Gene editing treatment method and therapeutic agent for retinitis pigmentosa

Abstract

The present invention relates to: a pharmaceutical composition for preventing or treating retinitis pigmentosa comprising an agent for inducing a deletion of an IMPDH1 C.947G > C (p.ARG316PRO) mutation, and a method for preventing or treating retinitis pigmentosa, comprising a step of inducing the deletion of the mutation; a composition for diagnosing or predicting retinitis pigmentosa, comprising an agent for detecting an IMPDH1 C.947G > C (p.ARG316PRO) mutation; and a method for providing information for diagnosing or predicting retinitis pigmentosa, comprising a step of detecting the mutation.

Description

Genetic correction treatment methods and treatments for retinitis pigmentosa

[0001] [Cross-reference with related applications]

[0002] This application claims the benefit of priority to Korean Patent Application No. 10-2023-0158646, filed November 15, 2023, the entire contents of which are incorporated herein by reference.

[0003] The present invention relates to a pharmaceutical composition for preventing or treating retinitis pigmentosa, a method for preventing or treating retinitis pigmentosa, a composition for diagnosing or predicting retinitis pigmentosa, and a method for providing information for diagnosing or predicting retinitis pigmentosa.

[0004]

[0005] Retinitis pigmentosa (RP) is a progressive retinal degenerative disease caused by dysfunction of photoreceptors distributed in the retina. It refers to a group of diseases characterized by hereditary and progressive retinal function decline, cell loss, and ultimately retinal tissue atrophy. Retinitis pigmentosa is a progressive disease that occurs due to problems with the function of photoreceptors. It primarily affects photoreceptors and the retinal pigment epithelium, and it is reported to affect approximately 1 in 4,000 people worldwide.

[0006] The cause of this type of retinitis pigmentosa is not yet clear, but it may be related to genetic abnormalities. There are reports that the clinical manifestations and progression of the disease differ depending on the genetic type and causative gene, but further research is needed.

[0007] IMPDH1 (Inosine-5'-monophosphate dehydrogenase 1) is a homotetramer that regulates cell growth. IMPDH1 is an enzyme that catalyzes the synthesis of xanthine monophosphate (XMP) from inosine-5'-monophosphate (IMP). In addition, IMPDH1 is known to act as a rate-limiting step in the de novo synthesis of guanine nucleotides.

[0008] The present inventors have discovered that the IMPDH1 mutant gene causes retinitis pigmentosa, and have devised a method for removing the mutation through gene correction to prevent or treat retinitis pigmentosa, thereby completing the present invention.

[0009]

[0010] The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating retinitis pigmentosa.

[0011] In addition, the present invention aims to provide a method for preventing or treating retinitis pigmentosa.

[0012] In addition, the present invention aims to provide a composition for diagnosing or predicting retinitis pigmentosa.

[0013] In addition, the present invention aims to provide a method for providing information for diagnosing or predicting retinitis pigmentosa.

[0014]

[0015] In order to achieve the above purpose, the present invention has clarified the relationship between retinitis pigmentosa and a mutation in the IMDPH1 gene, and thus, one aspect of the present invention provides a pharmaceutical composition for preventing or treating retinitis pigmentosa, including an agent that induces a defect in the IMPDH1 c.947G>C (p.Arg316Pro) mutant gene.

[0016] In addition, in order to achieve the above purpose, another aspect of the present invention provides a method for preventing or treating retinitis pigmentosa, comprising the step of inducing a defect in the IMPDH1 c.947G>C (p.Arg316Pro) mutant gene in a retinitis pigmentosa patient.

[0017] In addition, in order to achieve the above purpose, another aspect of the present invention provides a composition for diagnosing or predicting retinitis pigmentosa, comprising an agent for detecting an IMPDH1 c.947G>C (p.Arg316Pro) mutant gene or a protein expressed from the mutant gene.

[0018] In addition, in order to achieve the above purpose, another aspect of the present invention provides a method for providing information for diagnosing or predicting retinitis pigmentosa, comprising the step of detecting an IMPDH1 c.947G>C (p.Arg316Pro) mutant gene or a protein expressed from the mutant gene in a biological sample isolated from an individual.

[0019]

[0020] According to the present invention, the IMPDH1 c.947G>C (p.Arg316Pro) mutant gene causes retinitis pigmentosa, and by using a guide RNA that specifically recognizes the IMPDH1 mutant gene, the mutation is induced to be deleted, thereby having the effect of preventing or treating retinitis pigmentosa. Therefore, a preparation that deletes the mutation can be widely used as a gene therapy agent and treatment method for alleviating the symptoms of retinitis pigmentosa.

[0021] However, the effects of the present invention are not limited to the effects mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

[0022]

[0023] Figure 1 illustrates the IMPDH1 mutant gene region (45 bp) essential for designing guide RNA targeting the IMPDH1 mutant gene of the present invention. The IMPDH1 NM_000883.3 c.947G>C (p.Arg316Pro) mutation found in the patient is highlighted in red among the IMPDH1 base sequences derived from normal individuals and patients. It can be seen that for gene correction using the CRISPR-Cas system, the target base sequence (corresponding to the proto-spacer of the CRISPR RNA) must be selected within the 45 bp range of Figure 1.

[0024] Figure 2 illustrates an example of a genetic scissors for correcting and deleting the IMPDH1 mutant gene of the present invention. The corresponding base sequences in Figure 2 indicate a target base sequence (yellow) and a PAM base sequence (light blue) that can be used to produce RG1 and RG2, which are sgRNAs that can interact with S. pyogenes Cas9.

[0025] Figure 3 shows the results of investigating the activity and accuracy of the gene scissors for correcting the IMPDH1 mutant gene of the present invention. Figure 3A illustrates the principle of the reporter assay. The reporter in which a normal or patient-derived base sequence (target base sequence) is cloned basically only expresses mRFP and cannot express EGFP due to the stop codon present after the target base sequence. However, when the gene scissors act on this target base sequence to induce a double-strand DNA break, an indel mutation is induced, the existing stop codon is removed, and EGFP can be expressed. Figures 3B and 3C show the results of observing the expression of mRFP and EGFP under a microscope after the gene scissors and reporter gene were simultaneously transfected into the 293TA cell line. EV, empty vector (no gene scissors); Merged, result of merging mRFP and EGFP signals; RG1 and RG2, gene scissors presented in Figure 2.

[0026] Figure 4 shows the results of confirming the activity and accuracy of the gene scissors for correcting the IMPDH1 mutation of the present invention in induced pluripotent stem cells derived from patients with retinitis pigmentosa. Figure 4A is a microscopic photograph of established patient-derived induced pluripotent stem cells (iPSCs). Figures 4B and 4C show the activity of the RG2 gene scissors in normal and patient-derived iPSCs. Each iPSC was infected with a lentivirus expressing the RG2 gene scissors, and genomic DNA was isolated after puromycin selection. Using this as a template, the region where the mutation existed was amplified by PCR, and the indel mutation induced by the activity of the gene scissors was identified by the T7E1 assay (B) or targeted deep-seq (C).

[0027] Figure 5 shows the results of examining the gene scissors activity of 20 types of forward guide RNAs of the present invention. After the gene scissors and reporter gene were simultaneously transfected into the 293TA cell line, the expression of mRFP and EGFP was observed using a fluorescence microscope (Figure 5A) and a flow cytometer (Figure 5B).

[0028] Figure 6 shows the results of examining the gene scissors activity of 20 types of reverse guide RNAs of the present invention. The gene scissors and reporter genes were simultaneously transfected into 293TA cell lines, and then the expression of mRFP and EGFP was observed using a fluorescence microscope (Figure 6A) and a flow cytometer (Figure 6B).

[0029] Figure 7 shows the results of analyzing the activity of the gene scissors for correcting the IMPDH1 mutant gene in fertilized eggs obtained from a retinitis pigmentosa patient-mimetic mutant mouse model (see Korean Patent Application No. 10-2023-0074425). Figure 7A shows the results of destroying the patient-derived mutant base sequence in mouse fertilized eggs using the gene scissors R2 for gene correction therapy. Figure 7B shows the results of genome sequencing of the mouse model. Figure 7C shows the results of targeted deep-sequencing of the mouse model.

[0030] Figure 8 shows the retinal phenotype observation results of a mouse model in which the IMPDH1 mutation derived from a retinitis pigmentosa patient has been disrupted. In Figure 8, red and blue arrows indicate the outer nuclear layer, and red and blue triangles indicate blood flow within the retinal vessels surrounding the optic nerve.

[0031]

[0032] Hereinafter, the present invention will be described in detail.

[0033]

[0034] 1. IMPDH1 mutation of the present invention

[0035] The present invention clarified the correlation between the IMPDH1 c.947G>C (p.Arg316Pro) mutation gene and retinitis pigmentosa.

[0036] The above retinitis pigmentosa is a progressive retinal degenerative disease caused by dysfunction of photoreceptors distributed in the retina, and it has been suggested that it may be caused by genetic mutations.

[0037] The above IMPDH1 (Inosine-5'-monophosphate dehydrogenase 1) is a homotetramer that regulates cell growth, and IMPDH1 is known as an enzyme that catalyzes the synthesis of xanthine monophosphate (XMP) from inosine-5'-monophosphate (IMP). The protein encoded by the IMPDH1 gene acts as a homotetramer that regulates cell growth. The encoded protein is an enzyme that catalyzes the synthesis of xanthine monophosphate (XMP) from inosine-5'-monophosphate (IMP), which is the rate-limiting step in the de novo synthesis of guanine nucleotides. Defects in the IMPDH1 gene cause retinitis pigmentosa type 10 (RP10).

[0038] The specific base sequence of the IMPDH1 gene and the amino acid sequence information of the protein encoded by the gene can be found in the known database, such as GenBank of the National Center for Biotechnology Information (NCBI). Specifically, the mRNA of the human IMPDH1 gene may include the nucleotide sequence of NCBI Reference Sequence: NM_000883.3 or NM_000883.4, but may include any nucleotide sequence that exhibits substantially the same or corresponding effect as the gene without limitation. The human IMPDH1 protein may include the amino acid sequence of NCBI Reference Sequence: NP_000874.2, but is not limited thereto. The human IMPDH1 protein may include an isoform or a precursor thereof. The mRNA of the mouse IMPDH1 gene may include the nucleotide sequence of NCBI Reference Sequence: NM_011829.3, but may include, without limitation, any nucleotide sequence that exhibits substantially the same or corresponding effect as the gene. The mouse IMPDH1 protein may include the amino acid sequence of NCBI Reference Sequence: NP_035959.2, but is not limited thereto. The mouse IMPDH1 protein may include an isoform or a precursor thereof. The nucleotide sequence of the IMPDH1 gene of mammals other than the mouse and the amino acid sequence of the mouse IMPDH1 protein can be found in known databases such as NCBI's GenBank.

[0039] In one embodiment, the IMPDH1 gene region comprising the IMPDH1 c.947G>C (p.Arg316Pro) mutation may be a region of 25 to 50 bp in length comprising the c.947G>C and may include the base sequence of SEQ ID NO: 1.

[0040] If a point mutation of c.947G>C (p.Arg316Pro) occurs in the IMPDH1 gene, retinitis pigmentosa may be induced. Specifically, according to Korean Patent Application No. 10-2023-0074425, the IMPDH1 c.947G>C (p.Arg316Pro) mutation was discovered as a result of analyzing the genes of the retinitis pigmentosa patient, and it was confirmed that retinitis pigmentosa was induced in a mouse model in which the c.947G>C (p.Arg316Pro) mutation was introduced into the IMPDH1 gene.

[0041] Therefore, the IMPDH1 c.947G>C (p.Arg316Pro) mutant gene of the present invention may be a biomarker for diagnosing or predicting retinitis pigmentosa.

[0042] The above biomarker refers to a factor that exists in or is derived from a biological sample, and is a characteristic that can distinguish one biological phenomenon from another.

[0043]

[0044] 2. Prevention or treatment of retinitis pigmentosa through editing of the IMPDH1 mutant gene of the present invention.

[0045] One aspect of the present invention provides a pharmaceutical composition for preventing or treating retinitis pigmentosa, comprising an agent that induces a defect in the IMPDH1 mutation.

[0046] The above pharmaceutical composition has an effect of preventing or treating retinitis pigmentosa by deleting or removing the IMPDH1 mutant gene of the present invention.

[0047] The above “prevention” means anything that suppresses or delays the onset of retinitis pigmentosa by treating or administering the subject, and the above “treatment” means anything that improves or beneficially changes the symptoms of retinitis pigmentosa by treating or administering the subject.

[0048] The above retinitis pigmentosa may be induced by a mutation in the IMPDH1 gene.

[0049] In order to induce a defect in the IMPDH1 mutant gene, any technique that can be adopted by a person skilled in the art to remove or delete a gene in an animal, plant, or microorganism, including a human, can be used without limitation to induce a defect in the IMPDH1 mutant gene.

[0050] Specifically, the agent that induces a defect in the IMPDH1 mutant gene may utilize a CRISPR-Cas system and a guide RNA (gRNA) that specifically binds to the IMPDH1 mutant.

[0051] The above "CRISPR" or "CRISPR" is a locus containing multiple short direct repeats found in the genomes of approximately 40% of sequenced bacteria and 90% of sequenced archaea. When the Cas protein complexes with two RNAs, called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA), it forms an active endonuclease, thereby protecting the host cell from invasion by phage or plasmid by suppressing foreign genetic elements. The crRNA is transcribed from the CRISPR element in the host genome that has been seized from the foreign invader during delivery.

[0052] The above CRISPR (clustered regularly interspaced short palindromic repeat)-Cas system is an immune system discovered in bacteria that acts as a defense mechanism against phages. It is an RNA-guided gene scissors that recognizes the target base of the target DNA by guide RNA (gRNA) and causes DNA double-strand break (DSB) by the nuclease activity contained in the Cas9 protein. Compared to existing ZFN and TALEN gene scissors, it has the advantage of being able to target and edit any DNA site by simply changing the sequence of the gRNA as long as there is only a 20-base sequence recognized by the sgRNA and the Cas9 protein recognition PAM (protosapcer adjacent motif) sequence. This has been shown to work very well in mammalian cells and animals through cell and animal experiments. The above CRISPR-Cas system can be used without limitation as long as it can be applied by a person skilled in the art to induce editing or correction of genes, for example, it can be CRISPR-Cas, CRISPR-Cpf1 gene, etc., and specifically, it can be CRISPR-Cas9.

[0053] In one embodiment of the present invention, the CRISPR may be Cas9 (SpCas9) derived from Streptococcus pyogenes, or may be Cas9-SpRy (PAMless Cas9 variant), which is a variant of the SpCas9.

[0054] The above guide RNA refers to a small RNA of about 45 to 70 nucleotides that contains a base sequence complementary to a gene to be edited (hereinafter, target base sequence) and has base sequence information that serves as a template for a modification reaction when editing RNA. The guide RNA recognizes the IMPDH1 mutant gene and guides the CRISPR gene scissors to the IMPDH1 mutant gene. As long as it includes a target base sequence that specifically binds to the IMPDH1 mutant gene and guides the CRISPR gene scissors to the IMPDH1 mutant gene, it can be used without limitation. The guide RNA may include a target base sequence that targets the IMPDH1 mutant gene of the present invention, and specifically, the guide RNA may include a target base sequence that targets the base sequence of SEQ ID NO: 1, SEQ ID NO: 48, or a part of the base sequence thereof.

[0055] The above guide RNA may or may not contain a PAM sequence.

[0056] In one embodiment of the present invention, when the CRISPR is SpCas9, the guide RNA may include a PAM sequence, and when the CRISPR is Cas9-SpRy, the guide RNA may not include a PAM sequence.

[0057] Specifically, the guide RNA of the present invention may include any one base sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 8 to SEQ ID NO: 47 or a base sequence complementary thereto, and the complementary base sequence may include at least one base sequence selected from the group consisting of SEQ ID NO: 4 to SEQ ID NO: 7.

[0058] The base sequence of the above CRISPR-Cas and guide RNA can be introduced into a patient with retinitis pigmentosa through a vector including the base sequence of the above CRISPR-Cas and guide RNA.

[0059] The above vector may include all of the base sequences of the CRISPR-Cas and guide RNA in one vector, or the base sequences of the CRISPR-Cas and guide RNA may be included in each vector, so that there may be a total of two vectors each including the base sequences of the CRISPR-Cas and guide RNA.

[0060] The above vector can be produced and purified using standard recombinant DNA technology. The type of the vector is not particularly limited as long as it has the function of expressing a desired gene and producing a desired protein in various host cells of prokaryotic and eukaryotic cells. The vector may be selected from the group consisting of a plasmid vector, a cosmid vector, a bacteriophage vector, and a viral vector. For example, the viral vector may be an adenovirus vector, a retrovirus vector, a lentivirus, a vaccinia virus vector, a poxvirus vector, a herpes simplex virus vector, or an adeno-associated virus vector. For example, the vector that can be used as the above vector may be produced based on, but is not limited to, a plasmid used in the art (e.g., pcDNA series, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series, pUC19, etc.), a phage (e.g., λgt4λB, λ-Charon, λΔz1, M13, etc.), or a viral vector (e.g., adeno-associated virus (AAV) vector, etc.).

[0061] Therefore, the pharmaceutical composition of the present invention may comprise the vector.

[0062] The above vector can be introduced into a patient with retinitis pigmentosa to provide a transformant. The transformant refers to a transformant into which the CRISPR-Cas and guide RNA have been introduced into a host. The transformant refers to a host into which a foreign genetic material has been introduced by transfection or transduction, and in the present invention, the transformant may refer to a host cell into which a vector including the CRISPR-Cas; and a base sequence of the guide RNA or a DNA base sequence complementary thereto has been introduced. The transformant can be transformed by introducing the vector including the base sequence of the CRISPR-Cas and the guide RNA, thereby effectively expressing the CRISPR-Cas and the guide RNA. The CRISPR-Cas and the guide RNA introduced and expressed as described above can be used to edit genes to remove the IMPDH1 mutant gene in the retinitis pigmentosa host, and retinitis pigmentosa can be prevented or treated through the gene deletion editing.

[0063] In the present invention, the above “introduction” means a process of transforming a host by transfecting or transducing a foreign genetic material into the host, and the host cell may be, for example, an immune cell, an epithelial cell, a muscle cell, a kidney cell, a tumor cell, etc.

[0064] The above transformation refers to the introduction of a heterologous nucleic acid into a cell. The transformation of the cell may be stable or transient. Thus, in some embodiments, a host cell, host organism, or host animal can be stably transformed with the vector.

[0065] In addition, the introduction of the vector may be performed using local injection, microinjection, electroporation, sonoporation, cell squeezing, optical transfection, lipofection, nanofiber, nanoparticle, etc. However, the delivery method is not limited to these delivery methods, and is not particularly limited as long as the nucleic acid contained in the vector can be introduced into the target cell in an appropriate delivery form.

[0066] In a specific embodiment of the present invention, the IMPDH1 mutant gene of a mouse suffering from retinitis pigmentosa was deleted using guide RNAs of SEQ ID NOS: 4 to 7 and CRISPR-Cas9 gene scissors, and the phenotypic changes appearing in the retina of the mouse were analyzed. As a result, the mouse with the IMPDH1 mutation deleted showed a normal retinal interlayer structure and no defects in the photoreceptor layer, confirming that retinitis pigmentosa can be treated by deleting the IMPDH1 mutation.

[0067] Alternatively, the base sequence of the CRISPR-Cas and guide RNA can be introduced into a patient with retinitis pigmentosa via microinjection.

[0068] The above microinjection may involve injecting foreign substances (DNA, RNA, proteins, fluorescent dyes, etc.) into the cytoplasm or nucleus of a cell through a fine glass needle, etc.

[0069] In one embodiment of the present invention, genetic scissors and guide RNA were injected into the fertilized egg of an animal model mimicking a retinitis pigmentosa patient through microinjection.

[0070] In addition, the pharmaceutical composition may further comprise one or more pharmaceutically acceptable carriers. The pharmaceutically acceptable carrier must be compatible with the active ingredient of the present invention, and may be used as a mixture of saline solution, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components. If necessary, other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate the composition into an injectable formulation such as an aqueous solution, suspension, or emulsion. In particular, it is preferable to provide the composition by formulating it into a lyophilized form. A method commonly known in the art to which the present invention pertains can be used to manufacture a lyophilized formulation, and a stabilizer for lyophilization may be added. Furthermore, it can be preferably formulated according to each disease or ingredient using an appropriate method in the field or a method disclosed in Remington's pharmaceutical Science (Mack Publishing company, Easton PA).

[0071] The content and administration method of the active ingredients, etc. included in the above pharmaceutical composition can be determined by a person skilled in the art based on the symptoms and severity of the disease of a typical patient. Furthermore, the composition can be formulated in various forms, such as powders, tablets, capsules, liquids, injections, ointments, and syrups, and can also be provided in unit-dose or multi-dose containers, such as sealed ampoules and bottles. For example, when administering the pharmaceutical composition for clinical purposes, the effective dosage of the agent that induces a defect in the IMPDH1 mutant gene may vary depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, diet, administration time, administration route, excretion rate, drug mixing, and reaction sensitivity. However, in general, the dosage of the pharmaceutical composition is 0.01 to 20 mg / day per 1 kg of body weight of an adult patient, preferably 1 to 10 mg / day, and may be administered in divided doses several times a day at regular intervals, preferably 2 to 3 times a day, depending on the judgment of a doctor or pharmacist.

[0072] In addition, the pharmaceutical composition can be administered orally or parenterally. The route of administration of the composition according to the present invention is not limited to these, but for example, bronchial, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, enteral, sublingual, or topical administration is possible. The dosage of the composition according to the present invention varies depending on the patient's weight, age, sex, health condition, diet, administration time, method, excretion rate, or disease severity, and can be easily determined by a person skilled in the art. In addition, the pharmaceutical composition can be formulated into a suitable dosage form using a known technique for clinical administration.

[0073]

[0074] Another aspect of the present invention provides a method for preventing or treating retinitis pigmentosa.

[0075] The above method comprises a step of inducing a deletion of the IMPDH1 c.947G>C (p.Arg316Pro) mutant gene in a patient with retinitis pigmentosa.

[0076] Inducing a defect in the above IMPDH1 mutant gene may be accomplished by using an agent that induces a defect in the IMPDH1 mutant, and the agent that induces a defect in the IMPDH1 mutant can be understood in the same manner as described above.

[0077] The step of inducing a defect in the above IMPDH1 mutation may be to introduce a CRISPR-Cas system and a guide RNA (gRNA) that specifically binds to the IMPDH1 mutation into the patient.

[0078] Introduction into the above patient can be performed via a vector containing the base sequence of the above CRISPR-Cas and the above guide RNA.

[0079] Introducing the CRISPR-Cas and the guide RNA sequence into the patient may be accomplished by microinjecting the patient's cells.

[0080]

[0081] 3. Diagnosis or prediction of retinitis pigmentosa using the IMPDH1 mutant gene of the present invention

[0082] As described above, one aspect of the present invention is that the IMPDH1 mutant gene is an effective biomarker for diagnosing or predicting retinitis pigmentosa, and therefore the IMPDH1 mutation can be used for diagnosing or predicting retinitis pigmentosa.

[0083] The above "diagnosis" is a concept that includes all of the following: determining an object's susceptibility to a specific disease or condition, determining whether an object currently has a specific disease or condition, determining a prognosis of an object suffering from a specific disease or condition, or therametrics (e.g., monitoring an object's condition to provide information on treatment efficacy). In the present invention, the diagnosis may specifically mean early diagnosis or prediction of onset, but is not limited thereto. More specifically, the diagnosis means the diagnosis of retinitis pigmentosa.

[0084] The above "prediction" is a concept encompassing the act of anticipating or predicting the onset of a specific disease or condition prior to its occurrence. In the present invention, the prediction may specifically refer to predicting a patient's risk of retinitis pigmentosa prior to the onset of retinitis pigmentosa, but is not limited thereto.

[0085] In one embodiment utilizing the above biomarker, another aspect of the present invention provides a composition for diagnosing or predicting retinitis pigmentosa, comprising an agent for detecting the IMPDH1 mutant gene or a protein expressed from the mutant gene.

[0086] The above detection may include qualitatively or quantitatively confirming and analyzing the presence, degree of presence, change in degree of presence, etc. of the IMPDH1 mutant gene of the present invention or a protein expressed from the mutant gene.

[0087] The agent for detecting the above mutant gene may include, but is not limited to, a probe or primer specific to the IMPDH1 mutant gene of the present invention.

[0088] The above probe refers to a fragment of polynucleotide such as RNA or DNA, which is short, several base pairs to several hundred base pairs in length, and can specifically bind to mRNA, cDNA (complementary DNA), DNA, etc. of a specific gene, and is labeled so that the presence or absence of the target mRNA or cDNA to which it binds, the expression level, etc. can be confirmed. The selection and hybridization conditions of the probe can be appropriately selected according to techniques known in the art. The probe can be used in a diagnostic method for detecting an allele (or allele). The diagnostic method includes detection methods based on hybridization of nucleic acids, such as Southern blot, and may be provided in a form pre-bound to a substrate of a DNA chip in a method using a DNA chip.

[0089] The above primer is a short single-stranded oligonucleotide that acts as the starting point of DNA synthesis. The primer specifically binds to a polynucleotide template under suitable buffer and temperature conditions, and DNA is synthesized by DNA polymerase adding a nucleoside triphosphate having a base complementary to the template DNA to the primer and linking them. The primer generally consists of a sequence of 15 to 30 bases, and the melting temperature (Tm) at which it binds to the template strand varies depending on the base composition and length. The primer sequence does not need to be completely complementary to some base sequence of the template; it is sufficient to have sufficient complementarity within the range where it can hybridize with the template and perform its unique function. Therefore, in the present invention, the primer pair, which is a detection agent according to the present invention, can be easily designed by referring to the base sequence of the cDNA or genomic DNA of the IMPDH1 mutation. Primers for detecting SNPs do not need to have perfectly complementary sequences to each gene sequence. They simply need to be of a length and complementarity appropriate for the purpose of amplifying a specific section of mRNA or cDNA through DNA synthesis and measuring the amount of mRNA. Primers for the amplification reaction are composed of a set (pair) that complementarily bind to the template at both ends (sense) and opposite ends (antisense) of a specific section of mRNA to be amplified.

[0090] Therefore, in the present invention, the primer or probe can be chemically synthesized using a phosphoramidite solid support synthesis method or other methods well known to those skilled in the art. In addition, the primer or probe can be variously modified according to methods known in the art as long as it does not interfere with hybridization with the polynucleotide that is the target to be detected. Examples of such modifications include methylation, capping, substitution with one or more homologues of natural nucleotides, modification between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoramidate, carbamate, etc.) or charged linkers (e.g., phosphorothioate, phosphorodithioate, etc.), and binding of labeling materials using fluorescent or enzymes.

[0091] The above-detected agent may include any one base sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 8 to SEQ ID NO: 47 or a base sequence complementary thereto, and specifically, may include any one base sequence selected from the group consisting of SEQ ID NO: 11 to SEQ ID NO: 14, SEQ ID NO: 44 and SEQ ID NO: 45 or a base sequence complementary thereto.

[0092] The agent for detecting a protein expressed from the mutant gene may include, but is not limited to, an antibody or aptamer specific for the protein.

[0093] The above antibody refers to an immunoglobulin molecule that immunologically binds specifically to an epitope of the protein and has reactivity, and is used to mean, without limitation, a monoclonal antibody, a polyclonal antibody, an antibody having a full-length chain structure, an antibody of a functional fragment having at least an antigen-binding function, and a recombinant antibody.

[0094] The above aptamer refers to a single-stranded nucleic acid molecule that has the characteristic of being able to form a specific bond by targeting the protein and forms a stable three-dimensional structure, and an aptamer having specificity for the protein can be synthesized using SELEX (Systematic Evolution of Ligands by Exponential enrichment) technology, etc.

[0095] In addition, as another aspect of utilizing the above biomarker, another aspect of the present invention provides a kit for diagnosing or predicting retinitis pigmentosa comprising the above diagnostic or predictive composition.

[0096] The above kit may be, but is not limited to, an RT-PCR kit or a microarray chip kit.

[0097] The above kit can confirm the presence of the IMPDH1 mutation of the present invention, which is a biomarker for diagnosis or prediction of retinitis pigmentosa, through amplification or the like, or can diagnose or predict the onset of retinitis pigmentosa early by confirming the expression level of the IMPDH1 mutation as the expression level of mRNA.

[0098] In another aspect of utilizing the above biomarker, another aspect of the present invention provides a method for providing information necessary for diagnosing or predicting retinitis pigmentosa, comprising the step of detecting the IMPDH1 mutant gene or a protein expressed from the mutant gene in a biological sample isolated from an individual.

[0099] The above entity refers to a test subject for predicting or diagnosing the onset of retinitis pigmentosa, and may be a mammal including a human, and in particular, may be a patient suspected of having retinitis pigmentosa.

[0100] The biological sample above is a sample isolated from an individual from whom retinitis pigmentosa needs to be distinguished, and may be, for example, tissue, cell, blood, serum, plasma, cerebrospinal fluid, secretions, peritoneal fluid, synovial fluid, lung lavage fluid, saliva, urine, feces, etc. Specifically, the biological sample may be blood, plasma, serum, saliva, nasal fluid, sputum, ascites, vaginal secretions, and urine, and in particular, the biological sample may be blood, and specifically, may be serum isolated from the blood.

[0101] The step of detecting the above mutant gene can be performed by one or more methods selected from the group consisting of sequencing, exome sequencing, microarray hybridization, allele specific PCR, dynamic allele-specific hybridization, PCR extension analysis, and Taqman technique, but is not limited to any method capable of detecting a specific mutation in the gene.

[0102] The step of detecting a protein expressed from the above mutant gene can be performed by a method such as Western blot using the antibody or aptamer, protein microarray (protein chip), Enzyme Linked Immunosorbent Assay (ELISA), 2-Dimensional Electrophoresis, Immunohistochemistry (IHC), Immunofluorescence, Co-Immunoprecipitation Assay, Fluorescence Activated Cell Sorter (FACS), Radioimmunoassay (RIA), Radioimmunodiffusion, Matrix Assisted Laser Desorption / Ionization Time of Flight Mass Spectrometry (MALDI-TOF analysis), etc., but is not limited thereto as long as it is a method capable of detecting a protein expressed from a specific mutation of the gene.

[0103]

[0104] Hereinafter, the present invention will be described in detail by examples.

[0105] However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0106]

[0107] [Example 1]

[0108] Establishment of gRNA and CRISPR-Cas system for gene therapy of retinitis pigmentosa of the present invention

[0109] [1-1] Design of gRNA and CRISPR-Cas system

[0110] The maximum target gene range for designing a guide RNA that can be used in gene correction therapy using the CRISPR-Cas system to destroy the autosomal dominant IMPDH1 NM_000883.3 c.947G>C (p.Arg316Pro) mutation is a 45-bp region. In Figure 1, the IMPDH1 NM_000883.3 c.947G>C (p.Arg316Pro) mutation found in the patient is highlighted in red with the IMPDH1 base sequences derived from a normal individual and the patient. For gene correction using the CRISPR-Cas system, the target base sequence (SEQ ID NO: 1, corresponding to the proto-spacer of the CRISPR RNA) must be selected within the 45-bp range of Figure 1.

[0111] In order to determine whether gene correction therapy is possible by destroying the actual autosomal dominant IMPDH1 NM_000883.3 c.947G>C (p.Arg316Pro) mutation, Cas9 derived from Streptococcus pyogenes was used as a CRISPR-Cas gene scissors, and two guide RNAs (RG1 (SEQ ID NO: 2) and RG2 (SEQ ID NO: 3)) that can specifically recognize and attack the IMPDH1 mutation were selected, as shown in Fig. 2. In Fig. 2, the target base sequence (yellow) and PAM base sequence (light blue) that can be used for the production of RG1 and RG2, which are guide RNAs that can interact with the S. pyogenesCas9, are indicated. Specifically, first, DNA oligomers of the above guide RNA were synthesized (RG1: 5'-CACCggaagaacccagactaccctc-3' (SEQ ID NO: 4), 5'-AAACgagggtagtctgggttcttcc-3' (SEQ ID NO: 5); RG2: 5'-CACCgggtagtctgggttcttcttc-3' (SEQ ID NO: 6), 5'-AAACgaagaagaacccagactaccc-3' (SEQ ID NO: 7)), and these were cloned into lentiCRISPR v2 (Source: Addgene Plasmid #52961) capable of producing lentivirus vectors.

[0112] [1-2] Confirmation of activity and accuracy of gRNA and CRISPR-Cas systems

[0113] Next, a reporter gene assay was performed to determine the activity and accuracy with which the gene scissors act on the actual normal and mutant base sequences. The reporter gene assay is based on the following principle. A reporter in which the base sequence of normal or patient-derived IMPDH1 (target base sequence) is cloned only expresses the mRFP fluorescent protein linked upstream of the target base sequence, and does not express the EGFP fluorescent protein linked downstream of the target base sequence due to a stop codon present downstream of the target base sequence. On the other hand, when the gene scissors of Example 1-1 act on the target base sequence to remove the IMPDH1 mutant gene, the stop codon previously present downstream of the target base sequence is removed, allowing the EGFP to be expressed. Accordingly, the genetic scissors and the two types of reporter fluorescent protein genes were simultaneously transfected into the 293TA cell line, and the expression of mRFP and EGFP expressed from the reporter genes was observed under a microscope. Specifically, a base sequence derived from a normal person (5'-attgGACCTGAAGAAGAACCGAGACTACCCTCTGGCCTCCAAGGA-3' (SEQ ID NO: 135), 5'-ccaatccttggaggccagagggtagtctcggttcttcttcaggtc-3' (SEQ ID NO: 136)) and a base sequence derived from a retinitis pigmentosa patient (5'-attgGACCTGAAGAAGAACCcAGACTACCCTCTGGCCTCCAAGGA-3' (SEQ ID NO: 137), 5'-ccaaTCCTTGGAGGCCAGAGGGTAGTCTgGGTTCTTCTTCAGGTC-3' (SEQ ID NO: 138)) were cloned into pMRSv2, a reporter vector for the gene scissors activity test (Fig. 3A).

[0114] As a result, as shown in FIGS. 3B and 3C, when the reporter and therapeutic gene scissors were co-transfected into the 293TA cell line, RG1 showed activity toward both normal and patient-derived base sequences, but RG2 showed a very large difference in gene scissors activity toward normal and patient-derived base sequences, and it was confirmed that it worked preferentially toward patient-derived base sequences. Therefore, it was found that RG2 will be very useful for gene correction treatment of the IMPDH1 NM_000883.3 c.947G>C (p.Arg316Pro) mutation.

[0115] In addition, in order to remove the IMPDH1 NM_000883.3 c.947G>C (p.Arg316Pro) mutation, induced pluripotent stem cells (iPSCs) derived from a retinitis pigmentosa patient with the mutation were established (Fig. 4A), and the activity of the genetic scissors in the iPSCs was analyzed. Specifically, RG2 of Example 1-2 was expressed via a lentivirus vector in normal and patient-derived iPSCs, and the function of RG2 was investigated. In addition, in order to quantitatively confirm the function, targeted deep-sequencing was performed on samples delivered with RG2.

[0116] As a result, as shown in Figures 4B and 4C, when the induction of indel mutations (insertion-deletion mutations) was confirmed through the T7E1 assay, it was confirmed that the RG2 absolutely acts only on the mutation rather than the normal. In addition, it was confirmed that the RG2 exhibits a low off-target effect of approximately 2-3% on the normal base sequence, and a high on-target activity of approximately 22% on the mutation.

[0117] [1-3] Discovery of gRNA

[0118] Furthermore, in the gRNA and CRISPR-Cas system utilizing the IMPDH1 mutation of the present invention, in addition to the two guide RNAs (RG1 and RG2) of Example 1-1, guide RNAs that can operate in the system of the present invention were additionally discovered. In Example 1-1, wild-type SpCas9 derived from Streptococcus pyogenes was used as the CRISPR-Cas gene scissors, but in the case of wild-type SpCas9, the protospacer-adjacent motif (PAM) sequence is always constrained to 5'-NGG-3'. However, when Cas9-SpRy (PAMless Cas9 variant), a mutant of SpCas9, is used, there is no restriction on the PAM, so that a large number of forward and reverse guide RNAs specific for the IMPDH1 mutation of the present invention can be designed, like the 40 types of guide RNAs. Specifically, 20 types of forward guide RNAs and 20 types of reverse guide RNAs targeting the gene range (45-bp) region of FIG. 1 were synthesized as guide RNAs that can be used for gene correction therapy using the system of the present invention. The target base sequences (5'→3') of the total 40 types of guide RNAs are shown in Table 1 below. At this time, PAM-less-forward-RG12 in Table 1 is identical to the target base sequence of RG1, and PAM-less-reverse-RG9 is identical to the target base sequence of RG2.

[0119]

[0120] Next, using the reporter system of Example 1-2, the gene scissors activity of the normal IMPDH1 and the IMPDH1 mutant base sequence of the present invention among the 40 guide RNAs of Table 1, PAM-less-forward-RG4-RG20 and PAM-less-reverse-RG7-RG20, was investigated. For the guide RNAs of Table 1, PAM-less-forward-RG1 to RG3 and PAM-less-reverse-RG1 to RG6, two new reporter vectors for the normal IMPDH1 and IMPDH1 mutant base sequences were constructed, and the gene activity of the guide RNAs was analyzed. Specifically, a new reporter vector containing the normal IMPDH1 base sequence was constructed by annealing two oligomers (pMRSv2-hIMPDH1WT-LF: ATTGCCGCACCGACCTGAAGAAGAACCGAGACTACCCTCTGGCCTCCAAGG (SEQ ID NO: 49) and pMRSv2-hIMPDH1WT-LR: CCAACCTTGGAGGCCAGAGGGTAGTCTCGGTTCTTCTTCAGGTCGGTGCGG (SEQ ID NO: 50)) having the normal IMPDH1 base sequence, and cloning them into the BsmBI restriction enzyme site of the pMRSv2 vector. A new reporter vector containing the IMPDH1 mutant base sequence was constructed by amplifying two PCR primers (hIMPDH1-R316P-F: cctctggcctccaaggTTggatccag (SEQ ID NO: 51) and hIMPDH1-R316P-R: gtagtctGggttcttcttcaggtcgg (SEQ ID NO: 52)) were produced using a PCR-based site-direct mutagenesis technique.In addition, in order to produce the above guide RNA expression vector, DNA oligomers of the guide RNA having the base sequences shown in Table 2 below were synthesized (SEQ ID NO: 53 to SEQ ID NO: 132), and these were cloned into the Lenti-guide-BSD vector capable of producing a lentivirus guide RNA expression vector. The Lenti-guide-BSD vector was produced by deleting the puromycin resistance gene of the Lenti-guide-puro (source: Addgene plasmid #52963) vector and inserting the blasticidin resistance gene instead in the position where the gene was deleted. At this time, the blasticidin resistance gene was derived from the LentiCas9-Blast vector (source: Addgene plasmid #52962), and the blasticidin resistance gene was amplified using the PCR primers Blast-BsiWI-F (5'-tccgtacggccaccATGGCCAAGCCTTTGTCTCA-3', SEQ ID NO: 133) and Blast-MluI-R (5'-tagacgcgtTTAGCCCTCCCACACATAAC-3', SEQ ID NO: 134), and then cloned using BsiWI and MluI restriction enzymes. After that, the reporter vector, pCMV-D10-Cas9-SpRy expression vector, and guide RNA expression vector were co-transfected into the 293TA cell line, and the fluorescence signals of mRFP and GFP expressed from the reporter gene were observed using a fluorescence microscope and a flow cytometer.

[0121] Forward strandReverse strandPrimer name sequence (5'->3')Primer name sequence (5'->3')hIMPDH1-R316P-PAM less-RG20-F-FCACC G cAGACTACCCTCTGGCCTCChIMPDH1-R316P-PAM less-RG20-R-FCACC G GGAGGCCAGAGGGTAGTCTghIMPDH1-R316P-PAM less-RG20-F-Raaac GGAGGCCAGAGGGTAGTCTg chIMPDH1-R316P-PAM less-RG20-R-Raaac cAGACTACCCTCTGGCCTCC chIMPDH1-R316P-PAM less-RG19-F-FCACC G CcAGACTACCCTCTGGCCTChIMPDH1-R316P-PAM less-RG19-R-FCACC G GAGGCCAGAGGGTAGTCTgGhIMPDH1-R316P-PAM less-RG19-F-Raaac GAGGCCAGAGGGTAGTCTgG chIMPDH1-R316P-PAM less-RG19-R-Raaac CcAGACTACCCTCTGGCCTC chIMPDH1-R316P-PAM less-RG18-F-FCACC G CCcAGACTACCCTCTGGCCThIMPDH1-R316P-PAM less-RG18-R-FCACC G AGGCCAGAGGGTAGTCTgGGhIMPDH1-R316P-PAM less-RG18-F-Raaac AGGCCAGAGGGTAGTCTgGG chIMPDH1-R316P-PAM less-RG18-R-Raaac CCcAGACTACCCTCTGGCCT chIMPDH1-R316P-PAM less-RG17-F-FCACC G ACCcAGACTACCCTCTGGCChIMPDH1-R316P-PAM less-RG17-R-FCACC G GGCCAGAGGGTAGTCTgGGThIMPDH1-R316P-PAM less-RG17-F-Raaac GGCCAGAGGGTAGTCTgGGT chIMPDH1-R316P-PAMless-RG17-R-RaaacACCcAGACTACCCTCTGGCC chIMPDH1-R316P-PAM less-RG16-F-FCACC G AACCcAGACTACCCTCTGGChIMPDH1-R316P-PAM less-RG16-R-FCACC G GCCAGAGGGTAGTCTgGGTThIMPDH1-R316P-PAM less-RG16-F-Raaac GCCAGAGGGTAGTCTgGGTT chIMPDH1-R316P-PAM less-RG16-R-Raaac AACCcAGACTACCCTCTGGC chIMPDH1-R316P-PAM less-RG15-F-FCACC G GAACCcAGACTACCCTCTGGhIMPDH1-R316P-PAM less-RG15-R-FCACC G CCAGAGGGTAGTCTgGGTTChIMPDH1-R316P-PAM less-RG15-F-Raaac CCAGAGGGTAGTCTgGGTTC chIMPDH1-R316P-PAM less-RG15-R-Raaac GAACCcAGACTACCCTCTGG chIMPDH1-R316P-PAM less-RG14-F-FCACC G AGAACCcAGACTACCCTCTGhIMPDH1-R316P-PAM less-RG14-R-FCACC G CAGAGGGTAGTCTgGGTTCThIMPDH1-R316P-PAM less-RG14-F-Raaac CAGAGGGTAGTCTgGGTTCT chIMPDH1-R316P-PAM less-RG14-R-Raaac AGAACCcAGACTACCCTCTG chIMPDH1-R316P-PAM less-RG13-F-FCACC G AAGAACCcAGACTACCCTCThIMPDH1-R316P-PAM less-RG13-R-FCACC G AGAGGGTAGTCTgGGTTCTThIMPDH1-R316P-PAM less-RG13-F-Raaac AGAGGGTAGTCTgGGTTCTT chIMPDH1-R316P-PAM less-RG13-R-Raaac AAGAACCcAGACTACCCTCT chIMPDH1-R316P-PAM less-RG12-F-FCACC GGAAGAACCcAGACTACCCTChIMPDH1-R316P-PAM less-RG12-R-FCACC G GAGGGTAGTCTgGGTTCTTChIMPDH1-R316P-PAM less-RG12-F-Raaac GAGGGTAGTCTgGGTTCTTC chIMPDH1-R316P-PAM less-RG12-R-Raaac GAAGAACCcAGACTACCCTC chIMPDH1-R316P-PAM less-RG11-F-FCACC G AGAAGAACCcAGACTACCCThIMPDH1-R316P-PAM less-RG11-R-FCACC G AGGGTAGTCTgGGTTCTTCThIMPDH1-R316P-PAM less-RG11-F-Raaac AGGGTAGTCTgGGTTCTTCT chIMPDH1-R316P-PAM less-RG11-R-Raaac AGAAGAACCcAGACTACCCT chIMPDH1-R316P-PAM less-RG10-F-FCACC G AAGAAGAACCcAGACTACCCChIMPDH1-R316P-PAM less-RG10-R-FCACC G GGGTAGTCTgGGTTCTTCTTThIMPDH1-R316P-PAM less-RG10-F-Raaac GGGTAGTCTgGGTTCTTCTT chIMPDH1-R316P-PAM less-RG10-R-Raaac AAGAAGAACCcAGACTACCC chIMPDH1-R316P-PAM less-RG9-F-FCACC G GAAGAAGAACCCcAGACTACChIMPDH1-R316P-PAM less-RG9-R-FCACC G GGTAGTCTgGGTTCTTCTTChIMPDH1-R316P-PAM less-RG9-F-Raaac GGTAGTCTgGGTTCTTCTTCHchIMPDH1-R316P-PAM less-RG9-F-Raaac GGTAGTCTgGGTTCTTCTTCH chIMPDH1-R316P-PAM less-RG9-R-Raaac GAAGAAGAACCcAGACTACC chIMPDH1-R316P-PAM less-RG8-F-FCACC G TGAAGAAGAACCcAGACTAChIMPDH1-R316P-PAM less-RG8-R-FCACC GGTAGTCTgGGTTCTTCTTCAhIMPDH1-R316P-PAM less-RG8-F-Raaac GTAGTCTgGGTTCTTCTTCA chIMPDH1-R316P-PAM less-RG8-R-Raaac TGAAGAAGAACCcAGACTAC chIMPDH1-R316P-PAM less-RG7-F-FCACC G CTGAAGAAGAACCcAGACTAhIMPDH1-R316P-PAM less-RG7-R-FCACC G TAGTCTgGGTTCTTCTTCAGhIMPDH1-R316P-PAM less-RG7-F-Raaac TAGTCTgGGTTCTTCTTCAG chIMPDH1-R316P-PAM less-RG7-R-Raaac CTGAAGAAGAACCcAGACTA chIMPDH1-R316P-PAM less-RG6-F-FCACC G CCTGAAGAAGAACCcAGACThIMPDH1-R316P-PAM less-RG6-R-FCACC G AGTCTgGGTTCTTCTTCAGGhIMPDH1-R316P-PAM less-RG6-F-Raaac AGTCTgGGTTCTTCTTCAGG chIMPDH1-R316P-PAM less-RG6-R-Raaac CCTGAAGAAGAACCcAGACT chIMPDH1-R316P-PAM less-RG5-F-FCACC G ACCTGAAGAAGAACCcAGAChIMPDH1-R316P-PAM less-RG5-R-FCACC G GTCTgGGTTCTTCTTCAGGThIMPDH1-R316P-PAM less-RG5-F-Raaac GTCTgGGTTCTTCTTCAGGT chIMPDH1-R316P-PAM less-RG5-R-Raaac ACCTGAAGAAGAACCcAGAC chIMPDH1-R316P-PAM less-RG4-F-FCACC G GACCTGAAGAAGAACCcAGAhIMPDH1-R316P-PAM less-RG4-R-FCACC G TCTgGGTTCTTCTTCAGGTChIMPDH1-R316P-PAM less-RG4-F-Raaac TCTgGGTTCTTCTTCAGGTCchIMPDH1-R316P-PAM less-RG4-R-Raaac GACCTGAAGAAGAACCcAGA chIMPDH1-R316P-PAM less-RG3-F-FCACC G CGACCTGAAGAAGAACCcAGhIMPDH1-R316P-PAM less-RG3-R-FCACC G CTgGGTTCTTCTTCAGGTCGhIMPDH1-R316P-PAM less-RG3-F-Raaac ctGggttcttcttcaggtcg chIMPDH1-R316P-PAM less-RG3-R-Raaac cgacctgaagaagaaccCag chIMPDH1-R316P-PAM less-RG2-F-FCACC G CCGACCTGAAGAAGAACCcAhIMPDH1-R316P-PAM less-RG2-R-FCACC G TgGGTTCTTCTTCAGGTCGGhIMPDH1-R316P-PAM less-RG2-F-Raaac tGggttcttcttcaggtcgg chIMPDH1-R316P-PAM less-RG2-R-Raaac ccgacctgaagaagaaccCa chIMPDH1-R316P-PAM less-RG1-F-FCACC G ACCGACCTGAAGAAGAACCchIMPDH1-R316P-PAM less-RG1-R-FCACC G gGGTTCTTCTTCAGGTCGGThIMPDH1-R316P-PAM less-RG1-F-Raaac Gggttcttcttcaggtcggt chIMPDH1-R316P-PAM less-RG1-R-Raaac accgacctgaagaagaaccC c

[0122] As a result, as shown in FIGS. 5 and 6, the 40 types of guide RNAs were confirmed to exhibit high non-specificity for the normal IMPDH1 base sequence, while exhibiting high gene-editing activity only for the IMPDH1 mutant base sequence of the present invention. It was confirmed that the guide RNAs of PAM-less-forward-RG4 to PAM-less-forward-RG7 and PAM-less-reverse-RG17 to PAM-less-reverse-RG18 had particularly excellent gene-editing activity specific to the IMPDH1 mutant base sequence. Accordingly, the 40 types of guide RNAs that maintained high gene-editing activity only for the IMPDH1 mutant base sequence, while exhibiting lower gene-editing activity for the normal base sequence, were identified as guide RNAs that function in the CRISPR-Cas system of the present invention.

[0123]

[0124] [Example 2]

[0125] Confirmation of the effect of gene therapy using the gRNA and CRISPR-Cas system of the present invention

[0126] As a proof-of-concept experiment to determine the effect in the actual retina, after obtaining fertilized eggs derived from an existing patient-mimetic animal model of retinitis pigmentosa (Korean Patent Application No. 10-2023-0074425), founder mice with a disrupted patient-derived IMPDH1 mutant base sequence were produced by microinjecting the gene scissors for gene correction therapy and the RG2 in the same manner as in the production of the existing model (founder mice #14 to #27). To confirm the genomic information of the founder mice, heteroduplex DNA was formed and polyacrylamide gel electrophoresis (PAGE) was performed. In addition, Sanger sequencing was performed on founder mice #20 and #26, and the PCR products were cloned and subjected to the Sanger sequencing. Additionally, mosaicism in the founder mice was assessed through targeted deep-sequencing.

[0127] As a result, as shown in Fig. 7A, founder mice with the patient-derived mutations of #20 and #26 were produced. Genome sequencing of the mice showed that the #20 founder mouse had a frameshift mutation with a 4-bp deletion, as shown in Fig. 7B, and that the #26 founder mouse had two deletions, one of 1 bp and one of 6 bp. In addition, as shown in Fig. 7C, targeted deep-sequencing confirmed that 36.8% and 20.6% of the patient-derived mutations were destroyed in the #20 and #26 founder mice, respectively.

[0128] Next, we investigated whether disruption of the above mutation could be effective in treating retinitis pigmentosa. First, optical coherence tomography (OCT) was performed on homozygous and heterozygous mouse models carrying the mutation derived from retinitis pigmentosa patients and the founder mouse model.

[0129] As a result, as shown in Fig. 8, in the homozygous and heterozygous mouse models having the patient-derived mutation, the overall retinal thickness was thin, the thickness of the outer nuclear layer (ONL) in the retina where photoreceptors exist was reduced or lost, and in the fundus examination, the blood flow in the retinal blood vessels around the optic nerve was observed to be reduced and the overall blood vessel thickness was observed to be reduced. On the other hand, the #20 founder mouse in which the patient-derived mutation was destroyed showed a normal retinal interlayer structure in the OCT examination, just like a normal individual, and there was no finding of a defect in the photoreceptor layer. In the fundus photograph, it was confirmed that the blood flow in the retinal blood vessels around the optic nerve and the shape and course of the retinal blood vessels showed a pattern similar to that of a normal individual.

[0130] Through the experimental results of the above Example 2, it was confirmed that when the patient-derived mutation was destroyed using gene scissors, retinal damage in a mouse model caused by the IMPDH1 mutation derived from the retinitis pigmentosa patient was blocked, thereby having a therapeutic effect on retinitis pigmentosa.

[0131]

[0132] Although representative embodiments of the present invention have been described above as examples, the scope of the present invention is not limited to the specific embodiments described above, and those skilled in the art will be able to make appropriate changes within the scope described in the claims of the present application.

Claims

1. A pharmaceutical composition for preventing or treating retinitis pigmentosa, comprising an agent that induces a deletion of IMPDH1 c.947G>C (p.Arg316Pro) mutation.

2. In claim 1, A pharmaceutical composition for preventing or treating retinitis pigmentosa, wherein the agent inducing the defect of the above IMPDH1 mutation utilizes a CRISPR-Cas system and a guide RNA (gRNA) that specifically binds to the above IMPDH1 mutation.

3. In claim 2, A pharmaceutical composition for preventing or treating retinitis pigmentosa, wherein the CRISPR-Cas system is CRISPR-Cas9.

4. In claim 3, The above CRISPR-Cas9 is a pharmaceutical composition for preventing or treating retinitis pigmentosa, wherein the CRISPR-Cas9 is Cas9 (SpCas9) derived from Streptococcus pyogenes or a mutant thereof.

5. In claim 2, A pharmaceutical composition for preventing or treating retinitis pigmentosa, wherein the guide RNA comprises any one base sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 8 to SEQ ID NO: 47, or a base sequence complementary thereto.

6. In claim 5, A pharmaceutical composition for preventing or treating retinitis pigmentosa, wherein the guide RNA comprises any one base sequence selected from the group consisting of SEQ ID NO: 11 to SEQ ID NO: 14, SEQ ID NO: 44, and SEQ ID NO: 45, or a base sequence complementary thereto.

7. In claim 5, A pharmaceutical composition for preventing or treating retinitis pigmentosa, wherein the complementary base sequence comprises any one base sequence selected from the group consisting of SEQ ID NO: 4 to SEQ ID NO:

7.

8. In claim 2, A pharmaceutical composition for preventing or treating retinitis pigmentosa, wherein the agent that induces a defect in the above IMPDH1 mutation is a vector containing the base sequence of the CRISPR-Cas and the guide RNA.

9. A method for preventing or treating retinitis pigmentosa, comprising the step of inducing a defect in the IMPDH1 c.947G>C (p.Arg316Pro) mutant gene in a patient with retinitis pigmentosa.

10. In claim 9, A method for preventing or treating retinitis pigmentosa, wherein the step of inducing a defect in the above IMPDH1 mutation is a step of introducing a CRISPR-Cas system and a guide RNA (gRNA) that specifically binds to the IMPDH1 mutation into the patient.

11. In claim 10, A method for preventing or treating retinitis pigmentosa, wherein the introduction is performed via a vector containing the base sequence of the CRISPR-Cas and the guide RNA.

12. In claim 10, The above introduction is a method for preventing or treating retinitis pigmentosa by microinjecting the base sequence of the CRISPR-Cas and the guide RNA.

13. A composition for diagnosing or predicting retinitis pigmentosa, comprising an agent for detecting an IMPDH1 c.947G>C (p.Arg316Pro) mutant gene or a protein expressed from the mutant gene.

14. In claim 13, A composition for diagnosing or predicting retinitis pigmentosa, wherein the agent detecting the above mutant gene is a probe or primer.

15. In claim 14, A composition for diagnosing or predicting retinitis pigmentosa, wherein the agent for detecting the mutant gene comprises any one base sequence selected from the group consisting of SEQ ID NO: 11 to SEQ ID NO: 14, SEQ ID NO: 44, and SEQ ID NO: 45, or a base sequence complementary thereto.

16. In claim 13, A composition for diagnosing or predicting retinitis pigmentosa, wherein the agent detecting the above protein is an antibody or an aptamer.

17. A method for providing information for diagnosing or predicting retinitis pigmentosa, comprising the step of detecting an IMPDH1 c.947G>C (p.Arg316Pro) mutation in a biological sample isolated from an individual.

18. In claim 17, A method for providing information for diagnosing or predicting retinitis pigmentosa, wherein the detecting step is performed by at least one method selected from the group consisting of sequencing, genotyping, whole exome sequencing, microarray hybridization, allele specific PCR, dynamic allele-specific hybridization, PCR extension analysis, and Taqman technique.

Images