, L10, and L12, and comprises an unmodified nucleotide at one or more positions LS2, LS3, LS4, LS5, LS6, LS7, LS9, and LS11. In certain embodiments, the sgRNA comprises a modified nucleotide at one, two, three, or four of positions L1, L8, L10, and L12, and comprises an unmodified nucleotide at one, two, three, four, five, six, seven, or eight positions LS2, LS3, LS4, LS5, LS6, LS7, LS9, and LS11. In some embodiments, the sgRNA comprises a modified nucleotide at one or more positions L1, L8, L10, and L12 and comprises an unmodified nucleotide at each of positions LS2, LS3, LS4, LS5, LS6, LS7, LS9, and LS11. In some embodiments, L1, L8, L10, and L12, when modified, comprise a 2’-O-Me modification. In certain embodiments, L1, L8, L10, and L12, when modified, independently comprises a 2’-O-Me modification or a 2’F modified nucleotide. In certain embodiments, the sgRNA comprises a 2’-O-Me at L1, L8, L10, and L12, and an unmodified nucleotide at LS2, LS3, LS4, LS5, LS6, LS7, LS9, and LS11.

[0373] In some embodiments, the bulge region comprises modified nucleotides at B2 and B3. In some embodiments, the bulge region comprises unmodified nucleotides at B5 and B6, optionally at B1, B4, B5, and B6. In certain embodiments, one or more of B1, B4, B5, and B6 comprise unmodified nucleotides. In some embodiments, the bulge region comprises a modifiednucleotide at one or both of positions B2 and B3 and comprises an unmodified nucleotide at each of positions B1, B4, B5, and B6. In some embodiments, B2 and B3, when modified, independently comprise a 2’-O-Me modification or a 2’-F modified nucleotide. In certain embodiments, the buldge region comprises a 2’-O-Me modifed nucleotide at each of positions B2 and B3 each comprise, and comprise unmodified nucleotides at each of positions B1, B4, B5, and B6.

[0374] In some embodiments, the modified nucleotides of the upper stem are 2’-O-Me modified nucleotides. In some embodiments, the nexus region comprises unmodified nucleotides at N6, N8, N9, N10, N13, N14, and N18, optionally at N3, N5, N6, N8, N9, N10, N13, N14, N15, and N18. In some embodiments, the nexus region comprises unmodified nucleotides at N3, N5, N6, N8, N9, N10, N13, N14, N15, and N18. In certain embodiments, N1, N2, N4, N7, N11, N12, and N17 comprise modified nucleotides. In certain embodiments, N1, N2, N4, N7, N11, N12, and N17 comprise 2’-O-Me modified nucleotides. In certain embodiments, each of positions N3, N5, N6, N8, N9, N10, N13, N14, N15, N16, and N18 comprise unmodified nucleotides. In some embodiments, the nexus region comprises a 2’-O-Me modified nucleotide at each of positions N1, N2, N4, N7, N11, N12, and N17 and comprises an unmodified nucleotide at each of positions N3, N5, N6, N8, N9, N10, N13, N14, N15, N16, and N18. In certain embodiments, positions N1, N2, N4, N7, N11, N12, and N17 comprise modified nucleotides, and positions N3, N5, N6, N8, N9, N10, N13, N14, N15, N16, and N18 are not modified with 2’-O-Me.

[0375] In some embodiments, the hairpin 1 region comprises an unmodified nucleotide at H1-5. In certain embodiments, all of H1-2, H1-6, H1-7, H1-8, and H1-11 comprise modified nucleotides, optionally 2’-O-Me modified nucleotides. In certain embodiments, positions H1-2, H1-6, H1-7, H1-8, and H1-11 comprise 2’-O-Me modified nucletodies and position H1-5 comprises a nucleotide that is not modified. In certain embodiments, positions H2-1, H2-2, H2-3, H2-4, H2-5, H2-6, H2-7, H2-11, H2-12, H2-13, H2-14, and H2-15 comprise 2’-O-Me modified nucleotides and positions H2-8, H2-9, and H2-10 comprise a nucleotide that is not modified. In certain embodiments, positions H1-2, H1-6, H1-7, H1-8, and H1-11 comprise 2’-O-Me modified nucletodies and position H1-5 comprises a nucleotide that is not modified; and positions H2-1, H2-2, H2-3, H2-4, H2-5, H2-6, H2-7, H2-11, H2-12, H2-13, H2-14, and H2-15 comprise 2’-O- Me modified nucleotides and positions H2-8, H2-9, and H2-10 comprise a nucleotide that is not modified.

[0376] In some embodiments, the hairpin 2 region comprises unmodified nucleotides at H2-8, H2-9, and H2-10. In some embodiments, the gRNA further comprises a 3’ tail. In some embodiments, the gRNA comprises a 3’ end modification.

[0377] In some embodiments, the scaffold sequence comprises an internal linker. In some embodiments, wherein the scaffold sequence comprises (i) an internal linker in or substitutes for the upper stem region; (ii) an internal linker in a nexus region; or (iii) an internal linker in the hairpin 1 region. In some embodiments, the guide RNA comprises (a) the sequence of mGUUUUAGmAmGmC(L1)mGmCmAAGUUmAAmAAmUmAmAGmGCUmAGUCmCmG UUAUmCAmC(L1)mGGmGmCmAmCmCmGmAGUCmGmGmUmGmC (SEQ ID NO: 272 ) or a sequence having at least 90%, 95%, or 98% identity to SEQ ID NO: 272; (b) the sequence of GUUUUAGAmGmCmUmA(L1)mUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUC AC(L1)GGGCACCGAGUCGGmUmGmC (SEQ ID NO: 211 ) or a sequence having at least 90%, 95%, or 98% identity to SEQ ID NO: 211; (c) the sequence of GUUUUAGAmGmC(L1)mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAC(L1)GGGC ACCGAGUCGGmUmGmC (SEQ ID NO: 232 ) or a sequence having at least 90%, 95%, or 98% identity to SEQ ID NO: 232; wherein L1 denotes that the linker is S18, and L3 denotes that the linker is S6; or (d) the sequence of mGUUUUAGmAmGmCmUmA(L1)mUmAmGmCmAAGUUmAAmAAmUmAmAGmGCUm AGUCmCmGUUAUmCAmC(L1)mGGmGmCmAmCmCmGmAGUCmGmGmUmGmC (SEQ ID NO: 224) or a sequence having at least 90%, 95%, or 98% identity to SEQ ID NO: 224; wherein L1 denotes that the linker is S18. In some embodiments, the spacer or the scaffold of the guide RNA comprises a modified nucleotide. gRNAs; Domains / Regions Thereof

[0378] In some embodiments, a guide RNA provided herein is an sgRNA. Briner AE et al., Molecular Cell 56:333–339 (2014) describes functional domains of sgRNAs, referred to herein as “domains”, including the “spacer” domain responsible for targeting, the “lower stem”, the “bulge”, “upper stem” (which may include a tetraloop), the “nexus”, and the “hairpin 1” and “hairpin 2” domains. See Briner et al. at page 334, Figure 1A. As described in detail elsewhere herein, one or more domains (e.g., hairpin 1 or the upper stem) may be shortened in an sgRNA described herein.

[0379] In some embodiments, the sgRNA comprises a guide region and a conserved portion 3’ to the guide region (also referred to as a “scaffold region” or “scaffold” elsewhere herein), wherein the conserved portion comprises a repeat-anti-repeat region, a nexus region, a hairpin 1 region, and a hairpin 2 region. The repeat-anti-repeat region comprises an upper stem region and a lower stem region. Table 5A provides a schematic of the domains of an sgRNA as used herein. In Table 5A, the “n” between regions represents a variable number of nucleotides, for example, from 0 to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more. In some embodiments, n equals 0. In some embodiments, n equals 1.

[0380] In some embodiments, the sgRNA comprises at least one of: a first internal linker substituting for at least 4 nucleotides of the upper stem region; a second internal linker substituting for 2 nucleotides of the nexus region; and a third internal linker substituting for at least 2 nucleotides of the hairpin 1.

[0381] In some embodiments, the sgRNA comprises the first internal linker and the second internal linker. In some embodiments, the sgRNA comprises the first internal linker and the third internal linker. In some embodiments, the sgRNA comprises the second internal linker and the second internal linker. In some embodiments, the sgRNA comprise the first internal linker, the second internal linker, and the second internal linker.

[0382] In some embodiments, the first internal linker has a bridging length of about 9-30 atoms, optionally about 15-21 atoms. In some embodiments, the first internal linker substitutes for 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides of the repeat-anti-repeat region of the guide RNA.

[0383] In some embodiments, the second internal linker has a bridging length of about 9- 15 atoms. In some embodiments, the second internal linker substitutes for a hairpin region of the nexus region of the sgRNA. In some embodiments, the second internal linker substitutes for 2 nucleotides of a stem region of the nexus region of the sgRNA.

[0384] In some embodiments, the third internal linker has a bridging length of about 9-30 atoms, optionally about 15-21 atoms. In some embodiments, the third internal linker substitutes for 4, 5, 6, 7, 8, 9.10, 11, or 12 nucleotides of the hairpin 1 of the guide RNA.

[0385] In some embodiments, the first internal linker is in a hairpin between a first portion and a second portion, and the first portion and the second portion together form a duplex portion.

[0386] In some embodiments, the third internal linker is in a hairpin between a first portion of the guide RNA and second portion of the guide RNA, and the first portion and the second portion together form a duplex portion.

[0387] In some embodiments, a hairpin 2 region of the guide RNA does not contain any internal linker. 5’ Terminus Region

[0388] The sgRNA can comprise nucleotides at the 5’ end to the scaffold sequence as shown in Table 5A. The 5’ terminus of the sgRNA comprises a spacer or guide region that functions to direct a Cas protein, e.g., a SpyCas9 protein, to a target nucleotide sequence. The length of the spacer region can vary from 17-20 nucleotides in length, with the nucleotide sequence being dependent on the target sequence within the genome. In some embodiments, the spacer region comprises 17, 18, 19, or 20 nucleotides. For the purpose of defining nucleotide positions therein, the spacer region nucleotides are numbered using the designation 5’-S1 to S20- 3’ (as shown in FIGS.2A-2B). Lower Stem

[0389] The sgRNA comprises a lower stem (LS) region that when viewed linearly, is separated by a bulge and upper stem regions. See Table 5A.

[0390] In some embodiments, the lower stem regions comprise 1-12 nucleotides, e.g. in one embodiment the lower stem regions comprise LS1-LS12. In some embodiments, the lower stem region comprises fewer nucleotides than shown in Table 5A. In some embodiments, the lower stem region comprises more nucleotides than shown in Table 5A. When the lower stem region comprises fewer or more nucleotides than shown in the schematic of Table 5A, the modification pattern, as will be apparent to the skilled artisan, should be maintained.

[0391] In some embodiments, the lower stem region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the complementarity in nucleic acid sequence of lower stem leads to a secondary structure of a stem in the sgRNA (e.g., the regions may base pair with one another). In someembodiments, the lower stem regions may not be perfectly complimentary to each other when read in opposite directions.Bulge

[0392] The sgRNA comprises a bulge region typically comprising six nucleotides, B1BS. When viewed linearly, when an upper stem is present, the bulge region is separated into two regions. See Table 5 A. In some embodiments, the bulge region comprises six nucleotides, wherein the first two nucleotides are followed by an upper stem region, followed by the last four nucleotides of the bulge. In some embodiments, the bulge region comprises fewer nucleotides than shown in Table 5A. In some embodiments, the bulge region comprises more nucleotides than shown in Table 5A. When the bulge region comprises fewer or more nucleotides than shown in the schematic of Table 5 A, the modification pattern, as will be apparent to the skilled artisan, should be maintained. In some embodiments, the bulge region includes an internal spacer and no upper stem region as discussed below.

[0393] In some embodiments, the presence of a bulge results in a directional kink between the upper and lower stem modules in an sgRNA.Upper Stem

[0394] In some embodiments, the upper stem region is a shortened upper stem region, such as any of the shortened upper stem regions described elsewhere herein. In some embodiments, no upper stem is present.

[0395] In other embodiments, the sgRNA comprises an upper stem region comprising 12 nucleotides. In some embodiments, the upper stem region comprises a loop sequence. In some instances, the loop is a tetraloop (loop consisting of four nucleotides). In some embodiments, the upper stem region comprises more nucleotides than shown in Table 5A.

[0396] When the upper stem region comprises fewer or more nucleotides than shown in the schematic of Table 5A, the modification pattern, as will be apparent to the skilled artisan, should be maintained.

[0397] The upper stem region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the complementarity innucleic acid sequence of upper stem leads to a secondary structure of a stem in the sgRNA (e.g., the regions may base pair with one another). In some embodiments, the upper stem regions may not be perfectly complimentary to each other when read in opposite directions.

[0398] In some embodiments, the upper stem region comprises fewer nucleotides than shown in Figure 10A of WO2019237069, and sometimes is not present. In certain embodiments, bulge nucleotides B2 and B3 (corresponding to nucleotides 8 and 21 of SEQ ID: 400; see Table 5A) are directly joined (i.e., such that no intervening nucleotides are present) by an internal linker. In certain embodiments, B2 and B3 are directly joined by one or more, e.g., 1, 2, 3, or 4 abasic nucleosides. In certain embodiments, B2 and B3 are joined by an internal linker or one or more, e.g., 1, 2, 3, or 4, abasic nucleosides wherein additional nucleotides present do not form a duplex portion above the bulge. In certain embodiments, B2 and B3 are joined by an internal linker or one or more, e.g., 1, 2, 3, or 4 abasic nucleoside wherein additional nucleotides present do not form a duplex portion longer than 3 nucleotides above the bulge. Nexus

[0399] The sgRNA comprises a nexus region that is located between the lower stem region and the hairpin 1 region. In some embodiments, the nexus comprises 18 nucleotides. In some embodiments, the nexus region comprises nucleotides N1 through N18 as shown in Table 5A. In some embodiments, the nexus region comprises a substitution (e.g., at position N18) or lacks a nucleotide, such as any of the nexus regions with a substitution or lacking a nucleotide described in detail elsewhere herein.

[0400] In some embodiments, the nexus region comprises fewer nucleotides than shown in Table 5A. In some embodiments, the nexus region comprises more nucleotides than shown in Table 5A. When the nexus region comprises fewer or more nucleotides than shown in the schematic of Table 5A, the modification pattern, as will be apparent to the skilled artisan, should be maintained.

[0401] The nexus region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the complementarity in nucleic acid sequence leads to a secondary structure of a stem or stem loop in the sgRNA (e.g., certain nucleotides in the nexus region may base pair with one another). In some embodiments,the nexus regions may not be perfectly complimentary to each other when read in opposite directions. Hairpins

[0402] In some embodiments, the sgRNA comprises a hairpin structure within the hairpin region. The hairpin region is downstream of (i.e., 3’ to) the repeat-anti-repeat region and the nexus region. The region of nucleotides immediately downstream of the nexus region is termed “hairpin 1” or “H1”. The region of nucleotides 3’ to hairpin 1 is termed “hairpin 2” or “H2”. The hairpin region comprises both hairpin 1 and hairpin 2. In some embodiments, the sgRNA comprises hairpin 1 or hairpin 2.

[0403] In some embodiments, the hairpin 1 region is a shortened hairpin 1 region, such as any of the shortened hairpin 1 regions described elsewhere herein. In some embodiments, a shortened hairpin 1 region includes an internal linker as discussed below.

[0404] In other embodiments, the hairpin 1 region comprises 12 nucleotides immediately downstream of the nexus region. In some embodiments, the hairpin 1 region comprises nucleotides H1-1 through H1-12 as shown in Table 5A.

[0405] In some embodiments, the hairpin 2 region comprises 15 nucleotides downstream of the hairpin 1 region. In some embodiments, the hairpin 2 region comprises nucleotides H2-1 through H2-15 as shown in Table 5A.

[0406] In some embodiments, one or more nucleotides is present between the hairpin 1 and the hairpin 2 regions. The one or more nucleotides between the hairpin 1 and hairpin 2 region may be modified or unmodified. In some embodiments, hairpin 1 and hairpin 2 are separated by one nucleotide. In some embodiments, the hairpin regions comprise fewer nucleotides than shown in Table 5A. In some embodiments, the hairpin regions comprise more nucleotides than shown in Table 5A. When a hairpin region comprises fewer or more nucleotides than shown in the schematic of Table 5A, the modification pattern, as will be apparent to the skilled artisan, should be maintained.

[0407] A hairpin region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the hairpin regions may not be perfectly complimentary to each other when read in opposite directions (e.g., the top or loop of the hairpin comprises unpaired nucleotides).3’ Terminus

[0408] The sgRNA has a 3’ end, which is the last nucleotide of the scaffold region of the SpyCas9 guide sgRNA. The 3’ terminus region includes the last 1-4 nucleotides from the 3’ end. In some embodiments, the 3’ end is the end of hairpin 2. In some embodiments, the sgRNA comprises nucleotides after the hairpin region(s). In some embodiments, the sgRNA includes a 3’ tail region, in which case the last nucleotide of the 3’ tail is the 3’ terminus. In some embodiments, the 3’ tail region comprises 1, 2, 3, or 4 nucleotides that are not associated with the secondary structure of a hairpin. In some embodiments, the 3’ tail region comprises 1 nucleotide that is not associated with the secondary structure of a hairpin. In some embodiments, the 3’ tail region comprises 1, 2, or 3 nucleotides that are not associated with the secondary structure of a hairpin. It is understood that a 3’ extension is distinct, structurally and functionally, from a 3’ tail. gRNAs comprising linkers

[0409] In certain embodiments, the SpyCas9 guide RNA scaffold sequence an internal linker. In some embodiments, the SpyCas9 guide RNA scaffold sequence comprises an internal linker in the upper stem region; an internal linker in a nexus region; or an internal linker in the hairpin 1 region. In certain embodiments, the SpyCas9 guide RNA scaffold sequence comprises an internal linker in the upper stem region and an internal linker in the hairpin 1 region. The length of an internal linker may be dependent on, for example, the number of nucleotides replaced by the linker and the position of the linker in the guide RNA. Internal linkers and their use in the context of guide RNA are provided in WO2022261292, the content of which is incorporated by reference.

[0410] gRNAs disclosed herein may comprise an internal linker. In general, any internal linker compatible with the function of the guide RNA may be used. It may be desirable for the linker to have a degree of flexibility. In some embodiments, the internal linker comprises at least two, three, four, five, six, or more on-pathway single bonds. A bond is on-pathway if it is part of the shortest path of bonds between the two nucleotides whose 5’ and 3’ positions are connected to the linker.

[0411] As used herein the length of the internal linker can be defined by its bridging length. The “bridging length” of an internal linker as used herein refers to the distance or number of atoms in the shortest chain of atoms on the pathway from the first atom of the linker (bound to a 3’ substituent, such as an oxygen or phosphate, of the preceding nucleotide to the last atom of the linker (bound to a 5’ substituent, such as an oxygen or phosphate) of the following nucleotide) (e.g., from ~ to # in the structure of Formula (I) described below). Approximate predicted bridging lengths for various linkers are provided in a table below.

[0412] Exemplary predicted linker lengths by number of atoms, number of ethylene glycol units, approximate linker length in Angstroms on the assumption that an ethylene glycol monomer is about 3.7 Angstroms, and suitable location for substitution of at least the entire loop portion of a hairpin structure are provided in Table 2 below. Substitution of two nucleotides requires a linker length of at least about 11 Angstroms. Substitution of at least 3 nucleotides requires a linker length of at least about 16 Angstroms.

[0413] In some embodiments, the internal linker has a bridging length of about 3 Angstroms-37 Angstroms. In some embodiments, the internal linker has a bridging length of about 3-23 Angstroms. Table 2

[0414] In some embodiments, the internal linker comprises a structure of formula (I): ~-L0-L1-L2-# (I) wherein:~ indicates a bond to a 3’ substituent of the preceding nucleotide; # indicates a bond to a 5’ substituent of the following nucleotide; L0 is null or C1-3aliphatic; L1 is –[E1-(R1)]m-, where each R1is independently a C1-5aliphatic group, optionally substituted with 1 or 2 E2, each E1and E2are independently a hydrogen bond acceptor, or are each independently chosen from cyclic hydrocarbons, and heterocyclic hydrocarbons, and each m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and L2 is null, C1-3aliphatic, or is a hydrogen bond acceptor.

[0415] In some embodiments, L1 comprises a -CH2CH2O-, CH2OCH2-, or -OCH2CH2- unit (“ethylene glycol subunits”). In some embodiments, the number of -CH2CH2O-, -CH2OCH2-, or -OCH2CH2- units is in the range of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0416] In some embodiments, m is 1, 2, 3, 4 or 5. In some embodiments, m is 1, 2, or 3. In some embodiments, m is 6, 7, 8, 9, or 10.

[0417] In some embodiments, L0 is null. In some embodiments, L0 is -CH2- or - CH2CH2-.

[0418] In some embodiments, L2 is null. In some embodiments, L2 is -O-, -S-, or C1-3aliphatic. In some embodiments, L2 is -O-. In some embodiments, L2 is -S-. In some embodiments, L2 is -CH2- or -CH2CH2-.

[0419] In the tables herein, L1 and L2, are optionally, C9 and C18, respectively as follows:

[0420] In certain embodiments, the internal linker has a bridging length of about 3-30 atoms, optionally 3-21 atoms, and the linker substitutes for at least 2 nucleotides of the guide RNA. In certain embodiments, the internal linker has a bridging length of about 3-18 atoms, and the linker substitutes for at least 2 nucleotides of the guide RNA. In certain embodiments, the internal linker substitutes for 2-12 nucleotides.

[0421] In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 22, including modifications disclosed elsewhere herein. Table 3A shows various embodiments of the guide RNA structures and species with possible number of internal linkers and positions.Table 3A.

[0422] In certain embodiments, one of the internal linkers is in the repeat / anti-repeat region of the guide RNA. In certain embodiments, the internal linker substitutes for at least 4 nucleotides of the repeat-anti-repeat region of the guide RNA. In certain embodiments, the internal linker substitutes for the loop in the repeat-anti-repeat region of a SpyCas9 guide RNA, corresponding to nucleotides 13-16 in SEQ ID NO: 22.

[0423] In some embodiments, wherein the internal linker is in a repeat-anti-repeat region of the guide RNA, the internal linker is in the upper stem region. In certain embodiments, the internal linker in the upper stem region substitutes for US1 through US12 relative to SEQ ID NO: 22.

[0424] In certain embodiments, the SpyCas9 guide RNA scaffold sequence further comprises an internal linker in a nexus region. In certain embodiments, the internal linker substitutes for 2, 3, or 4 nucleotides of the nexus region of the guide RNA. In certain embodiments, the internal linker substitutes for the loop in the nexus region of a SpyCas9 guide RNA corresponding to nucleotides 33-36 of SEQ ID NO: 22.

[0425] In certain embodiments, the internal linker is in a hairpin region of the guide RNA. In certain embodiments, the internal linker substitutes for at least 4 nucleotides of the hairpin region of the guide RNA. In certain embodiments, the internal linker or one of the internal linkers is in the hairpin 1 region. In certain embodiments, the internal linker substitutes for H1-5 through H1-8 relative to SEQ ID NO: 22.

[0426] In certain embodiments, nucleotides 29-40 (US1 through US12 of the upper stem region) are substituted for the first internal linker relative to SEQ ID NO: 22; and nucleotides 70- 78 (HP1-HP10 of the hairpin 1 region) are substituted for the second internal linker relative to SEQ ID NO: 22.

[0427] In some embodiments, the guide RNA comprises the sequence of GUUUUAGAGCUA-linker-UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAC-linker- GGGCACCGAGUCGGUGC (SEQ ID NO: 299), wherein “linker” denotes an internal linker.

[0428] In some embodiments, the guide RNA comprises the sequence of GUUUUAGA(L3)AAGUUAAAAUAAGGCUAGUCCGUUAUCAC(L1)GGGCACCGAGUC GGUGCU (SEQ ID NO: 370) or a sequence having at least 90%, 95%, or 98% identity to SEQ ID NO: 370, wherein “(L1)” denotes an S18 internal linker disclosed herein (see Table 7), “(L3)” denotes an S6 internal linker disclosed herein (see Table 7).

[0429] In some embodiments, the guide RNA comprises the sequence of GUUUUAGA(L3)AAGUUAAAAUAAGGCUAGUCCGUUAUCAC(L1)GGGCACCGAGUC GGUGCU (SEQ ID NO: 370), or GUUUUAGA(L3)AAGUUAAAAUAAGGCUAGUCCGUUAUCAC(L1)GGGCACCGAGUCGGUGC (SEQ ID NO: 373), wherein “(L1)” denotes an S18 internal linker disclosed herein (see Table 7), “(L3)” denotes an S6 internal linker disclosed herein (see Table 7).

[0430] In some embodiments, the guide RNA comprises mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGA(L3)AAGUUAAAAUAAGGCUAG UCCGUUAUCAC(L1)GGGCACCGAGUCGGmU*mG*mC*mU (SEQ ID NO: 371) or a sequence having at least 90%, 95%, 98%, or 99% identity to SEQ ID NO: 371, wherein * denotes that the nucleotide is linked to the next nucleotide with a PS bond, a lower case “m” denotes that the nucleotide is modified with 2’-O-Me, “(L1)” denotes an S18 internal linker disclosed herein (see Table 7), “(L3)” denotes an S6 internal linker disclosed herein (see Table 7), where N is any nucleotide.

[0431] In some embodiments, the guide RNA comprises mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGA(L3)AAGUUAAAAUAAGGCUAG UCCGUUAUCAC(L1)GGGCACCGAGUCGGmU*mG*mC*mU (SEQ ID NO: 371), wherein * denotes that the nucleotide is linked to the next nucleotide with a PS bond, a lower case “m” denotes that the nucleotide is modified with 2’-O-Me, “(L1)” denotes an S18 internal linker disclosed herein (see Table 7), “(L3)” denotes an S6 internal linker disclosed herein (see Table 7), where N is any nucleotide. An example of the above guide RNA is shown in Fig.6.

[0432] In some embodiments, the guide RNA comprises GUUUUAGA(L3)AAGUUAAAAUAAGGCUAGUCCGUUAUCAC(L1)GGGCACCGAGUC GGmU*mG*mC*mU (SEQ ID NO: 203); or mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGA(L3)AAGUUAAAAUAAGGCUAG UCCGUUAUCAC(L1)GGGCACCGAGUCGGmU*mG*mC (SEQ ID NO: 384), wherein * denotes that the nucleotide is linked to the next nucleotide with a PS bond, a lower case “m” denotes that the nucleotide is modified with 2’-O-Me, “(L1)” denotes an S18 internal linker disclosed herein (see Table 7), “(L3)” denotes an S6 internal linker disclosed herein (see Table 7), where N is any nucleotide.

[0433] In some embodiments, the guide RNA comprises a scaffold comprising GUUUUAGA(L3)AAGUUAAAAUAAGGCUAGUCCGUUAUCAC(L1)GGGCACCGAGUC GGmU*mG*mC*mU (SEQ ID NO: 203) or mGmUmUmUmUmAmGmA(L3)mAmAmGmUmUmAmAmAmAmUmAmAmGmGmCmUm AmGmUmCmCmGmUmUmAmUmCAC(L1)GmGGCACCGAGUCGGmU*mG*mC*mU(SEQ ID NO: 372), wherein * denotes that the nucleotide is linked to the next nucleotide with a PS bond, a lower case “m” denotes that the nucleotide is modified with 2’-O-Me, “(L1)” denotes an S18 internal linker disclosed herein (see Table 7), “(L3)” denotes an S6 internal linker disclosed herein (see Table 7). In some embodiments, the SpyCas9 guide RNA comprises a modified nucleotide sequence having at least 90%, 95%, 98% identity to any one of SEQ ID NOs: 350-371 or any one of the sequences listed in Table 3B. Table 3B. Exemplary SpyCas9 guide RNAs comprising linkers

[0434] In some embodiments, where any of the sequences in Table 3B comprise a 3’ terminal uridine, the guide RNA comprising the sequence does not comprise a 3’ terminal uridine.

[0435] In certain embodiments, Exemplary SpyCas9 sgRNA-1, or an sgRNA, such as an sgRNA comprising an Exemplary SpyCas9 sgRNA-1. In certain embodiments, the Exemplary SpyCas9 sgRNA-1 does not include a 3’ tail. In certain embodiments, the Exemplary SpyCas9 sgRNA-1, further may include a 3’ tail, e.g., a 3’ tail of 1, 2, 3, 4, or more nucleotides, e.g., a tail of 1 nucleotide, e.g., a tail of 1 uridine nucleotide. It is understood that a 3’ tail is not a 3’ extension disclosed herein, which includes a template and a DRS, is distinct in structure and function from a 3’ tail. The nucleotides and nucleotide modifications discussed in relation to the Exemplary SpyCas9 sgRNA-1 spacer and scaffold may or may not be tolerated in a 3’ extension as discussed further below. Methods of Making

[0436] Methods of producing or synthesizing a guide RNA comprising an internal linker disclosed herein are known in the art. Suitable precursors, e.g., linker can be introduced into an sgRNA oligonucleotide by using the corresponding phosphoramidite building block in methods of making sgRNA in a single production or synthetic process. Such building blocks are commercially available or can be prepared by known methods.

[0437] Methods of production or synthesis include a series of sequential coupling reactions including covalently linking a first nucleotide to a second nucleotide; covalently linking an internal linker to a second nucleotide; and covalently linking a third nucleotide to the internal linker. In certain embodiments, such linkages are performed using phosphoramidite chemistry. In certain embodiments, the method includes covalent linkage of a second linker to the first linker prior to covalent linkage of the third nucleotide.

[0438] In some embodiments, a solid support covalently attached to the linker of the guide RNA disclosed herein is provided.

[0439] The guide RNA provided herein with internal linkers are made in a single production or synthetic process such that a full-length guide RNA strand (sgRNA, crRNA, or trRNA) is produced by the production or synthetic method. In the case of a dgRNA, the crRNA and trRNA are produced or synthesized separately and annealed. That is, when the guide RNA is made as a dgRNA, the separately produced or synthesized portions do not require covalent linkageto form a stable guide RNA. In certain embodiments, the crRNA and trRNA of a dgRNA containing an internal linker as provided herein, does not include a covalent linkage between the crRNA and the trRNA.

[0440] In preferred embodiments, the guide RNA is not made using click chemistry. Guide RNAs Comprising Chemical Modifications

[0441] In some embodiments, the Exemplary SpyCas9 sgRNA-1 gRNA is chemically modified. An Exemplary SpyCas9 sgRNA-1, SpyCas9 spacer and scaffold, or more simply guide RNA comprising one or more modified nucleosides or nucleotides is called a “modified” guide RNA or “chemically modified” guide RNA, to describe the presence of one or more non-naturally or naturally occurring components or configurations that are used instead of or in addition to the canonical A, G, C, and U residues. In some embodiments, a modified guide RNA that is produced or synthesized with a non-canonical nucleoside or nucleotide, is here called “modified.” Modified nucleosides and nucleotides can include one or more of: (i) alteration, e.g., replacement, of one or both of the non-linking phosphate oxygens or of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage (an exemplary backbone modification); (ii) alteration, e.g., replacement, of a constituent of the ribose sugar, e.g., of the 2’ hydroxyl on the ribose sugar (an exemplary sugar modification); (iii) modification or replacement of a naturally occurring nucleobase, including with a non-canonical nucleobase (an exemplary base modification); and (iv) modification of nucleotides at the 3’ end or 5’ end of the oligonucleotide, e.g., to provide exonuclease stability, e.g., with 2’ O-me, or 2’ halide substituted ribose; or inverted abasic terminal nucleotide, or replacement of phosphodiester with phosphorothioate. The RNA modification used depends, at least in part, to the type of the guide RNA (e.g., sgRNA, tgRNA) and the portion of the guide (e.g., spacer, scaffold, DRS, template when RNA is present in the template).

[0442] Chemical modifications such as those listed above can be combined to provide modified guide RNAs comprising nucleosides and nucleotides (collectively “residues”) that can have two, three, four, or more modifications. For example, a modified residue can have a modified sugar and a modified nucleobase. In certain embodiments, phosphate groups of a guide RNA molecule are replaced with phosphorothioate groups. In some embodiments, modified guide RNAs comprise at least one modified residue at or near the 5’ end of the RNA. In some embodiments, modified guide RNAs comprise at least one modified residue at or near the 3’ endof the RNA. In some embodiments, when the modified guide RNA comprises a 3’ extension that is covalently linked to the 3’ end of the scaffold sequence, the modified guide RNA does not comprise a modified residue at or near the 3’ end of the scaffold sequence.

[0443] In some embodiments, the guide RNA disclosed herein comprises one, two, three or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, 10%, 15%, preferably at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60%) of the positions in a modified guide RNA are modified nucleosides or nucleotides. In some embodiments, 20-60% of the positions in the modified guide RNA spacer and scaffold are modified nucleotides.

[0444] Unmodified nucleic acids can be prone to degradation by, e.g., intracellular nucleases or nucleases found in serum. For example, nucleases can hydrolyze nucleic acid phosphodiester bonds. Accordingly, in one aspect the guide RNAs described herein can contain one or more modified nucleosides or nucleotides, e.g., to introduce stability toward intracellular or serum-based nucleases. In some embodiments, the modified guide RNA molecules described herein can exhibit a reduced innate immune response when introduced into a population of cells, both in vivo and ex vivo. The term “innate immune response” includes a cellular response to exogenous nucleic acids, including single stranded nucleic acids, which involves the induction of cytokine expression and release, particularly interferons, and cell death.

[0445] In some embodiments of a backbone modification, the phosphate group of a modified residue can be modified by replacing one or more of the oxygens with a different substituent. Further, the modified residue, e.g., modified residue present in a modified nucleic acid, can include the replacement of an unmodified phosphate moiety with a modified phosphate group as described herein. In some embodiments, the backbone modification of the phosphate backbone can include alterations that result in either an uncharged linker or a charged linker with unsymmetrical charge distribution.

[0446] Examples of modified phosphate groups include, phosphorothioate, borano phosphate esters, methyl phosphonates, phosphoroamidates, phosphodithioate, alkyl or aryl phosphonates and phosphotriesters. In certain embodiments, the modified phosphate group is a phosphorothioate group. The phosphorous atom in an unmodified phosphate group is achiral. However, replacement of one of the non-bridging oxygens with one of the above atoms or groups of atoms can render the phosphorous atom chiral. The stereogenic phosphorous atom can possess either the “R” configuration (herein Rp) or the “S” configuration (herein Sp). Thebackbone can also be modified by replacement of a bridging oxygen, (i.e., the oxygen that links the phosphate to the nucleoside), with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylenephosphonates). The replacement can occur at either linking oxygen or at both of the linking oxygens.

[0447] The phosphate group can be replaced by non-phosphorus containing connectors in certain backbone modifications, e.g., an amide linkage. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties which can replace the phosphate group can include, without limitation, e.g., methyl phosphonate, carboxymethyl, carbamate, amide, and thioether. Further examples of moieties which can replace the phosphate group can Include, without limitation, e.g., ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino.

[0448] Scaffolds that can mimic nucleic acids can also be constructed wherein the phosphate linker and ribose sugar are replaced by nuclease resistant nucleoside or nucleotide surrogates. Such modifications may comprise backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by a surrogate backbone. Examples can include, without limitation, the morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.

[0449] The modified nucleosides and modified nucleotides can include one or more modifications to the sugar group, i.e., a sugar modification. For example, the 2’ hydroxyl group (OH) can be modified, e.g., replaced with a number of different “oxy” substituents. In some embodiments, modifications to the 2’ hydroxyl group can enhance the stability of the nucleic acid since the hydroxyl can no longer be deprotonated to form a 2’-alkoxide ion.

[0450] Examples of 2’ hydroxyl group modifications can include alkoxy or aryloxy (OR, wherein “R” can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or a sugar); polyethyleneglycols (PEG), O(CH2CH2O)nCH2CH2OR wherein R can be, e.g., H or optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20). In some embodiments, the 2’ hydroxyl group modification can be 2’-O-Me. In some embodiments, the 2’ hydroxyl group modification can be a 2’-fluoro modification, whichreplaces the 2’ hydroxyl group with a fluoride. In some embodiments, the 2’ hydroxyl group modification can include “locked” nucleic acids (LNA) in which the 2’ hydroxyl can be connected, e.g., by a C1-6alkylene or C1-6heteroalkylene bridge, to the 4’ carbon of the same ribose sugar, where exemplary bridges can include methylene, propylene, ether, or amino bridges; O-amino (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy, O(CH2)n-amino, (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino).

[0451] Locked nucleic acids can be depicted as follows:

[0452] In some embodiments, the 2’ hydroxyl group modification can include “unlocked” nucleic acids (UNA) in which the ribose ring lacks the C2’-C3’ bond. In some embodiments, the 2’ hydroxyl group modification can include the methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).2’ modifications can include hydrogen (i.e. deoxyribose sugars); halo (e.g., bromo, chloro, fluoro, or iodo); amino (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CH2CH2NH)nCH2CH2- amino (wherein amino can be, e.g., as described herein), -NHC(O)R (wherein R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl and alkynyl, which may be optionally substituted with e.g., an amino as described herein.

[0453] The sugar modification can comprise a sugar group which may also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a modified nucleic acid can include nucleotides containinge.g., arabinose, as the sugar. The modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms. The modified nucleic acids can also include one or more sugars that are in the L form, e.g., L- nucleosides. As used herein, a single abasic sugar is not understood to result in a discontinuity of a duplex.

[0454] In certain embodiments, 2’ modifications, include, for example, modifications include 2’-Ome, 2’-F, LNA, optionally 2’-O-Me.

[0455] The modified nucleosides and modified nucleotides described herein, which can be incorporated into a modified nucleic acid, can include a modified base, also called a modified nucleobase. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uridine (U). These nucleobases can be modified or wholly replaced to provide modified residues that can be incorporated into modified nucleic acids. The nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine analog, or a pyrimidine analog. In some embodiments, the nucleobase can include, for example, naturally- occurring and synthetic derivatives of a base.

[0456] In embodiments employing a dual guide RNA, each of the crRNA and the tracr RNA can contain modifications. Such modifications may be at one or both ends of the crRNA or tracr RNA. In some embodiments, when the modified tracrRNA comprises a 3’ extension that is covalently linked to the 3’ end of the scaffold sequence, the modified tracrRNA does not comprise a modified residue at or near the 3’ end of the scaffold sequence. In embodiments comprising an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or internal nucleosides may be modified, or the sgRNA may be chemically modified throughout. Certain embodiments comprise a 5’ end modification. Certain embodiments comprise a 3’ end modification. Certain embodiments comprise a 5’ end modification and a 3’ end modification. In some embodiments, when the modified sgRNA comprises a 3’ extension that is covalently linked to the 3’ end of the scaffold sequence, the modified sgRNA does not comprise a modified residue at or near the 3’ end of the scaffold sequence.

[0457] In some embodiments, the guide RNAs, spacer and scaffold, disclosed herein comprise one of the modification patterns disclosed in WO2018107028, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAsdisclosed herein comprise one of the structures / modification patterns disclosed in US20170114334, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of the structures / modification patterns disclosed in WO2017136794, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of the structures / modification patterns disclosed in WO2019237069, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of the structures / modification patterns disclosed in WO2021119275, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of the structures / modification patterns disclosed in WO2023081687, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of the structures / modification patterns disclosed in WO2022 / 261292, the contents of which are hereby incorporated by reference in their entirety.

[0458] Any of the modifications described below may be present in the guide RNAs and mRNAs described herein.

[0459] In the context of chemically modified sequences, “A,” “C,” “G,” “N,” and “U” denote an RNA nucleotide, i.e., 2’-OH with a phosphodiesterase linkage to the ...

Claims

WE CLAIM:

1. A system comprising a DNA-dependent DNA polymerase, a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: a) the first polynucleotide comprises a SpyCas9 guide RNA comprising, from 5’ to 3’: i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and ii) a scaffold; and b) the second polynucleotide is operably linked to the first polynucleotide and comprises, from 5’ to 3’: i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 10-14 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides; and iii) wherein the DRS comprises at least one of: 1) a sequence not fully complementary to the DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid; 2) a 1-5 nucleotide, optionally a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide; or 3) a 5’ terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage.

2. The system of claim 1, wherein the first polynucleotide is covalently linked to the second polynucleotide, optionally wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide.

3. The system of any one of claims 1-2, wherein the first polynucleotide is linked to the second polynucleotide by a non-nucleotide linker, optionally a phosphodiester bond or a phosphorothioate bond.

4. The system of any one of claims 1-3, wherein the 3’ terminal nucleotide of the template is a DNA nucleotide.

5. The system of any one of claims 1-4, wherein (i) the 5’ terminal nucleotide of the DRS is a DNA nucleotide; or (ii) the penultimate 5’ terminal nucleotide of the DRS is an RNA nucleotide.

6. The system of any one of claims 1-5, wherein the 3’ terminal nucleotide of the template and the 5’ terminal nucleotide of the DRS are DNA nucleotides, and the penultimate 5’ terminal nucleotide of the DRS is an RNA nucleotide.

7. The system of any one of claims 1-4, wherein the 3’ terminal nucleotide in the DRS is an RNA nucleotide and the remaining nucleotides in the DRS are DNA nucleotides.

8. The system of any one of claims 1-7, wherein the template consists of DNA nucleotides.

9. The system of any one of claims 1-4, wherein the DRS consists of RNA nucleotides.

10. The system of any one of claims 1-9, wherein (i) the sequence of the DRS that is complementary to the DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid comprises nucleotides D2-D9 of the DRS, optionally D2-D8 or D3-D9 of the DRS; or (ii) the sequence of the DRS that is complementary to a DRS- complementary region of a non-target strand of the DNA duplex target nucleic acid comprises nucleotides D6-D13 of the DRS, optionally wherein 1, 2, 3, 4, 5, 6, 7, or 8 of nucleotides D6-D13 are DNA nucleotides.

11. The system of claim 1, wherein the tgRNA further comprises an affinity tag, wherein the first polynucleotide or the second polynucleotide are bound to a peptide or a peptide complex comprising the nCas9 and the DNA-dependent DNA polymerase by the affinity tag.

12. The system of claim 11, wherein 1-7 consecutive 5’ terminal nucleotides of the DRS are DNA nucleotides, optionally wherein:i) the 5’ terminal and penultimate 5’ terminal nucleotides of the DRS are DNA nucleotides; ii) at least 3 consecutive 5’ terminal nucleotides of the DRS are DNA nucleotides; or iii) 3 consecutive 5’ terminal nucleotides of the DRS are DNA nucleotides.

13. The system of any one of claims 11-12, wherein the affinity tag is located 5’ of the template sequence or the affinity tag is located 3’ of the DRS.

14. The system of any one of claims 11-13, wherein the tgRNA comprises two affinity tags, optionally wherein (i) both affinity tags are located 5’ of the template; or (ii) a first affinity tag is located 5’ of the template sequence and a second affinity tag is located 3’ of the DRS, wherein the DNA-dependent DNA polymerase is T5 DNA polymerase.

15. The system of any one of claims 11-14, wherein the affinity tag is an aptamer comprising one or more modified nucleotides, optionally wherein the aptamer is located 5’ of the template and has a 5’ terminus, further optionally wherein the aptamer comprises one or more modified nucleotide at the 5’ end thereof.

16. The system of claim 15, wherein the modified nucleotide is a 2’-O-methyl (2’-O-Me) modified nucleotide or a phosphorothioate (PS) linkage modified nucleotide or wherein the aptamer comprises a stem-loop, optionally wherein the aptamer comprises 2’-O-Me modified nucleotides at each nucleotide in the stem of the stem-loop.

17. The system of any one of claims 15 or 16, wherein the aptamer is located 5’ of the template sequence, further wherein: i) the aptamer comprises a PS linkage between each of the first three nucleotides at the 5’ end; ii) the aptamer comprises 2’-O-Me modified nucleotides at each of the first two nucleotides at the 5’ end; iii) the aptamer comprises 2’-O-Me modified nucleotides at each of the first two nucleotides at the 5’ end and a PS linkage between each of the first three nucleotides at the 5’ end; or iv) the aptamer comprises 2’-O-Me modified nucleotides at each nucleotide in the stem of the stem-loop and a PS linkage between each of the first three nucleotides at the 5’ end.

18. The system of any one of claims 15-17, wherein the aptamer is located 3’ of the DRS, further wherein: the affinity tag comprises a PS linkage between the last two nucleotides at the 3’ end; or the aptamer comprises 2’-O-Me modified nucleotides at each nucleotide in the stem of the stem-loop and a PS linkage between the last two nucleotides at the 3’ end.

19. The system of any one of claims 15-18, wherein the aptamer comprises 2’-O-Me modified nucleotides at each nucleotide.

20. The system of any one of claims 1-19, wherein the DRS comprises a modified nucleotide.

21. The system of any one of claims 1-20, wherein the DRS comprises a modified nucleotide selected from: i) 2’-O-methyl (2’-O-Me) modified nucleotide; ii) 2’-fluoro (2’-F) modified nucleotide; iii) an amine modified nucleotide; iv) an alkoxy modified nucleotide; v) an LNA modified nucleotide; vi) methoxyethyl modified nucleotide; vii) a halo modified nucleotide; or viii) phosphorothioate (PS) linkage modified nucleotide; optionally, wherein the modified nucleotide is a 2’-O-methyl (2’-O-Me) modified nucleotide or a phosphorothioate (PS) linkage modified nucleotide.

22. The system of claim 20 or 21, wherein: i) the modification in the DRS comprises a phosphorothioate modification, and the DRS does not comprise a phosphorothioate modification at position D1-D9 in the DRS sequence; ii) the modification in the DRS comprises a phosphorothioate modification, and the DRS comprises a phosphorothioate modification at or 3’ of position D10 in the DRS sequence; iii) the modification in the DRS comprises a 2’-O-Me modification, and the DRS does not comprise a 2’-O-Me modification at position D1-D3 in the DRS sequence; iv) the modification in the DRS comprises a 2’-O-Me modification, and the DRS comprises a 2’-O-Me modification at or 3’ of position D4 in the DRS sequence; orv) the DRS comprises a 2’-O-Me modification at a nucleotide other than the 5’ terminal and 3’ terminal nucleotides of the DRS.

23. The system of any one of claims 1-22, wherein the DNA-dependent DNA polymerase and nCas9 are provided as one or more polypeptides.

24. The system of any one of claims 1-22, wherein the DNA-dependent DNA polymerase and nCas9 are provided as one or more polynucleotides.

25. The system of any one of claims 1-24, wherein the DNA-dependent DNA polymerase comprises DNA polymerase Κ (polΚ), optionally human DNA polymerase Κ (polΚ), cynomolgus polΚ, or mouse polΚ, phage T5 DNA polymerase (T5 pol), DNA polymerase Θ, E. coli DNA polymerase I, optionally wherein the E. coli dependent DNA polymerase is Klenow (exo-), or DNA polymerase Ν, optionally wherein the DNA-dependent DNA polymerase is polK or T5 DNA polymerase.

26. The system of claims 1-25, comprising an nCas9-polymerase fusion polypeptide.

27. The system of claim 26, wherein the fusion polypeptide further comprises (i) a heterologous nuclear localization signal (NLS); or (ii) a linker or further comprises an additional linker.

28. The system of claim 26 or 27, wherein the polymerase is selected from: polymerase Θ, E. coli polymerase I, optionally an E. coli polymerase I Klenow (exo-), polymerase Ν, or Phi29 polymerase, wherein: i) the polymerase Θ and nCas9 are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order selected from: 1) nCas9 - polymerase Θ -NLS; or 2) nCas9- linker - polymerase Θ - linker - NLS; or ii) the E. coli polymerase I and nCas9 are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order selected from: 1) nCas9- Klenow (exo-) -NLS; 2) nCas9 - linker - Klenow (exo-) - linker -NLS; 3) NLS - nCas9- NLS - E coli PolI; or 4) NLS - nCas9-linker - NLS – linker - E coli PolI; or iii) the polymerase Ν and nCas9 are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order selected from: 1) polymerase Ν –NLS- nCas9– NLS; or2) polymerase Ν - linker - NLS- nCas9- linker - NLS; or iv) the Phi29 polymerase and nCas9 are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order selected from: 1) NLS - nCas9-NLS - Phi29 polymerase; 2) ii. NLS - nCas9- linker - NLS - linker - Phi29 polymerase; 3) nCas9- Phi29 polymerase - NLS; or 4) nCas9- linker - Phi29 polymerase - linker – NLS.

29. The system of claim 27 or 28, wherein, the linker comprises an amino acid sequence of any one of SEQ ID NOs: 1596-1665, 1735, 1738, 1815, 1825, 1827, and 1829-1830.

30. The system of any one of claims 26-29, wherein the fusion polypeptide comprises an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1024, 1027, 1030, 1033, 1036, 1039, 1042, 1045, 1048, 1053, 1056, 1059, 1074, 1081, 1084, 1086, 1094, 1097, 1100, 1102, 1112, 1114, 1124, 1129, 1134, 1137, 1142, 1147, 1152, 1157, 1162, 1167, 1172, 1192, 1195, 1198, 1219, 1224, 1229, 1234, 1236, 1239, 1254, and 1259, 1268, and 1273, 1276, 1300, 1303, 1307, 1373, 1376, 1388, 1447, 1450, 1453, 1923, 1926, 1929, 1932, 1935, and 1938, or a nucleic acid encoding the fusion protein sequence of any one of SEQ ID NOs: 1024, 1027, 1030, 1033, 1036, 1039, 1042, 1045, 1048, 1053, 1056, 1059, 1074, 1081, 1084, 1086, 1094, 1097, 1100, 1102, 1112, 1114, 1124, 1129, 1134, 1137, 1142, 1147, 1152, 1157, 1162, 1167, 1172, 1192, 1195, 1198, 1219, 1224, 1229, 1234, 1236, 1239, 1254, 1259, 1268, and 1273, 1276, 1300, 1303, 1307, 1373, 1376, 1388, 1477, 1450, 1453, 1923, 1926, 1929, 1932, 1935, and 1938.

31. The system of any one of claims 1-30, wherein the DNA-dependent DNA polymerase is (i) a human DNA-dependent DNA polymerase; or (ii) a cynomolgus or mouse DNA-dependent DNA polymerase.

32. The system of any one of claims 1-31, wherein the DNA-dependent DNA polymerase is not a Phi29 DNA polymerase.

33. The system of any one of claims 1-32, wherein the DNA-dependent DNA polymerase does not comprise at least 8 point mutations, optionally wherein the DNA-dependent DNA polymerase does not comprise at least 5 point mutations.

34. The system of any one of claims 1-33, wherein the wild-type DNA-dependent DNA polymerase has a polymerization rate at least twice as high, optionally at least five times as high at 37 °C as compared to 30 °C.

35. The system of any one of claims 1-34, comprising: i) a DNA polymerase Κ (polΚ), comprising an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acid residues 19-526 of SEQ ID NO: 1021; or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1021 or 1206, optionally wherein the polK includes or lacks an N- terminal methionine relative to SEQ ID NO: 1021 or 1206; or a nucleic acid encoding the polK, comprising a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1020 or 1205, optionally wherein the nucleotide sequence includes or lacks a start or stop codon relative to SEQ ID NO: 1020 or 1205; or ii) a T5 polymerase (T5 pol) comprising an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NO: 1116 or 1121, optionally wherein the T5 pol includes or lacks an N- terminal methionine relative to SEQ ID NO: 1116 or 1121; or a nucleic acid encoding the T5, comprising a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:1115 or 1120, optionally wherein the nucleotide sequence includes or lacks a start or stop codon relative to SEQ ID NO: 1115 or 1120.

36. The system of any one of claims 1-35, wherein the DNA-dependent DNA polymerase comprises a heterodimerization domain or further comprises an additional heterodimerization domain, optionally wherein the DNA-dependent DNA polymerase and nCas9 are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order of: i) NLS-nCas9-linker-NLS-linker-DNA-dependent DNA polymerase-NLS-NLS-linker- heterodimerization domain; or ii) NLS-nCas9-linker-NLS-linker- DNA-dependent DNA polymerase-linker-NLS- linker-heterodimerization domain.

37. The system of claim 36, wherein the heterodimerization domain comprises a coiled coil heterodimerization domain, optionally an EV, EI, KV, or KI domain.

38. The system of any one of claims 36 or 37, wherein the heterodimerization domain comprises an EI or KI domain, optionally wherein the heterodimerization domain comprises SEQ ID NO: 1589, SEQ ID NO: 1593, or SEQ ID NO: 1595.

39. The system of any one of claims 1-25 and 31-38, comprising: a) a first polypeptide comprising the DNA-dependent DNA polymerase operably linked to a first split-intein, or a nucleic acid encoding the first polypeptide; and (ii) a second polypeptide comprising the nCas9 operably linked to a second split-intein that is complementary to the first split intein, or a nucleic acid encoding the second polypeptide; b) a first polypeptide comprising a first portion of the DNA-dependent DNA polymerase operably linked to a first split-intein, or a nucleic acid encoding the first polypeptide; and (ii) a second polypeptide comprising a second portion of the DNA-dependent DNA polymerase and an nCas9 operably linked to a second split-intein that is complementary to the first split-intein; or c) a first polypeptide comprising a DNA-dependent DNA polymerase and a first portion of an nCas9 operably linked to a first split-intein, or a nucleic acid encoding the first polypeptide; and (ii) a second polypeptide comprising a second portion of the nCas9 operably linked to a second split-intein that is complementary to the first split-intein, or a nucleic acid encoding the second polypeptide, optionally wherein the first split-intein and the second split-intein are capable of binding to each other to undergo intein-mediated protein splicing.

40. The system of claim 39, wherein the first split-intein is an N-split-intein and the second split- intein is a C-split-intein, or wherein the first split-intein is a C-split-intein and the second split intein is an N-split-intein.

41. The system of any one of claims 39-40, wherein the first split-intein and second split-intein are complementary inteins selected from Cfa, M86, Npu, NpuSsp, gp41-1, gp41-8, NrdJ-1, IMPDH-1, SspDnaX, SspGyrB, Cth-Ter, NrdA-2, Mja-KlbA, RBS1, TE3S11, and Rma, optionally wherein the first split-intein and second split-intein are Cfa-inteins.

42. The system of claim 41, wherein the first split-intein is a CfaC split-intein and the second split-intein is a CfaN split-intein, optionally wherein (i) the CfaC split-intein comprises anamino acid sequence having at least 90% identity to SEQ ID NO: 1746 and the CfaN split- intein comprises an amino acid sequence having at least 90% identity to SEQ ID NO: 1744; or (ii) the CfaC split-intein comprises the amino acid sequence of SEQ ID NO: 1746 and the CfaN split-intein comprises the amino acid sequence of SEQ ID NO: 1744.

43. The system of any one of claims 39-42, wherein the DNA-dependent DNA polymerase or the first portion of the DNA-dependent DNA polymerase is operably linked to the first split- intein by a first peptide linker, optionally wherein the first peptide linker comprises 30 amino acids, optionally wherein the first peptide linker comprises an amino acids sequence at least 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1829.

44. The system of any one of claims 39-43, wherein the nCas9 or second portion of the nCas9 is operably linked to the second split-intein by a second peptide linker, optionally wherein the second peptide linker is SGGS (SEQ ID NO: 1738).

45. The system of any one of claims 39-44, wherein (i) the DNA-dependent DNA polymerase or the first portion of the DNA-dependent DNA polymerase is operably linked to a heterologous nuclear localization signal (NLS); or (ii) the nCas9 or the second portion of the nCas9 is operably linked to a heterologous nuclear localization signal (NLS); optionally wherein the heterologous NLS is selected from an SV40 NLS, SV40-c-Myc, and nucleoplasmin.

46. The system of any one of claims 1-45, further comprising at least one chromatin remodeler.

47. The system of claim 46, wherein the DNA-dependent DNA polymerase, nCas9, and chromatin remodeler are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order selected from: i) chromatin remodeler – nCas9 – DNA-dependent DNA polymerase; ii) nCas9 – chromatin remodeler – DNA-dependent DNA polymerase; or iii) nCas9 – DNA-dependent DNA polymerase – chromatin remodeler.

48. The system of claim 47, further comprising a nuclear localization signal (NLS), optionally wherein the DNA-dependent DNA polymerase, nCas9, and chromatin remodeler are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order selected from: i) NLS – chromatin remodeler – nCas9 – DNA-dependent DNA polymerase – NLS; ii) NLS – chromatin remodeler – nCas9 – NLS – DNA-dependent DNA polymerase – NLS;iii) NLS – nCas9 – chromatin remodeler – DNA-dependent DNA polymerase – NLS; or iv) NLS – nCas9 – chromatin remodeler – NLS-DNA-dependent DNA polymerase – NLS; nCas9 – DNA-dependent DNA polymerase – chromatin remodeler – NLS.

49. The system of any one of claims 46-48, further comprising one or more linkers between the NLS, nCas9, DNA-dependent DNA polymerase, and the chromatin remodeler.

50. The system of any one of claims 46-49, wherein the at least one chromatin remodeler is selected from a polypeptide comprising HMGB1, HMGN1, HMGN2, HMGN3a, HMGN3b, HMGN4, HMGN5, histone H1.0, histone H1.2, CHD1, ISWI, DNA helicase, TOP1, herpesvirus 8 LANA, CMV IE1 or a domain thereof.

51. The system of any one of claims 1-50, wherein the at least one chromatin remodeler comprises an HMGB1 polypeptide, optionally wherein the HMGB1 polypeptide comprises a sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1783.

52. The system of claim 51, wherein the HMGB1 polypeptide comprises an HMGB1 Box B domain and at least 7 contiguous amino acid residues C-terminal to the HMGB1 Box B domain, and wherein the HMGB1 polypeptide lacks all or part of an acidic tail domain.

53. The system of any one of claims 51-52, wherein the HMGB1 polypeptide comprises a cryptic nuclear localization signal (NLS), optionally wherein the cryptic NLS comprises the sequence of EKSKKKK (SEQ ID NO: 1787).

54. The system of any one of claims 51-53, wherein the HMGB1 polypeptide lacks an HMGB1 Box A domain or wherein the HMGB1 polypeptide comprises two HMGB1 Box B domains, optionally wherein the cryptic NLS is located C-terminal to the C-terminal end of the two HMGB1 Box B domains.

55. The system of any one of claims51-54, wherein the HMGB1 polypeptide comprises, from N- terminus to C-terminus: 1) HMGB1 Box A domain – HMGB1 Box B domain – cryptic NLS; 2) HMGB1 Box B domain – HMGB1 Box B domain – cryptic NLS; or 3) HMGB1 Box B domain – cryptic NLS.

56. The system of any one of claims 51-55, wherein the HMGB1 polypeptide comprises (i) at least 90% sequence identity to SEQ ID NO: 1783-1792 and 1803-1804; or (ii) the amino acid sequence of SEQ ID NO: 1783-1792 and 1803-1804.

57. The system of any one of claims 39-56, wherein the first or second polypeptide further comprises an HMGB1 polypeptide.

58. The system of claim 57, wherein the first or second polypeptide further comprises an HMGB1 polypeptide, further wherein: the first polypeptide comprises, from N-terminus to C-terminus: HMGB– nCas9 – N-split-intein; and the second polypeptide comprises, from N- terminus to C-terminus: C-split-intein – DNA-dependent DNA polymerase.

59. The system of claim 57 or 58, wherein: i) the first polypeptide comprises, from N-terminus to C-terminus: NLS – HMGB – linker – nCas9 – linker – N-split-intein; and ii) the second polypeptide comprises, from N-terminus to C-terminus: 1) C-split-intein – linker – NLS – DNA-dependent DNA polymerase – linker – coiled coil heterodimerization domain; or 2) C-split-intein – linker – NLS – DNA-dependent DNA polymerase – linker – NLS; optionally wherein the second polypeptide comprises at least one enhancer of template- based genome editing at the C-terminus.

60. A template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: i) the first polynucleotide comprises a SpyCas9 guide RNA, comprising, from 5’ to 3’, 1) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and 2) a scaffold; ii) the second polynucleotide is operably linked to the first polynucleotide and comprises, from 5’ to 3’: 1) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and 2) a DNA-dependent DNA polymerase recruiting sequence (DRS) having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS-complementary region of thenon-target strand of the DNA duplex target nucleic acid, optionally wherein the DRS is 6-20 nucleotides in length, further optionally 6-17, 8-17, 10-12, 10-14, 10- 16, or 12-14 nucleotides in length.

61. The tgRNA of claim 60, wherein the DRS comprises at least one of: 1) a sequence not fully complementary to the DRS-complementary region of the non- target strand of the DNA duplex target nucleic acid; 2) a 1-5 nucleotide, optionally a 1-3 nucleotide 3’ terminal tail comprising a 3’ terminal modified uridine nucleotide; or 3) a 5’ terminal (D1) DNA nucleotide and a penultimate 5’ terminal (D2) RNA nucleotide wherein the 3’ end of the ϐirst polynucleotide is covalently linked to the 5’ end of the second polynucleotide by a phosphorothioate or phosphodiester linkage.

62. The tgRNA of claim 60 or 61, wherein the spacer sequence is 20 nucleotides in length.

63. The tgRNA of any one of claims 60-62, wherein the spacer of the guide RNA comprises a modified nucleotide, optionally wherein the spacer of the guide RNA comprises a phosphorothioate (PS) modification, a 2’-O-methyl (2’-O-Me) modified nucleotide, or a 2’-F modified nucleotide.

64. The tgRNA of any one of claims 60-63, wherein the spacer of the guide RNA comprises DNA nucleotides, optionally wherein the spacer of the guide RNA comprises a DNA nucleotide at at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, further optionally wherein the spacer of the guide RNA comprises a DNA nucleotide at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 nucleotides.

65. The tgRNA of any one of claims 60-64, wherein the spacer of the guide RNA comprises a DNA nucleotide at one or more, two or more, three or more, or four or more of positions S1, S2, S3, S4, S5, S9, S10, S11, S12, S13, S17, S18, or S20, optionally wherein the spacer of the guide RNA comprises a DNA nucleotide at one or more of positions S11, S12, and S18, optionally at each of positions S11, S12, and S18.

66. The tgRNA of any one of claims 60-63, wherein the spacer of the guide RNA does not comprise DNA nucleotides.

67. The tgRNA of any one of claims 60-64, wherein the spacer of the guide RNA comprises a modified nucleotide at one or more of the first five nucleotides at the 5’ end, optionally at one or more of the first three nucleotides at the 5’ end of the spacer.

68. The tgRNA of any one of claims 60-67, wherein the spacer of the guide RNA does not comprise a modification at one or more of positions S6, S7, S8, S15, S16, and S19, optionally at one or more of positions S4, S5, S6, S7, S8, S11, S12, S15, S16, S18, and S19.

69. The tgRNA of any one of claims 60-68, wherein the spacer of the guide RNA comprises a modification at one or more of positions S4, S5, S9, S10, S11, S12, S13, S14, S17, S18, and S20.

70. The tgRNA of any one of claims 60-69, wherein the spacer of the guide RNA comprises (i) 3 PS linkages between the 4 consecutive 5’ terminal nucleotides of the spacer; or (ii) a PS linkage between positions S7 and S8.

71. The tgRNA of any one of claims 60-70, wherein the spacer of the guide RNA comprises a 2’- O-Me modified nucleotide or a 2’-F modified nucleotide in at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.

72. The tgRNA of any one of claims 60-71, wherein the spacer of the guide RNA comprises (i) 2’-O-Me modified nucleotides at each of the first three nucleotides (S1, S2, and S3) at the 5’ end of the spacer; or (ii) 2’-F modified nucleotides at one or more of positions S9, S10, S11, S13, S14, S17, and S18.

73. The tgRNA of claim 72, wherein the spacer of the guide RNA comprises a 2’-O-Me modified nucleotide at position S4 and 2’-F modified nucleotides at each of positions S9, S10, S11, S13, S14, S17, and S18, further optionally wherein the spacer of the guide RNA comprises a PS linkage between positions S7 and S8.

74. The tgRNA of any one of claims 60-72, wherein the spacer of the guide RNA comprises 2’- O-Me modified nucleotides at one or more of positions S4, S5, S9, S10, S11, S12, S13, S14, S17, S18, and S20, optionally wherein the spacer of the guide RNA comprises (i) 2’-O-Me modified nucleotides at one or more of positions S4, S5, S9, S10, S13, S14, S17 and S20; or (ii) 2’-O-Me modified nucleotides at each of positions S9, S10, S13, S14, S17, and S20.

75. The tgRNA of claim 74, wherein the spacer of the guide RNA comprises 2’-O-Me modified nucleotides at each of positions S9, S10, S17, and S20 and DNA nucleotides at each of positions S11, S12, and S18.

76. The tgRNA of any one of claims 60-72, wherein the spacer of the guide RNA comprises 2’- O-Me modified nucleotides at each of positions S1, S2, S3, S4, and 2’-F modified nucleotides at each of positions S9, S10, S11, S13, S14, S17, and S18, and unmodified nucleotides at each of positions S5, S6, S7, S8, S12, S15, S16, S19, an S20.

77. The system of any one of claims 60-72, wherein the spacer of the guide RNA comprises 2’- O-Me modified nucleotides at each of S1, S2, S3, S9, S10, S13, S14, S16, and S20., and unmodified nucleotides at each of S6, S7, S8, S15, S16, and S19, optionally unmodified nucleotides at one, two, three, four, or all of S4, S5, S11, S12, and S18.

78. The system of any one of claims 60-72, wherein the spacer of the guide RNA comprises 2’- O-Me modified nucleotides at each of S1, S2, S3, S9, S10, S13, S14, S17, and S20, DNA nucleotides at each of S11, S12, and S18, and unmodified nucleotides at each of S6, S7, S8, S15, S16, and S19, optionally unmodified nucleotides at one or both of S4 and S5.

79. The tgRNA of claim 74, wherein: i) the spacer of the guide RNA comprises 2’-O-Me modified nucleotides at each of S1, S2, S3, S9, S10, S13, S14, S17, and S20; and ii) the spacer of the guide RNA does not comprise a modification at each of S4, S5, S6, S7, S8, S11, S12, S15, S16, S18, and S19.

80. The tgRNA of claim 74, wherein: i) the spacer of the guide RNA comprises 2’-O-Me modified nucleotides at each of S1, S2, S3, S9, S10, S13, S14, S17, and S20; ii) the spacer of the guide RNA comprises DNA nucleotides at each of positions S11, S12, and S18; and iii) the spacer of the guide RNA does not comprise a modification at each of S4, S5, S6, S7, S8, S15, S16, and S19.

81. The tgRNA of any one of claims 60-80, wherein the scaffold of the guide RNA comprises the nucleotide sequence of SEQ ID NO: 27 or 40.

82. The tgRNA of claim 81, wherein: i) nucleotides 5’-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAU-3’ or 5’- GUUUUAGACGUAGAAAUACGAAGUUAAAAU-3’ constitute a repeat / antirepeat (R / AR) region, wherein nucleotides 1-6 (LS1-LS6) and 25-30 (LS7-LS12) of the R / AR constitute a lower stem (LS) region, nucleotides 7-8 (B1-B2) and 21-24 (B3-B6) of the R / AR constitute a bulge region; and nucleotides 9-20 (US1-US12) of the R / AR constitute an upper stem (US) region; ii) nucleotides 5’-AAGGCUAGUCCGUUAUCA-3’ constitute a nexus region (N1- N18); iii) nucleotides 5’-CGAAAG-3’ constitute a hairpin 1 (H1) region (from 5’ to 3’, H1-2, H1-5 to H1-8, and H1-11); iv) nucleotides 5’-GCACCGAGUCGGUGC-3’ constitute a hairpin 2 (H2) region H2-1 to H2-15); and v) a G nucleotide between H1 region and H2 region constitutes nucleotide n; wherein the scaffold comprises at least one region with unmodified and modified nucleotides selected from: 1) the lower stem region comprising modified nucleotides at LS1, LS8, LS10, and LS12; nucleotides not modified with 2’-O-Me at LS2, LS3, LS4, LS5; 2) the bulge region comprising nucleotides not modified with 2’-O-Me at B5 and B6; 3) the upper stem region comprising modified nucleotides at at least 10 positions selected from US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12, optionally at all positions US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12; 4) the nexus region comprising modified nucleotides at N1, N2, N4, N7, N11, N12, and N17; and nucleotides not modified with 2’-O-Me at N6, N8, N9, N10, N13, and N14; 5) the hairpin 1 (H1) region, comprising modified nucleotides at H1-2, H1-6, H1-7, H1-8, and H1-11; and nucleotides not modified with 2’-O-Me at H1-5; 6) the hairpin 2 (H2) region comprising modified nucleotides at H2-1, H2-2, H2-3, H2-4, H2-5, H2-6, H2-7, H2-12, H2-13, H2-14, and H2-15; and nucleotides not modified with 2’-O-Me at H2-8, H2-9, and H2-10; and 7) the n is a modified or unmodified nucleotide.

83. The tgRNA of claim 82, wherein the scaffold comprises at least one region with unmodified and modified nucleotides selected from:i) the lower stem region comprising modified nucleotides at LS1, LS8, LS10, and LS12; nucleotides not modified with 2’-O-Me at LS2, LS3, LS4, LS5, and LS6; ii) the bulge region comprising nucleotides not modified with 2’-O-Me at B5 and B6; iii) the upper stem region comprising modified nucleotides at at least 10 positions selected from US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12, optionally at all positions US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12; iv) the nexus region comprising modified nucleotides at N1, N2, N4, N7, N11, N12, and N17; and nucleotides not modified with 2’-O-Me at N6, N8, N9, N10, N13, N14, and N16; v) the hairpin 1 (H1) region, comprising modified nucleotides at H1-2, H1-6, H1-7, H1- 8, and H1-11; and nucleotides not modified with 2’-O-Me at H1-5; vi) the hairpin 2 (H2) region comprising modified nucleotides at H2-1, H2-2, H2-3, H2- 4, H2-5, H2-6, H2-7, H2-11, H2-12, H2-13, H2-14, and H2-15; and nucleotides not modified with 2’-O-Me at H2-8, H2-9, and H2-10; and vii) the n is a modified or unmodified nucleotide.

84. The tgRNA of claim 81 or 82, wherein the scaffold comprises at least one region with unmodified and modified nucleotides selected from: i) the lower stem region comprising modified nucleotides at LS1, LS8, LS10, and LS12; nucleotides not modified with 2’-O-Me at LS2, LS3, LS4, LS5, LS6, and LS9; ii) the bulge region comprising nucleotides not modified with 2’-O-Me at B5 and B6; iii) the upper stem region comprising modified nucleotides at at least 10 positions selected from US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12, optionally at all positions US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11, and US12; iv) the nexus region comprising modified nucleotides at N1, N2, N4, N7, N11, N12, N16, and N17; and nucleotides not modified with 2’-O-Me at N6, N8, N9, N10, N13, N14, and N16; v) the hairpin 1 (H1) region, comprising modified nucleotides at H1-2, H1-6, H1-7, H1- 8, and H1-11; and nucleotides not modified with 2’-O-Me at H1-5;vi) the hairpin 2 (H2) region comprising modified nucleotides at H2-1, H2-2, H2-3, H2- 4, H2-5, H2-6, H2-7, H2-11, H2-12, H2-13, H2-14, and H2-15; and nucleotides not modified with 2’-O-Me at H2-8, H2-9, and H2-10; and vii) the n is a modified or unmodified nucleotide.

85. The tgRNA of any one of claims 81-84, wherein the lower stem region comprises modified nucleotides at LS1, LS8, LS10, and LS12; nucleotides not modified with 2’-O-Me at LS2, LS3, LS4, LS5, LS6, LS7, LS9, and LS11.

86. The tgRNA of any one of claims 81-85, wherein the lower stem region comprises unmodified nucleotides at LS2, LS3, LS4, and LS5, optionally at LS2, LS3, LS4, LS5, LS6, LS7, LS9, and LS11, optionally wherein the lower stem region comprises unmodified nucleotides at LS7, LS9, and LS11.

87. The tgRNA of any one of claims 81-86, wherein the bulge region comprises (i) modified nucleotides at B2 and B3; or (ii) unmodified nucleotides at B5 and B6, optionally at B1, B4, B5, and B6.

88. The tgRNA of any one of claims 81-87, wherein the modified nucleotides of the upper stem are 2’-O-Me modified nucleotides.

89. The tgRNA of any one of claims 81-88, wherein the nexus region comprises unmodified nucleotides at N6, N8, N9, N10, N13, N14, and N18, optionally at N3, N5, N6, N8, N9, N10, N13, N14, N15, and N18.

90. The tgRNA of any one of claims 81-89, wherein the hairpin 1 region comprises (i) an unmodified nucleotide at H1-5; or (ii) unmodified nucleotides at H2-8, H2-9, and H2-10.

91. The tgRNA of any one of claims 81-90, further comprising a 3’ tail, optionally wherein the gRNA comprises a 3’ end modification.

92. The tgRNA of any one of claims 60-91, wherein the scaffold sequence comprises an internal linker, optionally wherein the scaffold sequence comprises (i) an internal linker in or substitutes for the upper stem region; (ii) an internal linker in a nexus region; or (iii) an internal linker in the hairpin 1 region.

93. The tgRNA of any one of claims 60-92, wherein the scaffold of the SpyCas9 guide RNA comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of any one of SEQ ID NOs: 5, 27, 35, 210, 212, 223, 269, 370, 201-208, 373-374, 393-400, 429, and 430; optionally,i) the sequence of mGUUUUAGmAmGmC(L1)mGmCmAAGUUmAAmAAmUmAmAGmGCUmAG UCmCmGUUAUmCAmC(L1)mGGmGmCmAmCmCmGmAGUCmGmGmUmGm C (SEQ ID NO: 272) or a sequence having at least 90%, 95%, or 98% identity to SEQ ID NO: 272; b) the sequence of GUUUUAGAmGmCmUmA(L1)mUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCAC(L1)GGGCACCGAGUCGGmUmGmC (SEQ ID NO: 211) or a sequence having at least 90%, 95%, or 98% identity to SEQ ID NO: 211; c) the sequence of GUUUUAGAmGmC(L1)mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAC( L1)GGGCACCGAGUCGGmUmGmC (SEQ ID NO: 232) or a sequence having at least 90%, 95%, or 98% identity to SEQ ID NO: 232; or d) the sequence of mGUUUUAGmAmGmCmUmA(L1)mUmAmGmCmAAGUUmAAmAAmUmAmA GmGCUmAGUCmCmGUUAUmCAmC(L1)mGGmGmCmAmCmCmGmAGUCm GmGmUmGmC (SEQ ID NO: 224) or a sequence having at least 90%, 95%, or 98% identity to SEQ ID NO: 224, wherein L1 denotes that the linker is S18, and L3 denotes that the linker is S6.

94. The tgRNA of any one of claims 60-93, wherein the spacer or the scaffold of the guide RNA comprises a modified nucleotide.

95. The tgRNA of any one of claims 60-94, wherein the first polynucleotide comprises (i) a SpyCas9 guide RNA comprising, from 5’ to 3’, a guide sequence and any one of SEQ ID NOs: 5, 27, 35, 210, 212, 223, 269, 370, 201-208, 373-374, and 393-400 ; (ii) a SpyCas9 guide RNA comprising, from 5’ to 3’, a guide sequence and a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of any one of SEQ ID NOs: 5, 27, 35, 210, 212, 223, 269, 370, 201-208, 373-374, 393-400, 429, and 430; or (iii) a SpyCas9 guide RNA comprising a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of any one of SEQ ID NOs: 310, 312, 319-326, 347-349, 371, 384-392, 434, 438.

96. The tgRNA of any one of claims 60-95, wherein the first polynucleotide is covalently linked to the second polynucleotide, optionally wherein the 3’ end of the first polynucleotide is covalently linked to the 5’ end of the second polynucleotide.

97. The tgRNA of any one of claims 60-96, wherein the first polynucleotide is linked to the second polynucleotide by a non-nucleotide linker, optionally by a phosphodiester bond or a phosphorothioate bond.

98. The tgRNA of any one of claims 60-97, wherein the template comprises a mismatch to the genomic sequence, optionally 1-4 mismatches to the genomic sequence.

99. The tgRNA of any one of claims 60-98, wherein the mismatch that directs a template-based edit in the genomic DNA is within nucleotides T1-T25, optionally within nucleotides T1-T15 of the template.

100. The tgRNA of any one of claims 60-99, wherein the template comprises DNA nucleotides.

101. The tgRNA of any one of claims 60-100, wherein: (i) the 3’ terminal nucleotide of the template is a DNA nucleotide; or (ii) the template consists of DNA nucleotides from nucleotide 4 (T4) from the 3’ end of the template to the 5’ end of the template.

102. The tgRNA of any one of claims 60-101, wherein the template consists of DNA nucleotides.

103. The tgRNA of any one of claims 60-101, wherein the template comprises RNA nucleotides.

104. The tgRNA of any one of claims 60-101 and 103, wherein the template comprises both RNA nucleotide(s) and DNA nucleotide(s), optionally wherein at least one nucleotide at positions T1 or T2 of the template is an RNA nucleotide.

105. The tgRNA of any one of claims 60-101 and 103-104, wherein the template comprises 0- 1 RNA nucleotides, optionally 1 RNA nucleotide, at the 3’ end of the template or wherein the template comprises 1-3 RNA nucleotides, optionally only 1 RNA nucleotide, at the 3’ end of the template.

106. The tgRNA of any one of claims 60-105, wherein (i) the DRS is 6-18 nucleotides in length, optionally 8-18 or 10-12 nucleotides in length; or (ii) the DRS is 10-16 or 12-14 nucleotides in length.

107. The tgRNA of any one of claims 60-106, wherein the DRS comprises (i) a sequence that is complementary to at least 6 nucleotides of the DRS-complementary region of the non- target strand of the DNA duplex target nucleic acid comprising nucleotides D2-D9 of the DRS, optionally D2-D8 or D3-D9 of the DRS; or (ii) a sequence that is complementary to a DRS-complementary region of a non-target strand of the DNA duplex target nucleic acid comprising nucleotides D6-D13 of the DRS, optionally wherein 1, 2, 3, 4, 5, 6, 7, or 8 of nucleotides D6-D13 are DNA nucleotides.

108. The tgRNA of any one of claims 60-107, wherein the DRS comprises a sequence that is not fully complementary to the DRS-complementary region of the non-target strand of the DNA duplex target nuclei acid.

109. The tgRNA of any one of claims 60-108, wherein the DRS comprises RNA nucleotides.

110. The tgRNA of any one of claims 60-109, wherein (i) the penultimate 5’ terminal nucleotide of the DRS (D2) is an RNA nucleotide; (ii) each nucleotide from the penultimate 5’ nucleotide (D2) to the 3’ terminal nucleotide in the DRS is an RNA nucleotide; or (iii) each nucleotide from the penultimate 5’ nucleotide (D2) to the 3’ end nucleotide in the DRS is an RNA nucleotide.

111. The tgRNA of any one of claims 60-110, wherein the DRS consists of RNA nucleotides.

112. The tgRNA of any one of claims 60-110, wherein the DRS comprises DNA nucleotides or wherein the DRS comprises both DNA nucleotide(s) and RNA nucleotide(s).

113. The tgRNA of any one of claims 60-110 and 112, wherein the DRS comprises a 3’ end and a 5’ end, and (i) the 5’ terminal nucleotide of the DRS (D1) is a DNA nucleotide; (ii) 0-7 nucleotides at the 5’ end of the DRS (nucleotides D1-D7) are DNA nucleotides; (iii) one or more of nucleotides 1-7 nucleotides at the 5’ end of the DRS (nucleotides D1-D7) are DNA nucleotides; or (iv) one or more of nucleotides 1-3 at the 5’ end of the DRS (nucleotides D1- D3), optionally the 5’ terminal nucleotide in the DRS (nucleotide D1) is a DNA nucleotide.

114. The tgRNA of claim 113, wherein: i) one or more of nucleotides 1-5 at the 5’ end of the DRS (nucleotides D1-D5) are DNA nucleotides, optionally wherein the remaining nucleotides in the DRS are RNA nucleotides; ii) 1-3 nucleotides at the 5’ end of the DRS (nucleotides D1-D3), optionally the most 5’ nucleotide in the DRS (nucleotide D1), is a DNA nucleotide;iii) nucleotides 1 and 3 at the 5’ end of the DRS (nucleotides D1 and D3) are DNA nucleotides, optionally wherein the remaining nucleotides in the DRS are RNA nucleotides; iv) nucleotides 1, 3, and 5 at the 5’ end of the DRS (nucleotides D1, D3, and D5) are DNA nucleotides, optionally wherein the remaining nucleotides in the DRS are RNA nucleotides; or v) the 3’ terminal nucleotide in the DRS is an RNA nucleotide and the remaining nucleotides in the DRS are DNA nucleotides.

115. The tgRNA of any one of claims 60-110 and 112-114, wherein the 3’ terminal nucleotide of the template and the 5’ terminal nucleotide of the DRS are DNA nucleotides, and the penultimate 5’ terminal nucleotide of the DRS is an RNA nucleotide.

116. The tgRNA of any one of claims 60-110 and 112-113, wherein the 3’ terminal nucleotide in the DRS is an RNA nucleotide and the remaining nucleotides in the DRS are DNA nucleotides or wherein the DRS consists of DNA nucleotides.

117. The tgRNA of claim 116, wherein the spacer of the guide RNA comprises 2’-O-Me modified nucleotides at one or more of positions S1, S2, S3, S4, S5, S9, S10, S11, S12, S13, S14, S17, S18, and S20.

118. The tgRNA of claim 116, wherein the spacer of the guide RNA does not comprise a modification at one or more of positions S6, S7, S8, S15, S16, and S19.

119. The tgRNA of any one of claims 116-118, wherein: i) the spacer of the guide RNA comprises 2’-O-Me modified nucleotides at each of S1, S2, S3, S9, S10, S13, S14, S17, and S20; and ii) the spacer of the guide RNA does not comprise a modification at each of S4, S5, S6, S7, S8, S11, S12, S15, S16, S18, and S19.

120. The tgRNA of claim 114, wherein: i) the spacer of the guide RNA comprises 2’-O-Me modified nucleotides at each of S1, S2, S3, S9, S10, S13, S14, S17, and S20; ii) the spacer of the guide RNA comprises DNA nucleotides at each of positions S11, S12, and S18; and iii) the spacer of the guide RNA does not comprise a modification at each of S4, S5, S6, S7, S8, S15, S16, and S19.

121. The tgRNA of any one of claims 60-120, wherein the DRS comprises a 3’ tail at the 3’ end of the DRS, wherein the tail is 1-5 nucleotides, optionally 1-3 nucleotides in length.

122. The tgRNA of claim 121, wherein the 3’ tail of the DRS comprises an RNA nucleotide.

123. The tgRNA of claim 121 or 122, wherein the 3’ tail comprises a uridine nucleotide, optionally wherein the 3’ terminal nucleotide is a modified uridine nucleotide.

124. The tgRNA of any one of claims 60-123, wherein the DRS comprises a modified nucleotide, optionally wherein the modified nucleotide is selected from: i) 2’-O-methyl (2’-O-Me) modified nucleotide; ii) 2’-fluoro (2’-F) modified nucleotide; iii) an amine modified nucleotide; iv) an alkoxy modified nucleotide; v) an LNA modified nucleotide; vi) methoxyethyl modified nucleotide; vii) a halo modified nucleotide; or viii) phosphorothioate (PS) linkage modified nucleotide; optionally, wherein the modified nucleotide is a 2’-O-methyl (2’-O-Me) modified nucleotide or a phosphorothioate (PS) linkage modified nucleotide.

125. The tgRNA of claim 124, wherein i) the modification in the DRS comprises a phosphorothioate modification, and the DRS does not comprise a phosphorothioate modification at position D1-D9 in the DRS sequence; ii) the DRS comprises a phosphorothioate modification at or 3’ of position D10 in the DRS sequence; iii) the modification in the DRS comprises a 2’-O-Me modification, and the DRS does not comprise a 2’-O-Me modification at position D1-D3 in the DRS sequence; iv) the modification in the DRS comprises a 2’-O-Me modification, and the DRS does not comprise a 2’-O-Me modification at the 5’ terminal and 3’ terminal nucleotides of the DRS; v) the modification in the DRS comprises a 2’-O-Me modification at a nucleotide other than the 5’ terminal and 3’ terminal nucleotides of the DRS;vi) the modification in the DRS comprises a 2’-O-Me modification, and the DRS comprises a 2’-O-Me modification at or 3’ of position D4 in the DRS sequence; vii) the modification in the DRS comprises a 2’-O-Me or a 2’-F modification, and the DRS comprises a 2’-O-Me or 2’-F modification at the 3’ terminal nucleotide in the DRS; viii) 1-3 terminal nucleotides at the 3’ end of the DRS are chemically modified, optionally wherein the nucleotide at the 3’ end of the DRS is chemically modified; ix) 1-3 terminal nucleotides at the 3’ end of the DRS comprises a phosphorothioate (PS) modification, optionally wherein at least one PS modification is between the last two nucleotides at the 3’ terminus; x) the 3’ terminal nucleotide of the DRS comprises a 2’-O-Me modification; xi) the DRS comprises PS linkages between 2, 3, 4, 5, or 6 consecutive 3’ terminal nucleotides of the DRS; or xii) all RNA nucleotides in the DRS comprise modified RNA nucleotides.

126. The tgRNA of any one of claims 124-125, wherein: i) the DRS comprises PS linkages between 2, 3, 4, 5, or 6 consecutive 3’ terminal nucleotides of the DRS; ii) the DRS comprises a PS linkage between the 3’ terminal and penultimate 3’ terminal nucleotides of the DRS; iii) the DRS comprises 3 PS linkages between the 4 consecutive 3’ terminal nucleotides of the DRS; iv) the DRS comprises a PS linkage between 2 nucleotides other than the 3’ terminal and penultimate 3’ terminal nucleotides of the DRS; v) the DRS comprises a phosphorothioate modification, wherein the DRS does not comprise a phosphorothioate modification at position D1-D9 in the DRS sequence; or vi) the DRS comprises a phosphorothioate modification at or 3’ of position D10 in the DRS sequence.

127. The tgRNA of any one of claims 60-95 and 98-126, wherein the first polynucleotide is not covalently linked to the second polynucleotide.

128. The tgRNA of any one of claims 60-110, and 112-127 , wherein i) 1-7 consecutive 5’ terminal nucleotides of the DRS are DNA nucleotides;ii) the 5’ terminal and penultimate 5’ terminal nucleotides of the DRS are DNA nucleotides; iii) at least 3 consecutive 5’ terminal nucleotides of the DRS are DNA nucleotides; or iv) 3 consecutive 5’ terminal nucleotides of the DRS are DNA nucleotides.

129. The tgRNA of any one of claims 60-128, wherein the tgRNA further comprises an affinity tag, wherein the first polynucleotide or the second polynucleotide are bound to a peptide or a peptide complex comprising an nCas9 and a DNA-dependent DNA polymerase by the affinity tag.

130. The tgRNA of any one of claims 60-110, and 112-129, wherein 1-7 consecutive 5’ terminal nucleotides of the DRS are DNA nucleotides, optionally wherein: i) the 5’ terminal and penultimate 5’ terminal nucleotides of the DRS are DNA nucleotides; ii) at least 3 consecutive 5’ terminal nucleotides of the DRS are DNA nucleotides; or iii) 3 consecutive 5’ terminal nucleotides of the DRS are DNA nucleotides.

131. The tgRNA of any one of claims 129-130, wherein the affinity tag is located 5’ of the template sequence or the affinity tag is located 3’ of the DRS.

132. The tgRNA of any one of claims 129-131, wherein the tgRNA comprises two affinity tags, optionally wherein (i) both affinity tags are located 5’ of the template; or (ii) a first affinity tag is located 5’ of the template sequence and a second affinity tag is located 3’ of the DRS, wherein the DNA-dependent DNA polymerase is T5 DNA polymerase.

133. The tgRNA of any one of claims 129-132, wherein the affinity tag is an aptamer comprising one or more modified nucleotides, optionally wherein the aptamer is located 5’ of the template and has a 5’ terminus, further optionally wherein the aptamer comprises one or more modified nucleotide at the 5’ end thereof.

134. The tgRNA of claim 133, wherein the modified nucleotide is a 2’-O-methyl (2’-O-Me) modified nucleotide or a phosphorothioate (PS) linkage modified nucleotide.

135. The tgRNA of any one of claims 133-134, wherein the aptamer comprises a stem-loop, optionally wherein the aptamer comprises 2’-O-Me modified nucleotides at each nucleotide in the stem of the stem-loop.

136. The tgRNA of any one of claims 133-135, wherein the aptamer is located 5’ of the template sequence, further wherein:i) the aptamer comprises a PS linkage between each of the first three nucleotides at the 5’ end; ii) the aptamer is located 5’ of the template sequence, further wherein the aptamer comprises 2’-O-Me modified nucleotides at each of the first two nucleotides at the 5’ end; iii) the aptamer comprises 2’-O-Me modified nucleotides at each of the first two nucleotides at the 5’ end and a PS linkage between each of the first three nucleotides at the 5’ end; or iv) the aptamer comprises 2’-O-Me modified nucleotides at each nucleotide in the stem of the stem-loop and a PS linkage between each of the first three nucleotides at the 5’ end.

137. The tgRNA of any one of claims 133-136, wherein the aptamer is located 3’ of the DRS, further wherein: (i) the affinity tag comprises a PS linkage between the last two nucleotides at the 3’ end; or (ii) the aptamer comprises 2’-O-Me modified nucleotides at each nucleotide in the stem of the stem-loop and a PS linkage between the last two nucleotides at the 3’ end.

138. The tgRNA of any one of claims 133-137, wherein the aptamer comprises 2’-O-Me modified nucleotides at each nucleotide.

139. A system comprising: a) a first polynucleotide encoding a first polypeptide comprising a DNA-dependent DNA polymerase, or portion thereof, operably linked to a first split-intein; and b) a second polynucleotide encoding a second polypeptide comprising a SpyCas9 nickase (nCas9), or portion thereof, operably linked to a second split-intein that is complementary to the first split-intein, wherein the first split-intein and the second split-intein undergo trans-splicing reaction, resulting in the formation of a single fusion polypeptide comprising from N-terminus to C-terminus, (i) the DNA-dependent DNA polymerase and the nCas9, or (ii) the nCas9 and the DNA-dependent DNA polymerase.

140. The system of claim 139, comprising: i) a first polynucleotide encoding the DNA-dependent DNA polymerase operably linked to the first split-intein; and (ii) a second polynucleotide encoding the nCas9 operably linked to the second split-intein that is complementary to the first split- intein;ii) a first polynucleotide encoding a first portion of the DNA-dependent DNA polymerase operably linked to the first split-intein; and (ii) a second polynucleotide encoding a second portion of the DNA-dependent DNA polymerase and the nCas9 operably linked to the second split-intein that is complementary to the first split- intein; or iii) a first polynucleotide encoding the DNA-dependent DNA polymerase and a first portion of the nCas9 operably linked to the first split-intein; and (ii) a second polynucleotide encoding a second portion of the nCas9 operably linked to the second split-intein that is complementary to the first split-intein.

141. The system of claim 139 or 140, wherein: i) the DNA-dependent DNA polymerase is a polK comprising an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acid residues 19-526 of SEQ ID NO: 1021; or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1021, 1265, or 1206, optionally wherein the polK includes or lacks an N-terminal methionine relative to SEQ ID NO: 1021, 1265, or 1206; or ii) the DNA-dependent DNA polymerase is a T5 pol comprising an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NO: 1116 or 1121, optionally wherein the T5 pol includes or lacks an N-terminal methionine relative to SEQ ID NO: 1116 or 1121.

142. The system of any one of claims 139-141, wherein the first split-intein is an N-split-intein and the second split-intein is a C-split-intein or wherein the first split-intein is a C-split-intein and the second split-intein is an N-split-intein, optionally wherein the first split-intein and second split-intein are Cfa-inteins.

143. The system of any one of claims 139-142, wherein: 1) the first polynucleotide comprises an open reading frame (ORF) of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 1278, 1281, 1363, 1366, and 1378; 1391, 1395, 1399, 1403, 1407, 1411, 1415, 1419, 1423, 1427, 1431, 1435, 1439, 1443, 1907, 1913, 1940, 1943 or a sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,99%, or 100% identical to any one of SEQ ID NOs: 1277, 1280, 1362, 1365, 1377, 1906, 1912, 1939, 1942, 3006-3008, 3010, 3012, and 3017-3018; or 2) the second polynucleotide comprises an open reading frame (ORF) of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 1284, 1287, 1290, 1293, 1296, 1369, 1381, 1384, 1389, 1393; 1397, 1401, 1405, 1409, 1413, 1417, 1421, 1425, 1429, 1433, 1437, 1441, 1901, 1904, 1910, 1916, 1918, 1946, 1949, 1952, 1955, 1958 or a sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 1283, 1286, 1289, 1292, 1295, 1368, 1380, 1383, 1900, 1903, 1909, 1915, 1919, 1945, 1948, 1951, 1954, 1957, 3001-3005, 3009, 3011, 3013-3016, and 3019-3022.

144. A system comprising: (a) a DNA-dependent DNA polymerase and a SpyCas9 nickase (nCas9); and (b) at least one chromatin remodeler operably linked to the nCas9 and the DNA-dependent DNA polymerase.

145. The system of claim 144, further comprising a nuclear localization signal, wherein the DNA-dependent DNA polymerase and the nCas9 are covalently linked sequentially in a polypeptide from N-terminus to C-terminus, wherein the order is: i) nuclear localization signal – chromatin remodeler – nCas9 –DNA Dependent DNA polymerase – nuclear localization signal; ii) nuclear localization signal – nCas9 – chromatin remodeler –DNA Dependent DNA polymerase – nuclear localization signal; or iii) nuclear localization signal – nCas9 – DNA Dependent DNA polymerase – chromatin remodeler – nuclear localization signal.

146. The system of any one of claims 144-145, wherein the at least one chromatin remodeler comprises an HMGB1 polypeptide.

147. The system of claim 146, wherein the HMGB1 polypeptide comprises an HMGB1 polypeptide, wherein the HMGB1 polypeptide comprises an HMGB1 Box B domain and at least 7 contiguous amino acid residues C-terminal to the HMGB1 Box B domain, and wherein the HMGB1 polypeptide lacks all or part of an acidic tail domain.

148. The system of claim 146 or 147, wherein the HMGB1 polypeptide comprises a cryptic nuclear localization signal (NLS), optionally wherein the cryptic NLS comprises the sequence of EKSKKKK (SEQ ID NO: 1787).

149. The system of any one of claims 146-148, wherein the HMGB1 polypeptide lacks an HMGB1 Box A domain.

150. The system of any one of claims 146-149, wherein the HMGB1 polypeptide comprises two HMGB1 Box B domains, optionally wherein the cryptic NLS is located C-terminal to the C-terminal end of the two HMGB1 Box B domains.

151. The system of any one of claims 146-150, wherein the HMGB1 polypeptide comprises at least 90% sequence identity to SEQ ID NO: 1783-1792 or 1803-1804, or wherein the HMGB1 polypeptide comprises the amino acid sequence of SEQ ID NO:1783-1792 or 1803- 1804.

152. The system of any one of claims 139-151, further comprising a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: a) the first polynucleotide of the tgRNA comprises a SpyCas9 guide RNA comprising, from 5’ to 3’: i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and ii) a scaffold; and b) the second polynucleotide of the tgRNA is operably linked to the first polynucleotide of the tgRNA and comprises, from 5’ to 3’: i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-18 nucleotides in length, optionally 8-18 or 10-12 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary toat least 6 nucleotides of a DRS-complementary region of the nontarget strand of the DNA duplex target nucleic acid.

153. A system comprising a DNA polymerase kappa (polΚ), a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: a) the first polynucleotide comprises a SpyCas9 guide RNA comprising, from 5’ to 3’: i) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and ii) a scaffold; and b) the second polynucleotide is operably linked to the first polynucleotide and comprises, from 5’ to 3’: i) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; ii) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-18 nucleotides in length, optionally 8-18 or 10-12 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS-complementary region of the non- target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides.

154. The system of claim 153, wherein the polΚ comprises an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acid residues 19-526 of SEQ ID NO: 1021; or an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1021, optionally wherein the polK includes or lacks an N-terminal methionine relative to SEQ ID NO: 1021.

155. The system of claim 153 or 154, wherein the polΚ comprises amino acids 19-526, optionally amino acids 1-526 of polΚ relative to SEQ ID NO: 1021.

156. The system of any one of claims 335-337, wherein the polΚ comprises a mutation at G411 or E412 relative to SEQ ID NO: 1021, optionally wherein the polΚ comprises a mutation at G411 and E412.

157. The system of any one of claims 153-156, wherein the polΚ comprises GE411-412RV mutations relative to SEQ ID NO: 1021.

158. The system of any one of claims 153-157, wherein polΚ is encoded by: a) a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a coding sequence for amino acid residues 19-526 within SEQ ID NO: 1021; a) a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1020; b) a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1201; c) a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1203; d) a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1205; e) a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1264; or f) a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1018.

159. The system of any one of claims 153-158, wherein the polΚ or the nCas9 is linked to a heterologous nuclear localization signal (NLS).

160. The system of any one of claims 153-159, wherein the polΚ is linked to an MS2 coat protein (MCP) domain.

161. The system of any one of claims 153-160, wherein the polΚ is covalently linked to the nCas9.

162. The system of any one of claims 153-161 wherein the polΚ and nCas9 are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order selected from: 1) NLS-nCas9-NLS-polΚ;2) NLS- nCas9-linker-NLS-linker- polΚ; 3) polΚ- NLS- nCas9-NLS; 4) polΚ – linker – NLS-linker – nCas9 – linker-NLS; 5) NLS- nCas9- NLS- polΚ (GE411-412RV); 6) NLS- nCas9-linker-NLS-polΚ (GE411-412RV); 7) NLS- nCas9-NLS- polΚ (19-526); 8) NLS- nCas9- linker-NLS- linker- polΚ (19-526); 9) polΚ (19-526)- NLS – nCas9 – NLS; 10) polΚ (19-526)- Linker- NLS – linker – nCas9- linker- NLS; 11) polΚ (GE411-412RV)- NLS – NLS – nCas9; 12) polΚ (GE411-412RV)- linker- NLS – linker- NLS – nCas9; 13) NLS- nCas9 –NLS -polΚ (19-526, GE411-412RV); 14) NLS- nCas9 – linker- NLS -linker – polΚ (19-526, GE411-412RV); 15) NLS- nCas9 – NLS – polΚ -NLS; 16) NLS- nCas9 – linker – NLS – linker – polΚ- linker -NLS; 17) NLS- nCas9–NLS – polΚ(1-526, GE411-412RV) – NLS; 18) NLS- nCas9– linker- NLS – linker- polΚ (1-526, GE411-412RV) – linker – NLS; 19) nCas9-polΚ (1-526); 20) polK (1-526, GE411-412RV)-nCas9-NLS-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled coil heterodimerization domain, optionally an EI domain or a KI domain; or 21) polK (1-526, GE411-412RV)-linker-NLS-nCas9-linker-NLS-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled coil heterodimerization domain, optionally an EI domain or a KI domain; optionally wherein the order is NLS- nCas9– linker- NLS – linker- polΚ (1-526, GE411-412RV) – linker – NLS, optionally further comprising a heterodimerization domain comprising a coiled coil heterodimerization domain, optionally an EI domain or a KI domain.

163. The system of any one of claims 153-162, wherein the polΚ, or portion thereof, is operably linked to a first split-intein and the nCas9, or portion thereof, is operably linked to asecond split-intein that is complementary to the first split intein, wherein the first split-intein and second split-intein undergo trans-splicing reaction, resulting in the formation of a single fusion polypeptide comprising, from N-terminus to C-terminus, (i) the polK and the nCas9 or (2) the polK and the nCas9.

164. The system of any one of claims 163, wherein the polΚ is operably linked to a heterologous nuclear localization signal (NLS) or, wherein the nCas9 is operably linked to a heterologous nuclear localization signal (NLS).

165. The system of any one of claims 153-164, wherein the polΚ and nCas9 are operably linked to at least one chromatin remodeler, and wherein the polΚ, nCas9, and chromatin remodeler are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order selected from: ii) chromatin remodeler – nCas9 – polΚ; iii) nCas9 – chromatin remodeler – polΚ; or iv) nCas9 – polΚ – chromatin remodeler. optionally further comprising a nuclear localization signal (NLS) 166. The system of any one of claims 165, wherein the at least one chromatin remodeler comprises an HMGB1 polypeptide.

167. The system of claim 166, wherein the HMGB1 polypeptide comprises (i) at least 90% sequence identity to SEQ ID NO: 1783-1792 and 1803-1804 or (ii) the amino acid sequence of SEQ ID NO: 1783-1792 and 1803-1804.

168. The system of any one of claims 153-160, wherein the polΚ and nCas9 are not covalently linked, and the polΚ is provided with a 3’ extension recruiting domain, wherein, the polΚ and the 3’ extension recruiting domain are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order selected from: 1) 3’ extension recruiting domain-polΚ- NLS; 2) 3’ extension recruiting domain -linker-polΚ-linker-NLS; 3) 3’ extension recruiting domain- polΚ (GE411-412RV)- NLS; and 4) 3’ extension recruiting domain-linker- polΚ (GE411-412RV)-linker-NLS.

169. The system of any one of claim 168, wherein the polypeptide comprises a heterodimerization domain or further comprises an additional heterodimerization domain.

170. The system of any one of claims 161-169, wherein (i) the polypeptide comprises a sequence selected from any one of SEQ ID NOs: 1024, 1027, 1030, 1036, 1039, 1042, 1045, 1048, 1053, 1056, 1059, 1074, 1200, 1202, 1229, 1234, or 1268, or 1300, 1373, 1388, 1447, 1453, 1923, 1926, or 1929; or (ii) the polypeptide is encoded by a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1023, 1026, 1029, 1035, 1038, 1041, 1044, 1047, 1052, 1055, 1058, 1073, 1199, 1201, 1228, 1233, or 1267, and 1299, 1372, 1387, 1446, 1452, 1922, 1925, or 1928.

171. The system of any one of claims 161-170, wherein (i) the polypeptide comprises a sequence selected from any one of SEQ ID NOs: 1062 and 1067; or (ii) the polypeptide is encoded by a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1061 and 1066.

172. A system comprising a T5 DNA polymerase (T5 pol), a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: 1) the first polynucleotide comprises a SpyCas9 guide RNA comprising, from 5’ to 3’: a. a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and b. a scaffold; and 2) the second polynucleotide is operably linked to the first polynucleotide and comprises, from 5’ to 3’: a. a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; and b. a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6- 20 nucleotides in length, optionally 10-16 or 12-14 nucleotides in length, and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and whereinthe DRS comprises a sequence that is complementary to at least 6 nucleotides of a DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid comprising nucleotides 5-105’ of the PAM in the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides.

173. The system of claim 172, wherein the T5 pol comprises an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NO: 1116 or SEQ ID NO: 1121, optionally wherein the T5 pol includes or lacks an N-terminal methionine relative to SEQ ID NO: 1116 or 1121.

174. The system of claim 172 or 173, wherein the T5 pol comprises a mutation at D164 or E166 relative to SEQ ID NO: 1116.

175. The system of any one of claims 172-174, wherein the T5 pol comprises D164A and E166A mutations relative to SEQ ID NO: 1116.

176. The system of any one of clams 172-175, wherein the T5 pol comprises an amino acid sequence comprising an N-terminal deletion of 30 amino acids relative to SEQ ID NO: 1116.

177. The system of any one of claims 172-176, wherein the T5 pol is encoded by a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1115 or SEQ ID NO: 1120, optionally wherein the T5 pol includes or lacks a start or stop codon relative to SEQ ID NO: 1115 or 1120.

178. The system of any one of claims 172-177, wherein the template comprises 0-1 RNA nucleotides, optionally 1 RNA nucleotide, at the 3’ end of the template.

179. The system of any one of claims 172-178, wherein the T5 pol or the nCas9 is linked to a heterologous nuclear localization signal (NLS).

180. The system of any one of claims 172-179, wherein the T5 pol is linked to an MS2 coat protein (MCP domain).

181. The system of any one of claims 172-180, wherein the T5 pol is covalently linked to the nCas9.

182. The system of any one of claims 172-181, wherein the T5 pol and nCas9 are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order selected from: 1) nCas9- T5Pol –NLS;2) nCas9- linker – T5Pol – linker –NLS; 3) T5Pol–nCas9 - NLS; 4) T5Pol– linker – nCas9 -linker – NLS; 5) NLS – nCas9 – NLS- T5Pol –binding site –NLS- NLS; 6) NLS – nCas9 – linker –NLS- linker – T5Pol – linker – MCP –linker–NLS- linker – NLS; 7) nCas9 – linker - T5Pol – linker –NLS; 8) nCas9 – T5Pol(N30del) – NLS; 9) nCas9 – linker - T5Pol(N30del) – linker –NLS; 10) nCas9 – T5Pol(DA593R) – NLS; 11) nCas9 – linker – T5Pol(A593R) – linker –NLS; 12) NLS- nCas9 – NLS- T5Pol- NLS –NLS; 13) NLS- nCas9 – linker –NLS- linker – T5Pol - linker –NLS – linker – NLS; 14) nCas9 –NLS –T5Pol; 15) nCas9 – linker–NLS – linker – T5Pol; 16) NLS- nCas9 – NLS- T5Pol –NLS – NLS; 17) NLS – nCas9 – linker – NLS- linker – T5Pol – linker –NLS – NLS; 18) nCas9 –T5Pol(K425I) –NLS; 19) nCas9 – linker--T5Pol(K425I)-- linker—NLS; 20) nCas9-T5Pol-NLS-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled coil heterodimerization domain, optionally an EI domain or a KI domain; or 21) nCas9-linker-T5Pol-linker-NLS-linker-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled coil heterodimerization domain, optionally an EI domain or KI domain, and optionally, wherein the T5pol comprises a mutation at D164 or E166 relative to SEQ ID NO: 1116, optionally wherein the T5 pol comprises D164A and E166A mutations relative to SEQ ID NO: 1116.

183. The system of any one of claims 172-182, wherein the T5 pol and nCas9 are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in order wherein the order is NLS – nCas9 – linker – NLS- linker – T5Pol – linker –NLS – NLS; optionally,wherein the T5pol comprises a mutation at D164 or E166 relative to SEQ ID NO: 1116, optionally wherein the T5 pol comprises D164A and E166A mutations relative to SEQ ID NO: 1116.

184. The system of any one of claims 172-183, wherein the T5Pol and nCas9 are covalently linked sequentially in a polypeptide from N-terminus to C-terminus, wherein the order is NLS-nCas9-linker-NLS-linker-T5Pol-linker-NLS-NLS-linker, wherein the T5Pol comprises a mutation at D164 or E166 relative to SEQ ID NO: 1116.

185. The system of any one of claims 172-179, wherein the T5 pol or a portion thereof, is operably linked to a first split-intein and the nCas9, or a portion thereof, is operably linked to a second split-intein that is complementary to the first split intein, wherein the first split- intein and second split-intein undergo trans-splicing reaction, resulting in the formation of a single fusion polypeptide comprising, from N-terminus to C-terminus, the polK and the nCas9.

186. The system of claim 185, wherein the T5 pol is operably linked to a heterologous nuclear localization signal (NLS) or wherein the nCas9 is operably linked to a heterologous nuclear localization signal (NLS).

187. The system of any one of claims 172-186, wherein the T5 pol and the nCas9 are covalently linked, and wherein the T5 pol and the nCas9 are operably linked to at least one chromatin remodeler, further wherein the T5 pol, nCas9, and chromatin remodeler are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order selected from: 1) chromatin remodeler – nCas9 – T5 pol; 2) nCas9 – chromatin remodeler – T5 pol; or 3) nCas9 – T5 pol – chromatin remodeler.

188. The system of claim 187, wherein the at least one chromatin remodeler comprises an HMGB1 polypeptide.

189. The system of claim 188, wherein the HMGB1 polypeptide comprises (i) at least 90% sequence identity to SEQ ID NO: 1783-1792 and 1803-1804 or (ii) the amino acid sequence of SEQ ID NO: 1783-1792 and 1803-1804.

190. The system of any one of claims 185-189, wherein the T5 pol and the nCas9 are not covalently linked, and the T5 pol is provided with a 3’ extension-recruiting domain, wherein,the T5 pol and the 3’ extension-recruiting domain are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in an order selected from: i) 3’ extension-recruiting domain – T5Pol(D164A,E166A) –NLS; or ii) 3’ extension-recruiting domain – linker – T5Pol(D164A,E166A) – linker –NLS.

191. The system of claim 190, wherein each NLS is independently selected from an SV40 NLS, a nucleoplasmin NLS, or a c-Myc NLS.

192. The system of any one of claims 179-184 and 187-191, wherein (i) the polypeptide comprises a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NO: 1124, 1127, 1129, 1132, 1134, 1137, 1140, 1142, 1145, 1147, 1150, 1152, 1155, 1157, 1160, 1162, 1165, 1167, 1170, 1172, 1216, 1219, 1224, 1254, and 1259, 1276, 1303, 1307, 1376, 1450, 1932, 1935, and 1938; or (ii) the polypeptide comprises a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NO: 1124, 1129, 1134, 1137, 1142, 1147, 1152, 1157, 1162, 1167, 1172, 1219, 1224, 1254, and 1259, 1276, 1307, 1932, 1935, and 1938.

193. The system of any one of claims 179-184 and 187-192, wherein (i) the polypeptide comprises a sequence selected from any one of SEQ ID NO: 1124, 1127, 1129, 1132, 1134, 1137, 1140, 1142, 1145, 1147, 1150, 1152, 1155, 1157, 1160, 1162, 1165, 1167, 1170, 1172, 1216, 1219, 1224, 1254, and 1259, 1276, 1303, 1307, 1376, 1450, 1932, 1935, and 1938 or comprises a sequence selected from any one of SEQ ID NO: 1124, 1129, 1134, 1137, 1142, 1147, 1152, 1157, 1162, 1167, 1172, 1219, 1224, 1254, and 1259, 1276, 1307, 1932, 1935, and 1938; (ii) is encoded by a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1123, 1126, 1128, 1131, 1133, 1136, 1139, 1141, 1144, 1146, 1149, 1151, 1154, 1156, 1159, 1161, 1164, 1166, 1169, 1171, 1215, 1218, 1223, 1253, and 1258, 1275, 1302, 1306, 1375, 1449, 1931, 1934, and 1937; or (iii) is encoded by a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1123, 1128, 1133, 1136, 1141, 1146, 1151, 1156, 1161, 1166, 1171, 1218, 1223, 1253, and 1258, 1275, 1306, 1931, 1934, and 1937.

194. The system of any one of claims 190-191, wherein (i) the polypeptide comprises a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%identity to any one of SEQ ID NO: 1175, 1177, 1180, and 1182, optionally a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1177 or 1182; or (ii) the polypeptide is encoded by a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1174, 1176, 1179, and 1181, optionally a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NOs: 1176 or 1181.

195. A fusion polypeptide comprising a polΚ comprising GE411-412RV mutations relative to SEQ ID NO: 1021, a SpyCas9 nickase (nCas9), and a heterologous nuclear localization signal (NLS) or a nucleic acid encoding the fusion polypeptide.

196. The fusion polypeptide or nucleic acid of claim 195, wherein the polΚ comprises (1) an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acid residues 19-526 of SEQ ID NO: 1021; or (2) an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1021; or (3) an amino acid sequence of residues 19-526 of SEQ ID NO: 1021.

197. The fusion polypeptide or nucleic acid of any one of claims 195 or 196, wherein the polΚ is encoded by a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1020 or 1205.

198. The fusion polypeptide or nucleic acid of any one of claims 195-197, wherein the polΚ and nCas9 are in a sequence from N-terminus to C-terminus, (i) polΚ-nCas9; or (ii) nCas9- polΚ.

199. The fusion polypeptide or nucleic acid of any one of claims 195-198, further comprising a peptide linker or a heterologous nuclear localization signal (NLS), optionally wherein the polΚ and nCas9 are covalently linked sequence from N-terminus to C-terminus selected from: 1) NLS-nCas9-NLS-polΚ; 2) NLS- nCas9-linker-NLS-linker- polΚ; 3) polΚ- NLS- nCas9-NLS; 4) polΚ – linker – NLS-linker – nCas9 – linker-NLS; 5) NLS- nCas9- NLS- polΚ (GE411-412RV);6) NLS- nCas9-linker-NLS-polΚ (GE411-412RV); 7) NLS- nCas9-NLS- polΚ (19-526); 8) NLS- nCas9- linker-NLS- linker- polΚ (19-526); 9) polΚ (19-526)- NLS – nCas9 – NLS; 10) polΚ (19-526)- Linker- NLS – linker – nCas9- linker- NLS; 11) polΚ (GE411-412RV)- NLS – NLS – nCas9; 12) polΚ (GE411-412RV)- linker- NLS – linker- NLS – nCas9; 13) NLS- nCas9 –NLS -polΚ (19-526, GE411-412RV); 14) NLS- nCas9 – linker- NLS -linker – polΚ (19-526, GE411-412RV); 15) NLS- nCas9 – NLS – polΚ -NLS; 16) NLS- nCas9 – linker – NLS – linker – polΚ- linker -NLS; 17) NLS- nCas9–NLS – polΚ(1-526, GE411-412RV) – NLS; 18) NLS- nCas9– linker- NLS – linker- polΚ (1-526, GE411-412RV) – linker – NLS; 19) nCas9-polΚ (1-526); 20) polK(1-526, GE411-412RV)-nCas9-NLS-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled coil heterodimerization domain, optionally an EI domain or a KI domain; 21) polK(1-526, GE411-412RV)-linker-NLS-nCas9-linker-NLS-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled coil heterodimerization domain, optionally an EI domain or KI domain; optionally wherein the order is NLS- nCas9– linker- NLS – linker- polΚ (1-526, GE411-412RV) – linker – NLS, optionally further comprising a heterodimerization domain comprising a coiled coil heterodimerization domain, optionally an EI domain or KI domain.

200. The fusion polypeptide of any one of claims 195-199, wherein polK and nCas9 are covalently linked sequentially in a polypeptide from N-terminus to C-terminus, wherein the order is: 1) SV40 NLS-nCas9-linker-SV40 NLS-linker- polK (1-526, GE411-412RV)-linker- SV40NLS; 2) SV40 NLS-nCas9-linker-SV40 NLS-linker- polK (1-526, GE411-412RV)-linker- SV40 NLS-linker-EI domain; or3) SV40 NLS-nCas9-linker-SV40 NLS-linker- polK (1-526, GE411-412RV)-linker- SV40 NLS-linker-KI domain.

201. The fusion polypeptide or nucleic acid of any one of claims 195-200, wherein (i) the polypeptide comprises a sequence selected from any one of SEQ ID NOs: 1024, 1027, 1030, 1036, 1039, 1042, 1045, 1048, 1053, 1056, 1059, 1074, 1200, 1202, 1229, 1234, and 1268, 1300, 1373, 1388, 1447, 1453, 1923, 1926, and 1929; or (ii) the polypeptide is encoded by a nucleic acid comprising a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1023, 1026, 1029, 1035, 1038, 1041, 1044, 1047, 1052, 1055, 1058, 1073, 1199, 1201, 1228, 1233, and 1267, and 1299, 1372, 1387, 1446, 1452, 1922, 1925, and 1928.

202. A fusion polypeptide comprising a T5 pol comprising D164A and E166A mutations relative to SEQ ID NO: 1116, a SpyCas9 nickase (nCas9), a heterologous nuclear localization signal (NLS), and optionally a heterodimerization domain, or a nucleic acid encoding the fusion polypeptide thereof.

203. The fusion polypeptide or nucleic acid of claim 202, wherein the T5 pol comprises an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NO: 1116 or 1121, optionally further wherein the T5 pol comprises a heterodimerization domain.

204. The fusion polypeptide or nucleic acid of claim 202 or 203, wherein the T5 pol comprises an N-terminal deletion of 30 amino acids relative to SEQ ID NO: 1116.

205. The fusion polypeptide or nucleic acid of any one of claims 202-204, wherein the T5 pol is encoded by a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1115 or 1120.

206. The fusion polypeptide or nucleic acid of any one of claims 202-205, wherein the T5 pol and the nCas9 are in a sequence from N-terminus to C-terminus, (i) nCas9-T5 pol or (ii) T5 pol - nCas9.

207. The fusion polypeptide or nucleic acid of any one of claims 202-206, wherein the T5Pol and nCas9 are covalently linked in sequence from N-terminus to C-terminus selected from: 1) nCas9- T5Pol –NLS 2) nCas9- linker – T5Pol – linker –NLS; 3) T5Pol –nCas9 - NLS;4) T5Pol – linker – nCas9 -linker – NLS; 5) NLS – nCas9 – NLS- T5Pol –binding site –NLS- NLS; 6) NLS – nCas9 – linker –NLS- linker – T5Pol – linker – MCP –linker–NLS- linker – NLS; 7) nCas9 – linker - T5Pol – linker –NLS; 8) nCas9 – T5Pol(N30del,) – NLS; 9) nCas9 – linker - T5Pol(N30del) – linker –NLS; 10) nCas9 – T5Pol(A593R) – NLS; 11) nCas9 – linker – T5Pol(DA593R) – linker –NLS; 12) NLS- nCas9 – NLS- T5Pol - NLS –NLS; 13) NLS- nCas9 – linker –NLS- linker – T5Pol- linker –NLS – linker – NLS; 14) nCas9 –NLS –T5Pol; 15) nCas9 – linker–NLS – linker – T5Pol; 16) NLS- nCas9 – NLS- T5Pol –NLS – NLS; 17) NLS – nCas9 – linker – NLS- linker – T5Pol – linker –NLS – NLS; 18) nCas9 –T5Pol(K425I) –NLS; 19) nCas9 – linker –T5Pol(K425I) – linker – NLS; 20) nCas9-T5Pol-NLS-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled coil heterodimerization domain, optionally an EI domain or a KI domain; or 21) nCas9-linker-T5Pol-linker-NLS-linker-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled coil heterodimerization domain, optionally an EI domain or a KI domain, optionally, wherein the T5pol comprises a mutation at D164 or E166 relative to SEQ ID NO: 1116, optionally wherein the T5 pol comprises D164A and E166A mutations relative to SEQ ID NO: 1116.

208. The fusion polypeptide or nucleic acid of any one of claims 202-207, wherein the T5 pol and nCas9 are covalently linked sequentially in a polypeptide from N-terminus to C-terminus in order wherein the order is NLS – nCas9 – linker – NLS- linker – T5Pol – linker –NLS – NLS; optionally, wherein the T5pol comprises a mutation at D164 or E166 relative to SEQID NO: 1116, optionally wherein the T5 pol comprises D164A and E166A mutations relative to SEQ ID NO: 1116.

209. The fusion polypeptide or nucleic acid of any one of claims 202-208, wherein the polypeptide comprises a sequence selected from any one of SEQ ID NO: 1124, 1127, 1129, 1132, 1134, 1137, 1140, 1142, 1145, 1147, 1150, 1152, 1155, 1157, 1160, 1162, 1165, 1167, 1170, 1172, 1216, 1219, 1224, 1254, and 1259, 1276, 1303, 1307, 1376, 1450, 1932, 1935, and 1938, optionally a sequence selected from any one of SEQ ID NO: 1124, 1129, 1134, 1137, 1142, 1147, 1152, 1157, 1162, 1167, 1172, 1219, 1224, 1254, and 1259, 1276, 1307, 1932, 1935, and 1938.

210. The fusion polypeptide or nucleic acid of any one of claims 202-209, wherein the polypeptide is encoded by a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1123, 1126, 1128, 1131, 1133, 1136, 1139, 1141, 1144, 1146, 1149, 1151, 1154, 1156, 1159, 1161, 1164, 1166, 1169, 1171, 1215, 1218, 1223, 1253, and 1258, 1275, 1302, 1306, 1375, 1449, 1931, 1934, and 1937, optionally a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1123, 1128, 1133, 1136, 1141, 1146, 1151, 1156, 1161, 1166, 1171, 1218, 1223, 1253, and 1258, 1275, 1306, 1931, 1934, and 1937.

211. A system comprising (i) a fusion polypeptide comprising a DNA-dependent DNA polymerase and a SpyCas9 nickase (nCas9), a nucleic acid encoding the fusion polypeptide, (ii) a template guide RNA (tgRNA), and (iii) an enhancer of template-based genome editing, wherein: 1) the fusion polypeptide comprising the DNA-dependent DNA polymerase and the nCas9 is a fusion polypeptide of any one of claims 45-65, 82-111, or 582-627; 2) the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: i) the first polynucleotide comprises a SpyCas9 guide RNA comprising, from 5’ to 3’: 1) a spacer that is complementary to a target region of a target strand of a DNA duplex target nucleic acid; and 2) a scaffold; and ii) the second polynucleotide is operably linked to the first polynucleotide and comprises, from 5’ to 3’:1) a template sequence that is at least 10 nucleotides in length and complementary to at least a portion of a non-target strand of the DNA duplex target nucleic acid, wherein the template sequence comprises a 3’ end and a 5’ end; and wherein the template comprises DNA nucleotides; 2) a DNA-dependent DNA polymerase recruiting sequence (DRS) that is 6-20 nucleotides in length, optionally 8-17 or 10-14 nucleotides in length and having a 3’ end and a 5’ end; wherein the 5’ end of the DRS is covalently attached to the 3’ end of the template sequence, and wherein the DRS comprises a sequence that is complementary to at least 6 consecutive nucleotides of a DRS-complementary region of the non-target strand of the DNA duplex target nucleic acid; and 3) the enhancer of template-based genome editing.

212. The system of claim 211, wherein the enhancer of template-based genome editing is an inhibitor of deoxynucleotide triphosphohydrolase, optionally wherein the inhibitor of deoxynucleotide triphosphohydrolase comprises a Vpx, a BGLF4, an M97, or an ORF36.

213. The system of claim 211 or 212, wherein the enhancer of template-based genome editing is selected from: i) a Vpx protein comprising an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1464, 1469, and 1503-1505, optionally wherein the Vpx protein includes or lacks an N-terminal methionine relative to any one of SEQ ID NO: 1464, 1469, and 1503- 1505, or a nucleic acid encoding the amino acid sequence; ii) a BGLF4 protein comprising an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1517 or 1518, optionally wherein the BGLF4 protein includes or lacks an N-terminal methionine relative to SEQ ID NO: 1517 or 1518, or a nucleic acid encoding the amino acid sequence; or iii) an M97 protein comprising an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1500, optionally wherein the M97 protein includes or lacks an N-terminal methionine relative to SEQ ID NO: 1500, or a nucleic acid encoding the amino acid sequence; oriv) a KSHV ORF36 protein comprising an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1576, optionally wherein the KSHV ORF36 protein includes or lacks an N-terminal methionine relative to SEQ ID NO: 1576, or a nucleic acid encoding the amino acid sequence.

214. The system of any one of claims 211-213 , wherein the inhibitor of deoxynucleotide triphosphohydrolase is encoded by a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1462, 1463, 1468, 1470, 1499, 1501, 1502, 1521-1523, 1574-1575, and 1585, and 3530.

215. The system of claim 211, wherein the enhancer of template-based genome editing is a DNA repair protein, or a nucleic acid encoding the amino acid sequence.

216. The system of claim 215, wherein the DNA repair protein is a single-stranded endonuclease that removes a 5’ flap at the 3’ end of a nick, optionally a flap structure- specific endonuclease 1 (FEN1) or MLH1.

217. The system of any one of claims 215-216, wherein the DNA repair protein is selected from: i) a FEN1 protein comprising an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1467, 1475, 1480, 1490, 1495, 1510-1516 and 1550-1555, optionally wherein the FEN1 protein includes or lacks an N-terminal methionine relative to any one of SEQ ID NOs: 1467, 1475, 1485, 1490, 1495, and 1510-1516, or a nucleic acid encoding the amino acid sequence; or ii) a MLH1 protein comprising an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1572 or 1573, optionally wherein the MLH1 protein includes or lacks an N-terminal methionine relative to any one of SEQ ID NOs: 1572 or 1573, or a nucleic acid encoding the amino acid sequence.

218. The system of any one of claims 211-217, comprising at least two enhancers of template- based genome editing, 219. The system of claim 218, wherein the at least two enhancers of template-based genome editing comprise Vpx and FEN-1.

220. The system of claim 219, wherein the at least two enhancers comprising Vpx and FEN1 are encoded on a same polypeptide, optionally wherein the polypeptide encoding Vpx and FEN1 comprises an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1578, 1580, 1582, and 1584; or wherein the polypeptide encoding Vpx and FEN1 is encoded by a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1577, 1579, 1581, and 1583, 3523, 3524, 3526, and 3527.

221. The system of any one of claims 1-59, 139-194, or 211-220 or the fusion protein or nucleic acid of any one of claims 195-210, wherein the heterologous NLS is independently selected from Nucleoplasmin NLS, C-Myc NLS, and SV40 NLS and the linker is independently selected from SEQ ID NOs: 1596, 1597, 1600, 1601, 1605, 1661, 1735, 1738, and 1815.

222. The system of any one of claims 1-59, 139-194, or 211-220 or the fusion protein or nucleic acid of any one of claims 195-210, wherein the linker comprises an amino acid sequence of any one of SEQ ID NOs: 1596-1665, 1735, 1738, 1815, 1825, 1827, and 1829- 1830.

223. The nucleic acid of any one of claims 195-210 and 221-222, wherein the nucleotide sequence encoding a polypeptide comprising the nCas9 or DNA-dependent DNA polymerase, or the fusion protein comprises: i) a Cap selected from Cap0 or Cap1; ii) a 5’ UTR selected from SEQ ID NOs: 1720-1723; iii) a Kozak sequence selected from SEQ ID NOs: 1724 and 1725; iv) a 3’ UTR selected from SEQ ID NOs: 1684 and 1740; v) a poly-A tail selected from SEQ ID NOs: 1741 and 1742; or vi) a combination of two, three, four, or five of (i)-(v).

224. The system of any one of claims 1-59, 139-194, and 211-223, wherein the DNA- dependent DNA polymerase, nCas9, and enhancers are provided as one or more polypeptides.

225. The system of any one of claims 1-59, 139-194, and 211-223, wherein the DNA- dependent DNA polymerase, nCas9, and enhancers are provided as one or more nucleic acids.

226. A system comprising the nucleic acid of any one of claims 195-210 or a composition comprising the nucleic acid of any one of claims 195-210 and an enhancer of template-based genome editing, optionally further comprising a template guide RNA of any one of claims 60-138.

227. The system or composition of claim 226, wherein the enhancer of template-based genome editing comprises a nucleic acid encoding the enhancer of template-based genome editing or an enhancer of template-based genome editing polypeptide.

228. The system or composition of claim 226 or 227, wherein the enhancer of template-based genome editing is an inhibitor of deoxynucleotide triphosphohydrolase.

229. The system of any one of claims 226-228, wherein the deoxynucleotide triphosphohydrolase comprises SAM domain and HD domain-containing protein 1 (SAMHD1).

230. The system or composition of claim 229, wherein the inhibitor of SAMHD1 comprises microRNA, shRNA, or siRNA that hybridizes to a SAMHD1 mRNA.

231. The system or composition of claim 229, wherein the inhibitor of SAMHD1 comprises a Vpx, a BGLF4, an M97, or KSHV ORF36.

232. The system or composition of claim 227 or 228, wherein the enhancer of template-based genome editing is a DNA repair protein, or a nucleic acid encoding the amino acid sequence.

233. The system or composition of claim 232, wherein the DNA repair protein is flap structure-specific endonuclease 1 (FEN1) or wherein the DNA repair protein is MLH1.

234. The system or composition of any one of claims 232-233, wherein the DNA repair protein comprises a heterodimerization domain or further comprises an additional heterodimerization domain.

235. The system or composition of any one of claims 232 or 234, wherein the DNA repair protein is selected from: i) a FEN1 protein comprising an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1467, 1475, 1485, 1490, 1495, and 1510-1516, optionally wherein the FEN1 proteinincludes or lacks an N-terminal methionine relative to any one of SEQ ID NOs: 1467, 1475, 1485, 1490, 1495, and 1510-1516, or a nucleic acid encoding the amino acid sequence; or ii) MLH1 protein comprising an amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1572 or 1573, optionally wherein the MLH1 protein includes or lacks an N-terminal methionine relative to any one of SEQ ID NOs: 1572 or 1573, or a nucleic acid encoding the amino acid sequence.

236. The system or composition of any one of claims 226-235 comprising two nucleic acids encoding two enhancers of template-based genome editing, optionally comprising (i) Vpx and FEN-1 or (ii) M97 and FEN-1.

237. The system or composition of any one of claims 1-59, 139-194, and 221-236, wherein further comprises a nicking guide RNA (ngRNA).

238. The system or composition of claim 237, wherein the ngRNA comprises a spacer that is complementary to the non-target strand of the DNA duplex target nucleic acid.

239. The system or composition of claim 238, wherein the ngRNA comprises a spacer that hybridizes to a sequence on the non-target strand such that (i) the nick site of the ngRNA is within 200 nucleotides 5’ or 3’ from the nick site of the template guide RNA; (ii) the nick site of the ngRNA is 20-200 nucleotides 5’ or 3’ from the nick site of the template guide RNA; or (iii) the nick site of the ngRNA is outside of the genomic locus of the spacer sequence of the template guide RNA.

240. The system or composition of any one of claims 237-239, wherein the ngRNA comprises, from 5’ to 3’, a guide sequence and any one of SEQ ID NOs: 5, 27, 35, 210, 223, 269, 370, 201-208, 373-374, and 393-400; (ii) a SpyCas9 guide RNA comprising, from 5’ to 3’, a guide sequence and a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of any one of SEQ ID NOs: 5, 27, 35, 210, 223, 269, 370, 201-208, 373-374, 393-400, 429, and 430; or (iii) a SpyCas9 guide RNA comprising a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of any one of SEQ ID NOs: 310, 319-326, 347-349, 371, 384-392, 434, 438 241. The system, fusion protein, or composition of any one of claims 1-59 and 139-240, (i) wherein the nCas9 comprises an amino acid sequence that has at least 90%, 91%, 92%, 93%,94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 972, 974, 976, 982, 984, 986, 988, 990, 992, 994, 996, 998, 1000, and 1014, optionally wherein the nCas9 comprises an amino acid sequence of any one of SEQ ID NOs: 972, 974, 976, 982, 984, 986, 988, 990, 992, 994, 996, 998, 1000, and 1014, optionally wherein the nCas9 protein includes or lacks an N-terminal methionine relative to any one of SEQ ID NOs: 972, 974, 976, 982, 984, 986, 988, 990, 992, 994, 996, 998, 1000, and 1014; or (ii) wherein the nCas9 is encoded by a nucleotide sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 971, 973, 975, 981, 983, 985, 987, 989, 991, 993, 995, 997, 999, and 1013, optionally wherein the nCas9 is encoded by a nucleotide sequence of any one of SEQ ID NOs: 971, 973, 975, 981, 983, 985, 987, 989, 991, 993, 995, 997, 999, and 1013, optionally wherein the nCas9 protein includes or lacks a start codon or stop codon relative to any one of SEQ ID NOs: 971, 973, 975, 981, 983, 985, 987, 989, 991, 993, 995, 997, 999, and 1013.

242. The system, fusion protein, or composition of any one of claims 1-59 and 139-241, wherein the nCas9 comprises an H840A point mutation.

243. The system, fusion protein, or composition of any one of claims 226-242, wherein the nucleotide sequence encoding the nCas9, DNA-dependent DNA polymerase, nCas9 / DNA- dependent DNA polymerase fusion protein, enhancer of template-based genome editing, or Sso7 DNA binding accessory factor comprises a 5’ cap selected from Cap0, Cap1, and Cap2.

244. The system, fusion protein, or composition of any one of claims 226-243, wherein the polynucleotide further comprises a poly-adenylated (poly-A) tail sequence or a polyadenylation signal sequence.

245. The system, fusion protein, or composition of any claim 243 or 244, wherein the poly-A sequence comprises a sequence of any one of SEQ ID NOs: 1692-1693 and 1741-1742.

246. The system, fusion protein, or composition of any one of claims 226-245, wherein at least 70%, 75%, 80%, 85%, 90%, or 95% of the uridine in the nucleic acid is substituted with a modified uridine, optionally wherein the modified uridine is one or more of N1-methyl- pseudouridine, pseudouridine, 5-methoxyuridine, or 5-iodouridine.

247. The system or composition of any one of claims 1-59, 139-194, and 211-246, further comprising a template guide RNA, if not present, wherein the template guide RNA is a template guide RNA of any one of claims 60-138.

248. The system or composition of claim 247, wherein the DRS bound to the DRS- complementary region in the non-target strand of the DNA duplex target nucleic acid forms a binding site for a DNA-dependent DNA polymerase, optionally wherein the DNA-dependent DNA polymerase is polK or T5 pol.

249. The system or composition of any one of claims 247-248, wherein (i) the DRS has 0, 1, 2, 3, or 4 mismatches to the corresponding genomic sequence; (ii) 6 terminal nucleotides at the 5’ end of the DRS have 0, 1, 2, or 3 mismatches to the corresponding genomic sequence; (iii) the first 3 nucleotides at the 3’ end of the DRS have 0, 1, or 2 mismatches to the genomic sequence; (iv) the DRS is 100% complementary to the corresponding genomic sequence for no more than 6 consecutive nucleotides, optionally no more than 4 consecutive nucleotides, without a mismatch interruption; or (v) 10 terminal nucleotides at the 5’ end of the DRS are 100% complementary to the corresponding genomic sequence.

250. The system or composition of any one of claims 247-249, wherein the at least one mismatched RNA nucleotides in the DRS comprises a modified RNA nucleotide, optionally all of the mismatched RNA nucleotides in the DRS comprise a modified RNA nucleotide.

251. The system or composition of any one of claims 247-250, wherein the template sequence is 10-10000 nucleotides in length, optionally 10-20, 10-100, 10-500.

252. The system or composition of any one of claims 247-251, wherein the template sequence is 14-18 nucleotides in length, optionally 14 or 15 nucleotides in length.

253. The system or composition of any one of claims 247-252, wherein the template sequence further comprises at least 2 nucleotides 5’ of a sequence to be edited by template-based genome editing, wherein the at least 8 nucleotides across the template base pair with the non- target strand of the DNA duplex target nucleic acid.

254. The system or composition of any one of claims 247-253, wherein the template sequence further comprises at least 5 nucleotides 5’ of a sequence to be edited by template-based genome editing, wherein the at least 10 nucleotides across the template base pair with the non-target strand of the DNA duplex target nucleic acid.

255. The system or composition of any one of claims 247-254, wherein the template sequence comprises a sequence of at least 5 consecutive nucleotides that base pair with the non-target strand of the DNA duplex target nucleic acid.

256. The system or composition of any one of claims 247-255, wherein the template sequence comprises a mismatch to the genomic sequence at at least one of positions 1-6, optionally at at least one of positions 5-65’ of the template junction with the DRS (positions T1-T6, optionally positions T5-T6).

257. The system or composition of claim 256, wherein the template sequence comprises a mismatch to the genomic sequence at at least one of positions 1-6, optionally at at least one of positions 5-65’ of the template junction with the DRS introduces a silent mutation.

258. The system or composition of claim 256, wherein the template sequence comprises a mismatch to the genomic sequence at at least one of positions T1-T6, optionally at at least one of positions T5-T65’ of the template junction with the DRS, wherein the template introduces a change in the amino acid sequence encoded by the genomic sequence.

259. The system or composition of any one of claims 247-258, wherein the template sequence comprises an insertion sequence relative to the corresponding genomic sequence.

260. The system or composition of claim 259, wherein the template sequence comprises an insertion sequence of up to 500, 1000, 3500, or 5000 nucleotides in length, optionally up to 10,000 nucleotides in length.

261. The system or composition of claim 259 or 260, wherein the length of the templated insertion is 1-10, 1-20, 1-50, 1-75, or 1-100 nucleotides in length.

262. The system or composition of any one of claims 247-261, wherein the template sequence comprises a sequence for directing a deletion relative to the corresponding genomic sequence.

263. The system or composition of claim 262, wherein the template sequence comprises a sequence to direct a deletion of at least 3, 10, 15, 20, 30, 40, or 50 nucleotides in length, optionally wherein the template sequence comprises a sequence to direct a deletion of up to 3500 nucleotides in length, optionally up to 10,000 nucleotides in length.

264. The system or composition of any one of claims 247-263, wherein the template sequence comprises at least one mismatch, optionally at least 3 mismatches relative to the corresponding genomic sequence wherein the mismatch provides the template sequence for template-based genome editing comprising a substitution.

265. The system or composition of any one of claims 247-264, wherein the template sequence comprises 1-10 mismatches relative to the corresponding genomic sequence wherein themismatch provides the template sequence for template-based genome editing comprising a substitution.

266. The system or composition of claim 264 or 265, wherein the substitution is a transition or transversion.

267. The system or composition of any one of claims 264-266, wherein the template-based edit in the genomic sequence results in a change in an amino acid sequence encoded by a locus in which the genomic sequence is present.

268. The system or composition of any one of claims 264-267, wherein the template-based edit in the genomic sequence does not result in a change in an amino acid sequence encoded by a locus in which the genomic sequence is present.

269. The system or composition of any one of claims 264-268, wherein the template further comprises an insertion sequence or a sequence for directing a deletion.

270. The system, tgRNA, or composition of any one of claims 1-194 and 211-269, wherein the SpyCas9 guide RNA comprises, from 5’ to 3’, a spacer sequence and a SpyCas9 guide RNA scaffold sequence.

271. The system, tgRNA, or composition of any one of claims 1-194 and 211-270, wherein the SpyCas9 guide RNA scaffold sequence comprises an internal linker.

272. The system, tgRNA, or composition of any one of claims 1-194 and 211-271, wherein the spacer of the guide RNA comprises a DNA nucleotide.

273. The system, tgRNA, or composition of any one of claims 1-194 and 211-272, wherein the spacer or the scaffold of the guide RNA comprises a modified nucleotide selected from a 2’- O-methyl (2’-O-Me) modified nucleotide, or a 2’-F modified nucleotide or wherein the spacer or the scaffold of the guide RNA comprises a phosphorothioate (PS) bond between nucleotides.

274. The system, tgRNA, or composition of any one of claims 1-194 and 211-273, wherein the guide RNA comprises a DNA nucleotide at at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of the spacer, optionally wherein the guide RNA comprises a DNA nucleotide at one or more of positions S11, S12, and S18.

275. The system, tgRNA, or composition of any one of claims 1-194 and 211-274, 276. The system, tgRNA, or composition of any one of claims 1-194 and 211-275, wherein the guide RNA comprises a 2’-O-Me or 2’-F modified nucleotide at at least 2, 3, 4, 5, 6, 7, 8, 9,or 10 nucleotides of the spacer, optionally wherein the guide RNA comprises 2’-O-Me or 2’- F modified nucleotides at one or more of positions S4, S5, S9, S10, S13, S14, S17 and S20.

277. The system, tgRNA, or composition of any one of claims 1-194 and 211-276, wherein the guide RNA terminates with 1-4 uridine nucleotides or 1-4 modified uridine nucleotides, optionally a modified uridine nucleotide at the 3’ end.

278. The system, tgRNA, or composition of any one of claims 1-194 and 211-277, wherein the guide RNA comprises a 3’ end modification and 5’ end modification.

279. The system, tgRNA, or composition of claim 278, wherein the 3’ end modification or 5’ end modification comprises or further comprises a 2’-O-methyl (2’-O-Me) modified nucleotide or a phosphorothioate (PS) linkage between nucleotides.

280. The system, tgRNA, or composition of any one of claims 1-194 and 211-279, wherein the SpyCas9 guide RNA comprises, from 5’ to 3’, a spacer sequence and a scaffold sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 4, 5, 27, 370, 429, and 430, or the scaffold portion of any one of the sequences listed in Tables 1A-1D.

281. The system, tgRNA, or composition of any one of claims 1-194 and 211-280, wherein the SpyCas9 guide RNA comprises a modified nucleotide sequence having at least 90% identity to any one of (a) SEQ ID NOs: 201-218, 223, 224, 225-231, 232-235, 236, 237-239, 240- 269, 270-276, 300-318, 319, 323-325, 326-344, 345-349, and 372-374, 375-383, and 431- 434, or any one of the sequences listed in Tables 1C and 1D, or a modified nucleotide sequence having at least 90%, 95%, 98% identity to any one of SEQ ID NOs: 350-374 and 384-400, 429-430, 435-454, or any one of the sequences listed in Table 4; or (b) SEQ ID NOs: 201-218, 223, 224, 225-269, 270-271, 272-273, 274, 275276, 300-318, 319, 323-325, 326-344, 345-346, 347-349, 372-383, and 431-433, 434 or any one of the sequences listed in Tables 1C and 1D, or a modified nucleotide sequence having at least 90%, 95%, 98% identity to any one of SEQ ID NOs: 350-374, 384-400, and 429-430, and 435-454 or any one of the sequences listed in Table 4; optionally wherein the SpyCas9 guide RNA comprises a modified nucleotide sequence of any one of SEQ ID NOs: 201-218, 223, 224, 225-250, 269, 272-273, 274, 275, 276, 301-318, 319, 323-325, 326-334, 347-349, 372-374, and 431-433, 434; or wherein the SpyCas9 guide RNA comprises a modified nucleotide sequence of any one of SEQ ID NOs: 201-218, 224, 225-231, 232-235, 236, 237-239, 240-269, 270-273, 274,275, 276, 300-318, 319, 323-325, 326-344, 345-349, 372-374, and 375-383 or any one of the sequences listed in Tables 1C and 1D or a modified nucleotide sequence of any one of SEQ ID NOs: 350-374 and 384-400, 429-430, 435-454 or any one of the sequences listed in Table 4; or (b) SEQ ID NOs: 201-218, 224, 225-269, 270-271, 272-273, 274, 275, 276, 300-318, 319, 323-325, 326-344, 345-346, 347-349, 372-383, and 431-433, 434 or any one of the sequences listed in Tables 1C and 1D or a modified nucleotide sequence of any one of SEQ ID NOs: 350-374 and 384-400, and 435-454 or any one of the sequences listed in Table 4; optionally wherein the SpyCas9 guide RNA comprises a modified nucleotide sequence of any one of SEQ ID NOs: 201-218, 224, 225-250, 269, 272-273, 274, 275, 276, 301-318, 319, 323-325, 326-334, 347-349, 372-374, and 431-433, 434.

282. The system, tgRNA, or composition of any one of claims 1-194 and 211-281, wherein the SpyCas9 guide RNA comprises: i) mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGA(L3)AAGUUAAAAUAA GGCUAGUCCGUUAUCAC(L1)GGGCACCGAGUCGGmU*mG*mC*mU (SEQ ID NO: 371) or a sequence having at least 90%, 95%, 98%, or 99% identity to SEQ ID NO: 371; ii) mN*mN*mN*NNNNNNNNNNNNNNNNNmGUUUUAGmAmGmC(L1)mGmCm AAGUUmAAmAAmUmAmAGmGCUmAGUCmCmGUUAUmCAmC(L1)mGGm GmCmAmCmCmGmAGUCmGmGmUmGmC (SEQ ID NO: 347) or a sequence having at least 90%, 95%, 98%, or 99% identity to SEQ ID NO: 347; or iii) mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmA(L1)mUm AmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAC(L1)GGGCACCGAGU CGGmUmGmC (SEQ ID NO: 348) or a sequence having at least 90%, 95%, 98%, or 99% identity to SEQ ID NO: 348; wherein * denotes that the nucleotide is linked to the next nucleotide with a PS bond, a lower case “m” denotes that the nucleotide is modified with 2'-O-Me, where N is any nucleotide.

283. A lipid nanoparticle (LNP) composition comprising the system, tgRNA, guide RNA, or composition of any one of claims 1-194 and 211-282.

284. The system, tgRNA, guide RNA, composition, or LNP composition of any one of claims 1-194 and 211-283, wherein one or more of the tgRNA, first polynucleotide, second polynucleotide, nucleic acid encoding the DNA-dependent DNA polymerase, nucleic acidencoding the nCas9, or nucleic acid encoding the fusion protein is associated with one or more LNP.

285. The system, tgRNA, guide RNA, composition, or LNP composition of any one of claims 1-194 and 211-284, wherein the DNA-dependent DNA polymerase and nCas9 are a fusion protein encoded by a single mRNA associated with one LNP; or , wherein the tgRNA is associated with a separate LNP from the LNP associated with the mRNA encoding the DNA- dependent DNA polymerase and nCas9 are a fusion protein, optionally wherein the system or composition further comprises an mRNA encoding an enhancer of template-based genome editing associated with an LNP.

286. The system, tgRNA, guide RNA, composition, or LNP composition of any one of claims 283-285, wherein the LNP comprises (i) an ionizable lipid; (ii) a helper lipid; (iii) a stealth lipid; (iv) a neutral lipid; or combinations of one or more of (i)-(iv).

287. The system, tgRNA, guide RNA, composition, or LNP composition of claim 286, wherein the ionizable lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3- ((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate.

288. The system, tgRNA, guide RNA, composition, or LNP composition of claim 286 or 287, wherein the helper lipid is cholesterol; the stealth lipid is PEG-DMG; or the neutral lipid is DSPC.

289. A pharmaceutical composition comprising the system, tgRNA, guide RNA, composition, fusion polypeptide, or LNP composition of any one of claims 1-194 and 211-288and a pharmaceutically acceptable carrier.

290. A method for template-based genomic editing, comprising delivering to a cell or subject the system, tgRNA, guide RNA, composition, or LNP composition of any one of claims 1- 194 and 211-288 or the fusion polypeptide or nucleic acid of any one of claims 195-210.

291. Use of the system, tgRNA, guide RNA, composition, or LNP composition of any one of claims 1-194 and 211-288 or the fusion polypeptide or nucleic acid of any one of claims 195- 210 for template-based genome editing in a cell or subject.

292. The method or use of claim 290 or 291, wherein template-based genome editing results in edits comprising an insertion or deletion in a nucleotide sequence.

293. The method or use of claim 290 or 291, wherein template-based genome editing results in edits comprising a substitution in a nucleotide sequence, optionally wherein the substitution is a transition or transversion.

294. The method or use of any one of claims 290-293, wherein template-based genome editing results in at least 20%, 25%, 30%, 35%, 40%, 45%, optionally at least 50%, 55%, 60%, 65%, optionally at least 70%, 75%, or 80% templated edits as a percent of total edits in the target nucleic acid, further optionally wherein no more than 30% of the templated edits, optionally no more than 20% or 10% of the templated edits further comprise a byproduct edit.

295. The method or use of any one of claims 290-294, wherein the cell is a quiescent cell, optionally wherein the quiescent cell is selected from a hepatocyte, unactivated T-cell, muscle cell, neuronal cell, and a lung cell, and wherein at least 5% of the cells in the cell population comprise a template-based genome edit in the target nucleic acid.

296. The method or use of any one of claims 290-295, wherein the cell is a primary cell.

297. The method or use of any one of claims 290-296, wherein the cell is an immune cell and wherein at least 50% of the cells in the cell population comprise a template-based genome edit in the target nucleic acid, optionally wherein no more than 30% of the templated edits, optionally no more than 20% or 10% of the templated edits further comprise a byproduct edit.

298. The method or use of any one of claims 290-297, wherein (i) the length of the templated insertion is at least 5, 10, 15, 20, 25, 30, 35, or 40 nucleotides in length, optionally wherein the length of the templated insertion is 1-10, 1-20, 1-50, 1-75, or 1-100 nucleotides in length; or (ii) the length of the templated insertion is up to 500, 1000, 3500, 5000, or 10,000 nucleotides in length.

299. A method of producing a ligated template guide RNA (tgRNA), the method comprising: providing a first polynucleotide comprising a 3’ end comprising at least 10 nucleotides; providing a second polynucleotide comprising a 5’ end comprising at least 10 nucleotides; providing a splint oligonucleotide capable of annealing to the at least 10 nucleotides at the 3’ end of the first polynucleotide and the at least 10 nucleotides at the 5’ end of the second polynucleotide; andproviding a ligase to ligate the 3’ end of the first polynucleotide to the 5’ end of the second polynucleotide thereby forming a ligated tgRNA; wherein the ligated tgRNA comprises a SpyCas9 guide RNA, a template sequence, and a DNA- dependent DNA polymerase recruiting sequence (DRS).

300. A method of producing a ligated template guide RNA (tgRNA), the method comprising: providing a first polynucleotide comprising a 3’ end comprising at least 10 nucleotides; providing a second polynucleotide comprising a 5’ end comprising at least 10 nucleotides and a 3’ end comprising at least 10 nucleotides; providing a third polynucleotide comprising a 5’ end comprising at least 10 nucleotides. providing a first splint oligonucleotide capable of annealing to the at least 10 nucleotides at the 3’ end of the first polynucleotide and the at least 10 nucleotides at the 5’ end of the second polynucleotide; providing a second splint oligonucleotide capable of annealing to the at least 10 nucleotides at the 3’ end of the second polynucleotide and the at least 10 nucleotides at the 5’ end of the third polynucleotide; and providing one or more ligases to ligate (i) the 3’ end of the first polynucleotide to the 5’ end of the second polynucleotide and (ii) the 3’ end of the second polynucleotide to the 5’ end of the third polynucleotide thereby forming a ligated tgRNA; wherein the ligated tgRNA comprises a SpyCas9 guide RNA, a template sequence, and a DNA-dependent DNA polymerase recruiting sequence (DRS).

301. The method of any one of claims 299-300, wherein the ligated tgRNA is at least 100 nucleotides in length, at least 110 nucleotides in length, at least 120 nucleotides in length, at least 130 nucleotides in length, at least 140 nucleotides in length, at least 150 nucleotides in length, at least 160 nucleotides in length, or at least 170 nucleotides in length.

302. The method of any one of claims 299-301, further comprising separating the ligated tgRNA from the splint oligonucleotide.

303. The method of any one of claims 299-302, further comprising subjecting the ligated tgRNA to a purification step.

304. The method of any one of claims 299 and 301-303, wherein the splint oligonucleotide is a DNA splint oligonucleotide.

305. The method of any one of claims 299-and 301-304, wherein the splint oligonucleotide is at least 15 or at least -20 nucleotides in length, or optionally about 15-20 nucleotides in length.

306. The method of any one of claims 299-305, wherein ligation occurs at a ligation site within the scaffold of the SpyCas9 guide RNA.

307. The method of any one of claims 300-303 and 306, wherein the first and second splint oligonucleotides are DNA splint oligonucleotides.

308. The method of any one of claims 300-303 and 306-307, wherein the first splint oligonucleotide is at least at least 15, 20, 30, 40, 50, 60, 70, 80, or 901nucleotides in length, optionally from about 15 to 25 nucleotides in length, or the second splint oligonucleotide is at least 15, 20, 30, 40, 50, 60, 70, 80, or 90 nucleotides in length, optionally from about 15 to 25 nucleotides in length.

309. The method of any one of claims 299-308, wherein the one or more ligases comprises an RNA ligase or a DNA ligase, optionally wherein the ligase comprises a T4 DNA ligase or a T4 RNA ligase.

310. The method of any one of claims 300-303 and 306-309, wherein a first ligation occurs at a first ligation site that is flanked by RNA nucleotides and a second ligation occurs at a second ligation site that is flanked by DNA nucleotides.

Citation Information

Patent Citations

  • Polynucleotide editors and methods of using the same

    US20230059368A1

  • Cloning and expression of t5 DNA polymerase reduced in 3'-to-5' exonuclease activity

    WO1993015096A1

  • Methods and compositions for editing nucleotide sequences

    WO2020191234A1

  • Compositions and methods for improved site-specific modification

    WO2021204877A2

  • Artificial DNA replisome and methods of use thereof

    WO2022178167A1