Disruption of ets1 and rbpj in t cells to enhance immunotherapy
Patent Information
- Application Number
- PCT/US2024/055492
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-13
- Filing Date
- 2024-11-12
- Publication Date
- 2025-07-31
AI Technical Summary
Current immunotherapies, such as adoptive cell therapy and immune checkpoint blockade, face limitations due to the poor persistence and proliferative capacity of T cells in the tumor microenvironment, particularly with exhausted T cells being unresponsive to existing treatments.
Modifying immune effector cells, specifically reducing or eliminating the expression and function of ETS1 and RBPJ genes, to enhance their anti-tumor effects. This modification can be achieved through methods such as site-specific nuclease activity or RNA interference, resulting in cells like CD8+ T cells with enhanced capabilities.
The modified immune effector cells demonstrate improved anti-tumor effects by enhancing the differentiation of precursor exhausted T cells to intermediate and terminal exhausted T cells, thereby boosting their proliferative capacity and responsiveness to immunotherapies.
Abstract
Description
Attorney Docket No: 243734.000206 DISRUPTION OF ETS1 AND RBPJ IN T CELLS TO ENHANCE IMMUNOTHERAPY CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Application No.63 / 598,472 filed, November 13, 2023, the disclosure of which is herein incorporated by reference in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under Grant No. CA253188 awarded by National Institutes of Health (NIH). The government has certain rights in the invention. SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on September 25, 2024, is named 243734_000206_SL.xml and is 1,127,941 bytes in size. FIELD
[0004] The application relates to modified immune effector cells with enhanced anti-tumor effects, as well as related pharmaceutical compositions. The application further relates to methods for generating the modified immune effector cells and methods for using the modified immune effector cells for treatment of diseases (e.g., adoptive cell therapy). BACKGROUND
[0005] Immunotherapies such as adoptive cell therapy (ACT) and immune checkpoint blockade (ICB) represent powerful approaches in combating cancer (8). However, poor persistence and proliferative capacity of T cells in the tumor microenvironment (TME) limit immunotherapeutic efficacy (8). Further, although exhausted T (Tex) cells are the major intratumoral cytotoxic T cell (CTL) population and directly kill tumors, they gradually lose proliferative capacity and unlike precursor exhausted T (Tpex) cells, are unresponsive to existing immunotherapies (5-7,9). Thus, there is an urgent need to systemically interrogate the regulatory circuitry underlying Tpex to Tex cell differentiation and identify strategies to functionally reinvigorate Tex cells. Generally, there exists a need in the art for developing improved T cell therapy. This need can be met with modified immune effector cells with enhanced anti-tumor effects as disclosed herein. 1 304098633v1Attorney Docket No: 243734.000206 SUMMARY
[0006] As specified in the Background section above, there is a great need in the art for modified immune effector cells with enhanced immune cell functions (e.g., enhanced anti- tumor effects) for use in cell therapy for cancer. The present application addresses these and other needs.
[0007] In one aspect, provided herein is a modified immune effector cell, wherein an E26 avian leukemia oncogene 1 (ETS1) gene or gene product is modified in the cell so that the expression and / or function of ETS1 in the cell is reduced or eliminated.
[0008] In some embodiments, the level of functional ETS1 protein in the cell is reduced by 50% or more.
[0009] In some embodiments, the ETS1 gene is deleted so that no detectable functional ETS1 protein is produced.
[0010] In another aspect, provided herein is a modified immune effector cell, wherein a recombination signal binding protein for immunoglobulin kappa J region (RBPJ) gene or gene product is modified in the cell so that the expression and / or function of RBPJ in the cell is reduced or eliminated.
[0011] In some embodiments, the level of functional RBPJ protein in the cell is reduced by 50% or more.
[0012] In some embodiments, the RBPJ gene is deleted so that no detectable functional RBPJ protein is produced.
[0013] In another aspect, provided herein is a modified immune effector cell, wherein an ETS1 gene and a RBPJ gene or their gene products are modified in the cell so that the expression and / or function of ETS1 gene and RBPJ gene in the cell is reduced or eliminated.
[0014] In some embodiments, the level of functional ETS1 protein and / or functional RBPJ protein in the cell is reduced by 50% or more.
[0015] In some embodiments, the ETS1 gene and / or the RBPJ gene is deleted so that no detectable functional ETS1 protein and / or RBPJ protein is produced.
[0016] In some embodiments, the immune effector cell is a T cell.
[0017] In some embodiments, the T cell is a CD8+T cell.
[0018] In some embodiments, the cell further comprises at least one surface molecule capable of binding specifically to an antigen.
[0019] In some embodiments, the antigen is a tumor antigen. 2 304098633v1Attorney Docket No: 243734.000206
[0020] In some embodiments, the tumor antigen is programmed cell death-ligand 1 (PD-L1), human epidermal growth factor receptor 2 (HER2), interleukin-13 receptor subunit alpha-2 (IL13Rα2), erythropoietin-producing human hepatocellular receptor A2 (EphA2), B7 homolog 3 protein (B7-H3), cluster of differentiation (CD) 19 (CD19), CD22, CD123, or GD2.
[0021] In some embodiments, the cell further comprises a chimeric antigen receptor (CAR), an antigen-specific T-cell receptor (TCR), or a bispecific antibody.
[0022] In some embodiments, the cell further comprises a CAR.
[0023] In some embodiments, the immune effector cell has been activated and / or expanded ex vivo.
[0024] In some embodiments, the immune effector cell is an allogeneic cell.
[0025] In some embodiments, the immune effector cell is an autologous cell.
[0026] In some embodiments, the immune effector cell is isolated from a healthy subject or a subject having a disease.
[0027] In some embodiments, the disease is a cancer.
[0028] In some embodiments, the immune effector cell is derived from a blood, marrow, tissue, or a tumor sample.
[0029] In another aspect, provided herein is a pharmaceutical composition comprising a modified immune effector cell described herein and a pharmaceutically acceptable carrier and / or excipient.
[0030] In another aspect, provided herein is a method for generating a modified immune effector cell described herein, the method comprising modifying an ETS1 gene or gene product in the cell so that the expression and / or function of the gene(s) in the cell is reduced or eliminated.
[0031] In another aspect, provided herein is a method for generating a modified immune effector cell described herein, the method comprising modifying a RBPJ gene or gene product in the cell so that the expression and / or function of the gene(s) in the cell is reduced or eliminated.
[0032] In another aspect, provided herein is a method for generating a modified immune effector cell described herein, the method comprising modifying an ETS1 gene or gene product and a RBPJ gene or gene product in the cell so that the expression and / or function of the genes in the cell is reduced or eliminated.
[0033] In another aspect, provided herein is a method of improving an anti-tumor effect of an immune effector cell, the method comprising modifying 1) an ETS1 gene or gene product, 2) a RBPJ gene or gene product, or 3) an ETS1 gene or gene product and a RBPJ gene or gene 3 304098633v1Attorney Docket No: 243734.000206 product in the cell so that the expression and / or function of the gene(s) in the cell is reduced or eliminated.
[0034] In some embodiments of the above-described methods, the immune effector cell is a T cell.
[0035] In some embodiments of the above-described methods, the T cell is a CD8+T cell.
[0036] In another aspect, provided herein is a method of promoting differentiation of a precursor exhausted T cell (Tpex) to an intermediate exhausted T cell (Tex), the method comprising modifying an ETS1 gene or gene product in a T cell so that the expression and / or function of the gene(s) in the T cell is reduced or eliminated.
[0037] In another aspect, provided herein is a method of reprogramming an exhausted T cell (Tex) toward a proliferative state, the method comprising modifying a RBPJ gene or gene product in a T cell so that the expression and / or function of the gene(s) in the T cell is reduced or eliminated.
[0038] In some embodiments, the method further comprises modifying the immune effector cell to express a chimeric antigen receptor (CAR) that is capable of binding to an antigen.
[0039] In some embodiments, the gene in the immune effector cell is modified as a result of an activity of a site-specific nuclease.
[0040] In some embodiments, the site-specific nuclease is an RNA-guided endonuclease.
[0041] In some embodiments, the RNA-guided endonuclease is a Cas9 protein, Cpf1 (Cas12a) protein, C2c1 protein, C2c3 protein, or C2c2 protein.
[0042] In some embodiments, the RNA-guided endonuclease is a Cas9 protein.
[0043] In some embodiments, the site-specific nuclease is a zinc finger nuclease, a TALEN nuclease, or mega-TALEN nuclease.
[0044] In some embodiments, the ETS1 gene product in the immune effector cell is modified as a result of an activity of an RNA interference (RNAi) molecule or an antisense oligonucleotide.
[0045] In some embodiments, the RBPJ gene product in the immune effector cell is modified as a result of an activity of an RNA interference (RNAi) molecule or an antisense oligonucleotide.
[0046] In some embodiments, the RNAi molecule is a small interfering RNA (siRNA) or a small hairpin RNA (shRNA). 4 304098633v1Attorney Docket No: 243734.000206
[0047] In some embodiments, the site-specific nuclease, the RNAi molecule, or the antisense oligonucleotide is introduced into the immune effector cell using a viral vector, a non-viral vector, or by physical means.
[0048] In some embodiments, the CAR is expressed from a transgene introduced into the immune effector cell.
[0049] In some embodiments, the CAR-expressing transgene is introduced into the immune effector cell using a viral vector, a non-viral vector, or by physical means.
[0050] In some embodiments, the viral vector is a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a herpes viral vector, or a baculoviral vector.
[0051] In some embodiments, the viral vector is a retroviral vector.
[0052] In some embodiments, the non-viral vector is a transposon.
[0053] In some embodiments, the transposon is a sleeping beauty transposon or PiggyBac transposon.
[0054] In some embodiments, the physical means is electroporation, microinjection, magnetofection, ultrasound, a ballistic or hydrodynamic method, or a combination thereof.
[0055] In some embodiments, the modified immune effector cell is activated and / or expanded ex vivo.
[0056] In another aspect, provided herein is a method of treating a disease in a subject in need thereof, the method comprising administering to the subject an effective amount of a modified immune effector cell described herein or a pharmaceutical composition described herein.
[0057] In another aspect, provided herein is a method of boosting a response to an immune checkpoint blockade therapy in a subject having a disease, the method comprising administering to the subject an effective amount of a modified immune effector cell described herein or a pharmaceutical composition described herein.
[0058] In some embodiments, the modified immune effector cell is an autologous cell.
[0059] In some embodiments, the modified immune effector cell is an allogeneic cell.
[0060] In some embodiments, the disease is a cancer.
[0061] In some embodiments, the cancer is a solid tumor.
[0062] In some embodiments, the cancer is a hematologic cancer.
[0063] In some embodiments, the method comprises: (i) isolating an immune effector cell from the subject or a donor; 5 304098633v1Attorney Docket No: 243734.000206 (ii) modifying a gene or gene product in the immune effector cell so that the expression and / or function of the gene in the cell is reduced or eliminated; and (iii) introducing the modified immune effector cell into the subject, wherein the gene is ETS1 gene or RBPJ gene or combination thereof.
[0064] In some embodiments, the method further comprises modifying the immune effector cell to express a chimeric antigen receptor (CAR) that is capable of binding specifically to an antigen.
[0065] In some embodiments, the subject is a human or a mouse. In some embodiments, the subject is a human.
[0066] In some embodiments, the method comprises administering to the subject an immune checkpoint blockade therapy.
[0067] In some embodiments, the immune checkpoint blockade therapy comprises an anti-PD-1 agent, an anti-PD-L1 agent, an anti-CTLA-4 agent, anti-LAG3 agent, anti-TIM3 agent, anti-TIGIT agent, anti-CD28 agent, or an anti-ICOS agent, or a combination thereof.
[0068] In another aspect, provided herein is a guide RNA (gRNA) targeting an ETS1 gene comprising a nucleotide sequence of SEQ ID NO: 2 (CAUCACCCAGUCCCGGACGU).
[0069] In some embodiments, provided herein is a guide RNA (gRNA) targeting a RBPJ gene comprising a nucleotide sequence of SEQ ID NO: 4 (UGCAGUGGACGACGACGAGU) or SEQ ID NO: 6 (GAGGAGGGCAAAAAAAUCUG).
[0070] In some embodiments, provided herein is a ribonucleoprotein complex comprising a gRNA described herein and a Cas9 protein.
[0071] In another aspect, provided herein is a retrovirus-based single-cell CRISPR screen to discover genes regulating a T cell response and an anti-tumor function in vivo. BRIEF DESCRIPTION OF THE DRAWINGS
[0072] Figures 1A-1D show that the in vivo single-cell clustered regularly interspaced short palindromic repeats (scCRISPR) screening of intratumoral CD8+cytotoxic T cells (CTLs) reveals connectivity of co-functional modules and gene programs. Figure 1A shows the relative ratio (log2FC(fold-change)) of cells with gene-level perturbation versus single guide RNA non-targeting control (sgNTC) cells. Vertical line signifies the transcription factors (TFs) excluded for initial network analyses. Nine co-functional perturbation modules and four co- regulated gene programs were identified through hierarchical clustering based on transcriptional changes of each perturbation. Figure 1B shows a representation of regulatory 6 304098633v1Attorney Docket No: 243734.000206 connections between the six major modules and the four co-regulated gene programs (programs A-D). Figure 1C shows a pseudotime analysis of the developmental trajectory of Tpex1, Tpex2, Tex1, and Tex2 among Tox+cells. Figure 1D shows the relative expression of cell state-associated genes (Tcf7, Slamf6, Myc, Sell, Bach2, Havcr2, Pdcd1, Entpd1, Cd38, Cd244a, Cx3cr1, Cxcr6, Mki67 and Ifng). Among the four cell states, Tpex1 cells showed the highest expression of Tcf7, Slamf6, Myc, Sell and Bach2. Tex2 cells showed the highest expression of Havcr2, Entpd1, Cd38, Cd244a and Cxcr6, but reduced expression of Mki67 and Ifng, compared to Tex1 cells.
[0073] Figures 2A-2H show that IKAROS promotes quiescence exit of Tpex1 cells. Figures 2A-2B show results from co-transferr of sgNTC (n = 4) or sgIkzf1 (n = 8) OT-I cells with sgNTC-expressing (‘spike’) cells (dual-color transfer system) to B16-OVA tumour-bearing mice. Relative frequency (normalized to ‘spike’) and number (per gram of tumour tissue) of OT-I cells (Figure 2A) and Tpex and Tex in OT-I cells (Figure 2B) are shown. Figure 2C shows pseudotime inference of cell states from single-cell RNA sequencing (scRNA-seq) analysis of sgNTC and sgIkzf1 OT-I cells. Figures 2D-2E show the relative (normalized to ‘spike’) geometric mean fluorescence intensities (gMFIs) of indicated markers (Figure 2D) or relative frequency of BrdU+(Figure 2E) cells (dual-colour transfer system). n = 7 for sgNTC and 8 for sgIkzf1 in Figure 2D and n = 5 per group in Figure 2E. Figure 2F shows B16-OVA tumour-bearing mice that received sgNTC or sgIkzf1 OT-I cells were treated with anti-PD-L1 or isotype control (n = 6 per group). Frequencies of indicated subsets are shown. Figures 2G- 2H shows the relative frequency of Tpex cells (Figure 2G) or Tpex versus Tex ratio (Figure 2H) of sgNTC (n = 4), sgIkzf1 (n = 4), sgTcf7 (n = 5), or sgIkzf1 + Tcf7 (n = 6) OT-I cells (dual- colour transfer system). Data are representative of three (Figures 2A, 2B, 2D), two (Figures 2E, 2G, 2H) or one (Figure 2F) independent experiment(s). NS = not significant; **P < 0.01 and ***P < 0.001; two-tailed unpaired Student’s t-test (Figures 2A, 2B, 2D, 2E) or one-way ANOVA (Figures 2F, 2G, 2H). Data are presented as mean ± SEM.
[0074] Figures 3A-3M show ETS1 is a gatekeeper for the Tpex to Tex1 cell transition. Figures 3A-3B show the relative frequency and number of indicated intratumoral OT-I cell populations (n = 7 per group). Figures 3C-3D show the relative frequencies of GZMB+and IFN^+(n = 7 for sgNTC and n = 6 for sgEts1) (Figure 3C) or Ki67+OT-I populations (n = 5 for sgNTC and 6 for sgEts1) (Figure 3D). Figure 3E shows the numbers of total, Tpex, and Tex OT-I cells after Tpex (n = 9 per group) and Tex (n = 6 per group) secondary transfer. N / D = not detected. Figure 3F shows B16-OVA tumour growth with sgNTC or sgEts1 OT-I cell 7 304098633v1Attorney Docket No: 243734.000206 treatment. Figure 3G shows B16-F10 tumour growth with sgNTC or sgEts1 pmel cell treatment. Figure 3H shows B16-hCD19 tumour growth with sgNTC or sgEts1 hCD19 CAR T cell treatment. Figure 3I shows B16-OVA tumour growth with indicated treatments. Figure 3J shows ETS1 and IFNG expression in memory, exhausted, and activated CD8+T cells from basal cell carcinoma (BCC) patients. Figure 3K shows TF motif enrichment analysis (n = 4 per group). Figure 3L shows the relative frequency and number of sgNTC (n = 3), sgEts1 (n = 5), sgBatf (n = 5), or sgEts1 + Batf (n = 5) Tex cells. Figure 3M shows the relative frequencies of GZMB+, IFN^+(n = 5 for sgNTC, 6 for sgEts1 or sgEts1 + Batf, and 7 for sgBatf) and Ki67+(n = 3 for sgNTC, 5 for sgEts1, sgBatf and sgEts1 + Batf) OT-I cells. Data are representative of three (Figures 3A-D, 3F), two (Figures 3E, 3G, 3H, 3L, 3M) or one (Figure 3I) independent experiment(s). NS = not significant; *P < 0.05, **P < 0.01, and ***P < 0.001; two-tailed unpaired Student’s t-test (Figures 3A-3D), two-tailed paired Student’s t-test (Figure 3E), two-way ANOVA (Figures 3F-3I), two-tailed Wilcoxon rank sum test (Figure 3J) or one-way ANOVA (Figures 3L, 3M). Data are presented as mean ± SEM.
[0075] Figures 4A-4H show RBPJ drives Tex1 to Tex2 cell differentiation. Figures 4A-4B show the relative frequency and number of OT-I cells (n = 6 for sgNTC and 7 for sgRbpj) (Figure 4A) or their Tpex and Tex subsets (n = 7 for sgNTC and 10 for sgRbpj) (Figure 4B) (dual-colour transfer system). Figure 4C shows the relative frequencies of Ki67+(n = 7 for sgNTC and 10 for sgRbpj; left) and BrdU+(n = 5 for sgNTC and 6 for sgRbpj; right) cells among indicated subsets. Figure 4D shows sgNTC or sgRbpj OT-I cells were individually transferred to B16-OVA tumour-bearing mice. Frequency and number of OT-I cells on day 7 after adoptive transfer are shown (n = 6 for sgNTC and 4 for sgRbpj). Figure 4E shows RBPJ expression in OT-I cells from spleen (n = 4) or tdLN (n = 5) and Tpex or Tex OT-I cells from B16-OVA tumours (n = 5), or naïve endogenous splenic CD8+T cells (n = 4). Figures 4F-4G show the numbers of total, Tpex, and Tex OT-I cells (Figure 4F) and CellTrace Violet (CTV) levels after Tex secondary transfer (Figure 4G) (n = 5 per group). Figure 4H shows the relative frequencies of indicated cell states (dual-colour transfer system) (n = 6 for sgNTC and 10 for sgRbpj). Data are representative of three (Figures 4A-4C, 4E-4G, 4H) or two (Figure 4D) independent experiments. NS = not significant; *P < 0.05, **P < 0.01, and ***P < 0.001; two- tailed unpaired Student’s t-test (Figures 4A-4D, 4H), one-way ANOVA (Figure 4E) or two- tailed paired Student’s t-test (Figures 4F, 4G). Data are presented as mean ± SEM.
[0076] Figures 5A-5K show RBPJ deficiency promotes CTL functional reinvigoration. Figure 5A shows numbers of GZMB+and IFN^+sgNTC or sgRbpj OT-I cells (n = 7 per group). 8 304098633v1Attorney Docket No: 243734.000206 Figure 5B shows B16-OVA tumour growth with sgNTC or sgRbpj OT-I cell treatment. Figure 5C shows B16-F10 tumour growth with sgNTC (same samples as Figure 3G) or sgRbpj pmel cell treatment. Figure 5D shows B16-OVA tumour growth with indicated treatments. Figure 5E shows B16-hCD19 tumour growth with sgNTC (same samples as Figure 3H) or sgRbpj hCD19-CAR T cell treatment. Figure 5F shows E.G7-OVA tumour growth with indicated treatments. Figure 5G shows TF motif enrichment analysis (n = 3 per group). Figures 5H-5I show the relative frequency of total (Figure 5H) or Tex (Figure 5I) cells transduced with indicated sgRNAs (n = 5 per group). Figures 5J-5K shows the relative frequencies of Ki67+(n = 5 per group) (Figure 5J) or GZMB+(n = 5 per group) and IFN^+(n = 5 for sgNTC or sgRbpj + Irf1, and 4 for sgRbpj and sgIrf1) OT-I cells (Figure 5K). Data are representative of three (Figures 5A, 5B, 5D, 5E), two (Figures 5C, 5H, 5I, 5J, 5K) or one (Figure 5F) independent experiment(s). NS = not significant; *P < 0.05, **P < 0.01, and ***P < 0.001; two-tailed unpaired Student’s t-test (Figure 5A), two-way ANOVA (Figures 5B-5F) or one- way ANOVA (Figures 5H, 5I, 5J, 5K). Data are presented as mean ± SEM.
[0077] Figures 6A-6D show scCRISPR screening and molecular diversity of intratumoral CTLs. Figure 6A shows a schematic of the dual sgRNA CRISPR knockout (KO) vector used for direct capture Perturb-seq. PS = protospacer sequence, TF.g1 = transcription factor (TF) guide RNA 1, TF.g2 = TF guide RNA 2, CR = constant region, CS = capture sequence, EFS = EF1^ short promoter. Figure 6B shows the bioinformatic approach that nominated the 180 TF targets in the direct capture Perturb-seq library (see methods described herein). DE = differential expression, DA = differentially accessibility of chromatin state, ME = motif enrichment. Figure 6C shows the activity scores of the curated Tpex-, Tex- and Teff- associated gene signatures among the Tpex, Tex, and Teff cells from the scCRISPR experiment. Figure 6D shows the fold-change (FC) / FC plot comparing transcriptomic profiles of Tex versus Tpex cells from the scCRISPR experiment (x-axis) with those from B16-OVA tumour-specific CD8+T cells (y-axis). r = Pearson correlation coefficient. ***P < 0.001; Two- tailed Wilcoxon rank sum test (Figure 6C), two-tailed unpaired Student’s t-test (Figure 6D). Data are presented as mean ± SEM.
[0078] Figures 7A-7H show the characterization of CTL differentiation states and identification of underlying drivers by scCRISPR screening. Figure 7A shows TOX, TCF-1, PD-1, and CD39 expression in intratumoral Tpex or Tex OT-I cells, or frequencies of Ki67+, IFN^+, GZMB+or TNF+cells among Tpex or Tex OT-I cells on days 7 (n = 5), 14 (n = 6), or 21 (n = 6) after adoptive transfer to B16-OVA tumour-bearing mice. Figure 7B shows the 9 304098633v1Attorney Docket No: 243734.000206 activity scores of indicated gene signatures in OT-I cell states. n = 6,202 (Tpex1), 3,246 (Tpex2), 7,695 (Tex1) or 8,631 (Tex2) cells examined over one independent experiment. The boxes stand for 25% to 75% interquartile range (IQR), and the whiskers stand for minimum (25% quantile – 1.5* IQR) to maximum (75% quantile + 1.5* IQR) values. Figures 7C-7G show analyses of indicated intraumoral Tpex or Tex populations or splenic naïve CD8+T cells. Frequency of pS6+cells (n = 5 for splenic naïve CD8+and 6 for Ki67–Tpex, Ki67+Tpex, Ki67+Tex, and Ki67–Tex) (Figure 7C), CD98 and CD71 expression (n = 6 per group) (Figure 7D), MitoTracker levels in cells (n = 6 per group) (Figure 7E), frequencies of GZMB+(n = 5 per group) and IFN^+(n = 6 per group) cells (Figure 7F), and T-bet and BATF expression (n = 4 for splenic naïve CD8+and 8 for Ki67–Tpex, Ki67+Tpex, Ki67+Tex, and Ki67–Tex) (Figure 7G) are shown. FMO = Fluorescence Minus One. Figure 7H shows Venn diagrams depicting the positive and negative transcriptional regulators of Tpex1 versus Tpex2 or Tex1 versus Tex2 states based on scCRISPR screening, with their discrete and overlapping distributions shown. Data are representative of one (Figure 7A), three (Figures 7C, 7D, 7F, 7G) or two (Figure 7E) independent experiment(s). NS = not significant; *P < 0.05, **P < 0.01, and ***P < 0.001; two-tailed unpaired Student’s t-test (Figure 7A), two-tailed Wilcoxon rank sum test (Figure 7B), or one-way ANOVA (Figures 7C-G). Data are presented as mean ± SEM.
[0079] Figures 8A-8Q show Ikzf1 deficiency promotes Tpex1 cell accumulation. Figure 8A shows IKAROS expression in total intratumoral sgNTC (n = 8) or sgIkzf1 (n = 9) OT-I cells (dual-colour transfer system). Figure 8B shows the relative frequencies and numbers of sgNTC (n = 4) and sgIkzf1 (n = 8) Tpex (TCF-1+TIM-3–) and Tex (TCF-1–TIM-3+) OT-I cells (dual- colour transfer system). Figures 8C-8D shows the relative frequencies and numbers of total (Figure 8C), Tpex, or Tex (Figure 8D) OT-I cells (dual-colour transfer system) from B16- OVA tumours that were analyzed on day 21 after adoptive transfer (n = 5 for sgNTC and 7 for sgIkzf1). Figure 8E shows numbers of OT-I cells in tdLN and spleen (dual-colour transfer system) on day 7 after adoptive transfer (n = 8 per group). Figure 8F shows relative frequencies of Ly108+TIM-3–cells among tdLN and splenic OT-I cells (dual colour-transfer system) (n = 6 for sgNTC and 8 for sgIkzf1). Figure 8G shows T-bet, BATF, RUNX3 and CX3CR1 expression in intratumoral OT-I cells (dual-colour transfer system) (n = 4 for sgNTC and 8 for sgIkzf1). Figure 8H shows relative frequencies of GZMB+and IFN^+OT-I cells (dual-colour transfer system) after cognate antigen (n = 7 for sgNTC and 8 for sgIkzf1) or PMA plus ionomycin (PMA + Iono) (n = 8 for sgNTC and 9 for sgIkzf1) stimulation ex vivo. Figure 8I shows a schematic for secondary Tpex cell transfer assay. Figure 8J shows frequencies and 10 304098633v1Attorney Docket No: 243734.000206 numbers of Tpex and Tex cells from Tpex secondary transfer assay (n = 7 per group). Figure 8K shows that pathway enrichment analysis reveals enrichment of metabolic pathway-related signatures among downregulated (DOWN) genes in sgIkzf1 Tpex cells versus sgNTC Tpex cells. Figure 8L shows the relative frequencies of Ki67+cells among total sgNTC (n = 7) or sgIkzf1 (n = 8) intratumoral OT-I cells and their Tpex and Tex subsets (dual-colour transfer system) on day 7 after adoptive transfer. Figure 8M shows the relative frequencies of Ki67+(n = 5 for sgNTC and 7 for sgIkzf1) and BrdU+(n = 5 for sgNTC and 6 for sgIkzf1) cells among indicated sgRNA-transduced intratumoral OT-I cell populations (dual-colour transfer system) on day 21 after adoptive transfer. Figure 8N shows the numbers of total intratumoral OT-I cells in mice given the indicated treatments (n = 5 for sgNTC OT-I + isotype, 4 for sgNTC OT- I + anti-PD-L1 and 6 for sgIkzf1 OT-I + isotype or sgIkzf1 OT-I + anti-PD-L1). Figure 8O shows B16-OVA tumour growth in mice that received sgNTC (n = 7) or sgIkzf1 (n = 6) OT-I cells (no cell transfer group, n = 4; left) and B16-OVA tumour growth in mice given the indicated treatments (n = 4 for no cell transfer, 8 for sgNTC OT-I + isotype, 7 for sgNTC OT- I + anti-PD-L1 and 9 for sgIkzf1 OT-I + isotype or sgIkzf1 OT-I + anti-PD-L1; right). Figure 8P shows a schematic for genetic interaction screening of sgRNA-transduced OT-I cells (e.g., sgNTC or sgIkzf1) (see methods as described herein) Figure 8Q shows sectored scatter plots of gene-level log2FC from sgNTC (x-axis) and sgIkzf1 (y-axis) OT-I cells in genetic interaction screening. The intratumoral Tpex versus Tex and Tpex versus input comparisons are shown, with Tcf7 highlighted. Data are representative of three (Figures 8A, 8B, 8E-G, 8L), one (Figures 8C, 8D, 8M, 8N) or two (Figures 8H, 8J, 8O) independent experiment(s). NS = not significant; *P < 0.05, **P < 0.01, and ***P < 0.001; two-tailed unpaired Student’s t-test (Figures 8A-8H, 8L, 8M), two-tailed paired Student’s t-test (Figure 8J), two-tailed Fisher’s exact test (Figure 8K), one-way ANOVA (Figure 8N) or two-way ANOVA (Figure 8O). Data are presented as mean ± SEM.
[0080] Figures 9A-9M show targeting Ets1 promotes Tex1 cell accumulation and antitumour immunity. Figure 9A shows gene set enrichment analysis (GSEA) reveals enrichment of indicated signatures among genes upregulated (UP) in Tex1 versus Tpex2 cells as profiled by scCRISPR screening. Figure 9B shows expression of Ets1 in indicated OT-I cell states. Figure 9C shows activity scores of the curated stemness-associated signatures in sgNTC and sgEts1 Tpex and Tex OT-I cells (from scRNA-seq analysis). Figure 9D shows GSEA reveals enrichment of indicated signatures in sgEts1 versus sgNTC total or Tex OT-I cells. Figure 9E shows relative expression of FSC-A, CD71 and CD98 in intratumoral OT-I cells (dual-colour transfer system) (n = 3 for sgNTC and 7 for sgEts1). Figures 9F-9G show relative 11 304098633v1Attorney Docket No: 243734.000206 frequencies and numbers of total (Figure 9F), Tpex, and Tex (Figure 9G) OT-I cells in B16- OVA tumours on day 21 after adoptive transfer (n = 5 for sgNTC and 7 for sgEts1). The same sgNTC OT-I cells are presented in Figures 8C, 8D. Figure 9H shows numbers of OT-I cells in tumor-draining lymph node (tdLN) and spleen on day 7 after adoptive transfer (n = 5 per group). Figure 9I shows frequencies of Ly108+TIM-3–OT-I cells in tdLN and spleen (n = 6 per group). The same sgNTC OT-I cells are presented in Figure 8F. Figure 9J shows relative expression of BATF, T-bet (n = 5 for sgNTC and 6 for sgEts1 for both BATF and T-bet), CX3CR1 (n = 7 per group), and CXCR6 (n = 7 per group) in intratumoral OT-I cells (dual- colour transfer system). Figure 9K shows relative frequencies of GZMB+and IFN^+OT-I cells (dual-colour transfer system) after PMA + Iono stimulation (n = 7 for sgNTC and 6 for sgEts1). Figure 9L shows relative frequencies of BrdU+cells among indicated intratumoral OT-I cell populations (dual-colour transfer system) (n = 4 for sgNTC and 5 for sgEts1) on day 7 after adoptive transfer. Figure 9M shows relative frequencies of Ki67+(n = 5 for sgNTC and 7 for sgEts1; left) and BrdU+(n = 5 for sgNTC and 6 for sgEts1; right) cells among intratumoral OT-I cell populations (dual-colour transfer system) on day 21 after adoptive transfer. The same sgNTC OT-I cells are presented in Figure 8M. Data are representative of three (Figures 9E, 9H, 9I-9K), one (Figures 9F, 9G, 9M), or two (Figure 9L) independent experiment(s). NS = not significant; *P < 0.05, **P < 0.01, and ***P < 0.001; two-tailed Kolmogorov–Smirnov test with false discovery rate (FDR) adjustments for multiple comparisons (Figures 9A, 9D), two-tailed Wilcoxon rank sum test (Figures 9B, 9C), or two-tailed unpaired Student’s t-test (Figures 9E-9M). Data are presented as mean ± SEM.
[0081] Figures 10A-10O show that the ETS1-BATF axis impinges upon Tpex to Tex cell transition. Figure 10A shows a schematic of Tpex or Tex secondary transfer assays. Figures 10B-10C show CellTrace Violet (CTV) levels in total intratumoral OT-I cells after Tpex (Figure 10B) or Tex (Figure 10C) secondary transfer (n = 9 per group for Tpex and 6 per group for Tex). Figure 10D shows E.G7-OVA tumour growth in mice given sgNTC (n = 8) or sgEts1 (n = 9) OT-I cells (no cell transfer, n = 4; left). LLC-OVA tumour growth in mice given sgNTC (n = 9) or sgEts1 (n = 10) OT-I cells (no cell transfer, n = 4; right). Figures 10E-10F show sgNTC (n = 6) or sgEts1 (n = 7) OT-I cells that were transferred to E.G7-OVA tumour- bearing mice (single-colour transfer system), showing the number of total intratumoral OT-I cell (Figure 10E) and frequencies and numbers of Tpex and Tex OT-I cells (Figure 10F). Figures 10G-10H show sgNTC (n = 5) or sgEts1 (n = 7) OT-I cells that were transferred to LLC-OVA tumour-bearing mice (single-colour transfer system), showing the number of total 12 304098633v1Attorney Docket No: 243734.000206 intratumoral OT-I cell (Figure 10G) and frequencies and numbers of Tpex and Tex OT-I cells (Figure 10H). Figure 10I shows E.G7-OVA tumour growth in mice given the indicated treatments (n = 3 for no cell transfer and 7 for all other groups). The same sgNTC OT-I + isotype and sgNTC + anti-PD-L1 groups are presented in Figure 5F. Figure 10J shows ETS1 expression in human intratumoral CD8+T cells before ICB (Pre-ICB) treatment in individuals with melanoma. Figure 10K shows ETS1 and IFNG expression in human CD8+T cell subsets from scRNA-seq analysis of T cells from patients with squamous cell carcinoma (SCC) pre- and post-anti-PD-1 treatments. Figure 10L shows TF motif enrichment analysis of differentially accessible chromatin regions in sgEts1 versus sgNTC Tpex cells by ATAC-seq (n = 4 per group). Figure 10M shows BATF expression in indicated intratumoral OT-I cell populations (dual-colour transfer system) (n = 5 for sgNTC and 6 for sgEts1). Figure 10N shows genetic interaction screen of sgEts1 and sgNTC-transduced OT-I cells (see methods described herein and similar schematic in Figure 8P). Sectored scatter plots show gene-level log2FC from sgNTC (x-axis) and sgEts1 (y-axis) OT-I cells in a genetic interaction screening. The intratumoral Tex versus Tpex and Tex versus input comparisons are shown, with Batf highlighted. Figure 10O shows the relative frequency and fold change of number of sgNTC (n = 3)-, sgEts1 (n = 5)-, sgBatf (n = 5)- or sgEts1 + Batf (n = 5)-transduced cells (dual-colour transfer system). Data are representative of two (Figures 10B-10D, 10O), one (Figures 10E- 10I) or three (Figure 10M) independent experiment(s). NS = not significant; *P < 0.05, **P < 0.01 and ***P < 0.001; two-tailed paired Student’s t-test (Figures 10B, 10C), two-way ANOVA (Figures 10D, 10I), two-tailed unpaired Student’s t-test (Figures 10E-10H, 10M), two-tailed Wilcoxon rank sum test (Figures 10J, 10K) or one-way ANOVA (Figure 10O). Data are presented as mean ± SEM.
[0082] Figures 11A-11J show Rbpj deficiency selectively promotes Tex cell accumulation. Figure 11A shows GSEA enrichment of hallmark gene signatures in sgRbpj versus sgNTC OT-I cells (based on gene expression in scCRISPR screening). Figure 11B shows immunoblot analysis of RBPJ expression in OT-I cells transduced with sgNTC or two individual sgRNAs targeting Rbpj (sgRbpj-#1 or sgRbpj-#2) cultured for four days. The numbers show abundance of RBPJ (normalized to ^-Actin) relative to that of sgNTC OT-I cells. Figure 11C shows the relative expression of RBPJ in sgNTC (n = 4) or sgRbpj (n = 5) intratumoral OT-I cells (dual- colour transfer system). Figure 11D shows number of OT-I cells in tdLN (n = 6 per group) and spleen (n = 7 per group). Figure 11E shows frequencies of Ly108+TIM-3–OT-I cells in tdLN and spleen (n = 6 for sgNTC and 7 for sgRbpj). The same sgNTC OT-I cells are presented in 13 304098633v1Attorney Docket No: 243734.000206 Figure 8F. Figure 11F shows flow cytometry analysis of intratumoral Tpex and Tex OT-I cells on day 7 after adoptive transfer (dual-colour transfer system). Figure 11G shows the relative frequencies and numbers of total intratumoral OT-I cells and their Tpex and Tex subsets (dual-colour transfer system) on day 21 after adoptive transfer (n = 5 for sgNTC and 7 for sgRbpj). The same sgNTC OT-I cells are presented in Figures 8C, 8D. Figure 11H shows the relative frequencies of active caspase-3+cells among intratumoral OT-I cells and their Tpex and Tex subsets (dual-colour transfer system) on day 7 after adoptive transfer (n = 7 for sgNTC and 10 for sgRbpj). Figure 11I shows the relative frequencies of Ki67+(n = 5 for sgNTC and 7 for sgRbpj; left) and BrdU+(n = 5 per group; right) cells among indicated intratumoral OT-I cell populations (dual-colour transfer system) on day 21 after adoptive transfer. The same sgNTC OT-I cells are presented in Figure 8M. Figure 11J shows the frequencies and numbers of Tpex and Tex OT-I cells after adoptive transfer to B16-OVA tumour-bearing mice (single- colour transfer system) (n = 6 for sgNTC and 4 for sgRbpj). Data are representative of two (Figures 11B, 11J), three (Figures 11C-11F, 11H) or one (Figures 11G, 11I) independent experiment(s). NS = not significant; *P < 0.05, **P < 0.01, and ***P < 0.001; two-tailed Kolmogorov–Smirnov test (Figure 11A), two-tailed unpaired Student’s t-test (Figures 11C- 11E, 11G-11J). Data are presented as mean ^ SEM.
[0083] Figures 12A-12E show RBPJ is expressed by, and mainly functions in, Tex cells. Figure 12A shows a schematic for Tpex-like and Tex-like cell generation in vitro. Figure 12B shows TIM-3 and Ly108 expression on freshly-isolated naïve (CD62L+CD44–) CD8+T cells (n = 2) from spleen or in vitro-derived Tpex-like (n = 6) and Tex-like (n = 6) cells. Figure 12C shows an immunoblot analysis of RBPJ protein expression in Tpex-like or Tex-like cells. The numbers show abundance of RBPJ (normalized to ^-Actin) relative to that of Tpex-like cells. Figure 12D shows a diagram of Tpex or Tex secondary transfer assays. Figure 12E shows the numbers of total intratumoral OT-I cells or their Tpex and Tex subsets in the Tpex secondary transfer assay (n = 7 per group). Data are representative of three (Figures 12B, 12E) or two (Figure 12C) independent experiments. NS = not significant; ***P < 0.001; two-tailed unpaired Student’s t-test (Figure 12B) or two-tailed paired Student’s t-test (Figure 12E). Data are presented as mean ± SEM.
[0084] Figures 13A-13T show RBPJ negatively correlates with immunotherapies in human cancers and suppresses antitumour immunity. Figure 13A shows RBPJ expression in human CD8+T cells from peripheral blood (blood), tumour-adjacent normal tissues (normal), and tumour tissues. Figure 13B shows HAVCR2, TCF7 and RBPJ expression in TCF7+HAVCR2–14 304098633v1Attorney Docket No: 243734.000206 and TCF7–HAVCR2+cells of human CD8+T cells from individuals with melanoma or hepatocellular carcinoma (HCC). Figure 13C shows a correlation matrix displaying the expression of RBPJ and genes associated with responsiveness to anti-PD-1 therapy. Kendall rank order correlations are displayed. Genes positively (+; including IL7R, SELL and TCF7) or negatively (–; including HOPX, LGALS1, VCAM1, RBPJ, SNAP47, CCL3, FASLG, MT2A, EPST11, GBP1, PSMB2, NDUFB3, CD38, GBP4, WARS, PRDX3) associated with response to anti-PD-1 blockade are indicated. Figure 13D shows differentially expressed genes in mutation-associated neoantigen (MANA)-specific T cells (derived from patients with non- small cell lung cancer (NSCLC)) with major pathologic response (MPR) compared to those without MPR (non-MPR). Figure 13E shows RBPJ expression in human CD8+T cell subsets (memory (mem), exhausted (ex), and activated (act)) from patients with BCC or SCC pre- and post-anti–PD-1 treatments. Figure 13F shows the expression of TOX, RBPJ, HAVCR2, ENTPD1, IFNG and GZMB from a public bulk RNA-seq dataset of human CAR T cells (46) at days 0, 16 and 28 after continuous antigen exposure (CAE) in vitro. The boxes stand for 25% to 75% interquartile range (IQR), and the whiskers stand for minimum (25% quantile – 1.5* IQR) to maximum (75% quantile + 1.5* IQR) values, and n = 4 biologically independent samples examined over one independent experiment. Figure 13G shows GSEA enrichment of CD8+effector T cell-associated signatures in sgRbpj versus sgNTC OT-I cells (from scRNA- seq profiling). Figure 13H shows relative frequencies of GZMB+and IFN^+intratumoral OT- I cells (dual-colour transfer system, isolated on day 7 after adoptive transfer) after OVA / H- 2Kb stimulation (n = 7 per group). Figure 13I shows relative frequencies and numbers of GZMB+and IFN^+intratumoral OT-I cells (dual-colour transfer system, isolated on day 7 after adoptive transfer) after PMA + Iono stimulation (n = 6 for sgNTC and 7 for sgRbpj). Figures 13J-13K show relative frequencies and numbers of GZMB+and IFN^+intratumoral OT-I cells (dual-colour transfer system, isolated on day 21 after adoptive transfer) after cognate antigen (Figure 13J; n = 5 for sgNTC and 7 for sgRbpj) or PMA + Iono stimulation (Figure 13K; n = 5 for sgNTC and 7 for sgRbpj). Figure 13L shows relative expression of perforin (n = 7 for sgNTC and 10 for sgRbpj), RUNX3 (n = 7 for sgNTC and 10 for sgRbpj), T-bet (n = 7 for sgNTC and 10 for sgRbpj), BATF (n = 6 for sgNTC and 7 for sgRbpj), CXCR6 (n = 7 for sgNTC and 10 for sgRbpj), and CX3CR1 (n = 7 for sgNTC and 10 for sgRbpj) in total intratumoral OT-I cells (dual-colour transfer system). Figure 13M shows expression of Prf1, Gzmb and Gzmk in Tpex and Tex subsets of intratumoral sgNTC and sgRbpj OT-I cells (as profiled by scRNA-seq). Figure 13N shows survival analysis of B16-OVA tumour-bearing 15 304098633v1Attorney Docket No: 243734.000206 mice given sgNTC (n = 5) or sgRbpj (n = 8) OT-I cells (no cell transfer, n = 5). Figure 13O shows E.G7-OVA tumor growth in mice that received sgNTC (n = 8) or sgRbpj (n = 8) OT-I cells (no cell transfer, n = 4). The same sgNTC OT-I cells are presented in Figure 10D. Figure 13P shows LLC-OVA tumour growth in mice given sgNTC (n = 9) or sgRbpj (n = 10) OT-I cells (no cell transfer, n = 4). The same sgNTC OT-I cells are presented in Figure 10D. Figures 13Q-13R show sgNTC (n = 6) or sgRbpj (n = 8)-transduced OT-I cells that were transferred (single-colour transfer system) to E.G7-OVA tumour-bearing mice and analyzed seven days later, showing number of total intratumoral OT-I cells (Figure 13Q) and frequencies and numbers of Tpex and Tex OT-I cells (Figure 13R). The same sgNTC OT-I cells are presented in Figures 10E, 10F. Figures 13S-13T show sgNTC (n = 5) or sgRbpj (n = 6) OT-I cells that were transferred to LLC-OVA tumour-bearing mice (single-colour transfer system) and analyzed seven days later, showing number of total intratumoral OT-I cells (Figure 13S) and frequencies and numbers of Tpex and Tex OT-I cells (Figure 13T). The same sgNTC OT-I cells are presented in Figures 10G, 10H. Data are representative of three (Figures 13H, 13I, 13L, 13N), one (Figures 13J, 13K, 13Q-T) or two (Figures 13O, 13P) independent experiment(s). NS = not significant; *P < 0.05; **P < 0.01 and ***P < 0.001. Two-tailed Wilcoxon rank sum test (Figures 13A, 13B, 13E, 13M), two-tailed Wald test (Figure 13F), two-tailed Kolmogorov–Smirnov test (Figure 13G), two-tailed unpaired Student’s t-test (Figures 13H-13L, 13Q-13T), log-rank (Mantel-Cox) test (Figure 13N) or two-way ANOVA (Figures 13O, 13P). Data are presented as mean ± SEM.
[0085] Figures 14A-14E show RBPJ acts independently of NOTCH1 / 2 and is repressed by BACH2. Figure 14A shows enrichment of transcriptional regulators in regions of the Rbpj locus (see methods as described herein). Figure 14B shows Rbpj expression in sgBach2, sgRunx1, sgRunx2, or sgJun OT-I cells versus OT-I cells transduced with sgNTC and other sgRNAs (sgRNAs for all the other perturbations combined) in scCRISPR screening. Figure 14C shows RBPJ expression in indicated sgBach2 (n = 9)-transduced intratumoral OT-I cell populations (dual-colour transfer system). Figure 14D shows Rbpj expression in wild-type (WT) or Bach2-deficient (Bach2 KO) naïve CD8+T cells after 0, 8, and 16 hours after TCR stimulation. The boxes stand for 25% to 75% interquartile range (IQR), and the whiskers stand for minimum (25% quantile – 1.5* IQR) to maximum (75% quantile + 1.5* IQR) values. Figure 14E shows Rbpj expression in control and Bach2 overexpressing (OE) CD8+T cells. Data are representative of three (Figure 14C) independent experiments. NS = not significant; two-tailed Wilcoxon sum-rank test (Figures 14B, 14E), two-tailed unpaired Student’s t-test (Figure 14C) or two-tailed moderated t-test (Figure 14D). Data are presented as mean ± SEM. 16 304098633v1Attorney Docket No: 243734.000206
[0086] Figures 15A-15H show that the RBPJ-IRF1 axis impinges upon Tex cell accumulation. Figure 15A shows principal component analysis (PCA) plot showing chromatin alterations in sgNTC (n = 3) and sgRbpj (n = 3) Tpex and Tex intratumoral OT-I cells (dual- colour transfer system), with the percentage of variance shown. Figure 15B shows peak set enrichment analysis of effector function-related pathways in Tpex and Tex subsets. Figure 15C shows relative intensity of differentially accessible peaks in Rbpj-deficient versus control Tex cells (Tpex peak intensity is shown as reference). Selective genes (Cd28, Prf1, Ifng) associated with effector function that display enhanced chromatin accessibility in Rbpj- deficient Tex cells are labeled. Figure 15D shows open chromatin regions (OCRs) upregulated in sgRbpj versus sgNTC Tex OT-I cells were analyzed for IRF1 binding motif (V_IRF1_06, from TRANSFAC database), followed by mapping to the nearest genes. Functional enrichment analysis of CD8+T cell effector function-associated pathways of these genes is shown. Figure 15E shows relative number of Tex cells (dual-colour transfer system) (n = 5 per group). Figure 15F shows a PCA plot showing transcriptome changes in sgNTC (n = 4; co-transferred cells from the sgIrf1 group), sgRbpj (n = 4), sgIrf1 (n = 4), and sgRbpj + Irf1 (n = 3) intratumoral OT-I cells (dual-colour transfer system), with the percentage of variance shown. Figure 15G shows B16-OVA tumour growth in mice that received indicated sgRNA-transduced OT-I cells (n = 7 per group; no cell transfer group, n = 4). Figure 15H shows a schematic of in vivo scCRISPR screening and that co-functional modules orchestrate heterogeneity and differentiation of intratumoral CTLs. Co-functional modules coordinately regulate gene expression programs underlying the CTL differentiation trajectory. This trajectory is characterized by a progressive loss of stemness, and an increase in metabolism and proliferative capacity in Tpex2 and Tex1 cells, which are decreased in Tex2 cells. IKAROS (from TF M3) and ETS1 (from TF M7) reciprocally regulate the transition from Tpex to intermediate Tex1 cells, which requires quiescence exit of Tpex cells. Moreover, a NOTCH-independent RBPJ (from TF M8)-IRF1 axis mediates Tex1 to Tex2 cell differentiation, associated with reduced proliferation (dotted line marks possible Tpex to Tex2 cell generation that may also arise). Data are representative of two (Figure 15E) or one (Figure 15G) independent experiment(s). NS = not significant; *P < 0.05, **P < 0.01, and ***P < 0.001; two-tailed Fisher’s exact test (Figures 15B, 15D), one-way ANOVA (Figure 15E) or two-way ANOVA (Figure 15G). Data are presented as mean ± SEM. 17 304098633v1Attorney Docket No: 243734.000206 DETAILED DESCRIPTION
[0087] CD8+cytotoxic T cells (CTLs) orchestrate anti-tumor immunity and exhibit inherent heterogeneity (1,2) with precursor exhausted T (Tpex) but not terminally exhausted T (Tex) cells responding to existing immunotherapies (3-7). The gene regulatory network (GRN) underlying CTL differentiation and whether Tex responses can be functionally reinvigorated are incompletely understood. As detailed in the Examples section below, the inventors systematically mapped causal GRNs via single-cell CRISPR (scCRISPR) screens in vivo and discovered checkpoints for CTL differentiation. It has been found that quiescence exit of Tpex cells initiated successive differentiation into intermediate Tex cells. This process was differentially regulated by IKAROS and ETS1, whose deficiencies dampened and elevated mTORC1-associated metabolic activities, respectively. IKAROS-deficient cells accumulated as a metabolically quiescent Tpex population with limited differentiation potential upon immune checkpoint blockade (ICB). Conversely, targeting ETS1 improved anti-tumor immunity and ICB efficacy by boosting Tpex to intermediate Tex cell differentiation and metabolic rewiring. Mechanistically, TCF-1 and BATF are the respective targets for IKAROS and ETS1 as described herein. In one of the aspects, RBPJ–IRF1 axis promoted intermediate Tex to terminal Tex cell differentiation. Accordingly, targeting Rbpj enhanced functional and epigenetic reprogramming of Tex cells toward the proliferative state, and improved therapeutic effects and ICB efficacy. Collectively, promoting quiescence exit of Tpex cells and enriching the proliferative state in Tex cells act as key modalities for anti-tumour effects and provides a systemic framework to integrate cell fate regulomes and reprogrammable functional determinants for cancer immunity. Definitions
[0088] The term “immune effector cell” as used herein refers to a cell that is involved in an immune response, e.g., in the promotion of an immune effector response. Non-limiting examples of immune effector cells include T cells (e.g., αβ T cells and γδ T cells), B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid-derived phagocytes. Immune effector cells include stem cells, such as induced pluripotent stem cells (iPSCs), that are capable of differentiating into immune cells.
[0089] The terms “T cell” and “T lymphocyte” are interchangeable and used synonymously herein. As used herein, T cell includes thymocytes, naïve T lymphocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes, and activated T lymphocytes. A T cell can be a T helper (Th) cell, for example a T helper 1 (Thl) or a T helper 2 (Th2) cell. 18 304098633v1Attorney Docket No: 243734.000206 The T cell can be a CD8+T cell, a CD4+T cell, a helper T cell or T-helper cell (HTL; CD4+T cell), a cytotoxic T cell (CTL; CD8+T cell), a tumor infiltrating cytotoxic T cell (TIL; CD8+T cell), CD4+CD8+T cell, or any other subset of T cells. Other illustrative populations of T cells suitable for use in particular embodiments include naïve T cells and memory T cells. Also included are “αβ T cell receptor (TCR) T cells”, which refer to a population of T cells that possess a TCR composed of α- and β-TCR chains. Also included are “NKT cells”, which refer to a specialized population of T cells that express a semi-invariant αβ T-cell receptor, but also express a variety of molecular markers that are typically associated with NK cells, such as NK1.1. NKT cells include NK1.1+and NK1.1–, as well as CD4+, CD4–, CD8+and CD8–cells. The TCR on NKT cells can be unique in that can recognize glycolipid antigens presented by the MHC I-like molecule CD1d. NKT cells can have either protective or deleterious effects due to their abilities to produce cytokines that promote either inflammation or immune tolerance. Also included are “gamma-delta T cells (γδ T cells),” which refer to a specialized population of T cells possessing a distinct TCR on their surface, and unlike the majority of T cells in which the TCR is composed of two glycoprotein chains designated α- and β-TCR chains, the TCR in γδ T cells is made up of a γ-chain and a δ-chain. γδ T cells can play a role in immunosurveillance and immunoregulation, and can be an important source of IL-17 and can induce a CD8+cytotoxic T cell response. Also included are “regulatory T cells” or “Tregs”, which refer to T cells that suppress an abnormal or excessive immune response and play a role in immune tolerance. Tregs cells are typically transcription factor Foxp3-positive (FoxP3+) CD4+T cells and can also include transcription factor Foxp3-negative (FoxP3–) regulatory T cells that are IL-10-producing CD4+T cells. In some embodiments, a T cell described herein refers to a precursor exhausted T cell (Tpex). In some embodiments, a T cell described herein refers to an exhausted T cell (Tex).
[0090] The terms “natural killer cell” and “NK cell” are used interchangeably and synonymously herein. As used herein, NK cell refers to a differentiated lymphocyte with a CD 16+CD56+and / or CD57+TCR–phenotype. NKs are characterized by their ability to bind to and kill cells that fail to express “self” MHC / HLA antigens by the activation of specific cytolytic enzymes, the ability to kill tumor cells or other diseased cells that express a ligand for NK activating receptors, and the ability to release protein molecules called cytokines that stimulate or inhibit the immune response.
[0091] The term “chimeric antigen receptor” or “CAR” as used herein is defined as a cell- surface receptor comprising an extracellular antigen-binding domain, a transmembrane domain and a cytoplasmic domain comprising a lymphocyte activation domain and, optionally, at least 19 304098633v1Attorney Docket No: 243734.000206 one co-stimulatory signaling domain, all in a combination, that are not naturally found together on a single protein. This particularly includes receptors wherein the extracellular domain and the cytoplasmic domain are not naturally found together on a single receptor protein. The chimeric antigen receptors of the present disclosure are intended primarily for use with lymphocytes such as T cells.
[0092] As used herein, the term “antigen” refers to any agent (e.g., protein, peptide, polysaccharide, glycoprotein, glycolipid, nucleic acid, portions thereof, or combinations thereof) molecule capable of being bound by a T-cell receptor. An antigen is also able to provoke an immune response. An example of an immune response may involve, without limitation, antibody production, or the activation of specific immunologically competent cells, or both. A skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be synthesized or can be derived from a biological sample, or might be macromolecule besides a polypeptide. Such biological sample can include, but is not limited to, a tissue sample, a tumor sample, a cell, or a fluid, e.g., with other biological components, an organism, a subunit of a protein / antigen, or killed or inactivated whole cells or cell lysates.
[0093] The term “antigen-binding moiety” refers to a target-specific binding element that may be any ligand that binds to the antigen of interest or a polypeptide or fragment thereof, wherein the ligand is either naturally derived or synthetic. Examples of antigen-binding moieties include, but are not limited to, antibodies; polypeptides derived from antibodies, such as, for example, single chain variable fragments (scFv), Fab, Fab′, F(ab′)2, and Fv fragments; polypeptides derived from T cell receptors, such as, for example, TCR variable domains; secreted factors (e.g., cytokines, growth factors) that can be artificially fused to signaling domains (e.g., “zytokines”); and any ligand or receptor fragment (e.g., CD27, NKG2D) that binds to the antigen of interest. Combinatorial libraries can also be used to identify peptides binding with high affinity to a therapeutic target(s).
[0094] The terms “antibody” and “antibodies” refer to monoclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), human antibodies, humanized antibodies, chimeric antibodies, single-chain Fvs (scFv), single chain antibodies, Fab fragments, F(ab′) fragments, disulfide-linked Fvs (sdFv), intrabodies, minibodies, diabodies and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antigen-specific TCR), and epitope- binding fragments of any of the above. The terms “antibody” and “antibodies” also refer to covalent diabodies such as those disclosed in U.S. Pat. Appl. Pub. 2007 / 0004909 and Ig- DARTS such as those disclosed in U.S. Pat. Appl. Pub. 2009 / 0060910, each of which is 20 304098633v1Attorney Docket No: 243734.000206 incorporated by reference in its entirety for all purposes. Antibodies useful as a TCR-binding molecule include, without limitation, immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, i.e., molecules that contain an antigen-binding site. Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgM1, IgM2, IgA1 and IgA2) or subclass. Also included are “bispecific antibodies”, which refer to antibodies that are capable of binding to two different antigens or different epitopes of the same antigen.
[0095] The term “host cell” means any cell that contains a heterologous nucleic acid. The heterologous nucleic acid can be a vector (e.g., an expression vector). For example, a host cell can be a cell from any organism that is selected, modified, transformed, grown, and / or used or manipulated in any way, for the production of a substance by the cell, for example the expression by the cell of a gene, a DNA or RNA sequence, a protein or an enzyme. An appropriate host may be determined. For example, the host cell may be selected based on the vector backbone and the desired result. By way of example, a plasmid or cosmid can be introduced into a prokaryote host cell for replication of several types of vectors. Bacterial cells such as, but not limited to, DH5α, JM109, and KCB, SURE® Competent Cells, and SOLOPACK Gold Cells, can be used as host cells for vector replication and / or expression. Additionally, bacterial cells such as E. coli LE392 can be used as host cells for phage viruses. Eukaryotic cells that can be used as host cells include, but are not limited, to yeast (e.g., YPH499, YPH500 and YPH501), insects, and mammals. Examples of mammalian eukaryotic host cells for replication and / or expression of a vector include, but are not limited to, HeLa, NIH3T3, Jurkat, 293, COS, CHO, Saos, and PC12 cells.
[0096] Host cells of the present disclosure can include T cells that contain the DNA or RNA sequences encoding a CAR and express the CAR on the cell surface. Host cells may be used for e.g., enhancing T cell activity and treatment of cancer .
[0097] The terms “activation” or “stimulation” mean to induce a change in the biologic state by which cells (e.g., T cells and NK cells) express activation markers, produce cytokines, proliferate and / or become cytotoxic to target cells. Each of these changes can be produced by primary stimulatory signals. Co-stimulatory signals can amplify the magnitude of the primary signals and suppress cell death following initial stimulation resulting in a more durable activation state, and thus a higher cytotoxic capacity. A “co-stimulatory signal” refers to a signal, which in combination with a primary signal, such as TCR / CD3 ligation, can lead to lymphocyte (e.g., T cell and / or NK cell) proliferation, and / or upregulation or downregulation of key molecules. 21 304098633v1Attorney Docket No: 243734.000206
[0098] The term “proliferation” refers to an increase in cell division, either symmetric or asymmetric division of cells. The term “expansion” refers to the outcome of cell division and cell death.
[0099] The term “differentiation” refers to decreasing the potency of a cell and moving the cell to a more developmentally restricted state, frequently accompanied by cell proliferation.
[0100] The terms “express” and “expression” mean allowing or causing the information in a gene or DNA sequence to become produced, for example producing a protein by activating the cellular functions involved in transcription and translation of a corresponding gene or DNA sequence. A DNA sequence is expressed in or by a cell to form an “expression product” such as a protein. The expression product itself, e.g., the resulting protein, may also be said to be “expressed” by the cell. An expression product can be characterized as intracellular, extracellular, or transmembrane.
[0101] The term “transfection” means the introduction of a “foreign” (i.e., extrinsic or extracellular) nucleic acid into a cell using recombinant DNA technology. The term “genetic modification” means the introduction of a “foreign” (i.e., extrinsic or extracellular) gene, DNA or RNA sequence to a host cell, so that the host cell will express the introduced gene or sequence to produce a desired substance, typically a protein or enzyme coded by the introduced gene or sequence. The introduced gene or sequence may also be called a “cloned” or “foreign” gene or sequence, may include regulatory or control sequences operably linked to polynucleotide encoding the chimeric antigen receptor, such as start, stop, promoter, signal, secretion, or other sequences used by a cell’s genetic machinery. The gene or sequence may include nonfunctional sequences or sequences with no known function. A host cell that receives and expresses introduced DNA or RNA has been “genetically engineered”. The DNA or RNA introduced to a host cell can come from any source, including cells of the same genus or species as the host cell, or from a different genus or species.
[0102] The term “transduction” means the introduction of a foreign nucleic acid into a cell using a viral vector.
[0103] The terms “genetically modified” or “genetically engineered” refers to the addition of extra genetic material in the form of DNA or RNA into a cell.
[0104] As used herein, the term “derivative” in the context of proteins or polypeptides (e.g., CAR constructs or domains thereof) refers to: (a) a polypeptide that has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to the polypeptide it is a derivative of; (b) a polypeptide encoded by a nucleotide sequence that has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% 22 304098633v1Attorney Docket No: 243734.000206 sequence identity to a nucleotide sequence encoding the polypeptide it is a derivative of; (c) a polypeptide that contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid mutations (i.e., additions, deletions and / or substitutions) relative to the polypeptide it is a derivative of; (d) a polypeptide encoded by nucleic acids that can hybridize under high, moderate, or typical stringency hybridization conditions to nucleic acids encoding the polypeptide it is a derivative of; (e) a polypeptide encoded by a nucleotide sequence that can hybridize under high, moderate, or typical stringency hybridization conditions to a nucleotide sequence encoding a fragment of the polypeptide, it is a derivative of, of at least 20 contiguous amino acids, at least 30 contiguous amino acids, at least 40 contiguous amino acids, at least 50 contiguous amino acids, at least 75 contiguous amino acids, at least 100 contiguous amino acids, at least 125 contiguous amino acids, or at least 150 contiguous amino acids; or (f) a fragment of the polypeptide it is a derivative of.
[0105] Percent sequence identity can be determined using any method known to one of skill in the art. In a specific embodiment, the percent identity is determined using the “Best Fit” or “Gap” program of the Sequence Analysis Software Package (Version 10; Genetics Computer Group, Inc., University of Wisconsin Biotechnology Center, Madison, Wisconsin). Information regarding hybridization conditions (e.g., high, moderate, and typical stringency conditions) have been described, see, e.g., U.S. Patent Application Publication No. US 2005 / 0048549 (e.g., paragraphs 72-73).
[0106] Percent sequence identity can be determined using a global alignment between two sequences. As used herein, the term “global alignment” refers to an alignment of residues between two amino acid or nucleic acid sequences along their entire length, introducing gaps as necessary if the two sequences do not have the same length, to achieve a maximum percent identity. A global alignment can be created using the global alignment tool “Needle” from the online European Molecular Biology Open Software Suite (EMBOSS) (see ebi.ac.uk / Tools / psa / emboss_needle / ) or the global alignment tool “BLAST® » Global Alignment” from the National Center for Biotechnology Information (NCBI) (see blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&PROG_D EFAULTS=on&BLAST_INIT=GlobalAln&BLAST_SPEC=GlobalAln&BLAST_PROGRA MS=blastn). Both of these global alignment tools incorporate the Needleman–Wunsch algorithm (Needleman, S.B. & Wunsch, C.D. (1970) “A general method applicable to the search for similarities in the amino acid sequences of two proteins.” J. Mol. Biol.48:443-453). In some embodiments, a global alignment of nucleotide sequences using BLAST Global Alignment uses the following default parameters: match score = 2; mismatch score = -3; Gap 23 304098633v1Attorney Docket No: 243734.000206 Cost Existence score = 5; Gap Cost Extension Score = 2. In some embodiments, a global alignment of protein sequences using BLAST Global Alignment uses the following default parameters: Gap Cost Existence = 11; Gap Cost Extension = 1.
[0107] The term “variant” as used herein refers to a modified polypeptide, protein, or polynucleotide that has substantial or significant sequence identity or similarity to a wild-type polypeptide, protein, or polynucleotide. The variant may retain the same, or have altered (e.g., improved, reduced, or abolished) biological activity relative to the wild-type polypeptide, protein, or polynucleotide of which it is a variant. The variant may contain an insertion, a deletion, or a substitution of at least one amino acid residue or nucleotide.
[0108] The terms “vector”, “cloning vector”, and “expression vector” mean the vehicle by which a DNA or RNA sequence (e.g., a foreign gene) can be introduced into a host cell so as to genetically modify the host cell and promote expression (e.g., transcription and translation) of the introduced sequence. Vectors include plasmids, synthesized RNA and DNA molecules, phages, viruses, etc. In some embodiments, the vector is a viral vector such as, but not limited to, an adenoviral, adeno-associated, alphaviral, herpes, lentiviral, retroviral, baculoviral, or vaccinia vector.
[0109] The term “regulatory element” refers to any cis-acting genetic element that controls some aspect of the expression of nucleic acid sequences. In some embodiments, the term “promoter” comprises essentially the minimal sequences required to initiate transcription. In some embodiments, the term “promoter” includes the sequenceto start transcription, and in addition, also include sequences that can upregulate or downregulate transcription, commonly termed “enhancer elements” and “repressor elements”, respectively.
[0110] As used herein, the term “operatively linked” and similar phrases, when used in reference to nucleic acids or amino acids, refer to the operational linkage of nucleic acid sequences or amino acid sequence, respectively, placed in functional relationships with each other. For example, an operatively linked promoter, enhancer element(s), open reading frame, 5' and 3' UTR, and terminator sequence(s) result in the accurate production of a nucleic acid molecule (e.g., RNA). In some embodiments, operatively linked nucleic acid elements result in the transcription of an open reading frame and, ultimately the production of a polypeptide (i.e., expression of the open reading frame). As another example, an operatively linked peptide is one in which the functional domains are placed with appropriate distance from each other to impart the intended function of each domain.
[0111] The term “site-specific nuclease” as used herein refers to a nuclease capable of specifically recognizing and cleaving a nucleic acid (DNA or RNA) sequence. Suitable site- 24 304098633v1Attorney Docket No: 243734.000206 specific nucleases for use in the present disclosure include, but are not limited to, an RNA- guided endonuclease (e.g., CRISPR-associated (Cas) proteins),a zinc finger nuclease, a TALEN nuclease, or a mega-TALEN nuclease.
[0112] By “enhance” or “promote” or “increase” or “expand” or “improve” refers generally to the ability of a composition contemplated herein to produce, elicit, or cause a greater physiological response (i.e., downstream effect(s)) compared to the response caused by either a vehicle or a control molecule / composition. A measurable physiological response may include an increase in T cell expansion, activation, effector function, persistence, and / or an increase in anti-tumor activity (e.g., cancer cell death or cancer cell killing ability), among others apparent from the understanding in the art and the description herein. In some embodiments, an “increased” or “enhanced” amount can be a “statistically significant” amount, and may include an increase that is 1.1, 1.2, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 or more times (e.g., 500, 1000 times) (including all integers and decimal points in between and above 1, e.g., 1.5, 1.6, 1.7.1.8, etc.) the response produced by a vehicle or a control composition.
[0113] By “decrease” or “lower” or “lessen” or “reduce” or “abate” refers generally to the ability of composition contemplated herein to produce, elicit, or cause a lesser physiological response (i.e., downstream effect(s)) compared to the response caused by either a vehicle or a control molecule / composition. In some embodiments, a “decrease” or “reduced” amount can be a “statistically significant” amount, and may include a decrease that is 1.1, 1.2, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 or more times (e.g., 500, 1000 times) (including all integers and decimal points in between and above 1, e.g., 1.5, 1.6, 1.7.1.8, etc.) the response produced by a vehicle or a control composition.
[0114] The terms “inhibit” or “inhibition” as used herein refer to reducing a function or activity to an extent sufficient to achieve a desired biological or physiological effect. Inhibition may be complete or partial.
[0115] The terms “treat” or “treatment” of a state, disorder or condition include: (1) preventing, delaying, or reducing the incidence and / or likelihood of the appearance of at least one clinical or sub-clinical symptom of the state, disorder, or condition developing in a subject that may be afflicted with or predisposed to the state, disorder, or condition, but does not yet experience or display clinical or subclinical symptoms of the state, disorder, or condition; or (2) inhibiting the state, disorder, or condition, i.e., arresting, reducing, or delaying the development of the disease or a relapse thereof or at least one clinical or sub-clinical symptom thereof; or (3) relieving the disease, i.e., causing regression of the state, disorder, or condition 25 304098633v1Attorney Docket No: 243734.000206 or at least one of its clinical or sub-clinical symptoms. The benefit to a subject to be treated is either statistically significant or at least perceptible to the patient or to the physician.
[0116] The term “effective” applied to a dose or an amount refers to that quantity of a compound or pharmaceutical composition that is sufficient to result in a desired activity upon administration to a subject in need thereof. When a combination of active ingredients is administered, the effective amount of the combination may or may not include amounts of each ingredient that would have been effective if administered individually. The exact amount required will vary from subject to subject, depending on, e.g., the species, age, and / or general condition of the subject, the severity of the condition being treated, the particular drug or drugs employed, the mode of administration, and the like.
[0117] The phrase “pharmaceutically acceptable” as used in connection with compositions described herein, refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., a human). Preferably, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly, in humans.
[0118] The term “protein” encompasses all kinds of naturally occurring and synthetic proteins, including protein fragments of all lengths, fusion proteins, and modified proteins, such as, without limitation, glycoproteins, as well as all other types of modified proteins (e.g., proteins resulting from phosphorylation, acetylation, myristoylation, palmitoylation, glycosylation, oxidation, formylation, amidation, polyglutamylation, ADP-ribosylation, pegylation, biotinylation, etc.).
[0119] The terms “nucleic acid”, “nucleotide”, and “polynucleotide” encompass both DNA and RNA unless specified otherwise. By a “nucleic acid sequence” or “nucleotide sequence” is meant the nucleic acid sequence encoding an amino acid. The term may also refer to the nucleic acid sequence including the portion coding for any amino acids added as an artifact of cloning, including any amino acids coded for by linkers.
[0120] The terms “patient”, “individual”, “subject”, and “animal” are used interchangeably herein and refer to mammals, including, without limitation, human and veterinary animals (e.g., cats, dogs, cows, horses, sheep, pigs, etc.) and experimental animal models. In a preferred embodiment, the subject is a human.
[0121] The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which a compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water 26 304098633v1Attorney Docket No: 243734.000206 and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier including, but not limited to, one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant, and a colorant. Suitable pharmaceutical carriers are described in “Remington’s Pharmaceutical Sciences” by E.W. Martin.
[0122] Singular forms “a”, “an”, and “the” include plural references, unless the context clearly dictates otherwise. Thus, for example, a reference to “a method” includes one or more methods, and / or steps of the type described herein, which will become apparent to those persons skilled in the art upon reading this disclosure.
[0123] The term “about” or “approximately” includes being within a statistically meaningful range of a value. Such a range can be within an order of magnitude, preferably within 50%, more preferably within 20%, still more preferably within 10%, and even more preferably within 5% of a given value or range. The allowable variation encompassed by the term “about” or “approximately” depends on the particular system under study, and can be readily appreciated by one of ordinary skill in the art.
[0124] If aspects of the disclosure are described as “comprising” a feature, or versions thereof (e.g., comprise), embodiments also are contemplated as “consisting of” or “consisting essentially of” the feature.
[0125] The practice of the present invention employs, unless otherwise indicated, conventional techniques of statistical analysis, molecular biology (including recombinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such tools and techniques are described in detail in e.g., Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York; Ausubel et al. eds. (2005) Current Protocols in Molecular Biology. John Wiley and Sons, Inc.: Hoboken, NJ; Bonifacino et al. eds. (2005) Current Protocols in Cell Biology. John Wiley and Sons, Inc.: Hoboken, NJ; Coligan et al. eds. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc.: Hoboken, NJ; Coico et al. eds. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc.: Hoboken, NJ; Coligan et al. eds. (2005) Current Protocols in Protein Science, John Wiley and Sons, Inc.: Hoboken, NJ; and Enna et al. eds. (2005) Current Protocols in Pharmacology, John Wiley and Sons, Inc.: Hoboken, NJ. Additional techniques are explained, e.g., in U.S. Patent No.7,912,698 and U.S. Patent Appl. 27 304098633v1Attorney Docket No: 243734.000206 Pub. Nos.2011 / 0202322 and 2011 / 0307437, each of which is incorporated herein by reference in its entirety for all purposes.
[0126] The technology illustratively described herein suitably may be practiced in the absence of any element(s) not specifically disclosed herein.
[0127] The terms and expressions which have been employed are used as terms of description and not of limitation, and use of such terms and expressions do not exclude any equivalents of the features shown and described or portions thereof, and various modifications are possible within the scope of the technology claimed. Modified Immune Effector Cells
[0128] In one aspect, the present disclosure provides a modified immune effector cell with enhanced immune cell function, e.g., enhanced anti-tumor effect. In one aspect, the immune effector cell is modified such that the expression and / or function of an E26 avian leukemia oncogene 1 (ETS1) in the cell is reduced or eliminated. In some embodiments, an ETS1 gene or gene product is modified in the cell such that the expression and / or function of ETS1 in the cell is reduced or eliminated. In another aspect, the immune effector cell is modified such that the expression and / or function of a recombination signal binding protein for immunoglobulin kappa J region (RBPJ) in the cell is reduced or eliminated. In a further aspect, the immune effector cell is modified such that the expression and / or function of an E26 avian leukemia oncogene 1 (ETS1) and a recombination signal binding protein for immunoglobulin kappa J region (RBPJ) in the cell is reduced or eliminated.
[0129] In some embodiments, the immune effector cell is a T cell. T cells may include, but are not limited to, thymocytes, naïve T lymphocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes, or activated T lymphocytes. A T cell can be a T helper (Th) cell, for example a T helper 1 (Thl) or a T helper 2 (Th2) cell. The T cell can be a helper T cell (HTL; CD4+T cell) CD4+T cell, a cytotoxic T cell (CTL; CD8+T cell), a tumor infiltrating cytotoxic T cell (TIL; CD8+T cell), CD4+ CD8+T cell, or any other subset of T cells. Other illustrative populations of T cells suitable for use in particular embodiments include naïve T cells, memory T cells, and NKT cells.
[0130] In some embodiments, the T cell may be a CD8+T cell, a CD4+T cell, a cytotoxic T cell, an αβ T cell receptor (TCR) T cell, a natural killer T (NKT) cell, a γδ T cell, a memory T cell, a T-helper cell, a regulatory T cell (Treg), a memory T cell (Tscm or TSCM), a central memory T cell (Tcm or TCM), an effector memory T cell (Tern or TEM), an effector T cell (Teff, TEFF or TE), a precursor exhausted T cell (Tpex or TPEX), an exhausted T cell (Tex or 28 304098633v1Attorney Docket No: 243734.000206 TEX), or a terminally exhausted T (Tex) cell. In some embodiments, the immune effector cell is CD8+T cell.
[0131] Naïve CD8+T cells differentiate into cytotoxic effector cells and memory cell precursors after cell activation. In tumors, an early Tpex cell cluster develops and preferentially localizes to lymphoid organs. This Tpex cluster is proliferative and function-reserved. Tpex cells subsequently generate additional subsets of Tex cells containing the transitory Tex clusters and the terminal Tex cell clusters in tumor microenvironments (TME), reflecting a cell differentiation hierarchy necessary for maintaining the functional T cell pool. This progressive development of T cell exhaustion results in a high heterogeneity of Tex cells. The expression of inhibitory receptors (IRs) like PD-1, CTLA-4, LAG-3 and TIM-3 is considered a crucial factor for categorizing Tex cells. Based on the expression levels of IRs and TCF-1, Tex cells are generally divided into three stages (1) the Tpex, which is the stem-like PD-1+TCF-1+TIM- 3–Tex precursors; (2) the Texterm, which is the terminally differentiated PD-1+TCF-1–TIM-3+Tex cluster with the highest exhaustion profile; and (3) the Texintor transitory Tex, which is at a transitional stage between the Tpex and Texterm, characterized by high effector functions and proliferation. See, Tian et al., Front. Immunol., Front. Immunol.14:1198551 (2023), which is incorporated herein by reference in its entirety. Moreover, recent study has further divided Tpex cells into CD62L+and CD62L–Tpex cells. (Hudson et al., Immunity 51, 1043–1058 (2019); Tsui et al. Nature 609, 354–360 (2022), each of which is incorporated herein by reference in its entirety). Similarly, Tpex and Tex clusters are also classified as precursor exhausted-like state 1 (Tpex1; TCF-1+TIM-3–Ki67–), Tpex2 (TCF-1+TIM-3–Ki67+), terminal exhausted-like state 1 (Tex1; TCF-1–TIM-3+Ki67+) and Tex2 (TCF-1–TIM-3+Ki67–) cells, with pseudotime analysis predicting a trajectory from Tpex1, via Tpex2 and Tex1, to Tex2 cells (Figure 1C).
[0132] The modification described herein may be applied to all forms of T cell therapies which include, but are not limited to, therapies with: i) T cells that express a chimeric antigen receptor (CAR); ii) T cells that express an endogenous αβ TCR or an endogenous γδ TCR, which may be specific for, e.g., a peptide derived from viral or tumor-associated antigens (including neoantigens); iii) T cells that transgenically express an αβ TCR or a γδ TCR, which may be specific for, e.g., a peptide derived from viral or tumor-associated antigens (including neoantigens); iv) T cells that transgenically express bispecific antibodies, which recognize viral or tumor-associated antigens (including neoantigens), or a peptide derived therefrom, and an activating molecule expressed on T cells such as CD3; and / or, v) T cells that are generated via stimulation with for example, without limitation, peptides, and / or antigen presenting and / or 29 304098633v1Attorney Docket No: 243734.000206 artificial antigen presenting cells (in vitro sensitized [IVS] T cell therapy). Lastly, T cell therapies in which the therapeutic genes are delivered in vivo are also included (in vivo T cell therapy).
[0133] E26 avian leukemia oncogene 1 (ETS1) encodes a member of the ETS family of transcription factors, which are defined by the presence of a conserved ETS DNA-binding domain that recognizes the core consensus DNA sequence GGAA / T in target genes. These proteins function either as transcriptional activators or repressors of numerous genes, and are involved in stem cell development, cell senescence and death, and tumorigenesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. Broad expression of the ETS1 gene is found in lymph nodes, spleen, adrenal, appendix, bone marrow, brain, colon, duodenum, endometrium, esophagus, fat, gall bladder, heart, kidney, liver, ovary, pancreas, placenta, prostate, salivary gland, skin, small intestine, testis, thyroid, and urinary bladder. In one embodiment, the ETS1 gene referred to herein is a human ETS1 gene (NCBI gene ID: 2113). In one embodiment, the ETS1 gene referred to herein is a mouse Ets1 gene (NCBI gene ID: 23871).
[0134] In some embodiments, an ETS1 gene or gene product is modified in a cell disclosed herein so that the expression and / or function of ETS1 in the cell is reduced or eliminated. In some embodiments the level of functional ETS1 protein in the cell is reduced by about 50% or more. The level of functional ETS1 protein in the cell may be reduced by from about 50% to about 60%, from about 50% to about 70%, from about 50% to about 80%, from about 50% to about 90%, more than 60%, from about 60% to about 70%, from about 60% to about 80%, from about 60% to about 90%, more than about 70%, from about 70% to about 80%, from about 70% to about 90%, more than about 80%, from about 80% to about 90%, more than 90%, from about 90% to about 95%, from about 90% to about 98%, more than 95%, from about 95% to about 98%, more than about 98%, or more than about 99%. The level of functional ETS1 protein in the cell may be reduced by about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or even 100%.
[0135] In some embodiments, the ETS1 gene is deleted or defective so that no detectable wild-type ETS1 protein is produced. The ETS1 gene may be deleted or become defective using the methods described herein.
[0136] In some embodiments, an ETS1 gene or gene product and a RBPJ gene or gene product are both modified in the same cell so that the expression and / or function of ETS1 and RBPJ in the cell is reduced or eliminated. In some embodiments, the ETS1 and the RBPJ gene 30 304098633v1Attorney Docket No: 243734.000206 are deleted and / or defective in the cell so that no detectable wild-type ETS1 and RBPJ protein are produced.
[0137] Recombination signal binding protein for immunoglobulin kappa J region (RBPJ) is the protein encoded by the RBPJ gene. The encoded protein is a transcriptional regulator important in the Notch signaling pathway. The encoded protein acts as a repressor when not bound to Notch proteins and an activator when bound to Notch proteins. It is thought to function by recruiting chromatin remodeling complexes containing histone deacetylase or histone acetylase proteins to Notch signaling pathway genes. Several transcript variants encoding different isoforms have been found for this gene, and several pseudogenes of this gene exist on chromosome 9. Ubiquitous expression of the RBPJ gene is found in placenta, endometrium, adrenal, appendix, bone marrow, brain, colon, duodenum, endometrium, esophagus, fat, gall bladder, heart, kidney, liver, lung, lymph node, ovary, pancreas, placenta, prostate, salivary gland, skin, small intestine, spleen, stomach, testis, thyroid and urinary bladder. In one embodiment, the RBPJ gene described herein is a human RBPJ gene (e.g., NCBI gene ID: 3516). In one embodiment, the RBPJ gene referred to herein is a mouse Rbpj gene (NCBI gene ID: 19664).
[0138] In some embodiments, a RBPJ gene or gene product is modified in a cell disclosed herein so that the expression and / or function of RBPJ in the cell is reduced or eliminated. In some embodiments the level of functional RBPJ protein in the cell is reduced by about 50% or more. The level of functional RBPJ protein in the cell may be reduced by from about 50% to about 60%, from about 50% to about 70%, from about 50% to about 80%, from about 50% to about 90%, more than 60%, from about 60% to about 70%, from about 60% to about 80%, from about 60% to about 90%, more than about 70%, from about 70% to about 80%, from about 70% to about 90%, more than about 80%, from about 80% to about 90%, more than 90%, from about 90% to about 95%, from about 90% to about 98%, more than 95%, from about 95% to about 98%, more than about 98%, or more than about 99%. The level of functional RBPJ protein in the cell may be reduced by about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or even 100%.
[0139] In some embodiments, the RBPJ gene is deleted or defective so that no detectable wild-type RBPJ protein is produced. The RBPJ gene may be deleted or become defective using the methods described herein.
[0140] In some embodiments, the ETS1 gene and the RBPJ gene may be deleted (e.g., knocked out) in the same cell using the methods described herein. 31 304098633v1Attorney Docket No: 243734.000206
[0141] In some embodiments, an ETS1 gene or gene product and a RBPJ gene or gene product are both modified in the same cell so that the expression and / or function of ETS1 and RBPJ in the cell is reduced or eliminated. In some embodiments, the ETS1 and the RBPJ gene are deleted and / or defective in the cell so that no detectable wild-type ETS1 and RBPJ protein are produced.
[0142] In some embodiments, the antigen is a tumor antigen. Non-limiting examples of tumor antigens that may be targeted by the modified immune effector cell described herein include inducible T-cell costimulator (ICOS) or CD278, cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), programmed cell death protein (PD-1), programmed cell death ligand 1 (PD-L1), T-cell immunoglobulin and mucin domain 3(TIM-3), lymphocyte Activation Gene 3 (LAG3) or CD223, human epidermal growth factor receptor 2 (HER2), interleukin-13 receptor subunit alpha-2 (IL-13Ra2), ephrin type-A receptor 2 (EphA2), A kinase anchor protein 4 (AKAP-4), adrenoceptor beta 3 (ADRB3), anaplastic lymphoma kinase (ALK), immunoglobulin lambda- like polypeptide 1 (IGLL1), androgen receptor, angiopoietin-binding cell surface receptor 2 (Tie 2), B7-H3 (CD276), bone marrow stromal cell antigen 2 (BST2), carbonic anhydrase IX (CAIX), CCCTC-binding factor (Zinc Finger Protein)-like (BORIS), CD171, CD179a, CD24, CD300 molecule-like family member f (CD300LF), CD38, CD44v6, CD72, CD79a, CD79b, CD97, chromosome X open reading frame 61 (CXORF61), claudin 6 (CLDN6), CS-1 (CD2 subset 1, CRACC, SLAMF7, CD319, or 19A24), C-type lectin domain family 12 member A (CLEC12A), C-type lectin-like molecule-1 (CLL-1), Cyclin B 1, Cytochrome P450 1B 1 (CYP1B 1), EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2), epidermal growth factor receptor (EGFR), ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene), ETS translocation-variant gene 6, located on chromosome 12p (ETV6-AML), Fc fragment of IgA receptor (FCAR), Fc receptor-like 5 (FCRL5), Fms-like tyrosine kinase 3 (FLT3), Folate receptor beta, Fos-related antigen 1, Fucosyl GM1, G protein-coupled receptor 20 (GPR20), G protein-coupled receptor class C group 5, member D (GPRC5D), disialoganglioside (GD2), ganglioside GD3, ganglioside GM3, glycoceramide (GloboH), Glypican-3 (GPC3), Hepatitis A virus cellular receptor 1 (HAVCR1), hexasaccharide portion of globoH, high molecular weight-melanoma-associated antigen (HMWMAA), human Telomerase reverse transcriptase (hTERT), interleukin 11 receptor alpha (IL-11Ra), KIT (CD117), leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2), Lewis(Y) antigen, lymphocyte antigen 6 complex, locus K 9 (LY6K), lymphocyte antigen 75 (LY75), lymphocyte-specific protein tyrosine kinase (LCK), mammary gland differentiation 32 304098633v1Attorney Docket No: 243734.000206 antigen (NY-BR-1), melanoma cancer testis antigen-1 (MAD-CT-1), melanoma cancer testis antigen-2 (MAD-CT-2), melanoma inhibitor of apoptosis (ML-IAP), mucin 1, cell surface associated (MUC1), N-acetyl glucosaminyl-transferase V (NA17), neural cell adhesion molecule (NCAM), o-acetyl-GD2 ganglioside (OAcGD2), olfactory receptor 51E2 (OR51E2), p53 mutant, paired box protein Pax-3 (PAX3), paired box protein Pax-5 (PAX5), pannexin 3 (PANX3), placenta-specific 1 (PLAC1), platelet-derived growth factor receptor beta (PDGFR- beta), Polysialic acid, proacrosin binding protein sp32 (OY-TES 1), prostate stem cell antigen (PSCA), Protease Serine 21 (PRSS21), Proteasome (Prosome, Macropain) Subunit, Beta Type, 9 (LMP2), Ras Homolog Family Member C (RhoC), sarcoma translocation breakpoints, sialyl Lewis adhesion molecule (sLe), sperm protein 17 (SPA17), squamous cell carcinoma antigen recognized by T cells 3 (SART3), stage-specific embryonic antigen-4 (SSEA-4), synovial sarcoma, X breakpoint 2 (SSX2), TCR gamma alternate reading frame protein (TARP), TGS5, thyroid stimulating hormone receptor (TSHR), Tn antigen (Tn Ag), tumor endothelial marker 1 (TEM1 / CD248), tumor endothelial marker 7-related (TEM7R), uroplakin 2 (UPK2), vascular endothelial growth factor receptor 2 (VEGFR2), v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN), Wilms tumor protein (WT1), and X Antigen Family, Member 1A (XAGE1), or a fragment or variant thereof.
[0143] Additional antigens that may be targeted by the extracellular target-binding domain include, but are not limited to, carbonic anhydrase EX, alpha-fetoprotein, A3, antigen specific for A33 antibody, Ba 733, BrE3-antigen, CA125, CD1, CD1a, CD3, CD5, CD15, CD16, CD19, CD20, CD21, CD22, CD23, CD25, CD30, CD33, CD38, CD45, CD74, CD79a, CD80, CD123, CD138, colon-specific antigen-p (CSAp), CEA (CEACAM5), CEACAM6, CSAp, EGFR, EGP-I, EGP-2, Ep-CAM, EphA1, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB6, FIt-I, Flt-3, folate receptor, HLA-DR, human chorionic gonadotropin (HCG) and its subunits, hypoxia inducible factor (HIF-I), Ia, IL-2, IL-6, IL-8, insulin growth factor-1 (IGF-I), KC4-antigen, KS-1-antigen, KS1-4, Le-Y, macrophage inhibition factor (MIF), MAGE, MUC1, MUC2, MUC3, MUC4, NCA66, NCA95, NCA90, antigen specific for PAM-4 antibody, placental growth factor, p53, prostatic acid phosphatase, PSA, PSMA, RS5, S100, TAC, TAG-72, tenascin, TRAIL receptors, Tn antigen, Thomson-Friedenreich antigens, tumor necrosis antigens, VEGF, ED-B fibronectin, 17-lA-antigen, an angiogenesis marker, an oncogene marker or an oncogene product.
[0144] In some embodiments, the tumor antigen targeted by the modified immune effector cell is programmed cell death ligand 1 (PD-L1), human epidermal growth factor receptor 2 (HER2), IL13Rα2, erythropoietin-producing human hepatocellular receptor A2 (EphA2), B7 33 304098633v1Attorney Docket No: 243734.000206 homolog 3 protein (B7-H3), Cluster of Differentiation (CD) 19 (CD19), CD22, CD123, or disialoganglioside (GD2).
[0145] In some embodiments, the tumor antigen targeted by the modified immune effector cell is inducible T-cell costimulator (ICOS) or CD278, cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), programmed cell death protein (PD-1), programmed cell death ligand 1 (PD-L1), T-cell immunoglobulin and mucin domain 3(TIM-3), lymphocyte Activation Gene 3 (LAG3) or CD223, T cell immunoreceptor with Ig and ITIM domains (TIGIT), or combination thereof.
[0146] In some embodiments, the tumor antigen targeted by the modified immune effector cell is disialoganglioside (GD2).
[0147] In some embodiments, the tumor antigen targeted by the modified immune effector cell is CD19, CD22, CD123, CD33, or a fragment or variant thereof.
[0148] In some embodiments, the tumor antigen targeted by the modified immune effector cell is HER2, IL13Rα2, or EphA2, or a fragment or variant thereof.
[0149] In some embodiments, the tumor antigen targeted by the modified immune effector cell is HER2. Human epidermal growth factor receptor 2 (HER2), also referred to as HER2 / neu, receptor tyrosine-protein kinase erbB-2, CD340 (cluster of differentiation 340), proto-oncogene Neu, or ERBB2, is a membrane tyrosine kinase and oncogene that is overexpressed in some types of cancer.
[0150] In some embodiments, the tumor antigen targeted by the modified immune effector cell is IL13Rα2. Interleukin-13 receptor subunit alpha-2 (IL13Rα2), also referred to as CD213A2 (cluster of differentiation 213A2), is a membrane bound protein that, in humans, is encoded by the IL13RA2 gene.
[0151] In some embodiments, the tumor antigen targeted by the modified immune effector cell is EphA2. Ephrin type-A receptor 2 (EphA2), also referred to as Eck (epithelial cell kinase), Myk2, or Sek2, is a member of the Eph receptor tyrosine kinase family which binds Ephrins A1, 2, 3, 4, and 5.
[0152] In some embodiments, the tumor antigen targeted by the modified immune effector cell is B7-H3 (CD276), or a fragment or variant thereof. B7 Homolog 3 (B7-H3) or CD276 (cluster of differentiation 276) is a type I transmembrane protein that is an immune checkpoint molecule and a costimulatory / coinhibitory immunoregulatory protein. Without wishing to be bound by theory, B7-H3 is highly expressed in tumor tissues (e.g., breast cancer, lung cancer, ovarian cancer, brain tumor, gastric cancer, and squamous cell carcinoma) where it participates in shaping and development of the tumor microenvironment, while showing limited expression 34 304098633v1Attorney Docket No: 243734.000206 in normal tissues. B7-H3 may also support pro-tumorigenic functions, e.g., enhanced invasive and migratory properties, and has been correlated with worsened prognosis, poor survival, and recurrence rate. In some embodiments, the modified immune effector cell further comprises a chimeric antigen receptor (CAR), an antigen specific T-cell receptor, or a bispecific antibody.
[0153] In some embodiments, the modified immune effector cell of the present disclosure further comprises an antigen specific T-cell receptor. Antigen specific T-cell receptors are T- cell receptors (TCRs) that are specific for recognizing a particular antigen. In some embodiments, the modified immune effector cell comprises a T cell receptor (TCR), or a functional fragment thereof. By way of a non-limiting example, a functional fragment of a TCR may immunospecifically bind to a particular antigen (or epitope) while retaining the capability to immunospecifically bind to the antigen (or epitope). In various embodiments, a functional fragment of a TCR may comprise at least one complementary determining region (CDR) of the alpha (α) chain and / or beta (β) chain of the TCR. In various embodiments, a functional fragment of a TCR may comprise two or more complementary determining regions (CDRs) of the α chain and / or β chain of the TCR. In various embodiments, a functional fragment of a TCR may comprise at least one complementary determining region (CDR) of the gamma (γ) chain and / or delta (δ) chain of the TCR. In various embodiments, a functional fragment of a TCR may comprise two or more complementary determining regions (CDRs) of the gamma chain and / or delta chain of the TCR.
[0154] In some embodiments, the TCR disclosed herein may comprise, for example, one or more of an α chain of a TCR, a β chain of a TCR, a δ chain of a TCR, a γ chain of a TCR, or a combination thereof. In some embodiments, the TCR may further comprise a constant region. The constant region may be derived from any suitable species such as, e.g., human or mouse.
[0155] In some embodiments, the TCR may comprise an α chain and / or a β chain of the TCR. In some embodiments, the TCR may comprise, e.g., constant regions of α and / or β chains of the TCR.
[0156] In some embodiments, the antigen specific TCR may recognize, without limitation, any of the antigens (e.g., an antigen(s) on a cancer cell) disclosed herein. In various embodiments, the TCR of the disclosure may specifically bind to an antigen selected from, for example, CD7, CD74, CD80, CD86, CDS, CEA, EGP-2, EGP-40, EpCAM, erb-B2,3,4, FBP, fetal acetylcholine receptor, folate receptor-α, GD2, GD3, HER2, hTERT, ICOSL, IL-13R-α2, KDR, K-light chain, LeY, Ll cell, MAGE-Al, Mesothelin, MUC1, MUC16, NKG2D ligands, 35 304098633v1Attorney Docket No: 243734.000206 NY-ESO-1, oncofetal antigen (h5T4), PD-L1, PD-L2, PSCA, PSMA, ROR1, TAG-72, VEGF- R2, and WT-1.
[0157] In some embodiments, the modified immune effector cell further comprises a bispecific antibody. Bispecific antibodies are antibodies that are capable of binding to two different antigens or two different epitopes of the same antigen. For example, the modified immune effector cell may comprise a bispecific antibody that is capable of binding to a molecule on the immune effector cell and is also capable of binding to an antigen on a target cell. Chimeric Antigen Receptor (CAR)
[0158] In some embodiments, the modified immune effector cell further comprises a chimeric antigen receptor (CAR).
[0159] CARs are typically comprised primarily of 1) an extracellular antigen-binding domain comprising an antigen-binding moiety, such as a single-chain variable fragment (scFv) derived from an antigen-specific monoclonal antibody, and 2) a cytoplasmic domain comprising a lymphocyte activation domain, such as the zeta (ζ)-chain from the T cell receptor CD3. These two regions are fused together via a transmembrane domain. Upon transduction, the lymphocyte expresses the CAR on its surface, and upon contact and ligation with the target antigen, it signals through the lymphocyte activation domain (e.g., CD3ζ chain) inducing cytotoxicity and cellular activation.
[0160] In some embodiments, the modified immune effector cell disclosed herein may comprise a CAR comprising, for example, (i) an extracellular antigen-binding domain, (ii) a transmembrane domain, and (iii) a cytoplasmic domain.
[0161] Constructs with only the antigen-specific binding region together with the lymphocyte activation domain are termed first-generation CARs. While activation of lymphocytes through a lymphocyte activation domain such as CD3ζ is sufficient to induce tumor-specific killing, such CARs can fail to optimally induce T cell proliferation and survival in vivo. The second-generation CARs added co-stimulatory polypeptides to boost the CAR- induced immune response. For example, the co-stimulating polypeptide CD28 signaling domain was added to the CAR construct. This region generally contains the transmembrane region of the co-stimulatory peptide (in place of the CD3ζ transmembrane domain) with motifs for binding other molecules such as PI3K and Lck. T cells expressing CARs with only CD3ζ vs CARs with both CD3ζ and a co-stimulatory domain (e.g., CD28) demonstrated that CARs expressing both domains can achieve greater activity. The most commonly used co-stimulating 36 304098633v1Attorney Docket No: 243734.000206 molecules include CD28 and 4-1BB, which promote both T cell proliferation and cell survival. The third-generation CAR includes three signaling domains (e.g., CD3ζ, CD28, and 4-1BB), which can further improve lymphocyte cell survival and efficacy. Examples of third-generation CARs include CD19 CARs, most notably for the treatment of chronic lymphocytic leukemia (Milone, M. C., et al., (2009) Mol. Ther. 17:1453-1464; Kalos, M., et al., Sci. Transl. Med. (2011) 3:95ra73; Porter, D., et al., (2011) N. Engl. J. Med. 365: 725-533, each of which is herein incorporated by reference in its entirety for all purposes). Studies in three patients showed impressive function, expanding more than a 1000-fold in vivo, and resulted in sustained remission in all three patients.
[0162] In some embodiments, the CAR expressed by a modified immune effector cell described herein comprises an extracellular antigen-binding domain and a transmembrane domain. In some embodiments, the CAR further comprises a cytoplasmic domain. Each domain is fused in frame.
[0163] In some embodiments, the CAR expressed by a modified immune effector cell described herein is a first-generation CAR. In some embodiments, the CAR expressed by a modified immune effector cell described herein is a second-generation CAR.
[0164] The choice of extracellular antigen-binding domain depends upon the type and number of antigens that define the surface of a target cell. For example, the extracellular antigen-binding domain may be chosen to recognize an antigen that acts as a cell surface marker on target cells associated with a particular disease state. In some embodiments, the CARs can be genetically modified to target a tumor antigen of interest by way of engineering a desired extracellular antigen-binding domain that specifically binds to an antigen (e.g., on a cancer cell). Non-limiting examples of cell surface markers that may act as targets for the extracellular antigen-binding domain of the CAR include those associated with cancer cells.
[0165] In some embodiments, the extracellular antigen-binding domain comprises an antigen-binding polypeptide, or functional variant thereof, that binds to an antigen. In some embodiments, the antigen-binding polypeptide is an antibody or an antibody fragment that binds to an antigen.
[0166] In some embodiments, the antigen-binding polypeptide can be monomeric or multimeric (e.g., homodimeric or heterodimeric), or associated with multiple proteins in a non- covalent complex. In some embodiments, the extracellular antigen-binding domain may consist of an Ig heavy chain. In some embodiments, the Ig heavy chain can be covalently associated with Ig light chain (e.g., via the hinge and optionally the CH1 region). In some embodiments, the Ig heavy chain may become covalently associated with other Ig heavy / light chain 37 304098633v1Attorney Docket No: 243734.000206 complexes (e.g., by the presence of hinge, CH2, and / or CH3 domains). In the latter case, the heavy / light chain complex that becomes joined to the chimeric construct may constitute an antibody with a specificity distinct from the antibody specificity of the chimeric construct. In some embodiments, the entire chain may be used. In some embodiments, a truncated chain may be used, where all or a part of the CH1, CH2, or CH3 domains may be removed, or all or part of the hinge region may be removed. Non-limiting examples of antigen-binding polypeptides include antibodies and antibody fragments such as, e.g., murine antibodies, rabbit antibodies, human antibodies, fully humanized antibodies, single chain variable fragments (scFv), single chain antibodies, Fab fragments, F(ab′) fragments, disulfide-linked Fvs (sdFv), intrabodies, minibodies, or diabodies, camelid antibody variable domains and humanized versions, shark antibody variable domains and humanized versions, single domain antibody variable domains, nanobodies (VHHs), and camelized antibody variable domains. In some embodiments, the antigen-binding polypeptide includes an scFv.
[0167] An extracellular antigen-binding domain of the present disclosure comprises an extracellular antigen-binding moiety. In some embodiments, the extracellular antigen-binding moiety comprises an antibody or an antibody fragment that binds to an antigen. Antigen- binding moieties may comprise antibodies and / or antibody fragments such as monoclonal antibodies, multispecific antibodies, chimeric antibodies, single-chain Fvs (scFv), single chain antibodies, Fab fragments, F(ab′) fragments, disulfide-linked Fvs (sdFv), intrabodies, minibodies, single domain antibody variable domains, nanobodies (VHHs), diabodies and anti- idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antigen specific TCR), and epitope-binding fragments of any of the above. Antibodies and / or antibody fragments may be derived from murine antibodies, rabbit antibodies, human antibodies, fully humanized antibodies, camelid antibody variable domains and humanized versions, shark antibody variable domains and humanized versions, and camelized antibody variable domains.
[0168] In some embodiments, the extracellular antigen-binding moiety comprises an scFv capable of binding to, e.g., CD19, CD22, CD123, CD33, CD80, CD86, B7-H3 (CD276), CTLA-4, HER2, ICOS, ICOSL, IL13Rα2, EphA2, PD-L1, and / or PD-1.
[0169] In some embodiments, the antigen-binding moiety comprises a ligand. Non-limiting examples of CARs comprising an antigen-binding moiety comprising a ligand include IL-13 mutein-CARs or CD27-CARs. In some embodiments, the antigen-binding moiety may comprise a peptide sequence. Non-limiting examples of CARs comprising an antigen-binding moiety comprising a peptide sequence include chlorotoxin and GRP78-CARs. See, for 38 304098633v1Attorney Docket No: 243734.000206 example, PCT Patent Application WO / 2021 / 216994, which is herein incorporated by reference in its entirety.
[0170] In some embodiments, the antigen-binding moiety binds to at least one tumor antigen. In some embodiments, the antigen-binding moiety binds to two or more tumor antigens. In some embodiments, the two or more tumor antigens are associated with the same tumor. In some embodiments, the two or more tumor antigens are associated with different tumors.
[0171] In some embodiments, the antigen-binding moiety binds to at least one antigen of an extracellular matrix. In some embodiments, the antigen-binding moiety binds to two or more antigens of the extracellular matrix. In some embodiments, the two or more tumor antigens are associated with the same extracellular matrix. In some embodiments, the two or more tumor antigens are associated with different extracellular matrices.
[0172] In some embodiments, the antigen-binding moiety binds to at least one antigen present on cells within the tumor microenvironment. In some embodiments, the antigen- binding moiety binds to two or more antigens present on cells within the tumor microenvironment. In some embodiments, the two or more antigens are associated with the same cell. In some embodiments, the two or more tumor antigens are associated with different cells.
[0173] In some embodiments, the tumor antigen is associated with basal cell carcinoma, breast cancer, colorectal cancer, glioblastoma, lung carcinoma, squamous cell carcinoma, ovarian cancer, cervical cancer, head and neck cancer, liver cancer, prostate cancer, pancreatic cancer, renal cell carcinoma, bladder cancer, or hematologic malignancy. Non-limiting examples of the tumor antigens associated with basal cell carcinoma, breast cancer, colorectal cancer, lung carcinoma, squamous cell carcinoma include PD-1 and PD-L1. Non-limiting examples of the tumor antigen associated with colon adenocarcinoma (COAD), endocervical adenocarcinoma (CESC), and lung adenocarcinoma (LUAD) includes ICOS. Non-limiting examples of the tumor antigen associated with Breast invasive carcinoma (BRCA), Cholangiocarcinoma (CHOL), Esophageal carcinoma (ESCA), Glioblastoma multiforme (GBM), Head and Neck squamous cell carcinoma (HNSC), Kidney renal papillary cell carcinoma (KIRP), Kidney renal clear cell carcinoma (KIRC), Brain Lower Grade Glioma (LGG), Liver hepatocellular carcinoma (LIHC), Lung adenocarcinoma (LUAD), Lung squamous cell carcinoma (LUSC), Stomach adenocarcinoma (STAD) includes TIGIT. Non- limiting examples of the tumor antigens associated with cervical cancer or head and neck cancer include PD-1, PD-L1, TIGIT, MUC1, Mesothelin, HER2, GD2, and EGFR. Non- 39 304098633v1Attorney Docket No: 243734.000206 limiting examples of tumor antigens associated with ovarian cancer include PD-1, FOLR1, FSHR, MUC16, MUC1, Mesothelin, CA125, EpCAM, EGFR, PDGFRα, Nectin-4, B7-H3 and B7-H4. Non-limiting examples of tumor antigens associated with hematological malignancies include BCMA, GPRC5D, SLAM F7, CD33, CD19, CD22, CD79, CLL1, CD123, and CD70. Non-limiting examples of tumor antigens associated with bladder cancer include Nectin-4 and SLITRK6. Non-limiting examples of tumor antigens associated with renal cancer include CD70 and FOLR1. Non-limiting examples of tumor antigen associated with glioblastoma include TIGIT, FGFR1, FGFR3, MET, CD70, ROBO1, IL13Rα2, HER2, EGFRvIII, EGFR, CD133, and PDGFRA. Non-limiting examples of tumor antigen associated with liver cancer include, CTLA-4, PD-1, EpCAM, cMET, AFP, Claudin 18.2, and GPC-3.
[0174] Additional examples of antigens that may be targeted by the antigen-binding moiety include, but are not limited to, alpha-fetoprotein, A3, antigen specific for A33 antibody, Ba 733, BrE3-antigen, carbonic anhydrase Ep-CAM, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB6, FIt-I, Flt-3, folate receptor, HLA-DR, human chorionic gonadotropin (HCG) and its subunits, hypoxia inducible factor (HIF-I), Ia, IL-2, IL-6, IL-8, insulin growth factor-1 (IGF-I), KC4-antigen, KS-1- antigen, KS1-4, Le-Y, macrophage inhibition factor (MIF), MAGE, MUC2, MUC3, MUC4, NCA66, NCA95, NCA90, EX, EGFR, EGP-I, EGP-2, antigen specific for PAM-4 antibody, placental growth factor, p53, prostatic acid phosphatase, PSA, PSMA, RS5, S100, CD1, CD1a, CD3, CD5, CD15, CD16, CD19, CD20, CD21, CD22, CD23, CD25, CD30, CD33, CD38, CD45, CD74, CD79a, CD80, CD123, CD138, colon-specific antigen-p (CSAp), CEA (CEACAM5), CEACAM6, CSAp, TAC, TAG-72, tenascin, VEGF, ED-B fibronectin, COL11A1, 17-1A-antigen, TRAIL receptors, Tn antigen, Thomson-Friedenreich antigens, tumor necrosis antigens, an oncogene marker, an oncogene product, and an angiogenesis marker.
[0175] In some embodiments, the antigen targeted by CARs of the present disclosure is an antigen expressed in the tumor stroma. Exemplary antigens expressed in the tumor stroma that may be targeted by CARs of the present disclosure include, but are not limited to, oncofetal splice variants of fibronectin and tenascin C, tumor-specific splice variants of collagen, and fibroblast activating protein (FAP).
[0176] In some embodiments, the antigen targeted by CARs of the present disclosure is an antigen expressed on endothelial cell. Exemplary antigens expressed on endothelial cells that may be targeted by CARs of the present disclosure include, but are not limited to, VEGF receptors and tumor endothelial markers (TEMs). 40 304098633v1Attorney Docket No: 243734.000206
[0177] In some embodiments, the extracellular antigen-binding domain further comprises a leader sequence. The leader sequence may be located at the amino-terminus of the extracellular antigen-binding domain. The leader sequence may be optionally cleaved from the antigen-binding domain during cellular processing and localization of the CAR to the cellular membrane.
[0178] In some embodiments, the CARs expressed by the modified immune effector cell comprise a transmembrane domain. The transmembrane domain may be fused in frame between the extracellular target-binding domain and the cytoplasmic domain.
[0179] The transmembrane domain may be derived from the protein contributing to the extracellular target-binding domain, the protein contributing the signaling or co-signaling domain, or by a totally different protein. In some instances, the transmembrane domain can be selected or modified by amino acid substitution, deletions, or insertions to minimize interactions with other members of the CAR complex. In some instances, the transmembrane domain can be selected or modified by amino acid substitution, deletions, or insertions to avoid-binding of proteins naturally associated with the transmembrane domain. In some embodiments, the transmembrane domain includes additional amino acids to allow for flexibility and / or optimal distance between the domains connected to the transmembrane domain.
[0180] The transmembrane domain may be derived either from a natural or from a synthetic source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein. Non-limiting examples of transmembrane domains of particular use in this disclosure may be derived from (i.e., comprise at least the transmembrane region(s) of) the α, β or ζ chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD40, CD64, CD80, CD86, CD134, CD137, CD154. Alternatively, the transmembrane domain may be synthetic, in which case the transmembrane domain will comprise predominantly hydrophobic residues such as leucine and valine. For example, a triplet of phenylalanine, tryptophan and / or valine can be found at each end of a synthetic transmembrane domain.
[0181] In some embodiments, the transmembrane domain may be derived from CD8α, CD28, CD8, CD4, CD3ζ, CD40, CD134 (OX-40), NKG2A / C / D / E, or CD7. In some embodiments, the transmembrane domain may be derived from CD28.
[0182] In some embodiments, the transmembrane domain is derived from CD3ζ, CD28, CD4, or CD8^. 41 304098633v1Attorney Docket No: 243734.000206
[0183] In some embodiments, it will be desirable to utilize the transmembrane domain of theζ,ηor FcεR1γ chains which contain a cysteine residue capable of disulfide bonding so that the resulting chimeric protein will be able to form disulfide linked dimers with itself, or with unmodified versions of the ζ, η or FcεR1γ chains or related proteins. In some instances, the transmembrane domain will be selected or modified by an amino acid substitution(s) to avoid- binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex. In other cases, it will be desirable to employ the transmembrane domain of ζ, η or FcεR1γ and -β, MB1 (Igα.), B29 or CD3- γ,ζ, or η, in order to retain physical association with other members of the receptor complex.
[0184] In some embodiments, the CAR further comprises a linker domain between the extracellular antigen-binding domain and the transmembrane domain, and the antigen-binding domain, the linker, and the transmembrane domain are in frame with each other.
[0185] The term “linker domain” as used herein generally means any oligo- or polypeptide that functions to link the antigen-binding moiety to the transmembrane domain. A linker domain can be used to provide more flexibility and accessibility for the antigen-binding moiety. A linker domain may comprise up to 300 amino acids, preferably 10 to 100 amino acids and most preferably 25 to 50 amino acids. A linker domain may be derived from all or part of naturally occurring molecules, such as from all or part of the extracellular region of CD8, CD4 or CD28, or from all or part of an antibody constant region. Alternatively, the linker domain may be a synthetic sequence that corresponds to a naturally occurring linker domain sequence, or may be an entirely synthetic linker domain sequence. Non-limiting examples of linker domains which may be used in accordance with the disclosure include a part of human CD8α chain, partial extracellular domain of CD28, FcγRllla receptor, IgG, IgM, IgA, IgD, IgE, an Ig hinge, or functional fragment thereof. In some embodiments, additional linking amino acids are added to the linker domain to ensure that the antigen-binding moiety is an optimal distance from the transmembrane domain. In some embodiments, when the linker is derived from an Ig, the linker may be mutated to prevent Fc receptor binding.
[0186] Hinge regions suitable for use in the present disclosure may be derived from an immunoglobulin IgG hinge or functional fragment, including IgG1, IgG2, IgG3, IgG4, IgM1, IgM2, IgA1, IgA2, IgD, IgE, or a chimera or variant thereof.
[0187] In some embodiments, the CAR expressed by the immune effector cell described herein further comprises a cytoplasmic domain. In some embodiments, the cytoplasmic domain of the CAR comprises one or more lymphocyte activation domains. 42 304098633v1Attorney Docket No: 243734.000206
[0188] The cytoplasmic domain, which comprises the lymphocyte activation domain of the CAR, is responsible for activation of at least one of the normal effector functions of the lymphocyte in which the CAR has been placed in. The term “effector function” refers to a specialized function of a cell. Effector function of a T cell, for example, may be cytolytic activity or helper activity including the secretion of cytokines. Thus, the term “lymphocyte activation domain” refers to the portion of a protein which transduces the effector function signal and directs the cell to perform a specialized function. While usually the entire lymphocyte activation domain is present, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion may be used in place of the intact chain as long as it transduces the effector function signal. The term intracellular signaling domain is thus meant to include any truncated portion of the lymphocyte activation domain sufficient to transduce the effector function signal.
[0189] Non-limiting examples of lymphocyte activation domains which can be used in the CARs described herein include those derived from DAP10, DAP12, Fc epsilon receptor I γ chain (FCER1G), CD3δ, CD3ε, CD3γ, CD3ζ, CD27, CD28, CD40, CD134, CD137, CD226, CD79A, ICOS, and MyD88.
[0190] Non-limiting examples of co-stimulatory domains which can be used in the CARs of the present disclosure include those derived from 4-1BB (CD137), CD28, CD40, ICOS, CD134 (OX-40), BTLA, CD27, CD30, GITR, CD226, CD79A, HVEM, MyD88, IL-2Rβ, or the STAT3-binding YXXQ. In some embodiments, the CAR of the present disclosure comprises one co-stimulatory domain. In some embodiments, the CAR of the present disclosure comprises a co-stimulatory domain derived from CD28.
[0191] In some embodiments, the co-stimulatory domains which can be used in the CARs of the present disclosure may be derived from CD28, 4-1BB, CD27, CD40, CD134, CD226, CD79A, ICOS, or MyD88, or any combination thereof.
[0192] In some embodiments, the CAR of the present disclosure comprises one or more co-stimulatory domains. In some embodiments, the CAR of the present disclosure comprises two or more co-stimulatory domains. In certain embodiments, the CAR of the present disclosure comprises two, three, four, five, six, or more co-stimulatory domains. For example, the CAR of the present disclosure may comprise a co-stimulatory domain derived from 4-1BB and a co-stimulatory domain derived from CD28.
[0193] In certain embodiments, the CARs of the present disclosure comprise a cytoplasmic domain, which comprises a signaling domain, a MyD88 polypeptide or functional fragment thereof, and a CD40 cytoplasmic polypeptide region, or a functional fragment thereof. In 43 304098633v1Attorney Docket No: 243734.000206 certain embodiments, the CAR lacks the CD40 transmembrane and / or CD40 extracellular domains. In certain embodiments, the CAR includes the CD40 transmembrane domain. In certain embodiments, the CAR includes the CD40 transmembrane domain and a portion of the CD40 extracellular domain, wherein the CD40 extracellular domain does not interact with natural or synthetic ligands of CD40.
[0194] In some embodiments, the signaling domain(s) and co-stimulatory domain(s) can be in any order. In some embodiments, the signaling domain is upstream of the co-stimulatory domains. In some embodiments, the signaling domain is downstream from the co-stimulatory domains. In the cases where two or more co-stimulatory domains are included, the order of the co-stimulatory domains could be switched.
[0195] In some embodiments, the cytoplasmic domain comprises both the CD3ζ lymphocyte activation domain and the CD28 co-stimulatory domain, which are fused in frame. The CD3ζ lymphocyte activation domain and the CD28 co-stimulatory domain can be in any order. In some embodiments, the CD3ζ lymphocyte activation domain is downstream of the CD28 co-stimulatory domain.
[0196] In addition to the CAR construct, the CAR may further comprise at least one additional gene that encodes an additional peptide. Examples of additional genes can include a transduced host cell selection marker, an in vivo tracking marker, cellular marker, epitope tag, a cytokine, a suicide gene, safety switch, or some other functional gene. In certain embodiments, the additional functional gene can induce the expression of another molecule. In certain embodiments, the additional functional gene can increase the safety of the CAR. For example, the CAR construct may comprise an additional gene which is truncated CD19 (tCD19). The tCD19 can be used as a tag. Expression of tCD19 may also help determine transduction efficiency.
[0197] Other examples of additional genes include genes that encode polypeptides with a biological function; examples include, but are not limited to, cytokines, chimeric cytokine receptors, dominant negative receptors, safety switches (CD20, truncated EGFR or HER2, inducible caspase 9 molecules). As another example, the CAR construct may comprise an additional gene which is a synNotch receptor. Once activated, the synNotch receptor can induce the expression of a target gene (e.g., a second CAR and / or bispecific molecule).
[0198] In some embodiments, the CAR may comprise one or more additional nucleotide sequences encoding one or more additional polypeptide sequences. As a non-limiting example, the one or more additional polypeptide sequences may be selected from one or more cellular 44 304098633v1Attorney Docket No: 243734.000206 markers, epitope tags, cytokines, safety switches, dimerization moieties, or degradation moieties.
[0199] In certain embodiments, the CAR comprises at least one additional gene (i.e., a second gene). In certain embodiments, the CAR comprises one second gene. In other embodiments, the CAR comprises two additional genes (i.e., a third gene). In yet another embodiment, the CAR comprises three additional genes (i.e., a fourth gene). In certain embodiments, the additional genes are separated from each other and the CAR construct. For example, the additional genes may be separated by 2A sequences and / or an internal ribosomal entry sites (IRES). In certain examples, the CAR can be at any position of the polynucleotide chain (for example construct A: CAR, second gene, third gene, fourth gene; construct B: second gene, CAR, third gene, fourth gene; etc.).
[0200] Non-limiting examples of classes of accessory genes that can be used to increase the effector function of CAR containing immune effector cells, include i) secretable cytokines (e.g., but not limited to, IL-7, IL-12, IL-15, IL-18), ii) membrane bound cytokines (e.g., but not limited to, IL-15), iii) chimeric cytokine receptors (e.g., but not limited to, IL-2 / IL-7, IL- 4 / IL-7), iv) constitutive active cytokine receptors (e.g., but not limited to, C7R), v) dominant negative receptors (DNR; e.g., but not limited to TGFRII DNR), vi) ligands of co-stimulatory molecules (e.g., but not limited to, CD80, 4-1BBL), vii) antibodies, including fragments thereof and bispecific antibodies (e.g., but not limited to, bispecific T-cell engagers (BiTEs)), or vii) a second CAR.
[0201] In certain embodiments, the additional functional gene can be a suicide gene. A suicide gene is a recombinant gene that will cause the host cell that the gene is expressed in to undergo programmed cell death or antibody mediated clearance at a desired time. Suicide genes can function to increase the safety of the CAR. In another embodiment, the additional gene is an inducible suicide gene. Non-limiting examples of suicide genes include: i) molecules that are expressed on the cell surface and can be targeted with a clinical grade monoclonal antibody including CD20, EGFR or a fragment thereof, HER2 or a fragment thereof, and ii) inducible suicide genes (e.g., but not limited to inducible caspase 9 (see Straathof et al. (2005) Blood. 105(11): 4247-4254; US Publ. No. 2011 / 0286980, each of which is incorporated herein by reference in its entirety for all purposes)).
[0202] In certain aspects, CARs of the present disclosure may be regulated by a safety switch. As used herein, the term “safety switch” refers to any mechanism that is capable of removing or inhibiting the effect of a CAR from a system (e.g., a culture or a subject). Safety switches can function to increase the safety of the CAR. 45 304098633v1Attorney Docket No: 243734.000206
[0203] The function of the safety switch may be inducible. Non-limiting examples of safety switches include: (a) molecules that are expressed on the cell surface and can be targeted with a clinical grade monoclonal antibody including CD20, EGFR or a fragment thereof, HER2 or a fragment thereof; and (b) inducible suicide genes (e.g., but not limited to herpes simplex virus thymidine kinase (HSV-TK) and inducible caspase 9 (see Straathof et al. (2005) Blood. 105(11): 4247-4254; US Publ. No. 2011 / 0286980, each of which is incorporated herein by reference in its entirety for all purposes).
[0204] In some embodiments, the safety switch is a CD20 polypeptide. Expression of human CD20 on the cell surface presents an attractive strategy for a safety switch. Cells that express CD20 can be rapidly eliminated with the FDA approved monoclonal antibody rituximab through complement-mediated cytotoxicity and antibody-dependent cell-mediated cytotoxicity (see e.g., Griffioen, M., et al. Haematologica 94, 1316-1320 (2009), which is incorporated herein by reference in its entirety for all purposes). Rituximab is an anti-CD20 monoclonal antibody that has been FDA approved for Chronic Lymphocytic Leukemia (CLL) and Non-Hodgkin’s Lymphoma (NHL), among others (Storz, U. MAbs 6, 820-837 (2014), which is incorporated herein by reference in its entirety for all purposes). The CD20 safety switch is non-immunogenic and can function as a reporter / selection marker in addition to a safety switch (Bonifant, C.L., et al. Mol Ther 24, 1615-1626 (2016); van Loenen, M.M., et al. Gene Ther 20, 861-867 (2013); each of which is incorporated herein by reference in its entirety for all purposes).
[0205] In some embodiments, the polynucleotide sequence(s) encoding the CARs of the present disclosure may be expressed in an inducible fashion, for example, as may be achieved with an inducible promoter, an inducible expression system, an artificial signaling circuits, and / or drug-induced splicing.
[0206] In some embodiments, the polynucleotide sequence(s) encoding the CARs of the present disclosure may be expressed in an inducible fashion, such as that which may be achieved with: i) an inducible promoter, for example, but not limited to, promotors that may be activated by T cell activation (e.g. NFAT, Nur66, IFN^) or hypoxia; ii) an inducible expression system, for example, but not limited to doxycycline- or tamoxifen- inducible expression system; iii) artificial signaling circuits including, but not limited to, SynNotch; and / or iv) drug-induced splicing.
[0207] In some embodiments, the polynucleotide sequence(s) encoding the CARs disclosed herein may be expressed as a “split molecule” in which, for example, transmembrane 46 304098633v1Attorney Docket No: 243734.000206 and intracellular signaling regions, or any other domains or regions of the CAR, may be assembled only in the presence of a heterodimerizing small molecule (e.g., small organic molecule, nucleic acid, polypeptide, or a fragment, isoform, variant, analog, or derivative thereof).
[0208] In some embodiments, the polynucleotide sequence(s) encoding the CARs herein may further encode a moiety so that the stability of CAR may be regulated with a small molecule including, but not limited to, the “SWIFF” technology or an immunomodulatory drug (IMiD)-inducible degron.
[0209] A “separation sequence” refers to a peptide sequence that causes a ribosome to release the growing polypeptide chain that it is being synthesizes without dissociation from the mRNA. In this respect, the ribosome continues translating and therefore produces a second polypeptide.
[0210] Alternatively, an Internal Ribosome Entry Site (IRES) may be used to link the CAR and the additional gene. IRES is an RNA element that allows for translation initiation in a cap- independent manner. IRES can link two coding sequences in one bicistronic vector and allow the translation of both proteins in cells.
[0211] In certain embodiments, the immune effector cells can be genetically modified to express not only CARs as disclosed herein but also to express a fusion protein with signaling activity (e.g., costimulation, T-cell activation). These fusion proteins can improve host cell activation and / or responsiveness. In certain embodiments, the fusion protein can enhance the host cell’s response to the target antigen. In certain embodiments, the fusion protein can impart resistance to suppression signals.
[0212] In certain embodiments, fusion proteins can comprise portions of CD4, CD8α, CD28, portions of a T-cell receptor, or an antigen-binding moiety (e.g., scFv) linked to a MyD88, CD40, and / or other signaling molecules.
[0213] In certain embodiments, the fusion protein comprises an extracellular target-binding domain (as disclosed above), a transmembrane domain (as described above) and a cytoplasmic domain, and the cytoplasmic domain comprises at least one co-stimulatory protein (as described above). In certain embodiments, the co-stimulatory fusion protein does not comprise a lymphocyte activation domain (e.g., CD3ζ). In certain embodiments, the at least one co- stimulatory protein can be a MyD88 polypeptide or functional fragment thereof, and / or a CD40 cytoplasmic polypeptide region or a functional fragment thereof.
[0214] In certain embodiments, the fusion protein comprises an extracellular domain (such as, but not limited to CD19, CD34), a transmembrane domain (as described above) and a 47 304098633v1Attorney Docket No: 243734.000206 cytoplasmic domain, wherein the cytoplasmic domain comprises at least one co-stimulatory protein (as described above). In certain embodiments, the fusion protein does not comprise a lymphocyte activation domain (e.g., CD3ζ). In certain embodiments, the at least one portion of the fusion protein can be a MyD88 polypeptide or functional fragment thereof, and / or a CD40 cytoplasmic polypeptide region or a functional fragment thereof.
[0215] Non-limiting examples of fusion proteins include, but are not limited to, the constructs in the publication of WO2019222579 and WO2016073875, which are incorporated herein by reference in their entirety for all purposes.
[0216] In certain embodiments, the fusion proteins are introduced into the immune effector cells on a separate vector from the CAR. In certain embodiments, the fusion proteins are introduced into the immune effector cells on the same vector as the CAR. In certain embodiments, the fusion proteins are introduced into the immune effector cells on the same vector as the CAR but separated by a separation sequence such as 2A. Methods for Generating Modified Immune Effector Cells
[0217] In one aspect, the present disclosure provides a method for generating a modified immune effector cell described herein. In a related aspect, the present disclosure provides a method of preserving developmental potential of an immune effector cell. Such methods may comprise modifying an ETS1 gene or gene product in the cell so that the expression and / or function of ETS1 in the cell is reduced or eliminated. As a non-limiting example, the immune effector cell may be any of the various T cells disclosed herein. In particular, the T cell may be selected from, e.g., T cell a CD8+T cell, a CD4+T cell, a cytotoxic T cell, an αβ T cell receptor (TCR) T cell, a natural killer T (NKT) cell, a γδ T cell, a memory T cell, a T-helper cell, and a regulatory T cell (Treg) , a memory T cell (Tscm or TSCM), a central memory T cell (Tcm or TCM), an effector memory T cell (Tern or TEM), an effector T cell (Teff, TEFF or TE), a precursor exhausted T cell (Tpex or TPEX), an exhausted T cell (Tex or TEX) or terminally exhausted T (Tex) cell. In some embodiments, the immune effector cell is CD8+T cell. In some embodiments, the above-described methods may comprise modifying the immune effector cell to express a CAR disclosed herein that is capable of binding to an antigen, e.g., an antigen specific to tumor disclosed herein.
[0218] The methods of the disclosure may further comprise modifying a RBPJ gene or gene product in the cell so that the expression and / or function of RBPJ in the cell is reduced or eliminated. In some embodiments, the ETS1 gene, and / or the RBPJ gene may be deleted. In certain embodiments, when the RBPJ gene is deleted or modified. 48 304098633v1Attorney Docket No: 243734.000206
[0219] In some embodiments, the ETS1 and / or RBPJ gene or gene product in the immune effector cell may be modified in the presence of one or more inhibitory signals or agents (e.g., compound, small molecule, e.g., small organic molecule, nucleic acid, polypeptide, or a fragment, isoform, variant, analog, or derivative thereof).
[0220] As used herein, “small molecule inhibitors” include, but are not limited to, small peptides or peptide-like molecules, soluble peptides, and synthetic non-peptidyl organic or inorganic compounds. A small molecule inhibitor or antagonist can have a molecular weight of any of about 100 to about 20,000 Daltons (Da), about 500 to about 15,000 Da, about 1000 to about 10,000 Da. In some embodiments, the small molecule may be, for example, a peptide and / or a peptidomimetic. A peptidomimetic may include, e.g., chemically modified peptides and peptide-like molecules that contain non-naturally occurring amino acids, peptoids, and the like. Methods for identifying a peptidomimetics are well known in the art and may comprise the screening of databases that contain libraries of possible peptidomimetics.
[0221] In some embodiments, the ETS1 and / or RBPJ gene or gene product may be targeted using any number of various agents (e.g., a small molecule inhibitor). In some embodiments, the agent may be used to reduce the expression and / or activity of ETS1 and / or RBPJ in a modified immune effector cell disclosed herein.
[0222] In some embodiments, the ETS1 and / or RBPJ gene in the immune effector cell may be deleted or modified as a result of an activity of a site-specific nuclease.
[0223] Site-specific nucleases may create double-strand breaks or single-strand breaks (i.e., nicks) in a genomic DNA of a cell. Although not wishing to be bound by theory, these breaks are typically repaired by the cell using one of two mechanisms: non-homologous end joining (NHEJ) and homology-directed repair (HDR). In NHEJ, the double-strand breaks are repaired by direct ligation of the break ends to one another. As a result, no new nucleic acid material is inserted into the site, although a few bases may be lost or added, resulting in a small insertions and deletion (indel). In HDR, a donor polynucleotide with homology to the cleaved target DNA sequence is used as a template to repair the cleaved target DNA sequence, resulting in the transfer of genetic information from the donor polynucleotide to the target DNA. As such, new nucleic acid material may be inserted or copied into the cleavage site. In some cases, an exogenous donor polynucleotide can be provided to the cell. The modifications of the target DNA due to NHEJ and / or HDR may lead to, for example, gene correction, gene replacement, gene tagging, transgene insertion, nucleotide deletion, gene disruption, gene mutation, sequence replacement, etc. Accordingly, cleavage of DNA by a site-directed nuclease may be used to delete nucleic acid material from a target DNA sequence by cleaving the target DNA 49 304098633v1Attorney Docket No: 243734.000206 sequence and allowing the cell to repair the sequence in the absence of an exogenously provided donor polynucleotide. Thus, the methods can be used to knock out a gene (resulting in complete lack of transcription or altered transcription) or to knock in genetic material (e.g., a transgene) into a locus of choice in the target DNA.
[0224] In some embodiments, the site-specific nuclease is an RNA-guided endonuclease. In particular, a group of RNA-guided endonucleases known as CRISPR-associated (Cas) proteins may be employed to genetically modify the immune effector cell. A Cas protein may form an RNA-protein complex (referred to as RNP) with a guide RNA (gRNA) and is capable of cleaving a target site bearing sequence complementarity to a short sequence (typically about 20-40nt) in the gRNA. In some embodiments, the RNA-guided endonuclease is a Cas9 protein, Cpf1 (Cas12a) protein, C2c1 protein, C2c3 protein, or C2c2 protein.
[0225] In a specific embodiment, the RNA-guided endonuclease is a Cas9 protein. The Cas9 protein may be from S. pyogenes, Streptococcus thermophilus, Neisseria meningitidis, F. novicida, S. mutans or Treponema denticola. The Cas9 may be a native or a modified Cas9 protein.
[0226] In some embodiments, the Cas9 protein may be programmed with a gRNA that targets a locus within or near the ETS1 gene. In some embodiments, the gRNA targets a nucleotide sequence comprising SEQ ID NO: 1. In some embodiments, the Cas9 protein is programmed with a gRNA that comprises a nucleotide sequence of SEQ ID NO: 2. In some aspects, the present disclosure provides a guide RNA (gRNA) targeting ETS1 comprising a nucleotide sequence of SEQ ID NO: 2.
[0227] In some embodiments, the Cas9 protein may be programmed with a gRNA that targets a locus within or near the RBPJ gene. In some embodiments, the gRNA targets a nucleotide sequence comprising SEQ ID NO: 3. In some embodiments, the Cas9 protein is programmed with a gRNA that comprises a nucleotide sequence of SEQ ID NO: 4. In some aspects, the present disclosure provides a guide RNA (gRNA) targeting RBPJ comprising a nucleotide sequence of SEQ ID NO: 4.
[0228] In some embodiments, the Cas9 protein may be programmed with a gRNA that targets a locus within or near the RBPJ gene. In some embodiments, the gRNA targets a nucleotide sequence comprising SEQ ID NO: 5. In some embodiments, the Cas9 protein is programmed with a gRNA that comprises a nucleotide sequence of SEQ ID NO: 6. In some aspects, the present disclosure provides a guide RNA (gRNA) targeting RBPJ comprising a nucleotide sequence of SEQ ID NO: 6. 50 304098633v1Attorney Docket No: 243734.000206
[0229] In various embodiments, the ETS1 gene and / or the RBPJ gene is derived from a mammal. In some embodiments, the ETS1 gene and / or the RBPJ gene is derived from a mouse. In some embodiments, the ETS1 gene and / or the RBPJ gene is derived from a human.
[0230] In certain aspects, the present disclosure provides a ribonucleoprotein complex comprising a gRNA disclosed herein and a Cas9 protein.
[0231] In alternative embodiments, the site-specific nuclease which can be used in the methods described herein include a zinc finger nuclease, a TALEN nuclease, and a mega- TALEN nuclease.
[0232] In some embodiments, the ETS1 and / or RBPJ gene product in the immune effector cell is deleted or modified as a result of an activity of an RNA interference (RNAi) molecule or an antisense oligonucleotide. RNA interference (RNAi) refers to the process of sequence- specific post-transcriptional gene silencing in animals mediated by small interfering RNAs (siRNAs) (Fire et al., 1998, Nature, 391, 806; Hamilton et al., 1999, Science, 286, 950-951). Any small nucleic acid molecules capable of mediating RNAi, such as a short interfering nucleic acid (siNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), a micro-RNA (miRNA), and a short hairpin RNA (shRNA), may be to inhibit the expression of the ETS1 and / or RBPJ gene. An antisense oligonucleotide (ASO) is a short nucleotide sequence that can hybridize or bind (e.g., by Watson-Crick base pairing) in a complementary fashion to its target sequence.
[0233] In some embodiments, the RNAi molecule is a small interfering RNA (siRNA) or a small hairpin RNA (shRNA). siRNAs, also known as short interfering RNA or silencing RNA, are a class of double-stranded RNA molecules, 20-25 base pairs in length, and operating within the RNA interference (RNAi) pathway. shRNAs or short hairpin RNAs are a group of artificial RNA molecules with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi).
[0234] In various embodiments, the site-specific nuclease, the RNAi molecule, or the antisense oligonucleotide, as described above, is introduced into the immune effector cell via a viral vector, a non-viral vector, or by physical means.
[0235] In some embodiments, the immune effector cell is contacted with an effective amount of the signaling molecule or a carrier containing the signaling molecule. Suitable carriers include, but are not limited to, polymers, micelles, reverse micelles, liposomes, emulsions, hydrogels, microparticles, nanoparticles, and microspheres. In some embodiments, the carrier is a nanoparticle. 51 304098633v1Attorney Docket No: 243734.000206
[0236] In some embodiments, the immune effector cell is contacted with the signaling molecule more than once. The immune effector cell may be contacted with the signaling molecule 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, or more than 8 times. The immune effector cell may be contacted with the signaling molecule at a frequency of every 8 hours, every 12 hours, every 16 hours, every 24 hours, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every 8 days, every 8 days, every 10 days, once a week, twice a week, biweekly, once a month, twice a month, 3 times a month, 4 times a month, or 5 times a month.
[0237] In some embodiments, the signaling molecule is expressed in the immune effector cell. The signaling molecule may be expressed from a transgene introduced into the immune effector cell. The signaling molecule-expressing transgene may be introduced into the immune effector cell using a viral vector, a non-viral vector, or by physical means.
[0238] In some embodiments, the modified immune effector cell is further engineered to express a chimeric antigen receptor (CAR) as described herein. The CAR may comprise an extracellular antigen-binding domain, a transmembrane domain, and / or a cytoplasmic domain as described above. The CAR may be expressed from a transgene introduced into the immune effector cell. The CAR-expressing transgene may be introduced into the immune effector cell using a viral vector, a non-viral vector, or by physical means. Non-limiting examples viral vectors include a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a herpes viral vector, or a baculoviral vector. In some embodiments, the retroviral vector is a lentiviral vector. In some embodiments, the non-viral vector is a transposon. In some embodiments, the transposon is a sleeping beauty transposon or PiggyBac transposon.
[0239] Physical means by which the CAR-expressing transgene may be introduced into the immune effector cells include, but are not limited to, electroporation, microinjection, magnetofection, ultrasound, a ballistic or hydrodynamic method, or a combination thereof.
[0240] In some embodiments, the immune effector cells are T cells.
[0241] Modified immune effector cells can be activated and / or expanded ex vivo for use in adoptive cellular immunotherapy in which infusions of such cells have been shown to have anti-disease reactivity in a disease-bearing subject. The compositions and methods of this disclosure can be used to generate a population of immune effector cells (e.g., T lymphocytes) with enhanced immune cell function for use in immunotherapy in the treatment of the disease. Isolation / Enrichment
[0242] The immune effector cells may be autologous / autogeneic (“self”) or non- autologous (“non-self,” e.g., allogeneic, syngeneic or xenogeneic). In some embodiments, the 52 304098633v1Attorney Docket No: 243734.000206 immune effector cells are obtained from a mammalian subject. In other embodiments, the immune effector cells are obtained from a primate subject. In some embodiments, the immune effector cells are obtained from a human subject.
[0243] Lymphocytes can be obtained from sources such as, but not limited to, peripheral blood mononuclear cells, bone marrow, lymph nodes tissue, cord blood, thymus issue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. Lymphocytes may also be generated by differentiation of stem cells. In some embodiments, lymphocytes can be obtained from blood collected from a subject using techniques generally known to the skilled person, such as sedimentation, e.g., FICOLL™ separation.
[0244] In some embodiments, cells from the circulating blood of a subject are obtained by apheresis. An apheresis device typically collects lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. In some embodiments, the cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing. The cells can be washed with PBS or with another suitable solution that lacks calcium, magnesium, and most, if not all other, divalent cations. A washing step may be accomplished by methods known to those in the art, such as, but not limited to, using a semiautomated flowthrough centrifuge (e.g., Cobe 2991 cell processor, or the Baxter CytoMate). After washing, the cells may be resuspended in a variety of biocompatible buffers, cell culture medias, or other saline solution with or without buffer.
[0245] In some embodiments, immune effector cells can be isolated from a subject (e.g., a donor). In some embodiments, the immune effector cell may be isolated from a subject having a disease. The disease may be, for example, a cancer. As a non-limiting example, the cancer may be a cancer expressing B7-H3. In certain embodiments, the cancer may be a cancer expressing, e.g., HER2, IL13Rα2, and / or EphA2. In some embodiments, the cancer may be a cancer expressing, e.g., CD19, CD22, CD123, and / or CD33. In some embodiments, the cancer may be a cancer expressing, e.g., PD-L1 and / or GD2.
[0246] In some embodiments, immune effector cells disclosed herein may be derived from a blood, marrow, tissue, or a tumor sample.
[0247] In some embodiments, immune effector cells can be isolated from peripheral blood mononuclear cells (PBMCs) by lysing the red blood cells and depleting the monocytes. As an example, the cells can be sorted by centrifugation through a PERCOLL™ gradient. In some embodiments, after isolation of PBMCs, both cytotoxic and helper T lymphocytes can be sorted 53 304098633v1Attorney Docket No: 243734.000206 into naïve, memory, and effector T cell subpopulations either before or after activation, expansion, and / or genetic modification.
[0248] In some embodiments, T lymphocytes can be enriched. For example, a specific subpopulation of T lymphocytes expressing one or more markers such as, but not limited to, CD3, CD4, CD8, CD14, CD15, CD16, CD19, CD27, CD28, CD34, CD36, CD45RA, CD45RO, CD56, CD62, CD62L, CD122, CD123, CD127, CD235a, CCR7, HLA-DR, or a combination thereof, can be enriched using either positive or negative selection techniques. In some embodiments, the T lymphocytes for use in the compositions of the disclosure do not express or do not substantially express one or more of the following markers: CD57, CD244, CD160, PD-1, CTLA4, ICOS, TIM3, and LAG3. Stimulation / Activation
[0249] In order to reach sufficient therapeutic doses of immune effector cell compositions, immune effector cells are often subjected to one or more rounds of stimulation / activation. In some embodiments, a method of producing immune effector cells for administration to a subject comprises stimulating the immune effector cells to become activated in the presence of one or more stimulatory signals or agents (e.g., compound, small molecule, e.g., small organic molecule, nucleic acid, polypeptide, or a fragment, isoform, variant, analog, or derivative thereof). In some embodiments, a method of producing immune effector cells for administration to a subject comprises stimulating the immune effector cells to become activated and to proliferate in the presence of one or more stimulatory signals or agents.
[0250] Immune effector cells (e.g., T lymphocytes) can be activated by inducing a change in their biologic state by which the cells express activation markers, produce cytokines, proliferate and / or become cytotoxic to target cells. All of these changes can be produced by primary stimulatory signals. Co-stimulatory signals amplify the magnitude of the primary signals and suppress cell death following initial stimulation resulting in a more durable activation state and thus a higher cytotoxic capacity.
[0251] T cells can be activated generally using methods as described, for example, in U.S. Patents 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; and 6,867,041, each of which is incorporated herein by reference in its entirety.
[0252] In some embodiments, the T cell based immune effector cells can be activated by binding to an agent that activates CD3ζ.
[0253] In other embodiments, a CD2-binding agent may be used to provide a primary stimulation signal to the T cells. For example, and not by limitation, CD2 agents include CD2 54 304098633v1Attorney Docket No: 243734.000206 ligands and anti-CD2 antibodies, e.g., the Tl 1.3 antibody in combination with the Tl 1.1 or Tl 1.2 antibody (Meuer, S. C. et al. (1984) Cell 36:897-906) and the 9.6 antibody (which recognizes the same epitope as TI 1.1) in combination with the 9-1 antibody (Yang, S. Y. et al. (1986) J. Immunol.137:1097-1100, which is incorporated herein by reference in its entirety). Other antibodies which bind to the same epitopes as any of the above-described antibodies can also be used.
[0254] In some embodiments, the immune effector cells are activated by administering phorbol myristate acetate (PMA) and ionomycine. In some embodiments, the immune effector cells are activated by administering an appropriate antigen that induces activation and then expansion. In some embodiments, PMA, ionomycin, and / or appropriate antigen are administered with CD3 induce activation and / or expansion.
[0255] In general, the activating agents used in the present disclosure include, but are not limited to, an antibody, a fragment thereof and a proteinaceous binding molecule with antibody-like functions. Examples of (recombinant) antibody fragments are Fab fragments, Fv fragments, single-chain Fv fragments (scFv), a divalent antibody fragment such as an (Fab)2′- fragment, diabodies, triabodies (Iliades, P., et al., FEBS Lett (1997) 409, 437-441, which is incorporated herein by reference in its entirety), decabodies (Stone, E., et al., Journal of Immunological Methods (2007) 318, 88-94, which is incorporated herein by reference in its entirety) and other domain antibodies (Holt, L. J., et al., Trends Biotechnol. (2003), 21, 11, 484-490, which is incorporated herein by reference in its entirety). The divalent antibody fragment may be an (Fab)2′-fragment, or a divalent single-chain Fv fragment while the monovalent antibody fragment may be selected from a Fab fragment, a Fv fragment, and a single-chain Fv fragment (scFv).
[0256] In some embodiments, one or more binding sites of the CD3ζ agents may be a bivalent proteinaceous artificial binding molecule such as a dimeric lipocalin mutein (i.e., duocalin). In some embodiments the receptor binding reagent may have a single second binding site (i.e., monovalent). Examples of monovalent agents include, but are not limited to, a monovalent antibody fragment, a proteinaceous binding molecule with antibody-like binding properties or an MHC molecule. Examples of monovalent antibody fragments include, but are not limited to, a Fab fragment, a Fv fragment, and a single-chain Fv fragment (scFv), including a divalent single-chain Fv fragment.
[0257] The agent that specifically binds CD3 includes, but is not limited to, an anti-CD3- antibody, a divalent antibody fragment of an anti-CD3 antibody, a monovalent antibody fragment of an anti-CD3-antibody, and a proteinaceous CD3-binding molecule with antibody- 55 304098633v1Attorney Docket No: 243734.000206 like binding properties. A proteinaceous CD3-binding molecule with antibody-like binding properties can be an aptamer, a mutein based on a polypeptide of the lipocalin family, a glubody, a protein based on the ankyrin scaffold, a protein based on the crystalline scaffold, an adnectin, and an avimer. It also can be coupled to a bead.
[0258] In some embodiments, the activating agent (e.g., CD3-binding agent) can be present in a concentration of about 0.1 to about 10 μg / ml. In some embodiments, the activating agent (e.g., CD3-binding agent) can be present in a concentration of about 0.2 μg / ml to about 9 μg / ml, about 0.3 μg / ml to about 8 μg / ml, about 0.4 μg / ml to about 7 μg / ml, about 0.5 μg / ml to about 6 μg / ml, about 0.6 μg / ml to about 5 μg / ml, about 0.7 μg / ml to about 4 μg / ml, about 0.8 μg / ml to about 3 μg / ml, or about 0.9 μg / ml to about 2 μg / ml. In some embodiments, the activating agent (e.g., CD3-binding agent) is administered at a concentration of about 0.1 μg / ml, about 0.2 μg / ml, about 0.3 μg / ml, about 0.4 μg / ml, about 0.5 μg / ml, about 0.6 μg / ml, about 0.7 μg / ml, about 0.8 μM, about 0.9 μg / ml, about 1 μg / ml, about 2 μg / ml, about 3 μg / ml, about 4 μM, about 5 μg / ml, about 6 μg / ml, about 7 μg / ml, about 8 μg / ml, about 9 μg / ml, or about 10 μg / ml. In some embodiments, the activating agent (e.g., CD3-binding agent) can be present in a concentration of 1 μg / ml.
[0259] In some embodiments, the activating agent is attached to a solid support such as, but not limited to, a bead, an absorbent polymer present in a culture plate or well, or other matrices such as, but not limited to, Sepharose or glass; or, may be expressed (such as in native or recombinant forms) on cell surface of a natural or recombinant cell line by means known to those skilled in the art. Polynucleotide and / or Polypeptide Transfer
[0260] In some embodiments, the immune effector cells are genetically modified by introducing polynucleotides and / or polypeptides (e.g., a CAR, a signaling molecule, a site- specific nuclease, an RNAi molecule or an antisense oligonucleotide, or polynucleotides encoding the same). The immune effector cells can be genetically modified after stimulation / activation. In some embodiments, the immune effector cells are modified within 12 hours, 16 hours, 24 hours, 36 hours, or 48 hours of stimulation / activation. In some embodiments, the cells are modified within 16 to 24 hours after stimulation / activation. In some embodiments, the immune effector cells are modified within 24 hours.
[0261] In order to genetically modify the immune effector cell, the polynucleotides and / or polypeptides (e.g., a CAR, a signaling molecule, a site-specific nuclease, an RNAi molecule or an antisense oligonucleotide, or polynucleotides encoding the same) must be transferred into the cell. Polynucleotide and / or polypeptide transfer may be via viral, non-viral gene delivery 56 304098633v1Attorney Docket No: 243734.000206 methods, or a physical method. Suitable methods for polynucleotide and / or polypeptide delivery for use with the current methods include any method known by those of skill in the art by which a polynucleotide and / or polypeptide can be introduced into an organelle, cell, tissue or organism.
[0262] In various embodiments, polypeptides or polynucleotides (e.g., a CAR, a signaling molecule, a site-specific nuclease, an RNAi molecule or an antisense oligonucleotide, or polynucleotides encoding the same) described in the present disclosure are introduced to the immune effector cell via a recombinant vector.
[0263] In some embodiments, the vector is a viral vector. Suitable viral vectors that can be used in the present disclosure include, but are not limited to, a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a herpes viral vector, or a baculoviral vector. In one specific embodiment, the viral vector is a lentiviral vector.
[0264] In some embodiments, the immune effector cells can be transduced via retroviral transduction. References describing retroviral transduction of genes are Anderson et al., U.S. Pat. No. 5,399,346; Mann et al., Cell 33:153 (1983); Temin et al., U.S. Pat. No. 4,650,764; Temin et al., U.S. Pat. No.4,980,289; Markowitz et al., J. Virol.62:1120 (1988); Temin et al., U.S. Pat. No.5,124,263; International Patent Publication No. WO 95 / 07358, published Mar. 16, 1995, by Dougherty et al.; and Kuo et al., Blood 82:845 (1993), each of which is incorporated herein by reference in its entirety.
[0265] One method of genetic modification includes ex vivo modification. Various methods are available for transfecting cells and tissues removed from a subject via ex vivo modification. For example, retroviral gene transfer in vitro can be used to genetically modified cells removed from the subject and the cell transferred back into the subject. See e.g., Wilson et al., Science, 244:1344-1346, 1989 and Nabel et al., Science, 244(4910):1342-1344, 1989, both of which are incorporated herein by reference in their entity. In some embodiments, the immune effector cells may be removed from the subject and transfected ex vivo using the polynucleotides (e.g., expression vectors) of the disclosure . In some embodiments, the immune effector cells obtained from the subject can be transfected or transduced with the polynucleotides (e.g., expression vectors) of the disclosure and then administered back to the subject.
[0266] In some embodiments, polynucleotides and / or polypeptides are transferred to the cell in a non-viral vector. In some embodiments, the non-viral vector is a transposon. Exemplary transposons hat can be used in the present disclosure include, but are not limited to, a sleeping beauty transposon and a PiggyBac transposon. 57 304098633v1Attorney Docket No: 243734.000206
[0267] Nucleic acid vaccines may also be used to transfer polynucleotides into the immune effector cells. Such vaccines include, but are not limited to non-viral polynucleotide vectors, “naked” DNA and RNA, and viral vectors. Methods of genetically modifying cells with these vaccines, and for optimizing the expression of genes included in these vaccines are known to those of skill in the art.
[0268] In some embodiments, the polynucleotide(s) is operatively linked to at least one regulatory element for expression of the gene product (e.g., a CAR, a signaling molecule, a site-specific nuclease, an RNAi molecule). The regulatory element can be capable of mediating expression of the gene product in the host cell (e.g., modified immune effector cell). Regulatory elements include, but are not limited to, promoters, enhancers, initiation sites, polyadenylation (polyA) tails, IRES elements, response elements, and termination signals.In some embodiments, the regulatory element regulates expression of the gene product. In some embodiments, the regulatory element increases the expression of the gene product. In some embodiments, the regulatory element increases the expression of the gene product once the host cell (e.g., modified immune effector cell) is activated. In some embodiments, the regulatory element decreases expression of the gene product. In some embodiments, the regulatory element decreases expression of the gene product once the host cell (e.g., modified immune effector cell) is activated.
[0269] In various embodiment, polypeptides or polynucleotides (e.g., a CAR, a signaling molecule, a site-specific nuclease, an RNAi molecule or an antisense oligonucleotide, or polynucleotides encoding the same) are introduced into the modified immune effector cell using a physical means. Suitable physical means include, but are not limited to, electroporation, microinjection, magnetofection, ultrasound, a ballistic or hydrodynamic method, or a combination thereof.
[0270] Electroporation is a method for polynucleotide and / or polypeptide delivery. See e.g., Potter et al., (1984) Proc. Nat'l Acad. Sci. USA, 81, 7161-7165 and Tur-Kaspa et al., (1986) Mol. Cell Biol., 6, 716-718, both of which are incorporated herein in their entirety for all purposes. Electroporation involves the exposure of a suspension of cells and DNA to a high- voltage electric discharge. In some embodiments, cell wall-degrading enzymes, such as pectin- degrading enzymes, can be employed to render the immune effector cells more susceptible to genetic modification by electroporation than untreated cells. See e.g., U.S. Pat. No.5,384,253, incorporated herein by reference in its entirety for all purposes.
[0271] In vivo electroporation involves a basic injection technique in which a vector is injected intradermally in a subject. Electrodes then apply electrical pulses to the intradermal 58 304098633v1Attorney Docket No: 243734.000206 site causing the cells localized there (e.g., resident dermal dendritic cells) to take up the vector. These tumor antigen-expressing dendritic cells activated by local inflammation can then migrate to lymph nodes.
[0272] Methods of electroporation for use with this disclosure include, for example, Sardesai, N. Y., and Weiner, D. B., Current Opinion in Immunotherapy 23:421-9 (2011) and Ferraro, B. et al., Human Vaccines 7:120-127 (2011), both of which are hereby incorporated by reference herein in their entirety for all purposes.
[0273] Another method for polynucleotide and / or polypeptide transfer includes injection. In some embodiments, a polypeptide, a polynucleotide, or a viral vector may be delivered to a cell, tissue, or organism via one or more injections (e.g., a needle injection). Non-limiting methods of injection include injection of a composition (e.g., a saline-based composition). Polynucleotides and / or polynucleotides can also be introduced by direct microinjection. Non- limiting sites of injection include, subcutaneous, intradermal, intramuscular, intranodal (allows for direct delivery of antigen to lymphoid tissues), intravenous, intraprostatic, intratumor, intralymphatic (allows direct administration of DCs), and intraperitoneal. It is understood that proper site of injection preparation is necessary (e.g., shaving of the site of injection to observe proper needle placement).
[0274] Additional methods of polynucleotide and / or polypeptide transfer include liposome-mediated transfection (e.g., polynucleotide entrapped in a lipid complex suspended in an excess of aqueous solution. See e.g., Ghosh and Bachhawat, (1991) In: Liver Diseases, Targeted Diagnosis and Therapy Using Specific Receptors and Ligands. pp. 87-104). Also contemplated is a polynucleotide and / or polypeptide complexed with Lipofectamine, or Superfect); DEAE-dextran (e.g., a polynucleotide is delivered into a cell using DEAE-dextran followed by polyethylene glycol. See e.g., Gopal, T. V., Mol Cell Biol.1985 May; 5(5):1188- 90); calcium phosphate (e.g., polynucleotide is introduced to the cells using calcium phosphate precipitation. See e.g., Graham and van der Eb, (1973) Virology, 52, 456-467; Chen and Okayama, Mol. Cell Biol., 7(8):2745-2752, 1987), and Rippe et al., Mol. Cell Biol., 10:689- 695, 1990); sonication loading (introduction of a polynucleotide by direct sonic loading. See e.g., Fechheimer et al., (1987) Proc. Nat'l Acad. Sci. USA, 84, 8463-8467); microprojectile bombardment (e.g., one or more particles may be coated with at least one polynucleotide and / or polypeptide and delivered into cells by a propelling force. See e.g., U.S. Pat. No. 5,550,318; U.S. Pat. No.5,538,880; U.S. Pat. No.5,610,042; and PCT Application WO 94 / 09699; Klein et al., (1987) Nature, 327, 70-73, Yang et al., (1990) Proc. Nat'l Acad. Sci. USA, 87, 9568- 9572); and receptor-mediated transfection (e.g., selective uptake of macromolecules by 59 304098633v1Attorney Docket No: 243734.000206 receptor-mediated endocytosis that will be occurring in a target cell using cell type-specific distribution of various receptors. See e.g., Wu and Wu, (1987) J. Biol. Chem., 262, 4429-4432; Wagner et al., Proc. Natl. Acad. Sci. USA, 87(9):3410-3414, 1990; Perales et al., Proc. Natl. Acad. Sci. USA, 91:4086-4090, 1994; Myers, EPO 0273085; Wu and Wu, Adv. Drug Delivery Rev., 12:159-167, 1993; Nicolau et al., (1987) Methods Enzymol., 149, 157-176), each reference cited here is incorporated by reference in their entirety for all purposes.
[0275] In further embodiments, host cells (e.g., modified immune effector cells) are genetically modified using gene editing with homology-directed repair (HDR). Homology- directed repair (HDR) is a mechanism used by cells to repair double strand DNA breaks. In HDR, a donor polynucleotide with homology to the site of the double strand DNA break is used as a template to repair the cleaved DNA sequence, resulting in the transfer of genetic information from the donor polynucleotide to the DNA. As such, new nucleic acid material may be inserted or copied into a target DNA cleavage site. Double strand DNA breaks in host cells may be induced by a site-specific nuclease. Suitable site-specific nucleases for use in the present disclosure include, but are not limited to, RNA-guided endonuclease (e.g., CRISPR- associated (Cas) proteins), zinc finger nuclease, a TALEN nuclease, or mega-TALEN nuclease. For example, a site-specific nuclease (e.g., a Cas9 + guide RNA) capable of inducing a double strand break in a target DNA sequence is introduced to a host cell, along with a donor polynucleotide encoding a CAR of the present disclosure and optionally an additional protein (e.g., tCD19). Expansion / Proliferation
[0276] After the immune effector cells are activated and transduced, the cells are cultured to proliferate. T cells may be cultured for at least 1, 2, 3, 4, 5, 6, or 7 days, at least 2 weeks, at least 1, 2, 3, 4, 5, or 6 months or more with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more rounds of expansion.
[0277] Agents that can be used for the expansion of T cells can include interleukins, such as IL-2, IL-7, IL-15, or IL-21 (see for example Cornish et al. 2006, Blood. 108(2):600-8, Bazdar and Sieg, 2007, Journal of Virology, 2007, 81(22):12670-12674, Battalia et al, 2013, Immunology, 139(1):109-120, each of which is incorporated by reference in their entirety for all purposes). Other illustrative examples for agents that may be used for the expansion of T cells are agents that bind to CD8, CD45 or CD90, such as αCD8, αCD45 or αCD90 antibodies. Illustrative examples of T cell populations include antigen-specific T cells, T helper cells, cytotoxic T cells, memory T cell (an illustrative example of memory T cells are CD62L+CD8+60 304098633v1Attorney Docket No: 243734.000206 specific central memory T cells) or regulatory T cells (an illustrative example of Treg are CD4+CD25+CD45RA+Treg cells).
[0278] Additional agents that can be used to expand T lymphocytes includes methods as described, for example, in U.S. Patents 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; and 6,867,041, each of which is incorporated herein by reference in its entirety.
[0279] In some embodiments, the agent(s) used for expansion (e.g., IL-7, IL-15) are administered at about 20 units / ml to about 200 units / ml. In some embodiments, the agent(s) used for expansion (e.g., IL-7, IL-15) are administered at about 25 units / ml to about 190 units / ml, about 30 units / ml to about 180 units / ml, about 35 units / ml to about 170 units / ml, about 40 units / ml to about 160 units / ml, about 45 units / ml to about 150 units / ml, about 50 units / ml to about 140 units / ml, about 55 units / ml to about 130 units / ml, about 60 units / ml to about 120 units / ml, about 65 units / ml to about 110 units / ml, about 70 units / ml to about 100 units / ml, about 75 units / ml to about 95 units / ml, or about 80 units / ml to about 90 units / ml. In some embodiments, the agent(s) used for expansion (e.g., IL-7, IL-15) are administered at about 20 units / ml, about 25 units / ml, about 30 units / ml, 35 units / ml, 40 units / ml, 45 units / ml, about 50 units / ml, about 55 units / ml, about 60 units / ml, about 65 units / ml, about 70 units / ml, about 75 units / ml, about 80 units / ml, about 85 units / ml, about 90 units / ml, about 95 units / ml, about 100 units / ml, about 105 units / ml, about 110 units / ml, about 115 units / ml, about 120 units / ml, about 125 units / ml, about 130 units / ml, about 135 units / ml, about 140 units / ml, about 145 units / ml, about 150 units / ml, about 155 units / ml, about 160 units / ml, about 165 units / ml, about 170 units / ml, about 175 units / ml, about 180 units / ml, about 185 units / ml, about 190 units / ml, about 195 units / ml, or about 200 units / ml. In some embodiments, the agent(s) used for expansion (e.g., IL-7, IL-15) are administered at about 5 mg / ml to about 10 ng / ml. In some embodiments, the agent(s) used for expansion (e.g., IL-7, IL-15) are administered at about 5.5 ng / ml to about 9.5 ng / ml, about 6 ng / ml to about 9 ng / ml, about 6.5 ng / ml to about 8.5 ng / ml, or about 7 ng / ml to about 8 ng / ml. In some embodiments, the agent(s) used for expansion (e.g., IL-7, IL-15) are administered at about 5 ng / ml, 6 ng / ml, 7 ng / ml, 8 ng / ml, 9, ng / ml, or 10 ng / ml.
[0280] Conditions appropriate for T cell culture include an appropriate media (e.g., Minimal Essential Media (MEM), RPMI Media 1640, Lonza RPMI 1640, Advanced RPMI, Clicks, AIM-V, DMEM, a-MEM, F-12, TexMACS, X-Vivo 15, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum-free or supplemented 61 304098633v1Attorney Docket No: 243734.000206 with an appropriate amount of serum (or plasma) or a defined set of hormones, and / or an amount of cytokine(s) sufficient for the growth and expansion).
[0281] Examples of other additives for immune effector cell expansion include, but are not limited to, surfactant, piasmanate, pH buffers such as HEPES, and reducing agents such as N- acetyl-cysteine and 2-mercaptoethanol, Antibiotics (e.g., penicillin and streptomycin), are included only in experimental cultures, not in cultures of cells that are to be infused into a subject. The target cells are maintained under conditions necessary to support growth, for example, an appropriate temperature (e.g., 37° C) and atmosphere (e.g., air plus 5% CO2).
[0282] In certain embodiments, host cells of the present disclosure may be modified such that the expression of an endogenous TCR, MHC molecule, or other immunogenic molecule is decreased or eliminated. When allogeneic cells are used, rejection of the therapeutic cells may be a concern as it may cause serious complications such as the graft-versus-host disease (GvHD). Although not wishing to be bound by theory, immunogenic molecules (e.g., endogenous TCRs and / or MHC molecules) are typically expressed on the cell surface and are involved in self vs non-self-discrimination. Decreasing or eliminating the expression of such molecules may reduce or eliminate the ability of the therapeutic cells to cause GvHD.
[0283] In certain embodiments, expression of an endogenous TCR in the host cells is decreased or eliminated. In a particular embodiment, expression of an endogenous TCR (e.g., αβ TCR) in the host cells is decreased or eliminated. Expression of the endogenous TCR may be decreased or eliminated by disrupting the TRAC locus, TCR beta constant locus, and / or CD3 locus. In certain embodiments, expression of an endogenous TCR may be decreased or eliminated by disrupting one or more of the TRAC, TRBC1, TRBC2, CD3E, CD3G, and / or CD3D locus.
[0284] In certain embodiments, expression of one or more endogenous MHC molecules in the host cells is decreased or eliminated. Modified MHC molecules may be an MHC class I or class II molecule. In certain embodiments, expression of an endogenous MHC molecule may be decreased or eliminated by disrupting one or more of the MHC, β2M, TAP1, TAP2, CIITA, RFX5, RFXAP and / or RFXANK locus.
[0285] Expression of the endogenous TCR, an MHC molecule, and / or any other immunogenic molecule in the host cell can be disrupted using genome editing techniques such as Clustered regularly interspaced short palindromic repeats (CRISPR) / Cas, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and Meganucleases. These genome editing methods may disrupt a target gene by entirely knocking out all of its output or partially knocking down its expression. In a particular embodiment, 62 304098633v1Attorney Docket No: 243734.000206 expression of the endogenous TCR, an MHC molecule and / or any other immunogenic molecule in the host cell is disrupted using the CRISPR / Cas technique. Methods of Enhancing Immune Cell Function
[0286] In one aspect, the present disclosure provides a method of enhancing immune cell function (e.g., an enhanced anti-tumor function) of an immune effector cell. Such methods may comprise modifying an ETS1 gene or gene product in the cell so that the expression and / or function of ETS1 in the cell is reduced or eliminated. Alternatively, the method may include modifying a RBPJ gene or gene product in the T cell such that the expression and / or function of RBPJ in the T cell is reduced or eliminated. As another alternative, the method may include modifying a ETS1 gene or gene product and / or RBPJ gene or gene product in the T cell such that the expression and / or function of ETS1 gene and / or RBPJ gene in the T cell is reduced or eliminated.
[0287] In another aspect, provided herein is a method of promoting differentiation of a precursor exhausted T cell (Tpex) to an intermediate exhausted T cell (Tex). Such method may comprise modifying an ETS1 gene or gene product in a T cell so that the expression and / or function of the gene(s) in the cell is reduced or eliminated.
[0288] In another aspect, provided herein is a method of reprogramming an exhausted T cell (Tex) toward a proliferative state. Such method may comprise modifying a RBPJ gene or gene product in a T cell so that the expression and / or function of the gene(s) in the cell is reduced or eliminated.
[0289] In some embodiments, the modifying step comprises inhibiting a ETS1 protein with one or more of a small molecule inhibitor, a peptide, an antibody or antibody fragment, and an aptamer.
[0290] In some embodiments, the modifying step comprises inhibiting a RBPJ protein with one or more of a small molecule inhibitor, a peptide, an antibody or antibody fragment, and an aptamer.
[0291] In some embodiments, the modifying step comprises inhibiting an ETS1 protein and / or a RBPJ protein with one or more of a small molecule inhibitor, a peptide, an antibody or antibody fragment, and an aptamer.
[0292] The term “anti-tumor function” or “anti-tumor effect” as used herein refers to the ability of a T cell to inhibit tumor growth and / or to kill the tumor cells (cancer cells).
[0293] As a non-limiting example, the immune effector cell may be any of the various T cells disclosed herein. In particular, the T cell may be selected from, e.g., a CD8+T cell, a 63 304098633v1Attorney Docket No: 243734.000206 CD4+T cell, a cytotoxic T cell, an αβ T cell receptor (TCR) T cell, a natural killer T (NKT) cell, a γδ T cell, a memory T cell, a T-helper cell, and a regulatory T cell (Treg) , a memory T cell (Tscm or TSCM), a central memory T cell (Tcm or TCM), an effector memory T cell (Tern or TEM), an effector T cell (Teff, TEFF or TE), a precursor exhausted T cell (Tpex or TPEX), an exhausted T cell (Tex or TEX) or terminally exhausted T (Tex) cell. In some embodiments, the immune effector cell is CD8+T cell. In some embodiments, the above-described methods may comprise modifying the immune effector cell to express a CAR disclosed herein that is capable of binding to an antigen specific to tumor disclosed herein.
[0294] The methods may further comprise modifying a RBPJ gene or gene product in the cell so that the expression and / or function of RBPJ in the cell is reduced or eliminated. In some embodiments, the ETS1 gene and / or the RBPJ gene may be deleted.
[0295] In some embodiments, the ETS1 and / or the RBPJ gene or gene product in the immune effector cell may be modified in the presence of one or more inhibitory signals or agents (e.g., compound, small molecule, e.g., small organic molecule, nucleic acid, polypeptide, or a fragment, isoform, variant, analog, or derivative thereof). In some embodiments, the ETS1 and / or the RBPJ gene or gene product may be targeted using any number of various agents (e.g., a small molecule inhibitor). In certain embodiments, the agent may be used to reduce the expression and / or activity of ETS1 and / or RBPJ in a modified immune effector cell disclosed herein.
[0296] In some embodiments, the small molecule may be, for example, a peptide and / or a peptidomimetic. A peptidomimetic may include, e.g., chemically modified peptides and peptide-like molecules that contain non-naturally occurring amino acids, peptoids, and the like. Methods for identifying a peptidomimetics are well known in the art and may comprise the screening of databases that contain libraries of possible peptidomimetics.
[0297] In some embodiments, the ETS1 gene in the immune effector cell is deleted or modified as a result of an activity of a site-specific nuclease. In some embodiments, the site- specific nuclease is an RNA-guided endonuclease. In some embodiments, the RNA-guided endonuclease is a Cas9 protein. In some embodiments, the Cas9 protein may be programmed with a gRNA that targets a locus within or near the ETS1 gene. In some embodiments, the gRNA targets a nucleotide sequence comprising SEQ ID NO: 1. In some embodiments, the Cas9 protein is programmed with a gRNA that comprises a nucleotide sequence of SEQ ID NO: 2. In some aspects, the present disclosure provides a guide RNA (gRNA) targeting Ets1 comprising a nucleotide sequence of SEQ ID NO: 2. 64 304098633v1Attorney Docket No: 243734.000206
[0298] In some embodiments, the RBPJ gene in the immune effector cell is deleted or modified as a result of an activity of a site-specific nuclease. In some embodiments, the site- specific nuclease is an RNA-guided endonuclease. In some embodiments, the RNA-guided endonuclease is a Cas9 protein. In some embodiments, the Cas9 protein may be programmed with a gRNA that targets a locus within or near the RBPJ gene. In some embodiments, the gRNA targets a nucleotide sequence comprising SEQ ID NO: 3. In some embodiments, the Cas9 protein is programmed with a gRNA that comprises a nucleotide sequence of SEQ ID NO: 4. In some aspects, the present disclosure provides a guide RNA (gRNA) targeting Rbpj comprising a nucleotide sequence of SEQ ID NO: 4. In some embodiments, the gRNA targets a nucleotide sequence comprising SEQ ID NO: 5. In some embodiments, the Cas9 protein is programmed with a gRNA that comprises a nucleotide sequence of SEQ ID NO: 6. In some aspects, the present disclosure provides a guide RNA (gRNA) targeting Rbpj comprising a nucleotide sequence of SEQ ID NO: 6.
[0299] In alternative embodiments, the site-specific nuclease used in the methods described herein is a zinc finger nuclease, a TALEN nuclease, or a mega-TALEN nuclease.
[0300] In some embodiments, the ETS1 and / or RBPJ gene product in the immune effector cell is deleted or modified as a result of an activity of an RNA interference (RNAi) molecule or an antisense oligonucleotide. In some embodiments, the RNAi molecule is a small interfering RNA (siRNA) or a small hairpin RNA (shRNA).
[0301] In various embodiments, the site-specific nuclease, the RNAi molecule, or the antisense oligonucleotide, as described above, is introduced into the immune effector cell via a viral vector, a non-viral vector, or a physical means described herein.
[0302] In some embodiments, the method further includes activation and / or expansion of the immune effector cell ex vivo. Pharmaceutical Compositions
[0303] In some embodiments, the compositions comprise one or more polypeptides, polynucleotides, vectors comprising same, and cell compositions, as disclosed herein. Compositions include, but are not limited to pharmaceutical compositions. In some embodiments, the compositions of the present disclosure comprise an amount of modified immune effector cells manufactured by the methods disclosed herein.
[0304] In one aspect, the present disclosure provides a pharmaceutical composition comprising a modified immune effector cell described herein, and a pharmaceutically acceptable carrier and / or excipient. Examples of pharmaceutical carriers include, but are not 65 304098633v1Attorney Docket No: 243734.000206 limited to, sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions.
[0305] Compositions comprising modified immune effector cells disclosed herein may comprise buffers such as neutral buffered saline, phosphate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and, preservatives.
[0306] Compositions comprising modified immune effector cells disclosed herein may comprise one or more of the following: sterile diluents such as water for injection, saline solution, preferably physiological saline, Ringer's solution, isotonic sodium chloride, fixed oils such as synthetic mono or diglycerides which may serve as the solvent or suspending medium, polyethylene glycols, glycerin, propylene glycol or other solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
[0307] In some embodiments, the compositions are formulated for parenteral administration, e.g., intravascular (intravenous or intraarterial), intraperitoneal, intratumoral, intraventricular, intrapleural or intramuscular administration. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. An injectable pharmaceutical composition is preferably sterile. In some embodiments, the composition is reconstituted from a lyophilized preparation prior to administration.
[0308] In some embodiments, the modified immune effector cells may be mixed with substances that adhere or penetrate then prior to their administration, e.g., but not limited to, nanoparticles. Therapeutic Methods
[0309] In one aspect, the present disclosure provides a method of treating a disease or disorder in a subject in need thereof, including administering to the subject an effective amount of the modified immune effector cells, or the pharmaceutical composition, described herein. In some embodiments, the modified immune effector cells are prepared by the methods as disclosed above. 66 304098633v1Attorney Docket No: 243734.000206
[0310] In some embodiments, the modified immune effector cell is an autologous cell. In some embodiments, the modified immune effector cell is an allogeneic cell.
[0311] In some embodiments, the disease being treated by the therapeutic methods described herein is a cancer.
[0312] The terms “cancer” and “cancerous” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. The term “cancer” includes, for example, the soft tissue tumors (e.g., lymphomas), and tumors of the blood and blood-forming organs (e.g., leukemias), and solid tumors, which is one that grows in an anatomical site outside the bloodstream (e.g., carcinomas). Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma (e.g., osteosarcoma or rhabdomyosarcoma), and leukemia or lymphoid malignancies. More particular examples of such cancers include squamous cell cancer (e.g., epithelial squamous cell cancer), adenosquamous cell carcinoma, lung cancer (e.g., including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous carcinoma of the lung), cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer (e.g., including gastrointestinal cancer, pancreatic cancer), cervical cancer, ovarian cancer, liver cancer, bladder cancer, cancer of the urinary tract, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, primary or metastatic melanoma, multiple myeloma and B-cell lymphoma, non-Hodgkin's lymphoma, Hodgkin's lymphoma, brain (e.g., high grade glioma, diffuse pontine glioma, ependymoma, neuroblastoma, or glioblastoma), as well as head and neck cancer, and associated metastases. Additional examples of cancer can be found in The Merck Manual of Diagnosis and Therapy, 19th Edition, § on Hematology and Oncology, published by Merck Sharp & Dohme Corp., 2011 (ISBN 978-0-911910-19-3); The Merck Manual of Diagnosis and Therapy, 20th Edition, § on Hematology and Oncology, published by Merck Sharp & Dohme Corp., 2018 (ISBN 978-0-911-91042-1) (2018 digital online edition at internet website of Merck Manuals); and SEER Program Coding and Staging Manual 2016, each of which is incorporated by reference in its entirety for all purposes.
[0313] In some embodiments, the cancer is a solid tumor. Non-limiting examples of solid tumors include osteosarcoma, medulloblastoma, glioblastoma ependymoma and high-grade gliomas. In some embodiments, the cancer is a breast, prostate, urinary bladder, skin, lung, ovary, sarcoma, or brain cancer. 67 304098633v1Attorney Docket No: 243734.000206
[0314] In some embodiments, the cancer is a liquid tumor such as, but not limited to leukemia, including chronic leukemia, e.g., chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia, acute leukemia, e.g., acute lymphocytic leukemia, acute myelocytic leukemia, and myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia, lymphoma, Waldenstrom's macroglobulinemia, Hodgkin’s disease, non- Hodgkin’s lymphoma, polycythemia vera, multiple myeloma, and heavy chain disease. In some embodiments, the liquid tumor is B-cell acute lymphoblastic leukemia.
[0315] In various embodiments, the liquid tumor may comprise a hematologic cancer, i.e., a blood cancer which may originate from or occur within blood-forming tissue, e.g., blood and / or bone marrow. In some embodiments a hematologic cancer may originate from or occur within lymph nodes.
[0316] The therapeutic methods described herein may be used to treat a cancer expressing, e.g., PD-L1, CD19, CD22, CD123, CD33, B7-H3, GD2, HER2, IL13Rα2, or EphA2.
[0317] Cancers expressing PD-L1 may include, but are not limited to, squamous cell carcinoma of the head and neck, melanoma, and carcinomas of the brain, thyroid, thymus, esophagus, lung, breast, gastrointestinal tract, colorectum, liver, pancreas, kidney, adrenal cortex, bladder, urothelium, ovary, and skin.
[0318] Cancers expressing B7-H3 may include, but are not limited to, osteosarcoma, rhabdomyosarcoma, Ewing’s sarcoma and other Ewing’s sarcoma family of tumors, neuroblastoma, ganglioneuroblastoma, desmoplastic small round cell tumor, malignant peripheral nerve sheath tumor, synovial sarcoma, undifferentiated sarcoma, adrenocortical carcinoma, hepatoblastoma, Wilms tumor, rhabdoid tumor, high grade glioma (glioblastoma multiforme), medulloblastoma, astrocytoma, glioma, ependymoma, atypical teratoid rhabdoid tumor, meningioma, craniopharyngioma, primitive neuroectodermal tumor, diffuse intrinsic pontine glioma and other brain tumors, acute myeloid leukemia, multiple myeloma, lung cancer, mesothelioma, breast cancer, bladder cancer, gastric cancer, prostate cancer, colorectal cancer, endometrial cancer, cervical cancer, renal cancer, esophageal cancer, ovarian cancer, pancreatic cancer, hepatocellular carcinoma and other liver cancers, head and neck cancers, leiomyosarcoma, and melanoma. In some embodiments, the cancer expressing B7-H3 may include, without limitation, osteosarcoma, and glioblastoma. In some embodiments, the cancer expressing B7-H3 may be a brain tumor. Non-limiting examples of brain tumors include high- grade gliomas, medulloblastoma, ependymoma, and atypical teratoid rhabdoid tumors. The cancer expressing B7-H3 may include, without limitation, high-grade gliomas, medulloblastoma, ependymoma, and atypical teratoid rhabdoid tumors. 68 304098633v1Attorney Docket No: 243734.000206
[0319] Cancers expressing HER2 may include, but are not limited to, sarcomas such as angiosarcoma, chondrosarcoma, Ewing’s sarcoma, fibrosarcoma, gastrointestinal stromal tumor, leiomyosarcoma, liposarcoma, malignant peripheral nerve sheath tumor, osteosarcoma, pleomorphic sarcoma, rhabdomyosarcoma, or synovial sarcoma; brain cancers such as glioblastoma; breast, prostate, lung, and colon cancers or epithelial cancers / carcinomas such as breast cancer, colon cancer, prostate cancer, head and neck cancer, skin cancer; cancers of the genitourinary tract such as ovarian cancer, endometrial cancer, cervical cancer and kidney cancer; lung cancer, gastric cancer, cancer of the small intestine, liver cancer, pancreatic cancer, gall bladder cancer, cancers of the bile duct, esophagus cancer, cancer of the salivary glands, and cancer of the thyroid gland. In some embodiments, the cancer is a HER2-positive breast cancer.
[0320] Cancers expressing IL13Rα2 may include, but are not limited to, brain cancers such as glioblastoma, colon cancer, renal cell carcinoma, pancreatic cancer, melanoma, head and neck cancer, mesothelioma, and ovarian cancer. In some embodiments, the cancer is an IL13Rα2-positive glioblastoma.
[0321] Cancers expressing EphA2 may include, but are not limited to, sarcomas such as rhabdomyosarcoma, osteosarcoma, and Ewing’s sarcoma; breast, prostate, urinary bladder, skin cancers including melanoma, lung cancer, liver cancer, ovarian cancer, stomach cancer, colorectal cancer, thyroid cancer, head and neck cancer, cervical cancer, pancreatic cancer, endometrial cancer, and brain cancers.
[0322] The therapeutic methods described herein may include the steps of: (i) isolating an immune effector cell from the subject or a donor; (ii) modifying an ETS1 gene or gene product in the immune effector cell so that the expression and / or function of ETS1 in the cell is reduced or eliminated; and (iii) introducing the modified immune effector cell into the subject.
[0323] The therapeutic methods described herein may include the steps of: (i) isolating an immune effector cell from the subject or a donor; (ii) modifying an RBPJ gene or gene product in the immune effector cell so that the expression and / or function of RBPJ in the cell is reduced or eliminated; and (iii) introducing the modified immune effector cell into the subject.
[0324] The therapeutic methods described herein may include the steps of: (i) isolating an immune effector cell from the subject or a donor; (ii) modifying an ETS1 and / or a RBPJ gene or gene product in the immune effector cell so that the expression and / or function of ETS1 and / or RBPJ in the cell is reduced or eliminated; and (iii) introducing the modified immune effector cell into the subject. 69 304098633v1Attorney Docket No: 243734.000206
[0325] In some embodiments, the immune effector cell is activated by contacting the immune effector cell with a signaling molecule either ex vivo or in vivo. For example, stimulating the immune effector cell with a signaling molecule may be carried out by mixing the immune effector cell directly with the signaling molecule, or with a carrier (e.g., nanoparticles) containing the signaling molecule ex vivo. Mixing of the immune effector cell with the signaling molecule, or with a carrier (e.g., nanoparticles) containing the signaling molecule may be carried out prior to administration, or during administration. In some embodiments, the immune effector cells may be administered with nanoparticle “backpacks” which are capable of carrying signaling molecules and attaching them to the immune effector cells. Such nanoparticle “backpacks” may selectively release the signaling molecules in response to certain stimuli, such as the activation of the immune effector cell (Tang L., Nat Biotechnol. 2018;36(8):707-716, which is incorporated by reference in their entirety for all purposes).
[0326] Alternatively, signaling molecules may be provided to the modified immune effector cells in vivo by administration of the signaling molecule, for example, systemically, to the subject such that the signaling molecule can ultimately contact the modified immune effector cells. Signaling molecules may also be provided to the modified immune effector cells in vivo using oncolytic viruses encoding the signaling molecule. Oncolytic viruses can selectively infect and / or lyse cancer or tumor cells as compared to normal cells. Exemplary oncolytic viruses include a herpes simplex virus-1, a herpes simplex virus-2, a vesicular stomatitis virus, and a vaccinia virus.
[0327] In some embodiments, the therapeutic methods include genetically modifying the immune effector cell to express a chimeric antigen receptor (CAR) that is capable of binding specifically to an antigen. In some embodiments, the therapeutic methods include genetically modifying the immune effector cell to express a T cell receptor (TCR) that is capable of binding specifically to an antigen.
[0328] In some embodiments, the subject is human.
[0329] In cases where the immune effector cell is isolated from a donor, the method may further include a method to prevent graft-versus-host disease (GvHD) and the immune effector cell rejection.
[0330] In some embodiments of any of the therapeutic methods described above, the composition is administered in a therapeutically effective amount. The dosages of the composition administered in the methods of the disclosure will vary widely, depending upon the subject’s physical parameters, the frequency of administration, the manner of 70 304098633v1Attorney Docket No: 243734.000206 administration, the clearance rate, and the like. The initial dose may be larger, and might be followed by smaller maintenance doses. The dose may be administered as infrequently as weekly or biweekly, or fractionated into smaller doses and administered daily, semi-weekly, etc., to maintain an effective dosage level. It is contemplated that a variety of doses will be effective to achieve in vivo persistence of immune effector cells. It is also contemplated that a variety of doses will be effective to improve in vivo effector function of immune effector cells.
[0331] In some embodiments, compositions comprising the immune effector cells manufactured by the methods described herein may be administered at a dosage of 102to 1010cells / kg body weight, 105to 109cells / kg body weight, 105to 108cells / kg body weight, 105to 107cells / kg body weight, 107to 109cells / kg body weight, or 107to 108.cells / kg body weight, including all integer values within those ranges. The number of immune effector cells will depend on the therapeutic use for which the composition is intended for.
[0332] Modified immune effector cells may be administered multiple times at dosages listed above. The immune effector cells may be allogeneic, syngeneic, xenogeneic, or autologous to the patient undergoing therapy.
[0333] The compositions and methods described in the present disclosure may be utilized in conjunction with other types of therapy for cancer, such as chemotherapy, surgery, radiation, gene therapy, and so forth.
[0334] It is also contemplated that when used to treat various diseases / disorders, the compositions and methods of the present disclosure can be utilized with other therapeutic methods / agents suitable for the same or similar diseases / disorders. Such other therapeutic methods / agents can be co-administered (simultaneously or sequentially) to generate additive or synergistic effects. Suitable therapeutically effective dosages for each agent may be lowered due to the additive action or synergy.
[0335] In some embodiments of any of the above methods, the method may further comprise administering to the subject one or more additional compounds selected from immuno-suppressives, biologicals, probiotics, prebiotics, and cytokines (e.g., IFN or IL-2).
[0336] As a non-limiting example, the methods can be combined with other therapies that block inflammation (e.g., via blockage of IL1, INFα / β, IL6, TNF, IL23, etc.).
[0337] The methods of the disclosure can be combined with other immunomodulatory treatments such as, e.g., therapeutic vaccines (including, but not limited to, GVAX, DC-based vaccines, etc.), checkpoint inhibitors (including, but not limited to, agents that block PD-L1, CTLA-4, PD-1, LAG3, TIM3, TIGIT etc.) or activators (including, but not limited to, agents that enhance 4-1BB, OX40, etc.). The methods of the disclosure can be also combined with 71 304098633v1Attorney Docket No: 243734.000206 other treatments that possess the ability to modulate NKT function or stability, including but not limited to, CD1d, CD1d-fusion proteins, CD1d dimers or larger polymers of CD1d either unloaded or loaded with antigens, CD1d-chimeric antigen receptors (CD1d-CAR), or any other of the five known CD1 isomers existing in humans (CD1a, CD1b, CD1c, CD1e). The methods of the disclosure can also be combined with other treatments such as midostaurin, enasidenib, or a combination thereof.
[0338] Non-limiting examples of checkpoint inhibitors which can be used in combination treatments of the present disclosure include, for example, an anti-PD-1 agent, an anti-PD-L1 agent, an anti-CTLA-4 agent, an anti-TIM3 agent, an anti-LAG3 agent, an anti-ICOS agent, and an anti-TIGIT agent. Non-limiting examples of an anti-PD-1 agent which can be used in combination treatments of the present disclosure include, for example, nivolumab, pembrolizumzb, cemiplimab, dostralimab, retifanlimab, toripalimab, spartalizumab, camrelizumab, sintilimab, tislelizumab, acrixolimab, vopratelimab, zimberelimab, INCMGA00012 (MGA012), AMP-224, and AMP-514. Non-limiting examples of an anti-PD- L1 agent which can be used in combination treatments of the present disclosure include, for example, atezolizumab, avelumab, durvalumab, cosibelimab, KN035, AUNP12, CA-170, bintrafusp alfa, and BMS-986189. Non-limiting examples of an anti-CTLA-4 agent which can be used in combination treatments of the present disclosure include, for example, ipilimumab, and tremelimumab. Non-limiting examples of an anti-TIM3 agent which can be used in combination treatments of the present disclosure include, for example, cobolimab, sabatolimab, and feladilimab. Non-limiting examples of an anti-LAG3 agent which can be used in combination treatments of the present disclosure include, for example, retalimab. Non-limiting examples of an anti-ICOS agent which can be used in combination treatments of the present disclosure include, for example, MEDI-570. Non-limiting examples of anti-TIGIT agents which can be used in combination treatments of the present disclosure include, for example, vibostolimab, etiglimab, domvanalimab, ociperlimab, M6223 and tiragolumab.
[0339] Therapeutic methods of the disclosure can be combined with additional immunotherapies and therapies. For example, when used for treating cancer, the compositions of the disclosure can be used in combination with conventional cancer therapies, such as, e.g., surgery, radiotherapy, chemotherapy or combinations thereof, depending on type of the tumor, patient condition, other health issues, and a variety of factors. In certain aspects, other therapeutic agents useful for combination with conventional cancer therapies include anti- angiogenic agents. Many anti-angiogenic agents have been identified and are known in the art, including, e.g., TNP-470, platelet factor 4, thrombospondin-1, tissue inhibitors of 72 304098633v1Attorney Docket No: 243734.000206 metalloproteases (TIMP1 and TIMP2), prolactin (16-Kd fragment), angiostatin (38-Kd fragment of plasminogen), endostatin, bFGF soluble receptor, transforming growth factor beta, interferon alpha, soluble KDR and FLT-1 receptors, placental proliferin-related protein, as well as those listed by Carmeliet and Jain (2000). In one embodiment, the immune effector cells of the disclosure can be used in combination with a VEGF antagonist or a VEGF receptor antagonist such as anti-VEGF antibodies, VEGF variants, soluble VEGF receptor fragments, aptamers capable of blocking VEGF or VEGFR, neutralizing anti-VEGFR antibodies, inhibitors of VEGFR tyrosine kinases, and any combinations thereof (e.g., anti-hVEGF antibody A4.6.1, bevacizumab or ranibizumab).
[0340] Non-limiting examples of chemotherapeutic compounds which can be used in combination treatments of the present disclosure include, for example, aminoglutethimide, amsacrine, anastrozole, asparaginase, azacitidine, bcg, bicalutamide, bleomycin, buserelin, busulfan, campothecin, capecitabine, carboplatin, carmustine, chlorambucil, cisplatin, cladribine, clodronate, colchicine, cyclophosphamide, cyproterone, cytarabine, dacarbazine, dactinomycin, daunorubicin, decitabine, dienestrol, diethylstilbestrol, docetaxel, doxorubicin, epirubicin, estradiol, estramnustine, etoposide, exemestane, filgrastim, fludarabine, fludrocortisone, fluorouracil, fluoxymesterone, flutamide, gemcitabine, genistein, goserelin, hydroxyurea, idarubicin, ifosfamide, imatinib, interferon, irinotecan, ironotecan, letrozole, leucovorin, leuprolide, levamisole, lomustine, mechlorethamine, medroxyprogesterone, megestrol, melphalan, mercaptopurine, mesna, methotrexate, mitomycin, mitotane, mitoxantrone, nilutamide, nocodazole, octreotide, oxaliplatin, paclitaxel, pamidronate, pentostatin, plicamycin, porfimer, procarbazine, raltitrexed, rituximab, streptozocin, suramin, tamoxifen, temozolomide, teniposide, testosterone, thioguanine, thiotepa, titanocene dichloride, topotecan, trastuzumab, tretinoin, vinblastine, vincristine, vindesine, and vinorelbine.
[0341] These chemotherapeutic compounds may be categorized by their mechanism of action into, for example, following groups: anti-metabolites / anti-cancer agents, such as pyrimidine analogs (5-fluorouracil, floxuridine, capecitabine, gemcitabine and cytarabine) and purine analogs, folate antagonists and related inhibitors (mercaptopurine, thioguanine, pentostatin and 2-chlorodeoxyadenosine (cladribine)); antiproliferative / antimitotic agents including natural products such as vinca alkaloids (vinblastine, vincristine, and vinorelbine), microtubule disruptors such as taxane (paclitaxel, docetaxel), vincristin, vinblastin, nocodazole, epothilones and navelbine, epidipodophyllotoxins (etoposide, teniposide), DNA damaging agents (actinomycin, amsacrine, anthracyclines, bleomycin, busulfan, camptothecin, 73 304098633v1Attorney Docket No: 243734.000206 carboplatin, chlorambucil, cisplatin, cyclophosphamide, cytoxan, dactinomycin, daunorubicin, doxorubicin, epirubicin, hexamethyhnelamineoxaliplatin, iphosphamide, melphalan, merchlorehtamine, mitomycin, mitoxantrone, nitrosourea, plicamycin, procarbazine, taxol, taxotere, teniposide, triethylenethiophosphoramide and etoposide (VP16)); antibiotics such as dactinomycin (actinomycin D), daunorubicin, doxorubicin (adriamycin), idarubicin, anthracyclines, mitoxantrone, bleomycins, plicamycin (mithramycin) and mitomycin; enzymes (L-asparaginase which systemically metabolizes L-asparagine and deprives cells which do not have the capacity to synthesize their own asparagine); antiplatelet agents; antiproliferative / antimitotic alkylating agents such as nitrogen mustards (mechlorethamine, cyclophosphamide and analogs, melphalan, chlorambucil), ethylenimines and methylmelamines (hexamethylmelamine and thiotepa), alkyl sulfonates-busulfan, nitrosoureas (carmustine (BCNU) and analogs, streptozocin), trazenes-dacarbazinine (DTIC); antiproliferative / antimitotic antimetabolites such as folic acid analogs (methotrexate); platinum coordination complexes (cisplatin, carboplatin), procarbazine, hydroxyurea, mitotane, aminoglutethimide; hormones, hormone analogs (estrogen, tamoxifen, goserelin, bicalutamide, nilutamide) and aromatase inhibitors (letrozole, anastrozole); anticoagulants (heparin, synthetic heparin salts and other inhibitors of thrombin); fibrinolytic agents (such as tissue plasminogen activator, streptokinase and urokinase), aspirin, dipyridamole, ticlopidine, clopidogrel, abciximab; antimigratory agents; antisecretory agents (breveldin); immunosuppressives (cyclosporine, tacrolimus (FK-506), sirolimus (rapamycin), azathioprine, mycophenolate mofetil); anti-angiogenic compounds (e.g., TNP-470, genistein, bevacizumab) and growth factor inhibitors (e.g., fibroblast growth factor (FGF) inhibitors); angiotensin receptor blocker; nitric oxide donors; anti-sense oligonucleotides; antibodies (trastuzumab); cell cycle inhibitors and differentiation inducers (tretinoin); mTOR inhibitors, topoisomerase inhibitors (doxorubicin (adriamycin), amsacrine, camptothecin, daunorubicin, dactinomycin, eniposide, epirubicin, etoposide, idarubicin and mitoxantrone, topotecan, irinotecan), corticosteroids (cortisone, dexamethasone, hydrocortisone, methylpednisolone, prednisone, and prenisolone); growth factor signal transduction kinase inhibitors; mitochondrial dysfunction inducers and caspase activators; and chromatin disruptors.
[0342] In various embodiments of the methods described herein, the subject is a human. The subject may be a juvenile or an adult, of any age or sex. 74 304098633v1Attorney Docket No: 243734.000206 EXAMPLES
[0343] The present invention is also described and demonstrated by way of the following Examples. However, the use of these and other examples anywhere in the specification is illustrative only and in no way limits the scope and meaning of the invention or of any exemplified term. Likewise, the invention is not limited to any particular preferred embodiments described here. Indeed, many modifications and variations of the invention may be apparent to those skilled in the art upon reading this specification, and such variations can be made without departing from the invention in spirit or in scope. The invention is therefore to be limited only by the terms of the appended claims along with the full scope of equivalents to which those claims are entitled. Example 1. scCRISPR screen of intratumoral CTL fate.
[0344] Forward genetic screens enable the discovery of key immune-oncology targets (10). Most screening approaches rely upon cell fitness or established markers, thus limiting their capacity for unbiased biological discovery. In contrast, scCRISPR screening methods, which combine pooled genetic perturbations with single-cell RNA sequencing (scRNA-seq), are permissive for transcriptome profiling upon individual genetic perturbations in a complex cellular pool, as well as precise mapping of co-functional modules and gene expression programs (10). Large-scale in vivo scCRISPR screening had previously not been applied for unbiased target discovery or network reconstruction in primary immune cells.
[0345] To employ scCRISPR screening for gene regulatory network (GRN) mapping, a dual- guide, direct-capture lentiviral sgRNA vector (11) was re-engineered to generate a modified Ametrine-expressing retroviral vector that effectively transduced primary CD8+T cells (Figure 6A), followed by the synthesis of a scCRISPR library targeting transcription factors (TFs), arguably the most potent regulators of cell fate decisions. To select these TFs, computational analyses were performed (differential expression, differential chromatin accessibility, and TF motif enrichment) of four public RNA-seq and ATAC-seq datasets profiling CD8+T cell subsets (early versus late exhausted cells or Tpex cells versus Tex cells) (5, 12-14) (Figure 6B). The candidates enriched in at least two of three analyses were compiled (Table 1), and the final library targeted 180 curated TFs (in 360 dual-guide vectors) to ensure sufficient coverage for scCRISPR screening (15), as well as non-targeting controls (NTCs) (Table 2). 75 304098633v1Attorney Docket No: 243734.000206 Table 1. Gene list in the scCRISPR library and the re-analysis results of RNA-seq and ATAC-seq public datasets.76 304098633v1Attorney Docket No: 243734.00020677 304098633v1Attorney Docket No: 243734.000206 Fl F F F F F F F F G G H HHipk2 RNA / ATAC-seq P P P P N N U U U U D D Hivep1 RNA / ATAC-seq N D P P _P P P P U U U U U U Hivep2 RNA / ATAC-seq N D P P P P P _P U U U U U U Hivep3 RNA / ATAC-seq N N D D P P _P P _P P N U U U U U U D Hmgb2 RNA / ATAC-seq P P N P P U U D U U Id2 RNA / ATAC-seq N N N N N N N N D D D D D D D D 78 304098633v1Attorney Docket No: 243734.00020679 304098633v1Attorney Docket No: 243734.000206Mzf1 RNA / ATAC-seq P P P P U U U U Nab2 RNA / ATAC-seq P N N P N U D D U D Ncoa7 RNA / ATAC-seq P P P P P P P P P U U U U U U U U U Ncor2 RNA / ATAC-seq N N N N N D D D D D Nfat5 RNA / ATAC-seq P P P P P U U U U U Nfatc2 RNA / ATAC-seq N D P P P _P N U U U U D Nfe2 RNA / ATAC-seq N D N N N N N _P D D D D D U 80 304098633v1Attorney Docket No: 243734.00020681 304098633v1Attorney Docket No: 243734.00020682 304098633v1Attorney Docket No: 243734.00020683 304098633v1Attorney Docket No: 243734.00020684 304098633v1Attorney Docket No: 243734.000206Table 2. Gene list and sgRNA sequences of the scCRISPR library.85 304098633v1Attorney Docket No: 243734.00020686 304098633v1Attorney Docket No: 243734.00020687 304098633v1Attorney Docket No: 243734.00020688 304098633v1Attorney Docket No: 243734.00020689 304098633v1Attorney Docket No: 243734.00020690 304098633v1Attorney Docket No: 243734.00020691 304098633v1Attorney Docket No: 243734.00020692 304098633v1Attorney Docket No: 243734.00020693 304098633v1Attorney Docket No: 243734.00020694 304098633v1Attorney Docket No: 243734.00020695 304098633v1Attorney Docket No: 243734.00020696 304098633v1Attorney Docket No: 243734.00020697 304098633v1Attorney Docket No: 243734.00020698 304098633v1Attorney Docket No: 243734.00020699 304098633v1Attorney Docket No: 243734.000206100 304098633v1Attorney Docket No: 243734.000206101 304098633v1Attorney Docket No: 243734.000206102 304098633v1Attorney Docket No: 243734.000206103 304098633v1Attorney Docket No: 243734.000206104 304098633v1Attorney Docket No: 243734.000206105 304098633v1Attorney Docket No: 243734.000206106 304098633v1Attorney Docket No: 243734.000206107 304098633v1Attorney Docket No: 243734.000206108 304098633v1Attorney Docket No: 243734.000206109 304098633v1Attorney Docket No: 243734.000206110 304098633v1Attorney Docket No: 243734.000206111 304098633v1Attorney Docket No: 243734.000206112 304098633v1Attorney Docket No: 243734.000206113 304098633v1Attorney Docket No: 243734.000206114 304098633v1Attorney Docket No: 243734.000206115 304098633v1Attorney Docket No: 243734.000206116 304098633v1Attorney Docket No: 243734.000206117 304098633v1Attorney Docket No: 243734.000206118 304098633v1Attorney Docket No: 243734.000206119 304098633v1Attorney Docket No: 243734.000206120 304098633v1Attorney Docket No: 243734.000206121 304098633v1Attorney Docket No: 243734.000206
[0346] Next, Cas9-expressing activated OT-I CD8+T cells (specific for ovalbumin (OVA)) were transduced with the scCRISPR library, followed by adoptive transfer to B16-OVA melanoma tumour-bearing mice (16). Single-cell sgRNA and transcriptome libraries from donor-derived tumour-infiltrating lymphocytes (TILs) were assessed by droplet-based sequencing seven days later. At least one sgRNA was detected in the majority (82%) of cells, and ~81% of cells containing two sgRNAs were from the same vector. In the 42,209 cells bearing a single gene perturbation, the ratio of each genetic perturbation versus NTC was calculated and revealed putative positive (Stat5a, Stat5b and Irf4) and negative (Nr4a3 and Fli1) regulators of intratumoral CTL accumulation (Figure 1A).
[0347] To interrogate cellular heterogeneity and underlying transcriptional drivers, single- cell transcriptomes were visualized on Uniform Manifold Approximation and Project (UMAP). Clusters 0–4 expressed Tox, a key regulator of exhaustion (17-21). Within them, clusters 0-2 expressed stemness-associated markers Tcf7 (TCF-1), Slamf6 (Ly108) and Sell (CD62L), whereas clusters 3 and 4 had abundant Pdcd1 (PD-1) and Havcr2 (TIM-3) levels, with cluster 4 showing highest expression of terminal exhaustion markers Entpd1 (CD39), Cd38 and Cd244a. In contrast, cluster 5 (ToxlowEntpd1low) expressed high levels of effector markers (Ifng, Gzma and Gzmb) and Itgax (CD11c) (22). Based on expression of these markers (1,2) and Tpex, Tex and Teff signatures (Figure 6C), these clusters were annotated as Tpex (Tox+Tcf7+Havcr2–), Tex (Tox+Tcf7–Havcr2+) and Teff cells (Tox–Itgax+Havcr2+). The Tex versus Tpex differential gene expression profiles were highly correlated with a previous dataset (5), and Tpex and Tex cells showed increased chromatin accessibility of exhaustion-associated genes compared to T cells from acute lymphocytic choriomeningitis virus (LCMV) infection (23) (Figure 6D). Finally, intratumoral Tpex and Tex cells (among OT-I cells) displayed increased TOX expression than OT-I cells from the spleen and tumour-draining lymph node (tdLN), thereby collectively supporting their annotations as Tpex and Tex cells. In contrast, Teff cells showed reduced TOX and CD39 expression relative to Tex cells and represented a minor population, consistent with CTL adaptation to an exhausted state for better persistence 122 304098633v1Attorney Docket No: 243734.000206 in the TME (1,2). Together, in vivo scCRISPR screens and transcriptome analysis revealed molecular and cellular diversity in tumour-specific CTLs. Example 2. Co-functional modules and gene programs.
[0348] To establish co-functional modules and downstream gene programs, differential gene expression was analyzed by comparing 172 TF perturbations (versus NTC) with sufficient number of cells detected (15). Then, the regulatory effects of each TF perturbation on target gene expression were calculated to identify co-functional TF modules based on their similar regulatory effects and group target genes into co-regulated gene programs (24). Nine co- functional TF modules with convergent or divergent functional effects were identified (Table 3), along with four co-regulated gene programs associated with effector function (program A), exhaustion (program B), stemness (program C), and proliferation (program D) (Table 4). These gene programs showed unique molecular signatures and discrete enrichments in the Tpex, Tex, and Teff clusters. Table 3. Genes in each co-functional module.123 304098633v1Attorney Docket No: 243734.000206Table 4. Genes in each co-regulated gene program.124 304098633v1Attorney Docket No: 243734.000206
[0349] The strength of perturbation effects of the nine co-functional modules on the four co- regulated gene programs were visualized and six modules (M2, M3 and M5–M8) with marked effects were identified (Figure 1B). The strongest negative and positive regulators of effector 125 304098633v1Attorney Docket No: 243734.000206 function program were M5 (including Bach2 and Bcl6) and M2 (Id2 and Zeb2), respectively. The strongest negative and positive regulators of exhaustion program were M7 (Tcf7, Myb and Ets1) and M3 (Nr4a2, Nr4a3respectively, whereas stemness program was boosted by M7 and suppressed by M3, suggesting reciprocal regulation of exhaustion and stemness programs by these two modules. M5 was another noticeable positive regulator for stemness program. Finally, the top negative and positive regulators of proliferation program were M8 (Tox and Rbpj) and M6 (Foxo1), respectively (Figure 1B). Therefore, the complex but concerted effects of these modules on effector function, exhaustion, stemness and proliferation programs were resolved.
[0350] To uncover intramodular and intermodular regulatory circuits, a focused GRN between six main modules was generated and the interaction strengths were assessed. Strong positive intramodular interactions within M3 and M7 were observed. Also, there were mutual positive intermodular interactions between the stemness-promoting M5 and M7, and between the exhaustion-promoting M2 and M3, suggesting intermodular self-reinforcements of stemness and exhaustion programs. Conversely, the negative effect imposed by M3 upon M7 suggests that inhibition of stemness by the exhaustion program may potentiate terminal differentiation. To uncover specific regulation between individual TFs, the connectivity between TFs within and across the modules was constructed and then central hub TFs were defined. Rbpj, Ikzf2 and Klf13 (M8), Runx3, Ikzf1 and Nfat5 (M3), Foxo1 (M6), Tcf7, Myb and Ets1 (M7), Bach2 (M5), and Id2 (M2) had pronounced regulatory effects in their respective modules, nominating them as central hub TFs. Beyond capturing known interactions (e.g., Tcf7 (3), Bach2 (14) and Myb (25)), this analysis also revealed many previously uncharacterized interactions (Table 5). Collectively, intramodular and intermodular regulatory circuits and central hub TFs that likely underlie intratumoral CTL responses were revealed. Table 5. The regulatory effect of each transcription factor (TF) on other TFs in M2, M3, M5, M6, M7, and M8.126 304098633v1Attorney Docket No: 243734.000206127 304098633v1Attorney Docket No: 243734.000206128 304098633v1Attorney Docket No: 243734.000206129 304098633v1Attorney Docket No: 243734.000206130 304098633v1Attorney Docket No: 243734.000206131 304098633v1Attorney Docket No: 243734.000206Example 3. State-specific transcriptional drivers.
[0351] As TF perturbations may exert regulatory effects on gene programs by inducing cell population changes, the perturbation effects on intratumoral CTL heterogeneity were examined, focusing on Tpex and Tex populations. A perturbation-only (with sgNTC depleted) population that resembled Tpex cells was identified (cluster 0), while the remaining clusters contained both sgNTC and perturbation sgRNA-transduced cells. Dynamic regulation of discrete Tpex- or Tex-associated markers (5) and their progressive changes (13) were found during tumour development (Figure 7A). Given the identification of intermediate or transitory 132 304098633v1Attorney Docket No: 243734.000206 Tex cells in chronic infection (26,27), Tpex and Tex clusters were operationally classified as precursor exhausted-like state 1 (Tpex1), Tpex2, terminal exhausted-like state 1 (Tex1) and Tex2 cells, with pseudotime analysis predicting a trajectory from Tpex1, via Tpex2 and Tex1, to Tex2 cells (Figure 1C). Accordingly, Tex2, but not Tex1, cell proportion continuously increased while the two Tpex states declined during tumour progression. Finally, Tpex1 and Tex1 cells were respectively reduced upon perturbation of Myb (25) and Tbx21 (T-bet) (26,28), further supporting these annotations.
[0352] Gene set enrichment analysis (GSEA) revealed increased activation-specific signature (29) in Tpex2 versus Tpex1 cells and dysfunction-associated signature (29) in Tex2 versus Tex1 cells. Further, Tpex1 state expressed stemness-associated genes (Tcf7, Slamf6, Myb, Sell and Bach2) that were progressively downregulated during differentiation (Figure 1D). Conversely, Tpex2 state expressed Ifng and the proliferative marker Mki67, and had higher activities of mTORC1- and metabolism-associated signatures than Tpex1 state (Figure 1D, Figure 7B), suggesting their exit from a stem-like, quiescent state that is associated with metabolic reprogramming (30). Further, Tex1 cells retained high Mki67 expression and, compared to Tex2 cells, showed higher metabolic signatures, but lower levels of terminal exhaustion markers (13) ( Figure 1D, Figure 7B), partly resembling intermediate Tex cells (26,27). Accordingly, Ki67+Tpex or Ki67+Tex cells (corresponding to Tpex2 or Tex1 state, respectively) had higher mechanistic target of rapamycin complex 1 (mTORC1) activity (based on phosphorylated S6 (pS6), CD98, CD71, and MitoTracker staining) (30) compared to their Ki67–counterparts (Tpex1 and Tex2 states) (Figures 7C-7E). Ki67+Tex cells also expressed the highest levels of granzyme B (GZMB), T-bet and BATF, and comparable IFN^ levels as Ki67–Tex cells (Figures 7F, 7G), suggesting strong effector function.
[0353] Transcriptional activators and repressors for each cell state were identified based on sgRNA depletion or enrichment (versus the other three counterparts) (Table 6). This analysis also revealed shared and selective (e.g., MYB (25) and T-bet (26,28)) regulators for each state (Figure 7H). Further, visualization of the perturbation effects upon targeting of the eight TFs (Figure 1A) excluded from the abovementioned transcriptome analysis revealed their effects on cell states, including reduced Tex percentages upon targeting of Stat5a, Stat5b and Irf4. Altogether, analyses of state-specific regulators identified transcriptional drivers mediating CTL heterogeneity. Table 6. Tpex and Tex cell state-specific regulators identified in scCRISPR screening.133 304098633v1Attorney Docket No: 243734.000206134 304098633v1Attorney Docket No: 243734.000206135 304098633v1Attorney Docket No: 243734.000206136 304098633v1Attorney Docket No: 243734.000206137 304098633v1Attorney Docket No: 243734.000206
[0354] To determine the extent to which CTL differentiation states are shaped by the co- functional modules, whether a module was enriched among the top regulated genes within each state was examined. M7 was enriched as a positive and negative regulator of Tpex and Tex states, respectively, consistent with its stemness-promoting effects (Figure 1B). Conversely, M3, and to a lesser extent, M2, were negative regulators of Tpex1, but positive regulators of Tex cells, also consistent with their effects on gene programs. Collectively, these results revealed state-specific transcriptional drivers and co-functional modules that underlie the progressive CTL differentiation. Example 4. IKAROS–TCF-1 axis in Tpex quiescence exit.
[0355] Targeting of Ikzf1 (encoding IKAROS, from M3) resulted in the strongest accumulation of intratumoral CTLs (Figure 1A). To explore cell-intrinsic roles of Ikzf1, a dual- colour transfer system (16,23) was used, wherein the use of different fluorescent proteins did not alter CTL responses. sgIkzf1 OT-I cells, which showed efficient gene targeting (Figure 8A, Table 7), were markedly accumulated in the TME at day 7 after transfer (Figure 2A). Tpex cells increased upon Ikzf1 perturbation, whereas the percentage, but not number, of Tex cells were reduced (Figure 2B, Figure 8B). Ikzf1 deficiency exerted similar effects at day 21 after transfer (Figures 8C, 8D). Besides the TME, sgIkzf1 OT-I cells (mainly Ly108+TIM-3–) also accumulated in tdLN and spleen (Figures 8E, 8F). Notably, sgIkzf1 intratumoral OT-I cells had reduced expression of effector and cytotoxic molecules (Figures 8G, 8H). To determine the role of Ikzf1 in Tpex to Tex transition, sgNTC and sgIkzf1 Tpex cells were sort-purified from B16-OVA tumours and were transferred to new tumour-bearing mice (Figure 8I) (5,9). In this secondary transfer assay, Ikzf1 deficiency was associated with accumulation of Tpex and reduction of Tex cells (Figure 8J). Thus, IKAROS promotes Tpex to Tex differentiation. Table 7. The sgRNA deletion efficiency of in vivo OT-I cells.
[0356] To unbiasedly establish the effect of Ikzf1 deficiency on CTL heterogeneity, scRNA- seq analysis was performed. sgIkzf1 OT-I cells were transcriptionally distinct from sgNTC OT- I cells and contained more Tpex, especially Tpex1 cells, but fewer Tex cells. sgIkzf1 Tpex cells also upregulated stemness-associated TFs (14) and gene signatures (7,20). Pseudotime analysis 138 304098633v1Attorney Docket No: 243734.000206 indicated that sgIkzf1 cells mainly accumulated in Tpex1 state (Figure 2C), which was supported by sgIkzf1 enrichment among the top-most perturbations affecting the Tpex1 versus Tpex2 ratio (Table 8). Moreover, sgIkzf1 Tpex cells downregulated multiple metabolic and mTORC1 signatures (Figure 8K) (30), raising the possibility of aberrant metabolic quiescence (30). Indeed, sgIkzf1 Tpex cells showed reduced mTORC1-associated features, as well as lower levels of MitoSOX and proliferation markers (Ki67 and bromodeoxyuridine (BrdU)) at day 7 after transfer (Figures 2D, 2E, Figure 8L), with such proliferative defects also evident at day 21 (Figure 8M). Thus, Ikzf1 targeting inhibits Tpex1 to Tpex2 transition and associated metabolic rewiring and quiescence exit (26,30). Table 8. Positive and negative regulators between Tpex and Tex cell states identified in scCRISPR screening.139 304098633v1Attorney Docket No: 243734.000206140 304098633v1Attorney Docket No: 243734.000206141 304098633v1Attorney Docket No: 243734.000206142 304098633v1Attorney Docket No: 243734.000206
[0357] Since ICB induces differentiation of Tpex into Tex cells (5,7,26,27,31), the effect of Ikzf1 deficiency on ICB response was tested by treating tumour-bearing mice that received sgNTC or sgIkzf1 OT-I cells with anti-PD-L1. Unlike sgNTC OT-I cells, sgIkzf1 OT-I cells did not increase upon anti-PD-L1 treatment or display altered differentiation states (Figure 2F, Figure 8N). sgIkzf1 cells also did not upregulate IFN^ or GZMB expression upon anti-PD-L1 treatment. Moreover, tumour size was comparable in mice that received transfer of sgIkzf1 and sgNTC OT-I cells alone or in combination with anti-PD-L1 (Figure 8O). Thus, despite their increased accumulation, sgIkzf1 cells do not gain superior antitumour effects, likely due to the aberrant quiescence state and failure to differentiate into Tex cells.
[0358] To gain additional mechanistic insights, ATAC-seq analysis was performed and it was found that sgIkzf1 Tpex cells showed increased accessibility of Tpex-selective OCRs but reduced accessibility of Tex-selective OCRs, indicating an enhanced stemness-associated and reduced exhaustion-associated epigenetic program. TF footprinting analysis predicted increased binding activity of stemness-associated TCF / LEF family members in sgIkzf1 Tpex 143 304098633v1Attorney Docket No: 243734.000206 cells. To more unbiasedly identify IKAROS downstream targets, in vivo genetic interaction screens (10) were performed by co-transducing OT-I cells expressing sgNTC or sgIkzf1 together with the abovementioned TF sgRNA library, followed by transfer to tumour-bearing mice (Figure 8P). Functionally relevant targets of IKAROS were nominated by identifying perturbations that reversed the Tpex versus Tex ratio and Tpex accumulation (Table 9), and it was found that Tcf7 co-targeting blocked both of these parameters in sgIkzf1 cells (Figure 8Q). Accordingly, these validation experiments showed that co-targeting of Ikzf1 and Tcf7 rectified the alterations in Tpex cells and Tpex versus Tex ratio (Figures 2G, 2H) observed in Ikzf1- deficient cells. These results indicate that IKAROS affects Tpex to Tex differentiation largely by restraining TCF-1. Table 9. In vivo genetic interaction CRISPR screening results in sgNTC and sgIkzf1 OT- I cells.144 304098633v1Attorney Docket No: 243734.000206145 304098633v1Attorney Docket No: 243734.000206146 304098633v1Attorney Docket No: 243734.000206147 304098633v1Attorney Docket No: 243734.000206Example 5. ETS1–BATF axis curtails Tex1 generation.
[0359] Tex1 cells showed heightened effector function-associated pathways as compared to Tpex2 cells (Figure 9A). Therefore, putative TFs mediating Tpex2 to Tex1 transition were the focus and Ets1 (from M7) was identified as one of the top negative regulators (Table 8). Additionally, Ets1 expression was downmodulated in Tpex2 and Tex1 states (Figure 9B). To examine the role of ETS1 in CTL heterogeneity, Ets1 in OT-I cells was effectively deleted (Table 7) and scRNA-seq was performed. Ets1-deficient cells showed expansion of Tex1 cells, accompanied by a reduction of Tpex proportion and stemness-associated signatures in Tex cells (Figure 9C). Targeting Ets1 also upregulated metabolic gene signatures and mTORC1- associated features (Figures 9D, 9E), suggesting an inhibitory effect of ETS1 on mTORC1 signalling.
[0360] Further, Ets1 deficiency enhanced OT-I and Tex (but not Tpex) cell accumulation in the TME but not spleen or tdLN (Figures 3A, 3B, Figures 9F-9I). Intratumoral Ets1-deficient 148 304098633v1Attorney Docket No: 243734.000206 cells also showed increased expression of markers associated with effector function, cytotoxicity, and proliferation (Figures 3C, 3D, Figures 9J-9M), in agreement with the increased percentage of proliferative Tex1 cells. The extent to which Ets1 deficiency affects Tpex to Tex differentiation was tested using a secondary transfer assay of purified Tpex and Tex cells (Figure 10A). Upon transfer of Ets1-deficient Tpex cells, the numbers of total OT-I and Tex cells that developed from Tpex cells (5) were increased, associated with more extensive proliferation (Figure 3E, Figure 10B). Further, transfer of Ets1-deficient Tex cells resulted in enhanced Tex (and total OT-I) cell accumulation, also accompanied with more proliferation (Figure 3E, Figure 10C). These analyses suggest that ETS1 is a gatekeeper for Tpex to Tex differentiation and Tex accumulation.
[0361] To test therapeutic effects, adoptive cell transfer (ACT) experiments were performed and it was found that transfer of Ets1-deficient OT-I or pmel cells reduced B16-OVA and B16- F10 tumour growth, respectively (Figures 3F, 3G). Ets1-deficient CAR T cells targeting human CD19 (hCD19) also showed increased therapeutic effect for hCD19-expressing B16 (B16-hCD19) tumours (12,32) (Figure 3H). Beyond these melanoma-related models, Ets1- deficient OT-I cells also improved therapeutic efficacy against OVA-expressing EL4 lymphoma (E.G7-OVA) or Lewis lung carcinoma (LLC-OVA) tumours (Figure 10D), associated with enhanced intratumoral OT-I and Tex cell accumulation (Figures 10E-10H). Therefore, targeting Ets1 improves antitumour effects in multiple tumour types.
[0362] Moreover, the combinatorial treatment of OT-I cells deficient for Ets1 with anti-PD- L1 enhanced antitumour effects compared to control groups in B16-OVA or E.G7-OVA tumors (Figure 3I, Figure 10I), suggesting that targeting Ets1 boosts ICB response. Accordingly, ETS1 expression in CD8+T cells had an inverse correlation with ICB responsiveness in melanoma patients (33) (Figure 10J). Further, in scRNA-seq profiling of CTLs from patients with advanced basal cell carcinoma (BCC) (34), anti-PD-1 treatment induced an activated CD8+T cell population that had lower ETS1 and higher IFNG expression than the exhausted population (Figure 3J), with similar effects observed in squamous cell carcinoma (SCC) (Figure 10K). Thus, ETS1 expression negatively correlates with ICB response, consistent with the observations in murine models that targeting Ets1 overcomes resistance to ICB.
[0363] To explore the mechanistic basis of ETS1-dependent effects, ATAC-seq of Tpex and Tex cells was performed. TF motif enrichment and footprinting analyses revealed that Ets1- deficient cells showed enhanced activity of BATF, a potent regulator of CTL effector function (16,28,32) (Figure 3K, Figures 10L). Accordingly, BATF expression was increased in sgEts1 Tex and total OT-I cells (Figure 10M). Next, in vivo secondary genetic interaction screens 149 304098633v1Attorney Docket No: 243734.000206 were employed for functionally relevant downstream targets of ETS1 (similar as Figure 8P) to identify perturbations that reversed the enhanced Tpex to Tex differentiation and Tex accumulation (Table 10). Batf co-targeting in Ets1-deficient cells rectified both parameters (Figure 10N). To validate these results, sgNTC, sgEts1, sgBatf, or sgEts1 + Batf OT-I cells were transferred to B16-OVA tumour-bearing mice and it was found that co-targeting of Ets1 and Batf reversed the increased accumulation of total and Tex cells (Figure 3L, Figure 10O). The increased percentages of GZMB+, IFN^+and Ki67+Ets1-deficient cells were also reversed by Batf co-targeting (Figure 3M). Therefore, ETS1–BATF axis restrains Tex accumulation and effector responses. Table 10. In vivo genetic interaction CRISPR screening results in sgNTC and sgEts1 OT-I cells.150 304098633v1Attorney Docket No: 243734.000206151 304098633v1Attorney Docket No: 243734.000206152 304098633v1Attorney Docket No: 243734.000206153 304098633v1Attorney Docket No: 243734.000206Example 6. RBPJ drives Tex1 to Tex2 transition.
[0364] Impaired functional and proliferative capacities of Tex cells are a barrier to successful immunotherapy (5-7,9). Rbpj perturbation was identified as a top candidate to boost Tex1 versus Tex2 ratio (Table 8), with Rbpj sgRNAs enriched in Tex1, but not Tex2 cells, suggesting that its targeting may represent possible mechanisms to overcome these limitations. Further, Rbpj-deficient cells upregulated proliferation signatures (Figure 11A, Table 11), raising the possibility that RBPJ represses intratumoral CTL accumulation. To test this possibility, sgRNAs with effective depletion of RBPJ expression were generated (Figures 11B, 11C, Table 7), and greater OT-I cell accumulation was observed in the TME but not spleen or tdLN (Figure 4A, Figures 11D, 11E). Further, Rbpj deficiency increased Tex proportion and accumulation but decreased Tpex frequency (Figure 4B, Figures 11F, 11G), with increased proliferation but unaltered apoptosis of Tex cells (Figure 4C, Figures 11H, 11I). Similar effects were observed upon transfer of sgNTC or sgRbpj cells separately to tumour-bearing 154 304098633v1Attorney Docket No: 243734.000206 mice (Figure 4D, Figure 11J). Therefore, RBPJ selectively restrains Tex accumulation in the TME.
[0365] Regulation of Rbpj expression was examined in intratumoral CTLs. Rbpj was upregulated in endogenous Tex versus Tpex cells from murine B16 melanoma (29) and MC38 colon adenocarcinoma (35), and largely co-expressed with Havcr2 in CD8+T cells from genetically engineered mouse models (GEMMs) of breast cancer (36) and lung adenocarcinoma (37). Further, RBPJ expression in OT-I cells was higher in Tex than other intratumoral or peripheral CD8+T cell populations (Figure 4E). In Tpex-like and Tex-like CD8+T cells generated in vitro (38) (Figure 12A), concomitant to the expected changes in TIM-3 and Ly108 expression (38), RBPJ expression was upregulated in Tex-like cells (Figures 12B, 12C), consistent with in vivo observations.
[0366] In the secondary transfer assay of Tex cells (5,9) (Figure 12D), Rbpj deficiency increased Tex cell accumulation, associated with increased proliferation (Figures 4F, 4G). Conversely, upon transfer of Tpex cells, accumulation of Tpex and Tex cells remained largely unchanged upon targeting Rbpj (Figure 12E). Thus, Rbpj deficiency resulted in selective Tex cell accumulation, further supporting a cell-intrinsic inhibitory effect of RBPJ on Tex accumulation and proliferation.
[0367] scRNA-seq analysis was performed and a marked increase of Tex1 (but not Tex2) cells was found among Rbpj-deficient cells. In pseudotime analysis, Rbpj-deficient cells were accumulated in the middle of the differentiation trajectory based on intermediate Tcf7 and Entpd1 and high Mki67 expression, which was validated by increased Ki67+Tex percentage (Figure 4H). Therefore, Rbpj deficiency results in selective accumulation of Tex1 cells. Example 7. Exhaustion boosts RBPJ in human cancers.
[0368] Whether RBPJ expression correlates with exhaustion programs of human intratumoral T cells was explored. RBPJ was elevated in CD8+T cells from human tumour tissues (39), and also co-expressed with HAVCR2 in intratumoral CD8+T cells from patients with non-small cell lung cancer (NSCLC) (40) and colorectal cancer (CRC) (41) (Figure 13A). Also, RBPJ expression was upregulated in TCF7-HAVCR2+CTLs from individuals with melanoma (42) and hepatocellular carcinoma (43) (Figure 13B). Intratumoral CD8+T cells from melanoma patients acquire naïve-like, transitional and dysfunctional states (44), with RBPJ expression being progressively increased from naïve-like to dysfunctional cells. Similarly, in a liver cancer GEMM (13), Rbpj expression was continuously upregulated during T cell exhaustion. Collectively, upregulated RBPJ expression is a conserved feature of exhausted CD8+T cells in mice and humans. 155 304098633v1Attorney Docket No: 243734.000206
[0369] Correlation between RBPJ and genes associated with clinical responses to anti-PD-1 therapy was examined. In melanoma (33), RBPJ was clustered with genes negatively associated with responsiveness to anti-PD-1 blockade (including HOPX, LGALS1, VCAM1, RBPJ, SNAP47, CCL3, FASLG, MT2A, EPST11, GBP1, PSMB2, NDUFB3, CD38, GBP4, WARS, PRDX3) (Figure 13C). The major pathologic response (MPR) predicts ICB efficacy and is correlated with T cells specific for mutation-associated neoantigens (MANA) (45). Accordingly, in NSCLC-derived MANA-specific T cells, RBPJ was downregulated in MANA- specific T cells with MPR (Figure 13D), further supporting negative correlation between RBPJ expression and ICB response. Moreover, anti-PD-1 treated- individuals with BCC and SCC (34) had lower RBPJ expression in the ICB-induced activated than the exhausted T cell population (Figure 13E). Therefore, low RBPJ expression in CD8+T cells is associated with enhanced clinical response to ICB.
[0370] It was further tested whether RBPJ expression correlates with continuous antigen exposure (CAE)-induced CAR T cell exhaustion. Similar to HAVCR2 and TOX, RBPJ expression was progressively increased and reached the highest levels at day 28 when expression of IFNG and GZMB abated (Figure 13F). Further, at day 28 after CAE, RBPJ expression largely overlapped with known exhaustion markers (46). Further, ATAC-seq analysis (46) showed that, like exhaustion-promoting factors SOX4 and ID3, the RBPJ gene locus had increased accessibility at day 28 after CAE. These transcriptional and chromatin accessibility analyses revealed that RBPJ expression is associated with exhaustion in human CAR T cells, consistent with negative correlation of RBPJ with ICB response. Example 8. Rbpj deficiency improves immunotherapies.
[0371] The analyses described herein suggested that targeting Rbpj may enhance CTL effector function and antitumour effects. Accordingly, effector signatures were highly enriched in the absence of Rbpj (Figure 13G, Table 11). Rbpj-deficient cells had increased GZMB+and IFN^+frequencies and upregulated perforin and other effector-associated molecules (Figure 5A, Figures 13H-13L), indicating enhanced cytotoxic and effector features. Single-cell transcriptomics also revealed that Prf1 (encodes for perforin), Gzmb and Gzmk were increased in Rbpj-deficient Tex cells (Figure 13M). In line with enhanced effector function, Rbpj- deficient OT-I cells better controlled tumour growth and extended the survival of B16-OVA tumour-bearing mice (Figure 5B, Figure 13N). Similar results were observed upon pmel cell transfer to B16-F10 tumour-bearing mice (Figure 5C). To examine whether targeting Rbpj in CTLs enhances ICB response, anti-PD-L1 treatment was applied in B16-OVA tumour-bearing 156 304098633v1Attorney Docket No: 243734.000206 mice that received Rbpj-deficient OT-I cells and it was found that enhanced antitumour effects compared with either treatment alone (Figure 5D). Finally, the effect of Rbpj deficiency on the therapeutic efficacy of hCD19 CAR T cells was tested and it was found that Rbpj-deficient CAR T cells had improved efficacy in curtailing tumour growth (Figure 5E). Table 11. Gene set enrichment analysis of transcriptome data of sgRbpj vs. sgNTC OT-I cells._ _ 157 304098633v1Attorney Docket No: 243734.000206158 304098633v1Attorney Docket No: 243734.000206159 304098633v1Attorney Docket No: 243734.000206
[0372] To evaluate therapeutic effects in additional tumors, mice with E.G7-OVA or LLC- OVA tumours were challenged and improved antitumour effects were observed from sgRbpj cells (Figures 13O, 13P). Rbpj deficiency also enhanced intratumoral OT-I and Tex (but not Tpex) cell accumulation in E.G7-OVA and LLC-OVA tumours (Figures 13Q-T). Moreover, combinatorial treatment of E.G7-OVA tumour-bearing mice with Rbpj-deficient OT-I cells 160 304098633v1Attorney Docket No: 243734.000206 with anti-PD-L1 enhanced antitumour effects compared to control groups (Figure 5F), suggesting that targeting Rbpj also boosts ICB response in the lymphoma model. Collectively, targeting Rbpj in CTLs provokes potent antitumour effects. Example 9. NOTCH-independent RBPJ signalling.
[0373] As RBPJ has both NOTCH-dependent and -independent functions (47), Notch1 and Notch2 (Notch1 / 2) expression was examined. In contrast to Rbpj, Notch1 / 2 expression was comparable in Tpex and Tex cells. Additionally, Notch1 / 2 co-targeting did not alter the percentages of Tpex, Tex or Ki67+cells, or cells expressing GZMB or IFN^. Further, Rbpj- deficient Tpex and Tex cells had largely unaltered Notch1 / 2 expression and NOTCH signalling signature. Therefore, RBPJ functions independently of NOTCH signalling in intratumoral CTL responses.
[0374] To identify alternative mechanisms regulating RBPJ signalling, ATAC-seq analysis was performed and it was found that multiple OCRs in the Rbpj locus had increased chromatin accessibility in Tex compared to Tpex cells, consistent with elevated Rbpj expression in Tex cells (Figure 4E). TF motif enrichment analysis of these OCRs revealed enrichment for BACH2, RUNX, and JUN (Figure 14A), whereas the scCRISPR results herein showed that targeting Bach2 (but not Runx1, Runx2 or Jun) increased Rbpj expression in OT-I, Tpex and Tex cells (Figures 14B). Further, Bach2 and Rbpj showed reciprocal expression in Tpex and Tex subsets (Figure 1D), collectively suggesting that BACH2 may inhibit RBPJ expression. Indeed, targeting Bach2 upregulated RBPJ expression in total OT-I, Tpex and Tex cells (Figure 14C). Further, Rbpj expression was upregulated in TCR-stimulated Bach2-deficient CD8+T cells (48) (Figure 14D). Conversely, Bach2 overexpression (14) dampened Rbpj expression and gene accessibility (Figure 14E). Therefore, BACH2 is necessary and sufficient for inhibiting Rbpj expression. Example 10. RBPJ inhibits IRF1 activity.
[0375] Downstream mechanisms for RBPJ in CTL differentiation were determined. Peak set enrichment analysis of ATAC-seq profiling revealed that genes with enhanced chromatin accessibility in Rbpj-deficient Tex cells were enriched for pathways related to effector function, whereas fewer changes were noted in Tpex cells (Figures 15A, 15B). Accordingly, effector function-associated genes (Cd28, Prf1 and Ifng) had enhanced chromatin accessibility selectively in Rbpj-deficient Tex cells (Figure 15C). TF motif analysis of OCRs with increased accessibility in Rbpj-deficient Tex cells identified IRF1 as the top enriched motif, along with effector function-associated TFs BLIMP1 (49) and BATF (16,28,32) (Figure 5G). 161 304098633v1Attorney Docket No: 243734.000206
[0376] A secondary genetic interaction CRISPR screen (similar as Figure 8P) was performed, and candidates were nominated based on their ability to rectify intratumoral OT-I and Tex cell accumulation and Tex versus Tpex ratio (Table 12). This analysis revealed IRF1 as the only candidate meeting these criteria. Accordingly, IRF1 binding motif, identified in OCRs upregulated in sgRbpj versus sgNTC Tex cells in ATAC-seq analysis, was enriched in genes associated with T cell effector function (Figure 15D). Thus, these complementary approaches unveil IRF1 as a top candidate. Table 12. In vivo genetic interaction CRISPR screening results in sgNTC and sgRbpj OT-I cells.162 304098633v1Attorney Docket No: 243734.000206163 304098633v1Attorney Docket No: 243734.000206164 304098633v1Attorney Docket No: 243734.000206165 304098633v1Attorney Docket No: 243734.000206166 304098633v1Attorney Docket No: 243734.000206
[0377] To establish the functional relationship between RBPJ and IRF1, sgNTC, sgRbpj, sgIrf1 or sgRbpj + Irf1 OT-I cells were transferred to B16-OVA tumour-bearing mice. Co- 167 304098633v1Attorney Docket No: 243734.000206 targeting of Rbpj and Irf1 reduced accumulation of total OT-I and Tex cells caused by Rbpj deficiency (Figures 5H, 5I, Figure 15E). Further, alterations in transcriptome profiles between sgNTC and sgRbpj cells were mitigated by Irf1 co-targeting (Figure 15F), with proliferation- and effector function-related pathways also downregulated. Accordingly, such co-targeting reversed the increased percentages of Ki67+, GZMB+and IFN^+cells caused by Rbpj deficiency in validation experiments (Figures 5J, 5K), as well as the enhanced antitumour effect (Figure 15G). Collectively, IRF1 is required for Rbpj deficiency-induced proliferation and effector function of Tex cells and antitumor effects.
[0378] T cell exhaustion represents an adaptive state of hyporesponsiveness that is permissive for persistence in the TME (2), with terminal differentiation associated with poor antitumour responses. The causal GRN underlying CTL differentiation and heterogeneity remains elusive. Here, the functional effects of three transcriptional axes (IKAROS–TCF-1, ETS1–BATF and RBPJ–IRF1) were established on CTL heterogeneity with important therapeutic implications (Figure 15H). Specifically, IKAROS and ETS1 orchestrate successive steps in the differentiation of Tpex to proliferative Tex1 cells. IKAROS promotes metabolic activation in Tpex1 and their differentiation to Tpex2 cells, and targeting Ikzf1 dampened effector function and increased stemness and persistence of intratumoral CTLs, suggesting Ikzf1 deficiency likely freezes cells in an excessively quiescent state. Consequently, increased Ikzf1-deficient cell accumulation did not improve antitumour immunity alone or in combination with ICB. Conversely, ETS1 is a gatekeeper for Tpex2 to Tex1 transition, likely by suppressing mTORC1 activity and metabolic reprogramming. Targeting Ets1 enhanced antitumour effects in multiple immunotherapeutic systems, and ETS1 expression was negatively associated with ICB response in cancer patients. Mechanistically, IKAROS and ETS1 restrain the respective activities of TCF-1 and BATF. Thus, quiescence exit and metabolic reprogramming represent an under-appreciated modality for the transition from stem-like Tpex to intermediate Tex cells, thereby representing a key therapeutic checkpoint.
[0379] Tex cells are the major intratumoral population and directly contribute to killing tumour cells, but gradually lose proliferative capacity and do not respond to existing immunotherapies (5-7,9). How to functionally reinvigorate Tex cells to unleash antitumour immunity remains unclear. Here, it was showed that targeting Rbpj blocked terminal Tex2 differentiation, while expanding Tex1 cells with enhanced proliferation and effector function. RBPJ expression was correlated with terminal exhaustion in CTLs from cancer patients and GEMMs, as well as hyporesponsiveness to immunotherapies in individuals with cancer. 168 304098633v1Attorney Docket No: 243734.000206 Accordingly, targeting Rbpj improved antitumour immunity in multiple therapeutic models. Mechanistically, NOTCH-independent RBPJ signalling acts to suppress IRF1 function. Thus, targeting RBPJ specifically reprograms Tex cells and may act in synergy with ICB that targets Tpex cells (3-7).
[0380] Together, the studies herein provide a systemic framework of the genetic circuitry and molecular determinants underlying functional heterogeneity of intratumoral CTL responses, including three checkpoints for progressive CTL differentiation. The results highlight the modalities of inducing quiescence exit of Tpex and enriching the proliferative state in Tex cells for functional reinvigoration of CTL antitumour responses. Importantly, the intramodular and intermodular connectivity of co-functional modules may uncover unknown genetic interactions and extend pathway mapping in systems biology, with such approaches being scalable and applicable to other biological systems. Collectively, these results establish a perturbation map of progressive differentiation of CD8+T cells in the TME and identify putative actionable targets for functional reprogramming of Tpex and Tex cells to improve cancer immunotherapies.
[0381] Below are the methods used in the Examples described above. Mice
[0382] The research conducted in this study complies with all of the relevant ethical regulations. C57BL / 6, OT-I (50), pmel (51) and Rosa26-Cas9 knock-in (52) mice were purchased. Human CD19 CAR-transgenic (CAR-Tg) mice (T cells express CARs that comprise anti-human CD19 (human CD19) scFv fragments, CD8 transmembrane domain and 4-1BB-CD3ζ signalling tail) were used herein (53). Rosa26-Cas9 knock-in mice were crossed with OT-I, pmel or CAR-Tg mice to generate OT-I-Cas9, pmel-Cas9 or CAR-Tg-Cas9 mice that express Cas9 in antigen-specific CD8+T cells. Sex-matched (male or female) mice with pre-determined genotypes (not blinded to investigators) were used at 7–12 weeks old unless otherwise noted and assigned randomly to control and experimental groups. All mice were kept in a specific-pathogen-free facility. Mice were kept with 12-hour light–dark cycles that coincided with daylight. The housing facility was maintained at 30–70% humidity and 20–25°C. Cell lines
[0383] The Plat-E cell line, B16-OVA cell line, and B16-F10 cell line were provided or purchased. B16-hCD19 cell line was constructed by transducing B16-F10 cells with an amphotropic virus containing human CD19 (hCD19) and sorting cells with top 10% hCD19 expression (12). The Lewis lung carcinoma (LLC) cell line was purchased, and the LLC-OVA 169 304098633v1Attorney Docket No: 243734.000206 cell line was produced by transduction of the parental LLC cell line with the pMIG-II-neo- mOVA containing OVA protein fused with GFP, followed by sorting of GFP-expressing cells (54). All of the abovementioned cell lines were cultured in Dulbecco’s modified essential medium (DMEM) (Gibco) supplemented with 10% (vol / vol) FBS and 1% (vol / vol) penicillin– streptomycin. The E.G7-OVA (derivative of EL4) cell line was purchased and cultured in RPMI 1640 medium (Gibco) supplemented with 10% (vol / vol) FBS and 1% (vol / vol) penicillin–streptomycin. No commonly misidentified cell lines were used in this study (International Cell Line Authentication Committee). Cell lines used in this study were not independently authenticated or tested for mycoplasma contamination. Flow cytometry
[0384] For analysis of surface markers, cells were stained in PBS (Gibco) containing 2% FBS. Surface proteins were stained for 30 min at room temperature. For transcription factor (TF) staining, cells were stained for surface molecules, fixed using 2% paraformaldehyde for 30 min at room temperature, and permeabilized using 90% ice-cold methanol for 30 min on ice. Cells were stained with primary anti-RBPJ (1:100) antibody for 30 min at room temperature followed by staining with goat anti-rabbit IgG (H+L) (1:1,000) for another 30 min at room temperature. For phosphorylated S6 (pS6) ex vivo staining, tumour-bearing mice were euthanized and a small portion of tumour was collected and fixed immediately in 2% paraformaldehyde for 30 min at room temperature, and permeabilized using 90% ice-cold methanol for 30 min on ice. Cells were stained for surface molecules and anti-pS6 (S235 / 236) (1:100) for 30 min at room temperature. Intracellular staining for cytokines was performed using a fixation / permeabilization kit after stimulation with ionomycin and phorbol 12- myristate 13-acetate (PMA) in the presence of GolgiSTOP for 4 hours or stimulation with OVA / H-2Kb (1^M) in the presence of GolgiSTOP for 5 hours. Active caspase-3 staining was performed using instructions and reagents from the Active Caspase-3 Apoptosis Kit. BrdU staining (pulsed for 18 hours for intratumoral OT-I analyses on day 7 or 21 after adoptive transfer) was performed according to the manufacturer’s instructions using reagents from the APC BrdU Flow Kit.7-AAD (A9400, 1:200) or Fixable Viability Dye (65-0865-14; 1:1000) was used for dead-cell exclusion. The following antibodies were used: PE–anti-TOX (TXRX10, 12-6502-82, 1:100), APC–anti-perforin (OMAK-D, 17-9392-80, 1:200), PE- Cyanine7–anti-TIM-3 (RMT3-23, 25-5870-82, 1:400), PE–anti-CD244.2 (2B4; 244F4, 12- 2441-82, 1:400), eFluor 450–anti-CD71 (R17217(RI7 217.1.4), 48-0711-82, 1:400), PE- Cyanine7–anti-CD44 (IM7, 25-0441-82, 1:400), PerCP-eFluor 710–anti-CD39 (24DMS1, 46- 170 304098633v1Attorney Docket No: 243734.000206 0391-82, 1:400), PerCP-eFluor 710–anti-BATF (MBM7C7, 46-9860-42, 1:100), PE- Cyanine7–anti-T-bet (4B10, 25-5825-82, 1:100), Alexa Fluor 647–goat anti-rabbit IgG (H+L) (A21245, 1:1000), Alexa Fluor Plus 405–goat anti-rabbit IgG (H+L) (A48254, 1:1,000); Alexa Fluor 700–anti-CD8a (53-6.7, 100730, 1:400), Brilliant Violet 785–anti-TCRb (H57-597, 109249, 1:400), Brilliant Violet 650–anti-CD45.1 (A20, 110736, 1:400), APC–anti-TCR-Va2 (B20.1, 127810, 1:400), APC–anti-Ly108 (330-AJ, 134610, 1:400), Brilliant Violet 711–anti- CD366 (TIM-3) (RMT3-23, 119727, 1:400), Brilliant Violet 421–anti-CX3CR1 (SA011F11, 149023, 1:400), Brilliant Violet 421–anti-CD279 (PD-1) (29F.1A12, 135217, 1:400), PE–anti- CD62L (MEL-14, 104408, 1:400), PE-Cyanine7–anti-CD98 (4F2, 128214, 1:400), PE–anti- CD186 (CXCR6) (SA051D1, 151104, 1:400), PE–anti-TNF (MP6-XT22, 506306, 1:400), Alexa Fluor 647–anti-granzyme B (GB11, 515405, 1:100), PE–anti-IKAROS (2A9 / IKAROS, 653304, 1:200), Pacific Blue–anti-Ki67 (16A8, 652422, 1:400), Brilliant Violet 650–anti- CD11c (N418, 117339, 1:400) (all from Biolegend); Alexa Fluor 647–anti-active caspase-3 (C92-605, 560626, 1:100), Brilliant Violet 605–anti-Ly108 (13G3, 745250, 1:400), Alexa Fluor 647–anti-BrdU (3D4, 560209, 1:200); VioletFluor 450–anti-IFN^ (XMG1.2, 75-7311- U100, 1:400); APC–anti-RUNX3 / CBFA3 (527327, IC3765A, 1:100); anti-RBPJ (D10A4, 5313T), Alexa Fluor 647–anti-TCF-1 (C63D9, 6709, 1:100), APC–anti-pS6 (S235 / 236) (D57.2.2E, 14733, 1:100). To monitor cell division, Tpex or Tex cells were labeled with CellTrace Violet. For mitochondrial staining, TILs were isolated on day 7 after OT-I adoptive transfer and then incubated for 30 min at 37°C with 10 nM MitoTracker Deep Red or 100 nM MitoSOX together with staining surface markers. Flow cytometry data were acquired by BD FACSDiva software (v8) on LSRII, Symphony A3 or LSR Fortessa and were analyzed using Flowjo 10.8.1. Naïve T cell isolation and viral transduction
[0385] Naïve Cas9-expressing OT-I, pmel or hCD19 CAR-Tg T cells were isolated from the spleen and peripheral lymph nodes (PLNs) of OT-I-Cas9, pmel-Cas9 or CAR-Tg-Cas9 mice using a naïve CD8a+T cell isolation kit according to the manufacturer’s instructions. Purified naïve OT-I, pmel or hCD19 CAR-Tg T cells were activated in vitro for 18–20 hours with 10 mg ml–1anti-CD3 (2C11; Bio-X-Cell), 5 mg ml–1anti-CD28 (37.51) before viral transduction. Viral transduction was performed by spin-infection at 900g at 25°C for 3 hours with 10 mg ml–1polybrene. For transduction with two different sgRNAs, these two sgRNA viruses were mixed together and transduced by spin-infection at 900g at 25°C for 3 hours with 10 mg ml–1polybrene. After transduction, cells were cultured in T cell medium with human IL-2 (20 IU 171 304098633v1Attorney Docket No: 243734.000206 ml–1), mouse IL-7 (12.5 ng ml–1) and mouse IL-15 (25 ng ml–1) for four days. Transduced cells were sort-purified based on the expression of Ametrine, GFP or mCherry (as indicated in the figure legends) using a Reflection cell sorter (iCyt) before adoptive transfer into recipient mice. sgRNAs were designed using an online tool (portals.broadinstitute.org / gppx / crispick / public) and sgRNAs used in this study were listed in Table 13. The retroviral sgRNA vector was previously described (16,23). Retrovirus was produced by co-transfecting Plat-E cells with the core plasmid (sgRNA plasmid or pMIG-overexpressing plasmid) and helper plasmid pCL-Eco, and was harvested at 72 hours after transfection. Table 13. sgRNA sequences used in this study.Adoptive T cell transfer
[0386] B16-OVA tumour cells (5^105) were injected subcutaneously into the right flank of C57BL / 6 mice. At day 12 after tumour inoculation, a total of 4^106retrovirus-transduced OT- I cells were adoptively transferred intravenously (i.v.) to the B16-OVA tumour-bearing mice. In the dual-colour transfer system to establish cell-intrinsic effects, OT-I cells transduced with the indicated sgRNAs labeled with Ametrine were mixed at a 1:1 ratio with OT-I cells transduced with sgNTC labeled with GFP (called ‘spike’), followed by adoptive transfer to the B16-OVA tumour-bearing mice. Tumour-infiltrating lymphocytes (TILs) were harvested for cellular assays (see below herein) as indicated in the figures and figure legends. To calculate fold changes in the dual-colour transfer system, the frequency of indicated population or geometric mean fluorescence intensity (gMFI) of indicated protein was shown relative to ‘spike’ (sgNTC) cells from the same host. Specifically, the proportion of sgRNA-transduced 172 304098633v1Attorney Docket No: 243734.000206 cells was divided by the proportion of ‘spike’ cells and further normalized to the ratio of pre- transfer input samples. The quantification of cell number was performed by calculating the numbers of indicated sgRNA-transduced cells and the sgNTC-transduced ‘spike’ cells from the same host, followed by normalization to the tumour weight (23). The numbers of sgNTC- transduced cells and ‘spike’ cells from the same host in control group were comparable and were not depicted in the manuscript. For single-colour transfer system, the raw percentage and number of indicated population and gMFI of indicated protein were shown. The deletion efficiencies of sgRbpj + Irf1, sgIkzf1 + Tcf7 and sgEts1 + Batf in co-targeting experiments were examined by flow cytometry analysis. In the single-colour transfer system for tumour therapy assays, B16-OVA (5^105), B16-F10 (3^105) or B16-hCD19 (3^105) melanoma cells were injected subcutaneously into the right flank of C57BL / 6 mice. On day 12 after tumour inoculation, mice bearing tumours of a similar size were randomly divided into indicated groups (8–10 mice per group). Then, OT-I (for the treatment of B16-OVA melanoma), pmel (for the treatment of B16-F10 melanoma) or hCD19 CAR-Tg (for the treatment of B16-hCD19 melanoma) CD8+T cells (4^106) transduced with sgNTC or the indicated sgRNAs (with the same fluorescent reporter protein) were adoptively transferred individually to tumour-bearing mice. For analysis of other tumour models, E.G7-OVA (5^105) or LLC-OVA (5^105) cells were injected subcutaneously into the right flank of sex-matched C57BL / 6 mice. Seven days after tumour inoculation (54,55), mice bearing tumours of a similar size were randomly divided into indicated groups (8–10 mice per group). Then, OT-I cells (2^106for E.G7-OVA and 4^106for LLC-OVA) transduced with sgNTC or the indicated sgRNAs (with the same fluorescent reporter protein) were adoptively transferred individually to tumour-bearing mice. For anti- PD-L1 treatment, the B16-OVA tumour-bearing mice received OT-I cells on day 12 after tumour inoculation and then were treated with anti-PD-L1 (200 mg; clone 10F.9G2) or IgG isotype control antibody (200 mg; clone LTF-2) two times on days 15 and 18 after tumour inoculation. Alternatively, E.G7-OVA tumour-bearing mice received OT-I cells on day 7 after tumour inoculation and then were treated with anti-PD-L1 (200 mg; clone 10F.9G2) or IgG isotype control antibody (200 mg; clone LTF-2) two times on days 10 and 13 after tumour inoculation. Mice were monitored for tumour growth or survival; tumours were measured every two days with digital calipers and tumour volumes were calculated by the formula: length ´ width ´ [(length ´ width)0.5] ´ π / 6 (16). Tumour size limits were approved to reach a maximum of 3,000 mm3or ≤20% of body weight (whichever was lower). To test the effect of Ikzf1 deficiency on ICB response, OT-I cells transduced with sgIkzf1 (GFP+) were mixed at a 1:1 173 304098633v1Attorney Docket No: 243734.000206 ratio with cells transduced with sgNTC (Ametrine+) and co-transferred to B16-OVA tumor- bearing mice on day 12 after tumor inoculation, followed by treatment of anti-PD-L1 or isotype control antibody treatment. sgNTC and sgIkzf1 intratumoral OT-I cells from the same recipient mice were analyzed for various features on day 7 after adoptive transfer. TIL isolation
[0387] To isolate TILs on day 7 or 21 after adoptive transfer as indicated in the figure legends, B16-OVA melanoma, EG.7-OVA or LLC-OVA tumours were surgically excised, minced, and digested with 0.5 mg ml–1collagenase IV plus 200 IU ml–1DNase I for 1 hour at 37oC. Following the digestions, the tumor tissue was passed through 70-mm filters to remove the undigested part. TILs were then isolated by density-gradient centrifugation over Percoll. Measurement of genome editing efficiency
[0388] Pre-transfer OT-I cells or TILs isolated from B16-OVA tumours on day 7 after adoptive transfer were used for analyses of genome editing efficiency. Approximately 1^105cells were centrifuged at 2,000 rpm for 5 min, and the cell pellets were lysed. These lysates were used to generate gene-specific amplicons with partial Illumina adapters in the first round of PCR, and then indexed in a second round of PCR, followed by running the sample on a Miseq Sequencer System to generate paired 2 ´ 250 bp reads. Insertion and deletion (indel) mutation analysis was performed using CRIS.py (v2) (56). scCRISPR screening using the retroviral transcriptional factor library
[0389] Modified dual-guide direct-capture retroviral sgRNA vector (LMA-DC-EFS) design. To generate LMA-DC-EFS, the hU6-filler region of the previously described retroviral sgRNA vector was replaced (with the use of Ametrine as a selection marker) (16,23) with mU6-CR1CS1cassette from pJR85 vector (11). To facilitate cloning and library construction, the PGK promoter of the resulting vector was further replaced by EF1^ core promoter from pCLIP-All- EFS-tRFP vector.
[0390] Selection of 180 TFs for library design. To select the TFs that are potentially involved in CD8+T cell exhaustion in tumour context, bioinformatic analyses of differential gene expression (DE), differential accessibility (DA) of the chromatin state, and motif enrichment (ME) for TFs (Gene ontology GO term: 0140110 TF regulatory activity) were performed between early and late exhaustion (Philip 2017 (13)) or between Tpex and Tex cells (Miller 2019 (5), Chen 2019 (12), and Yao 2021 (14)) using four published datasets from mouse tumour and chronic infection models (see also Figure 6B). Specifically, DE and DA analyses were performed using the R package DEseq2 (v.1.32.0) (57), and |log2FC (fold change) | > 0.5 174 304098633v1Attorney Docket No: 243734.000206 and FDR < 0.05 were used as the cut-offs to define DE genes or DA chromatin regions. FIMO from MEME suite (v4.11.3) (58) was used for scanning TF motifs (TRANSFAC database release 2019) matches in the nucleosome-free regions, and two-tailed Fisher’s exact test (odds ratio > 1.5 and FDR corrected P value < 0.05) was used to determine whether a motif was significantly enriched in differentially accessible chromatin regions. For each dataset, a TF enriched in at least 2 out of 3 analyses (DE and DA, DE and ME or DA and ME) was nominated as a putative regulator for exhaustion. TFs were then ranked in a descending order by the number of datasets in which they were nominated as putative regulators. The 171 top ranked TFs were selected together with 9 manually curated TFs from literature (26,55,59-63) to construct the final library targeting 180 TFs (see Table 1 for details).
[0391] Dual-guide direct capture retroviral library construction. For the curated gene list containing 180 TFs, a total of four gRNA sequences distributed on two individual constructs were designed for each gene. To construct the library, a customized oligonucleotide pool containing 720 oligonucleotides targeting those 180 TFs and 40 NTCs (each oligonucleotide contains two guides targeting the same gene or NTC) (Table 2) was ordered. The oligonucleotide design follows the overall structure: 5'–PCR adapter–CCACCTTGTTGG– protospacer A–GTTTCAGAGCAGTCTTCGTTTTCGGGGAAGACAAGAAACATGG– protospacer B–GTTTAAGAGCTAAGC–PCR adapter–3' (SEQ ID NOs: 1215-1217, respectively). The dual-guide library was generated using a two-step cloning strategy as previously described (11). Briefly, the PCR-amplified oligonucleotide pool was digested with BstXI and Bpu1102I and ligated into a similarly digested LMA-DC-EFS vector. The ligation product was then electroporated into Endura Duos, amplified, and the resulting intermediate library was assessed for quality using next generation sequencing (NGS). For quality control, sgRNA skewing was measured using the script calc_auc_v1.1py (64) to monitor how closely sgRNAs are represented in a library, and sgRNA distribution was plotted with the area under the curve (AUC) < 0.7 to pass the quality control. The python script count_spacers.py (65) was used as an additional measure for quality control. Next, the CR3cs1-hU6 insert from pJR89 was isolated by digestion with BsmBI followed by gel extraction. The intermediate library from above was digested with BbsI and treated with rSAP. Finally, the CR3cs1-hU6 insert was ligated into the intermediate library vector, purified by isopropanol purification and electroporated into Endura Duos. Electroporated cells were plated overnight at 32°C, harvested the next day and plasmid library extracted using endotoxin free maxiprep kits. The amplified library was then validated by NGS as described above. 175 304098633v1Attorney Docket No: 243734.000206
[0392] In vivo screening. The in vivo screening approach was modified based on previous studies (16,23). Briefly, retrovirus was produced by co-transfecting the dual-guide, direct capture retroviral library with pCL-Eco in Plat-E cells. At 48 hours after transfection, the supernatant was collected and frozen at −80oC. Cas9-expressing OT-I cells were transduced to achieve 20–30% transduction efficiency. Transduced cells were sorted based on the expression of Ametrine, and an aliquot of 1^106transduced OT-I cells was saved as ‘input’. Transduced OT-I cells (4^106) were then transferred i.v. to B16-OVA tumour-bearing C57BL / 6 mice at day 12 after tumour inoculation. A total of 60 recipient mice was used in two experiments combined. Seven days later, donor-derived total OT-I cells were sort-purified and pooled for scCRISPR analysis. Sixteen reactions (Chromium Next GEM Single Cell 3’ Kit (v3.1), PN-1000268 and 3’ Feature Barcode Kit, PN-1000262) in total were used with each reaction (see below herein).
[0393] Sequencing library preparation. Sort-purified OT-I cells were resuspended and diluted in 1× PBS containing 0.04% BSA at concentration of 1×106cells ml–1. Both the gene expression library and the CRISPR screening library were prepared using the Chromium Next GEM Single Cell 3′ kit with Feature Barcode technology for CRISPR Screening (v3.1). Briefly, the single-cell suspensions were loaded onto the Chromium Controller according to their respective cell counts to generate 10,000 single-cell gel beads in emulsion (GEMs) per sample. Each sample was loaded into four separate channels. The resulting libraries were quantified, and quality checked by TapeStation. Samples were diluted and loaded onto the NovaSeq to a sequencing depth of 500 million reads per channel for gene expression libraries and 200 million reads per channel for CRISPR screening libraries.
[0394] Data analysis. Alignments and count aggregation of gene expression and sgRNA reads were completed with Cell Ranger (v6.0.0) (66). Gene expression and sgRNA reads were aligned using the cellranger count command with default settings. Gene expression reads were aligned to the mouse genome (mm10 from ENSEMBL GRCm38 loaded from 10X Genomics). sgRNA reads were aligned to the scCRISPR KO library described herein using the pattern GGG(BC)GTTT to capture both sgRNA 1 and 2 on the same vector. The quality control (QC) report indicated that an average of 26 sgRNA unique molecular identifiers (UMIs) were detected in each cell. Only droplets with > 1 sgRNA UMI were used in further analysis. The filtered feature matrices were imported into Seurat (v4.0.4) (67,68) to create assays for a Seurat object containing both gene expression and CRISPR guide capture matrices. A third assay summarizing the total gene-level counts of all four sgRNAs for each target gene was also 176 304098633v1Attorney Docket No: 243734.000206 created, followed by pooling of 16 samples by merge function. Cells were initially quality filtered based on the percentage of mitochondrial reads < 10% (to remove dead cells) and number of detected RNA features < 6,000 and UMI feature < 60,000 (removing doublets for gene expression), and 82% cells were detected with at least one out of 720 sgRNAs in the library. Since there were two sgRNAs (g1 and g2 or g3 and g4) targeting the same gene on each retroviral construct, the presence of sgRNAs derived from the same vector was detected in the majority (81%) of the cells containing two sgRNAs. Cells detected with sgRNAs targeting two or more genes were then removed to avoid interference from multi-sgRNA- transduced cells. A total of 42,209 OT-I cells passed the quality filtering and were used for downstream analysis. A median of 185 cells per target gene (median of 35 sgRNA UMIs per singlet) were recovered, along with 5,371 cells with NTC guides. To evaluate the enrichment or depletion of each perturbation versus NTC, the relative ratio (log2FC) of cell number with each perturbation (the 4 sgRNAs targeting the same gene) versus that with sgNTC (on average) was calculated and normalized to account for the different numbers of sgRNAs between gene- specific perturbations and NTC. Eight gene perturbations (sgEzh2, sgIrf4, sgJunb, sgKlf2, sgStat5a, sgStat5b, sgYy1 and sgZbtb32) with low cell counts (< 48) were removed from network analysis, as ∼50–100 cells are sufficient to accurately identify the perturbation phenotype in scCRISPR experiment for most genes (15). However, the perturbation effects on the percentages of Tpex1, Tpex2, Tex1 and Tex2 cells were analyzed for these eight TFs. For cell clustering, the FindClusters function of Seurat package was used to unbiasedly identify the clusters in OT-I T cells. Cluster-specific genes were identified by FindAllMarkers function of Seurat. Six clusters were annotated based on their distinct signatures.
[0395] To determine the molecular determinants for intratumoral CTL developmental trajectory, Tox+cells were selected for further graph-based clustering (68) without including a perturbation-specific cluster. Clusters were annotated as four cellular states (Tpex1, Tpex2, Tex1, and Tex2) based on Tcf7, Havcr2 and Mki67 expression. Dot plots showing the relative average expression (after scaled normalization) of marker genes in different clusters were visualized by DotPlot function in Seurat R package. Pseudotime trajectory analysis was performed by Slingshot (v2.0.0) R package (69) with default settings. Activity scores of gene signatures (such as the Hallmark mTORC1 signalling gene set (70)) were calculated by AddModuleScore function of Seurat package for the four cellular states. To visualize the distribution of cells with a specific perturbation (at gene level) on the UMAP, contour density plots were generated by ggplot2 (v3.3.5) R package. Additionally, the positive and negative regulators in each subset were determined by comparing the abundance of sgRNAs with that 177 304098633v1Attorney Docket No: 243734.000206 in the other three subsets, measured by log2FC. Similarly, the positive and negative regulators between two subsets were determined by comparing the abundance of sgRNAs in these two subsets.
[0396] Network analysis. Differential gene expression analysis was performed on the TF perturbations with sufficient number of cells (³ 48) detected (representing a total of 172 TFs). The FindMarker function of Seurat was used for each perturbation compared with NTC. The log2FC values were used to indicate the regulatory effect of a perturbation on the targeted genes. To identify the regulatory effect on the regulomes for OT-I cell differentiation, differential expression analysis of each of the six clusters versus other clusters was first performed. The top 100 differentially expressed genes (ranked by log2FC) in each of the six clusters were combined as critical genes for intratumoral OT-I cell differentiation (redundant differential expressed genes between different clusters were removed; 369 genes remained). Then, a gene^^ perturbation matrix (369^^ 172) with log2FC values was constructed to generate a perturbation map by ascertaining the effect of each genetic perturbation on target gene programs using the following procedures. First, the co-regulated gene programs were determined by Pearson correlation based hierarchical clustering. Four main gene programs, effector (program A), exhaustion (program B), stemness (program C) and proliferation (program D) were annotated based on their enrichment in the corresponding pathways. Second, the co-functional TF modules were determined by Spearman correlation based hierarchical clustering. A total of nine co-functional modules were defined. Specifically, the mean log2 fold- changes (log2FCs) of downstream gene expression alterations (for each of the four gene programs) induced by the individual TF perturbations (versus sgNTC) were calculated within each of these modules, followed by measuring the averaged values of all perturbations in that module. The strength of the regulation from TF modules to individual gene programs was visualized by ggalluvial R package (v.0.12.3), as indicated by the width of the lines connecting them. The positive and negative regulation effects are shown and the height of each TF module shows the overall strength of that module in regulating gene programs. Six (M2, M3, and M5– M8) of the nine co-functional modules with the strongest effects (either positive or negative) on each of the four gene programs (A-D) were further highlighted in Figure 1B. The connectivity between modules was calculated by the average number of regulatory effects between modules. For example, the number of edges (regulations) between the individual TFs in two modules was aggregated and normalized by the size (number of components) of the two modules. Third, to uncover the specific regulation between individual TFs, especially between 178 304098633v1Attorney Docket No: 243734.000206 the putative central hubs (71), functionally important central hub TFs were identified based on the number of DE genes (|log2FC| > 0.5) affected upon perturbation of each TF within that module. Cytoscape software (v3.7.2) was then used to visualize both intramodular and intermodular connectivity (edges), especially through the central hub TFs (nodes). Tpex and Tex secondary transfer assays
[0397] C57BL / 6 mice were subcutaneously injected with 3^105B16-OVA melanoma cells on day 0. At day 12 after tumour inoculation, a total of 4^106sgNTC (labeled with GFP or Ametrine)- and sgRbpj (labeled with Ametrine)-, sgEts1 (labeled with GFP)- or sgIkzf1 (labeled with Ametrine)- transduced OT-I cells were mixed at a 1:1 ratio and injected intravenously into same B16-OVA tumour-bearing mice. sgNTC- and sgRbpj-, sgEts1- or sgIkzf1-transduced Tpex (Ly108+TIM-3^) or Tex (Ly108^TIM-3+) cells among intratumoral OT-I cells were sort-purified seven days after adoptive transfer of OT-I cells. After sorting, sgNTC- and sgRbpj-, sgEts1- or sgIkzf1-transduced Tpex or Tex cells were mixed at a 1:1 ratio. The mixed Tpex or Tex cells were labeled with 5 ^M CellTrace Violet at 37°C for 15 min and resuspended in PBS. A total of 1^105(5^104sgNTC and 5^104sgRbpj, sgEts1 or sgIkzf1) mixed Tpex or Tex cells were intravenously transferred to C57BL / 6 mice that had been subcutaneously implanted with 5^105B16-OVA cells on day 8 before adoptive transfer. TILs were isolated and analyzed seven days after Tpex or Tex transfer for analysis. In vitro TCF-1^Tex-like and TCF-1+Tpex-like cell cultures
[0398] To generate TCF-1- Tex-like or TCF-1+Tpex-like OT-I cells, an established assay (38) was adopted. Briefly, splenocytes from Cas9-OT-I transgenic mice were pulsed with 100 nM OVA peptide at 1^106cells ml–1in T cell medium (Click’s medium supplemented with 10% fetal bovine serum (FBS), 55 mM 2-mercaptoethanol and 1´ penicillin–streptomycin–L- glutamine) at 37°C for 24 hours. Then, the cells were cultured at 1^106cells ml–1in T cell medium containing either 20 ng ml–1of murine IL-2 (mIL-2) and 10 ng ml–1of mIL-12, or 5 ng ml–1of mIL-2 to generate TCF-1- Tex-like or TCF-1+Tpex-like cells, respectively. Cells were maintained at the above concentration and cytokines were replenished daily. Four days later, TCF-1- Tex-like or TCF-1+Tpex-like cells were enriched using lymphocyte isolation medium (LSM) to remove dead cells, followed by flow cytometry and immunoblot analyses. Protein isolation and immunoblot
[0399] Cells were lysed in RIPA buffer, resolved in 4–12% Criterion XT Bis-Tris Protein Gel and transferred to PVDF membrane. Membranes were blocked using 5% non-fat milk for 1 hour in room temperature and then incubated overnight with anti-RBPJ (D10A4, 1:1,000) or 179 304098633v1Attorney Docket No: 243734.000206 anti-b-Actin (AC-74, 1:3,000) antibody in 4°C. Membranes were washed three times with TBST and then incubated with 1:5,000-diluted HRP-conjugated anti-rabbit IgG or HRP- conjugated anti-mouse IgG for 1 hour in room temperature. Following another three times washes with TBST, the membranes were exposed using enhanced chemiluminescence detection reagents and images were captured using the ODYSSEY Fc Analyzer (LI-COR). Single-cell RNA sequencing
[0400] C57BL / 6 mice were subcutaneously implanted with 3^105B16-OVA melanoma cells on day 0. At day 12 after tumour inoculation, a total of 4^106sgNTC- and sgIkzf1-, sgEts1- or sgRbpj-transduced OT-I cells were mixed at a 1:1 ratio (different fluorescent proteins were used between sgNTC and gene-specific perturbation) and injected intravenously into the same B16-OVA tumour-bearing mice. Intratumoral sgRNA-transduced OT-I cells were sort-purified from the same host and used in three batches for scRNA-seq analysis: (1) sgNTC- and sgIkzf1- transduced cells; (2) sgNTC- and sgEts1-transduced cells; and (3) sgNTC- and sgRbpj- transduced cells. For longitudinal analysis of OT-I cells, at day 7 after tumour inoculation, a total of 4^106sgNTC (GFP+)-transduced OT-I cells were injected intravenously into the B16- OVA tumour-bearing mice. After 7, 14 or 21 days, intratumoral sgNTC-transduced OT-I cells were sort-purified and used for scRNA-seq analysis. After cell counting and centrifugation at 2,000 rpm for 5 min, the supernatant was removed, and cells were resuspended and diluted in 1´ PBS containing 0.04% BSA at concentration of 1^106cells ml–1. Single cell libraries were prepared using the Chromium Single Cell 3′ Library and Gel Bead Kit (v3.1). Briefly, the single-cell suspensions were loaded onto the Chromium Controller according to their respective cell counts to generate 9,000 single cell GEMs per sample. Each sample was loaded into a separate channel. The cDNA content of each sample after cDNA amplification of 12 cycles was quantified and quality checked using a High-Sensitivity D5000 chip in a TapeStation to determine the number of PCR amplification cycles to yield a sufficient library for sequencing. After library quantification and quality-checking using D5000 chip, samples were diluted to 3.5 nM for loading onto the HiSeq 4000 with a 2^100-bp paired-end kit using the following cycles: 28 cycles read 1, 10 cycles i7 index, 10 cycles i5 index and 90 cycles read 2. An average of 300 million reads per sample was obtained (approximately 20,000 reads per cell).
[0401] Alignment, barcode assignment and UMI counting. The Cell Ranger Single-Cell software suite (v.6.0.0) was implemented to process the raw sequencing data from the Illumina HiSeq run (66). This pipeline performed demultiplexing, alignment (using the mouse genome 180 304098633v1Attorney Docket No: 243734.000206 mm10 from ENSEMBL GRCm38) and barcode processing to generate gene–cell matrices. Seurat R package (v.4.0.4) was used for downstream analysis. Specifically, for analysis of sgRbpj effects, data from sgNTC and sgRbpj intratumoral OT-I cell samples (each sample was pooled from two tumour-bearing mice) were used for downstream analysis. For analysis of sgIkzf1 or sgEts1 effects, two sgNTC and two sgIkzf1 or sgEts1 OT-I cell samples (each sample from one individual tumour-bearing mouse) were used for downstream analysis. Cells with low UMI counts (potentially dead cells with broken membranes) or high UMI counts (potentially two or more cells in a single droplet) were filtered. Potential dead cells with a high percentage (>10%) of mitochondrial reads were also removed. For the sgIkzf1 experiment, a total of 28,945 cells (sgNTC-transduced, 14,044 cells; sgIkzf1-transduced, 14,901 cells) were captured, with an average of 3,012 mRNA molecules (UMIs, median: 11,906; range: 1,026- 49,991). For the sgEts1 experiment, a total of 20,618 cells (sgNTC-transduced, 10,562 cells; sgEts1-transduced, 10,056 cells) were captured, with an average of 2,955 mRNA molecules (UMIs, median: 12,477; range: 1,703-49,993). For the sgRbpj experiment, a total of 19,516 cells (sgNTC-transduced, 10,918 cells; sgRbpj-transduced, 8,598 cells) were captured, with an average of 2,908 mRNA molecules (UMIs, median: 11,327; range: 1,265-49,887). The expression data were normalized by NormalizeData function in Seurat with scale.factor = 106. Raw and processed scRNA-seq data have been deposited into the GEO series database GSE216800.
[0402] Data visualization. Underlying cell variations derived in Tox+intratumoral CTLs (sgNTC- and sgIkzf1-, sgEts1-and sgRbpj-transduced OT-I cells from TILs) in the single-cell gene expression data were visualized with a two-dimensional projection by UMAP using Seurat R package (v.4.0.4). sgNTC and sgIkzf1, sgEts1 or sgRbpj OT-I cells were further unbiasedly clustered and annotated as four cellular states (Tpex1, Tpex2, Tex1, and Tex2) based on Tcf7, Havcr2 and Mki67 expression. Violin and dot plots that represent the expression levels of selective genes were generated by VlnPlot and DotPlot function in Seurat R package (v.4.0.4), respectively. Pathway scores were calculated by AddModuleScore function in Seurat (v.4.0.4). Ahmed CXCR5posCD8+, Ahmed CXCR5negCD8+T cell signatures are curated from literature (3) and GSE41978 KLRG1hiCD8+T cell signature (72) is from MSigDB C7 collection. The stemness signature of CD8+T cells from chronic infection was from literature (20), while the stemness signature in CD8+T cells from tumours are curated by identifying the significantly upregulated genes (log2FC >1 and Benjamini–Hochberg corrected P value < 0.05) in TCF-1-GFP+versus TCF-1-GFP- antigen-specific CD8+T cells (GSE114631 (7)). 181 304098633v1Attorney Docket No: 243734.000206 Pseudotime trajectory analysis was performed by using default parameters in Slingshot R package (v2.0.0) (69) on the four intratumoral CTL states.
[0403] Pre-ranked gene set enrichment analysis (GSEA) and Fisher’s exact test. For scRNA- seq analysis, non-parametric two-tailed Wilcoxon rank sum test was used to compare the gene expression of cells between two genotypes (sgIkzf1 versus sgNTC, sgEts1 versus sgNTC or sgRbpj versus sgNTC) and then genes in each comparison were ranked based on their log2FC. To identify the enriched pathways, pre-ranked GSEA (73), an analysis of GSEA against a user- supplied, ranked list of genes, was then performed with the MSigDB collection using fGSEA R package (v1.18.0) for each comparison. Two-tailed Fisher’s exact test was used to examine whether a MsigDB gene set was significantly (P < 0.05) enriched among differentially expressed genes after genetic perturbation (significantly increased or decreased (|log2FC| > 0.5 and FDR < 0.05) genes in sgIkzf1-, sgEts1- or sgRbpj- transduced OT-I cells compared to sgNTC cells). Comparison of public and in-house datasets for transcriptome and chromatin accessibility of Tpex and Tex cells
[0404] To test whether Tpex and Tex cells identified in our scCRISPR experiments resemble the established features corresponding to Tpex and Tex cells from the same B16- OVA tumour model, fold-change (FC) / FC plot analysis was performed to compare gene expression profiles (based on log2FC) in Tex versus Tpex cells from in-house scCRISPR experiments with those from a public dataset (GSE122713) of antigen-specific CD8+T cells in the literature (5). Pearson correlation coefficient was calculated to measure their correlation. The chromatin accessibility (by ATAC-seq) of Tpex and Tex cells from our model was further compared to that of CD8+T cells from an acute LCMV infection model (GSE160341) that does not induce T cell exhaustion (23). OCRs with upregulated accessibility in both Tpex and Tex cells compared to CD8+T cells in acute LCMV infection (log2FC > 1, FDR < 0.05) were visualized by Heatmap function by ComplexHeatmap R package (v.2.8.0). Public dataset analysis to examine the correlation of ETS1 or RBPJ with CD8+TIL exhaustion or responsiveness to ICB
[0405] Multiple public scRNA-seq datasets were re-analyzed to examine the correlation of Rbpj (mouse) or RBPJ (human) or ETS1 expression with intratumoral CD8+T cell exhaustion. Seurat v4.0.4 R package (67) was used for preprocessing and visualization, similar as in-house generated data. For transplanted mouse tumours, Rbpj expression in Pdcd1+Tcf7+Havcr2- and Pdcd1+Tcf7-Havcr2+cells from both B16 melanoma (29) (GSE86042) and MC38 (35) (E- MTAB-8832) tumours was visualized by FeaturePlot function in Seurat. For scRNA-seq 182 304098633v1Attorney Docket No: 243734.000206 datasets from GEMMs for breast cancer (36) (GSE161983) and lung carcinoma (37) (GSE164177), Rbpj and Havcr2 expression in CD8+T cells was visualized using the FeaturePlot function in Seurat. For RNA-seq dataset from GEMM for liver cancer (GSE89307) (13), the relative expression of Tcf7, Pdcd1, Tox and Rbpj of tumour-specific CD8+T cells after adoptive transfer was visualized by Heatmap function in ComplexHeatmap R package (v.2.8.0). For human tumours, RBPJ expression was examined in Tpex and Tex cells from multiple tumour datasets, including pan-cancer (39) (GSE156728), NSCLC (40) (GSE99254), melanoma (42,44) (GSE72056 and GSE123139) and HCC (43) (GSE98638). ETS1 expression was examined in intratumoral CD8+T cells before ICB (Pre-ICB) treatment in human melanoma patients (GSE120575) (33). In the human melanoma dataset (GSE123139), the naïve-like, transitional and dysfunctional CD8+T cell annotations were based on the reported markers in each subset (44) (TCF7 and IL7R in naïve-like; GZMK for transitional; HAVCR2 and ENTPD1 for dysfunctional). Pseudotime analysis was performed by using monocle 3 R package (v1.0.0) (74) with default settings and naïve-like cells as the starting point for trajectory inference.
[0406] The correlation of the responsiveness to ICB with RBPJ expression in CD8+T cells was assessed in multiple human tumour types. For melanoma (33) (GSE120575), the Pearson correlation between the gene expression of RBPJ and other reported markers for regulating ICB progression was performed in CD8+T cells in melanoma patients treated with ICB. For other skin cancers such as BCC (basal cell carcinoma) (34) (GSE123813) and SCC (squamous cell carcinoma) (34) (GSE123813), RBPJ and ETS1 expression was compared by violin plots in the CD8+T cell clusters (originally annotated in the literature) after ICB treatment. For lung cancer (45), the RBPJ gene expressional changes in MANA (mutation-associated neoantigens)-specific CD8+T cells from patients that responded to ICB (assessed by major pathologic response (MPR), which is associated with overall better patient survival (45)) versus those that failed to respond to ICB was measured. Finally, the correlation of CAR T exhaustion with RBPJ expression was assessed in an in vitro exhaustion model (46) (GSE160160). RBPJ expression, together with exhaustion-associated markers HAVCR2, LAYN and SOX4 in CAR T cells after continuous antigen exposure (CAE) for 28 days, was visualized using Loupe Browser (v6.0.0). In the same dataset, gene expression (bulk RNA-seq) of RBPJ was assessed between CAR T cells at days 0, 16 and 28 after CAE, with count of each gene provided in GSE160160. Differential expression analysis was performed using the R package DEseq2 (v.1.32.0) to calculate the log2FC and P value using day 16 versus day 0 and day 28 versus day 183 304098633v1Attorney Docket No: 243734.000206 16. Gene accessibility of RBPJ was also assessed between CAR T cells at day 0 and 28 after CAE by analyzing the raw ATAC-seq data in GSE160160. ATAC-seq
[0407] C57BL / 6 mice were subcutaneously implanted with 3^105B16-OVA melanoma cells on day 0. At day 12 after tumour inoculation, a total of 4^106sgNTC (labeled with GFP)- and sgIkzf1-, sgEts1- or sgRbpj-(labeled with Ametrine)-transduced OT-I cells were mixed at a 1:1 ratio and injected intravenously into the same B16-OVA tumour-bearing mice. To prepare the ATAC-seq library, intratumoral sgRNA-transduced OT-I cells or their Tpex (Ly108+TIM-3-) and Tex (Ly108-TIM-3+) subsets were sort-purified from the same host for ATAC-seq analysis: sgNTC- and sgIkzf1-, sgEts1- or sgRbpj-transduced cells (n = 3 biological replicates per group). Sort-purified cells were incubated in 50 ml ATAC-seq lysis buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA-630) on ice for 10 min. The resulting nuclei were pelleted at 500g for 10 min at 4°C. The supernatant was carefully removed with a pipette and discarded. The pellet was resuspended in 50 ml transposase reaction mix (25 ml 2´ TD buffer, 22.5 ml nuclease-free water and 2.5 ml transposase) and incubated for 30 min at 37°C to allow tagmentation occur. The DNA was then cleaned up using the Qiagen MinElute kit. The barcoding reaction of the tagmented DNA was run using the NEBNext HiFi kit based on manufacturer’s instructions and amplified for 5 cycles as described (16,23) using the same primers. The optimal cycle numbers were determined from 5 ml (of 50 ml) from the previous reaction mix using KAPA SYBRFast and a 20-cycle amplification on an Applied Biosystems 7900HT. The remaining 45 ml of PCR reaction was amplified in the same reaction mix using the optimal cycle number, which is determined from the linear part of the amplification curve.
[0408] Data analysis. ATAC-seq analysis was performed as described previously (16,23). Briefly, 2´ 50-bp paired-end reads obtained from NovaSeq were trimmed for Nextera adaptor by trimmomatic (v.0.36; paired-end mode, with parameter LEADING:10 TRAILING:10 SLIDINGWINDOW:4:18 MINLEN:25) and aligned to mouse genome mm9 downloaded from gencode release M1 (gencodegenes.org / mouse / releases.html) by BWA (v.0.7.16, default parameters). Duplicated reads were then marked with Picard (v.2.9.4) and only non-duplicated proper paired reads have been kept by SAMtools (parameter ‘-q 1 -F 1804’ v1.9). After adjustment of Tn5 shift (reads were offset by +4 bp for the sense strand and −5 bp for the antisense strand), reads were separated into nucleosome-free, mononucleosome, dinucleosome and trinucleosome as previously described (75) by fragment size and generated ‘.bigwig’ files by using the center 80 bp of fragments and scaled to 30^106nucleosome-free reads. Reasonable 184 304098633v1Attorney Docket No: 243734.000206 nucleosome-free peaks and a pattern of mono-, di- and tri-nucleosomes on IGV (v.2.4.13) were observed. All samples had approximately 2^108nucleosome-free reads, indicative of good data quality. Next, peaks were called on nucleosome-free reads by MACS2 (v.2.1.1.20160309, with default parameters with ‘–extsize 200–nomodel’). To assure reproducibility, nucleosome-free regions for each sample were finalized and retained a peak only if it called with a higher cut- off (MACS2 −q 0.05). Consensus peaks for each group were further generated by keeping peaks that were present in at least 50% of the replicates and discarding the remaining, non- reproducible peaks. The reproducible peaks were further merged between sgNTC- and sgIkzf1- , sgEts1- or sgRbpj- transduced Tpex or Tex samples if they overlapped by 100 bp and nucleosome-free reads from each sample were counted by bedtools (v.2.25.0). To identify the differentially accessible OCRs, raw nucleosome-free read was first normalized as counts per million followed by differential accessibility analysis by implementation of the negative binomial model in the DESeq2 R package (57). FDR-corrected P value < 0.05, |log2FC| > 0.5 were used as cut-offs for more- or less-accessible regions in sgIkzf1-, sgEts1- or sgRbpj- transduced Tpex and Tex cells compared to their sgNTC-transduced counterparts. Principal component analysis (PCA) was performed using the function prcomp in R. To extract Tpex- selective and Tex-selective OCRs in the ATAC-seq dataset of sgNTC and sgIkzf1 cells for heatmap visualization, OCRs from the first principal component (which accounted for the difference between sgNTC Tpex and sgNTC Tex cells) were first selected, followed by further selection of Tpex-selective (log2FC of Tpex versus Tex > 0.5) and Tex-selective (log2FC of Tpex versus Tex < –0.5) OCRs. The differentially accessible OCRs in the ATAC-seq data were assigned for the nearest genes to generate a list of DA genes using HOMER software (76). FDR-corrected P value < 0.05, |log2FC| > 0.5 were used as cut-offs for more- or less-accessible regions in sgRbpj-transduced Tpex and Tex cells compared to their sgNTC-transduced counterparts. Functional peak set enrichment was then performed using MSigDB C7 immunological collection for those DA genes. For motif analysis, 1,000 unchanged regions (log2FC < 0.05 and FDR-corrected P value > 0.5) were selected as control regions for each comparison. FIMO from MEME suite (v4.11.3, ‘–thresh 1e-4–motif-pseudo 0.0001’) (58) was used for scanning motifs (TRANSFAC database release 2019, only included Vertebrata and not 3D structure-based) matches in the nucleosome-free regions and two-tailed Fisher’s exact test was used to determine whether a motif was significantly enriched in differentially accessible compared to the control regions. For footprinting analysis of TF binding sites, RGT HINT (v0.13.2) application was used to infer TF activity and to plot the results (77). The Rbpj 185 304098633v1Attorney Docket No: 243734.000206 gene locus associated OCRs that increased their accessibility in Tex versus Tpex cells were scanned for TF motifs using HOMER software to determine TFs regulating Rbpj expression. In-house generated raw and processed ATAC-seq data have been deposited into the GEO series database GSE216800. Genetic interaction CRISPR–Cas9 screening using retroviral TF library
[0409] In vivo screening. The in vivo screening approach was modified based on previous studies (16,23). Briefly, Cas9-expressing OT-I cells were co-transduced with the virus containing the TF library (labeled with Ametrine) in combination with a virus containing sgNTC virus (labeled with mCherry) or sgIkzf1, sgEts1 or sgRbpj (labeled with GFP) to achieve 20–30% double transduction efficiency. Transduced cells were sort-purified based on the co- expression of Ametrine and mCherry or Ametrine and GFP, and an aliquot of 5^105co- transduced OT-I cells were saved as ‘input’. A total of 4^106sgNTC (co-labeled with Ametrine and mCherry) and sgIkzf1, sgEts1 or sgRbpj (co-labeled with Ametrine and GFP) co- transduced OT-I cells were mixed at a 1:1 ratio and injected intravenously into the same B16- OVA tumour-bearing C57BL / 6 mice on day 12 after tumour inoculation. A total of 30 recipients were randomly divided into three groups as biological replicates. Seven days after adoptive transfer, total OT-I cells from the s...
Claims
Attorney Docket No: 243734.000206 Claims 1. A modified immune effector cell, wherein an E26 avian leukemia oncogene 1 (ETS1) gene or gene product is modified in the cell so that the expression and / or function of ETS1 in the cell is reduced or eliminated.
2. The modified immune effector cell of claim 1, wherein the level of functional ETS1 protein in the cell is reduced by 50% or more.
3. The modified immune effector cell of claim 1, wherein the ETS1 gene is deleted so that no detectable functional ETS1 protein is produced.
4. A modified immune effector cell, wherein a recombination signal binding protein for immunoglobulin kappa J region (RBPJ) gene or gene product is modified in the cell so that the expression and / or function of RBPJ in the cell is reduced or eliminated.
5. The modified immune effector cell of claim 4, wherein the level of functional RBPJ protein in the cell is reduced by 50% or more.
6. The modified immune effector cell of claim 4, wherein the RBPJ gene is deleted so that no detectable functional RBPJ protein is produced.
7. A modified immune effector cell, wherein an ETS1 gene and a RBPJ gene or their gene products are modified in the cell so that the expression and / or function of the ETS1 gene and the RBPJ gene in the cell is reduced or eliminated.
8. The modified immune effector cell of claim 7, wherein the level of functional ETS1 protein and / or functional RBPJ protein in the cell is reduced by 50% or more.
9. The modified immune effector cell of claim 7, wherein the ETS1 gene and / or the RBPJ gene is deleted so that no detectable functional ETS1 protein and / or RBPJ protein is produced. 195 304098633v1Attorney Docket No: 243734.000206 10. The modified immune effector cell of any one of claims 1-9, wherein the immune effector cell is a T cell.
11. The modified immune effector cell of claim 10, wherein the T cell is a CD8+T cell.
12. The modified immune effector cell of any one of claims 1-11, wherein the cell further comprises at least one surface molecule capable of binding specifically to an antigen.
13. The modified immune effector cell of claim 12, wherein the antigen is a tumor antigen.
14. The modified immune effector cell of claim 13, wherein the tumor antigen is programmed cell death-ligand 1 (PD-L1), human epidermal growth factor receptor 2 (HER2), interleukin-13 receptor subunit alpha-2 (IL13Rα2), erythropoietin-producing human hepatocellular receptor A2 (EphA2), B7 homolog 3 protein (B7-H3), cluster of differentiation (CD) 19 (CD19), CD22, CD123, or GD2.
15. The modified immune effector cell of any one of claims 1-14, wherein the cell further comprises a chimeric antigen receptor (CAR), an antigen-specific T-cell receptor (TCR), or a bispecific antibody.
16. The modified immune effector cell of claim 15, wherein the cell further comprises a CAR.
17. The modified immune effector cell of any one of claims 1-16, wherein the immune effector cell has been activated and / or expanded ex vivo.
18. The modified immune effector cell of any one of claims 1-17, wherein the immune effector cell is an allogeneic cell.
19. The modified immune effector cell of any one of claims 1-17, wherein the immune effector cell is an autologous cell.
20. The modified immune effector cell of any one of claims 1-19, wherein the immune effector cell is isolated from a healthy subject or a subject having a disease. 196 304098633v1Attorney Docket No: 243734.000206 21. The modified immune effector cell of claim 20, wherein the disease is a cancer.
22. The modified immune effector cell of any one of claims 1-21, wherein the immune effector cell is derived from a blood, marrow, tissue, or a tumor sample.
23. A pharmaceutical composition comprising the modified immune effector cell of any one of claims 1-22 and a pharmaceutically acceptable carrier and / or excipient.
24. A method for generating the modified immune effector cell of any one of claims 1-3 and 10-22, said method comprising modifying an ETS1 gene or gene product in the cell so that the expression and / or function of the gene(s) in the cell is reduced or eliminated.
25. A method for generating the modified immune effector cell of any one of claims 4-6 and 10-22, said method comprising modifying a RBPJ gene or gene product in the cell so that the expression and / or function of the gene(s) in the cell is reduced or eliminated.
26. A method for generating the modified immune effector cell of any one of claims 7-22, said method comprising modifying an ETS1 gene or gene product and a RBPJ gene or gene product in the cell so that the expression and / or function of the genes in the cell is reduced or eliminated.
27. A method of improving an anti-tumor effect of an immune effector cell, said method comprising modifying 1) an ETS1 gene or gene product, 2) a RBPJ gene or gene product, or 3) an ETS1 gene or gene product and a RBPJ gene or gene product in the cell so that the expression and / or function of the gene(s) in the cell is reduced or eliminated.
28. The method of any one of claims 24-27, wherein the immune effector cell is a T cell.
29. The method of claim 28, wherein the T cell is a CD8+T cell.
30. A method of promoting differentiation of a precursor exhausted T cell (Tpex) to an intermediate exhausted T cell (Tex), said method comprising modifying an ETS1 gene or gene product in a T cell so that the expression and / or function of the gene(s) in the cell is reduced or eliminated. 197 304098633v1Attorney Docket No: 243734.000206 31. A method of reprogramming an exhausted T cell (Tex) toward a proliferative state, said method comprising modifying a RBPJ gene or gene product in a T cell so that the expression and / or function of the gene(s) in the cell is reduced or eliminated.
32. The method of any one of claims 24-31, wherein the method further comprises modifying the immune effector cell to express a chimeric antigen receptor (CAR) that is capable of binding to an antigen.
33. The method of any one of claims 24-32, wherein the gene in the immune effector cell is modified as a result of an activity of a site-specific nuclease.
34. The method of claim 33, wherein the site-specific nuclease is an RNA-guided endonuclease.
35. The method of claim 34, wherein the RNA-guided endonuclease is a Cas9 protein, Cpf1 (Cas12a) protein, C2c1 protein, C2c3 protein, or C2c2 protein.
36. The method of claim 35, wherein the RNA-guided endonuclease is a Cas9 protein.
37. The method of claim 33, wherein the site-specific nuclease is a zinc finger nuclease, a TALEN nuclease, or a mega-TALEN nuclease.
38. The method of any one of claims 24 and 26-27, wherein the ETS1 gene product in the immune effector cell is modified as a result of an activity of an RNA interference (RNAi) molecule or an antisense oligonucleotide.
39. The method of any one of claims 25 and 26-27, wherein the RBPJ gene product in the immune effector cell is modified as a result of an activity of an RNA interference (RNAi) molecule or an antisense oligonucleotide.
40. The method of claim 38 or claim 39, wherein the RNAi molecule is a small interfering RNA (siRNA) or a small hairpin RNA (shRNA). 198 304098633v1Attorney Docket No: 243734.000206 41. The method of any one of claims 33-40, wherein the site-specific nuclease, the RNAi molecule, or the antisense oligonucleotide is introduced into the immune effector cell using a viral vector, a non-viral vector, or by physical means.
42. The method of any one of claims 32-41, wherein the CAR is expressed from a transgene introduced into the immune effector cell.
43. The method of claim 42, wherein the CAR-expressing transgene is introduced into the immune effector cell using a viral vector, a non-viral vector, or by physical means.
44. The method of claim 41 or claim 43, wherein the viral vector is a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a herpes viral vector, or a baculoviral vector.
45. The method of claim 44, wherein the viral vector is a retroviral vector.
46. The method of any claim 41 or claim 43, wherein the non-viral vector is a transposon.
47. The method of claim 46, wherein the transposon is a sleeping beauty transposon or PiggyBac transposon.
48. The method of claim 41 or claim 43, wherein the physical means is electroporation, microinjection, magnetofection, ultrasound, a ballistic or hydrodynamic method, or a combination thereof.
49. The method of any one of claims 24-48, wherein the modified immune effector cell is activated and / or expanded ex vivo.
50. A method of treating a disease in a subject in need thereof comprising administering to the subject an effective amount of the modified immune effector cell of any one of claims 1- 22 or the pharmaceutical composition of claim 23.
51. A method of boosting a response to an immune checkpoint blockade therapy in a subject having a disease, said method comprising administering to the subject an effective amount 199 304098633v1Attorney Docket No: 243734.000206 of the modified immune effector cell of any one of claims 1-22 or the pharmaceutical composition of claim 23.
52. The method of claim 51, wherein the modified immune effector cell is an autologous cell.
53. The method of claim 51, wherein the modified immune effector cell is an allogeneic cell.
54. The method of any one of claims 50-53, wherein the disease is a cancer.
55. The method of claim 54, wherein the cancer is a solid tumor.
56. The method of claim 54, wherein the cancer is a hematologic cancer.
57. The method of any one of claims 50-56, wherein the method comprises: i. isolating an immune effector cell from the subject or a donor; ii. modifying a gene or gene product in the immune effector cell so that the expression and / or function of the gene in the cell is reduced or eliminated; and iii. introducing the modified immune effector cell into the subject, wherein the gene is ETS1 gene or RBPJ gene or combination thereof.
58. The method of claim 57, wherein the method further comprises modifying the immune effector cell to express a chimeric antigen receptor (CAR) that is capable of binding specifically to an antigen.
59. The method of any one of claims 50-58, wherein the subject is a human or a mouse.
60. The method of any one of claims 50-59, wherein the method comprises administering to the subject an immune checkpoint blockade therapy.
61. The method as claimed in claim 60, wherein the immune checkpoint blockade therapy comprises an anti-PD-1 agent, an anti-PD-L1 agent, an anti-CTLA-4 agent, anti-LAG3 200 304098633v1Attorney Docket No: 243734.000206 agent, anti-TIM3 agent, anti-TIGIT agent, anti-CD28 agent, or an anti-ICOS agent, or a combination thereof.
62. A guide RNA (gRNA) targeting an ETS1 gene comprising a nucleotide sequence of SEQ ID NO: 2 (CAUCACCCAGUCCCGGACGU).
63. A guide RNA (gRNA) targeting RBPJ gene comprising a nucleotide sequence of SEQ ID NO: 4 (UGCAGUGGACGACGACGAGU) or SEQ ID NO: 6 (GAGGAGGGCAA AAAAAUCUG).
64. A ribonucleoprotein complex comprising the gRNA of claim 62 or claim 63, and a Cas9 protein.
65. A retrovirus-based single-cell CRISPR screen to discover genes regulating a T cell response and an anti-tumor function in vivo. 201 304098633v1
Citation Information
Patent Citations
Modulating t cell function and response
US20210024890A1
Gene targets for manipulating t cell behavior
WO2021076744A1