J3 chaperone that increases chromosomal crossover recombination during meiosis in plant and use thereof

Abstract

The present invention relates to a J3 chaperone that increases chromosomal crossover recombination during meiosis in a plant and use thereof and, more specifically, to a method in which, by inhibiting the function of a J3 chaperone protein, the frequency of crossover recombination between homologous chromosomes is increased during meiosis in plant cells. By using the method for increasing crossover frequency of the present invention, the acceleration of crop breeding and the acceleration of quantitative trait mapping can be maximized.

Description

J3 chaperone that increases chromosome crossover recombination in meiosis in plants and its use

[0001] The present invention relates to a J3 chaperone that increases chromosome crossover recombination during meiosis in plants and its use, and more particularly, to a method for increasing the number of crossover recombination of homologous chromosomes during meiosis in plant cells by inhibiting the expression of a J3 protein derived from Arabidopsis thaliana, inducing a loss-of-function mutant by inserting T-DNA into a J3 protein-coding gene, or inducing a loss-of-function mutant of a wild-type J3 endogenous protein by expressing a J3 protein dominant-negative mutant gene.

[0002]

[0003] This invention was carried out with the support of the Rural Development Administration, the Samsung Future Technology Foundation, and the Seo Kyung-bae Science Foundation (Project No. PJ013370012020, SSTF-BA2202-09, and SUHF-17020079).

[0004] Meiotic recombination is initiated by the formation of programmed DNA double-strand breaks (DSBs), which are repaired using homologous chromosomes as templates to generate crossovers or noncrossovers. Despite the formation of over 200 DSBs, only a small fraction progresses to crossovers, resulting in one or two crossovers per chromosome pair.

[0005] Two pathways for crossover have been identified: class I and class II. The class I pathway promotes most crossovers and is mediated by the crossover-promoting ZMM proteins (Zip1-4, Mer3, and Msh4-5) and the MLH1-MLH3 heterodimeric endonuclease (MutLγ). ZMM proteins stabilize recombination intermediates such as the displacement loop (D-loop) and double Holliday junctions and recruit MutLγ to form crossovers. Crossovers via the class I pathway are characterized by interference, which inhibits the formation of additional crossovers at adjacent sites. In contrast, crossovers via the class II pathway are incoherent and involve the endonuclease MUS81. Incoherent crossovers are limited by several crossover-repressing factors, including the plant FANCM and RECQ4A / 4B helicases. Among ZMMs, the ZIP3 / HEI10 (Human Enhancer of Invasion-10) family of SUMO and / or ubiquitin E3 ligases plays a crucial role in regulating the number and location of interference-sensitive crossover sites in a level-dependent manner. HEI10 begins to localize on early leptotene chromosomes and gradually increases along the synapse complex (SC), a protein structure that forms between homologous chromosomes. In Arabidopsis thaliana, HEI10 E3 ligases diffuse along the SC and localize as small dots in the synapsed early pachytene, together with hundreds of recombination intermediates. Similar to biomolecular condensates that exhibit phase separation in a liquid phase, HEI10 proteins concentrate at designated crossover sites in one or a few larger condensates at the expense of smaller condensates in late pachytene. To account for these dynamics, crossover control, and interference, a diffusion-mediated HEI10 coarsening model was proposed.In Arabidopsis, a mutant lacking the function of the ZYP1 protein, which forms the SC transverse filament structure, exhibits abolished interference and increased class I crossing-over. The HORMA domain protein of the SC axis component is required for promoting class I crossing-over and mediating interference. Cross-over interference is limited by HCR1 (HIGH CROSSOVER RATE1, PROTEIN PHOSPHATASE X 1), which potentially dephosphorylates HEI10 in Arabidopsis. Consistently, posttranslational modifications of crossing-over promoting factors, such as phosphorylation, SUMOylation, ubiquitination, and proteasomal proteolysis, are involved in controlling meiotic recombination in Saccharomyces cerevisiae, Schizosaccharomyces pombe, Caenorhabditis elegans, and mouse. However, the molecular mechanisms mediating the protein degradation and dynamics of HEI10, a major cross-regulatory factor in plants, remain largely unknown.

[0006] The limited number of chromosomal recombination events occurring during meiosis poses a significant obstacle in breeding, both in terms of time and cost, to the combination of useful traits. In the present invention, we sought to identify novel crossover suppressors through genetic screening using an Arabidopsis thaliana fluorescent seed crossover detection system.

[0007] Meanwhile, Korean Patent No. 2410996 discloses 'Protein phosphatase 4 complex for increasing chromosome crossover recombination in meiosis in plant cells and its use', but does not describe 'J3 chaperone for increasing chromosome crossover recombination in meiosis in plants and its use' of the present invention.

[0008] The present invention was derived from the above-mentioned needs, and the present inventors screened the Arabidopsis fluorescent seed reporter line treated with EMS (Ethyl methanesulfonate) to obtain hcr3 (high crossover rate 3) mutants with increased crossover rate compared to the wild type, and confirmed through SHOREmap analysis that the HCR3 is a gene encoding the J3 chaperone, a member of the HSP40 protein family conserved in all eukaryotes including bacteria and plants. In addition, when the hcr3 mutant was crossed with other types of fluorescent seed or pollen reporter lines or a hybrid generation was created and GBS (genotyping by sequencing) analysis was performed, it was confirmed that the crossover rate was increased throughout the genome. As a result of analyzing the expression levels of crossover regulatory factors by Western blot, hcr3, J3 G155R (Dominant-negative mutant of J3 protein) was confirmed to limit the number of crossovers by regulating HEI10 E3 ligase, whose expression level and crossover rate are proportional to each other, at the protein level. Through the above results, the present invention was completed by confirming that the J3 of the present invention is a novel crossover suppressor that regulates crossover regulatory factors at the protein level and can increase the crossover rate through loss-of-function or dominant-negative mutations.

[0009] To solve the above problem, the present invention provides a method for increasing the number of crossover recombination of homologous chromosomes during meiosis of a plant cell, comprising a step of inhibiting the function of the J3 chaperone protein.

[0010] In addition, the present invention provides a method for producing a transgenic plant having an increased number of crossover recombination of homologous chromosomes compared to a wild type, the method comprising the steps of inhibiting the expression of a J3 chaperone protein coding gene in a plant cell, inserting T-DNA into a J3 chaperone protein coding gene to induce a loss-of-function mutant, or increasing the expression of a J3 chaperone dominant-negative mutant protein coding gene.

[0011] In addition, the present invention provides a transgenic plant having an increased number of crossover recombination of homologous chromosomes compared to a wild type produced by the above method, and a transformed seed thereof.

[0012] In addition, the present invention provides a composition for increasing the number of homologous chromosome crossover recombination during meiosis of a plant cell, comprising as an active ingredient a substance that inhibits the function of the J3 chaperone protein.

[0013] Since the Arabidopsis J3 gene according to the present invention functions as a meiotic crossover suppressor gene, the number of crossovers per chromosome increases when loss-of-function mutations are induced or dominant-negative mutations are expressed. Even if a crop has two or more J3 homologous genes, the number of crossovers can be effectively increased by inhibiting the normal function of the J3 homologous genes by expressing dominant-negative mutations without inducing loss-of-function mutations in all of the J3 homologous genes. Increasing the number of crossovers can shorten the period of crossbreeding and accelerate the creation of quantitative trait loci, and therefore, the method of the present invention can be usefully utilized in the agricultural field.

[0014] Figure 1 shows the process of obtaining Arabidopsis hcr3 (high crossover rate3) mutants with increased crossover rate through genetic screening using a fluorescent seed reporter line (420GR / GR). Figure 1a shows the process of creating a screening population by treating 420GR / ++ plants with EMS (Ethyl-methane-sulfonate). Figure 1b is a representative image of the fluorescent seed line (420GR / ++) used for screening for crossover-increasing mutants and analyzed using the image analysis program CellProfiler. Figure 1c shows the results of measuring the crossover frequency of hcr3 / +, hcr3, and hcr3BC1F2. 420(GR / GR) is a fluorescent tagged line (FTL) in which green (eGFP) and red (dsRed) markers are located 5.1 Mbp apart in the subtelomeric region of chromosome 3, and its genetic background is Columbia (Col). Figure 1d shows the location of the hcr3 mutation confirmed by sequencing the genome of the BC1F250 organism, showing that it is located on chromosome 3.

[0015] Figure 2a shows that the hcr3 mutation occurred in the 4th exon of the At3g44110 gene, which encodes the J3 chaperone (G→A). Figure 2b shows the evolutionarily well-conserved J3 phylogenetic tree. Figure 2c shows the results of introducing J3 genomic DNA into the j3-1 mutant, which confirmed that the increased crossover rate was restored to the wild-type level. Figure 2d shows that the introduction of hcr3 into the wild-type resulted in an increased crossover rate, demonstrating that the hcr3 mutation has dominant-negative properties.

[0016] Figure 3a shows the locations of the fluorescent seed and pollen reporter lines used in the crosses. Figure 3b shows that the number of crosses increased in the crosses between hcr3 and various fluorescent seed reporter lines compared to the crosses with the wild type. Figure 3c shows that the number of crosses increased in the crosses between hcr3 and various fluorescent pollen reporter lines compared to the crosses with the wild type. Figure 3d shows that the female-specific crossover rate increased in the 420 fluorescent seed reporter line.

[0017] Figure 4 shows the increase in genome-wide crossover when the hcr3 dominant negative mutation was ectopically expressed in the hybrid generation. Figure 4a shows the preparation process of F2 plants for genotyping-by-sequencing (GBS) analysis for crossover mapping. Figure 4b shows the J3:J3 G155R Figure 4c shows increased crossover in meiosis of the Col / Ler hybrid F1. J3:J3 G155R The average number of crossovers per Col / Ler hybrid F2 individual increased to 15.1 compared to 7.7 in the wild type. Figure 4d shows that the number of crossovers increased from the centromere to the telomeric region, with a J3:J3 G155R The increase in Col / Ler crossovers is shown to be significant. Figures 4e and 4f show that the crossover rates of both sexes increased approximately twofold. Figures 4g and 4h show that an additional increase in the number of crossovers occurred when the J3 dominant-negative mutation in recq4a / b was expressed, compared to the recq4a / b loss-of-function mutation. Figures 4i and 4j show that the pattern of increased crossover rates of hcr3 is similar to that observed when HEI10 was overexpressed.

[0018] Figure 5a shows that there is no significant change in chromosome behavior during meiosis in hcr3, and Figures 5b and 5c show that the number of RAD51, which marks DSB locations, is unchanged. Figure 5d shows that the axis element ASY1 is unchanged in hcr3 and J3 loss-of-function mutants.

[0019] Figures 6a and 6b show that the number of MLH1 foci overlapping the crossover site is increased in hcr3. Figures 6c and 6d show that the number of HEI10 foci is increased by approximately 30% in hcr3 compared to the wild type in the late anaphase. Furthermore, the distance between two HEI10 foci on a single chromosome is closer in hcr3 than in the wild type. Figure 6e shows the results of GBS analysis, showing that the distance between two crossover points on a single chromosome is close to a random distribution in hcr3, weakening the interference effect.

[0020] Figure 7a shows that when hcr3 is double-mutated with fancm, crossover increases further than in the single mutants. Furthermore, when hcr3 is double-mutated with zip4 or hei10, the crossover rate is the same as in the zip4 or hei10 single mutant. Figure 7b shows that when hcr3 and recq4a / b double mutants, crossover increases further than in the single mutants. Figure 7c shows that when hcr3 is double-mutated with mus81, the decrease in crossover rate compared to the hcr3 single mutant is similar to the difference in crossover rate between the wild type and the mus81 single mutant. Figure 7d shows that under high temperature conditions (28°C), a greater increase in crossover rate occurs in hcr3 compared to the wild type. Figure 7e shows that when hcr1 and hcr2, which are class I crossover suppressors identified in previous studies, double and triple mutants of hcr3 show further increases in crossover rate. Figure 7f shows the results of RNA base sequence analysis graphically represented as a heatmap.

[0021] Figures 8a and 8b show the results of a Western blot experiment confirming that the protein levels of HEI10-HA, PTD-HA, and MSH5-HA proteins were higher in the hcr3 and j3-1 genotypes when expressed in Arabidopsis protoplasts. Figures 8c and 8d show the results of a Western blot experiment confirming that the HEI10-Myc, PTD-Myc, and MSH5-Myc proteins were detected in higher amounts in flower buds containing meiotic progenitor cells when co-expressed with the J3 dominant-negative mutant compared to the J3 wild type. Figures 8e and 8f show that the HEI10 protein was detected in flower buds containing meiotic progenitor cells in hcr3,j3-1, and J3:J3. G155R This is the result of confirming through Western blot that it exists more in the genotype than in the wild type.

[0022] In order to achieve the object of the present invention, the present invention provides a method for increasing the number of crossover recombination of homologous chromosomes during meiosis of a plant cell, comprising a step of inhibiting the function of a J3 chaperone protein.

[0023] Homologous chromosomes are chromosomes of nearly identical size and shape, inherited one from each parent and paired with each other during meiosis. These homologous chromosomes undergo crossover, the exchange (recombination) of segments between homologous chromosomes during the prophase of meiosis I. This crossover contributes to the formation of genetic diversity.

[0024] In the method for increasing the number of crossover recombination according to the present invention, the inhibition of the function of the J3 chaperone protein may be achieved by, but is not limited to, inhibiting the expression of the J3 chaperone protein coding gene, inducing a loss-of-function mutant by inserting T-DNA into the J3 chaperone protein coding gene, or increasing the expression of the J3 chaperone dominant-negative mutant protein coding gene.

[0025] Inhibition of the expression of the J3 protein coding gene of the present invention can be performed by inserting the J3 protein coding gene into a VIGS (virus-induced gene silencing) vector or RNAi vector, which is an expression inhibition vector, and more preferably, by transforming a plant cell with a recombinant vector that specifically mediates silencing of the J3 protein coding gene at the meiotic stage, but is not limited thereto.

[0026] In the method for increasing the number of cross-recombinations according to the present invention, the J3 chaperone protein may be composed of an amino acid sequence of SEQ ID NO: 3, and the J3 chaperone dominant-negative mutant protein may be one in which the 155th amino acid in the amino acid sequence of SEQ ID NO: 3 is substituted from glycine to arginine, but is not limited thereto.

[0027] The term "dominant-negative mutation" in the present invention refers to a mutation that exhibits a mutant trait by inhibiting the normal function of the wild-type allele product through antagonism. Such mutations usually produce a gene product with altered molecular function and exhibit a dominant or semi-dominant phenotype relative to the wild-type allele. Despite the presence of the wild-type allele, it exhibits the characteristics of a dominant effect by driving the expression of the mutant trait, and it is characterized by exhibiting the characteristics of a negative effect in that it exhibits a loss-of-function phenotype.

[0028] In the method for increasing the number of crossover recombination according to the present invention, the expression of the J3 chaperone dominant negative mutant protein coding gene may be regulated by a constitutive promoter or a meiosis-specific promoter, but is not limited thereto. The meiosis-specific promoter may be, but is not limited to, the SPO11-1 (SPORULATION 11-1) promoter or the DMC1 (DNA meiotic recombinase 1) promoter.

[0029] In the present invention, the scope of the J3 chaperone protein includes a protein having an amino acid sequence represented by SEQ ID NO: 3 and a functional equivalent of the protein. The term "functional equivalent" refers to a protein having a sequence homology of at least 70%, preferably 80%, more preferably 90%, and even more preferably 95%, with the amino acid sequence represented by SEQ ID NO: 3 as a result of addition, substitution, or deletion of amino acids, and exhibiting substantially the same physiological activity as the protein represented by SEQ ID NO: 3. The term "substantially the same physiological activity" refers to an activity that increases the number of crossover recombination of homologous chromosomes during meiosis of a plant cell compared to a wild type, i.e., a non-transformant, through inhibition of the function of the J3 protein.

[0030] In addition, the present invention provides a gene encoding the J3 protein. The gene encoding the J3 protein of the present invention may include a base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2. In addition, a homolog of the base sequence is included within the scope of the present invention. Specifically, the gene may include a base sequence having a sequence identity of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% with the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2, respectively. The "% of sequence homology" for a polynucleotide is determined by comparing a comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region may include additions or deletions (i.e., gaps) compared to a reference sequence (which does not include additions or deletions) for the optimal alignment of the two sequences.

[0031] In addition, the method for increasing the number of crossover recombination according to the present invention may further inhibit the expression or function of one or more crossover suppressor proteins simultaneously with the inhibition of the function of the J3 chaperone protein, but is not limited thereto. The crossover suppressor proteins may be, but are not limited to, FANCM (Fanconi anemia group M protein), RECQ4A (ATP-dependent DNA helicase Q-like 4A), RECQ4B, FIGL1 (AAA-ATPase FIDGETIN-LIKE 1), HCR1 (HIGH CROSSOVER RATE 1 / PROTEIN PHOSPHATASE X1), or HCR2 (HIGH CROSSOVER RATE 2 / HEAT SHOCK FACTOR BINDING PROTEIN).

[0032] Further inhibition of the expression or function of the above-mentioned crossover suppressor protein can further increase the number of crossover recombination of homologous chromosomes during meiosis in plant cells.

[0033] The present invention also provides a method for producing a transgenic plant having an increased number of crossover recombination of homologous chromosomes compared to a wild type, the method comprising the steps of inhibiting the expression of a J3 chaperone protein coding gene in a plant cell, inserting T-DNA into a J3 chaperone protein coding gene to induce a loss-of-function mutant, or increasing the expression of a J3 chaperone dominant-negative mutant protein coding gene.

[0034] In the manufacturing method of the present invention, the J3 chaperone protein is composed of an amino acid sequence of SEQ ID NO: 3, and the J3 chaperone dominant-negative mutant protein may be one in which the 155th amino acid in the amino acid sequence of SEQ ID NO: 3 is substituted from glycine to arginine.

[0035] In the manufacturing method of the present invention, the inhibition of expression of the J3 chaperone protein coding gene or the increase in expression of the J3 chaperone dominant-negative mutant protein coding gene is not limited thereto, but preferably, expression may be specifically regulated at the meiotic stage, but is not limited thereto.

[0036] The term "recombinant" as used herein refers to a cell that replicates a heterologous nucleic acid, expresses said nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. A recombinant cell may express a gene or gene fragment not found in the cell's native form, either in sense or antisense form. A recombinant cell may also express a gene found in the cell's native form, but in a modified form that has been reintroduced into the cell by artificial means.

[0037] Additionally, the term "recombinant expression vector" refers to a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In general, any plasmid or vector can be used as long as it can replicate and be stabilized in a host. Important characteristics of the expression vector include having an origin of replication, a promoter, a marker gene, and translation control elements.

[0038] Expression vectors containing appropriate transcription / translation control signals can be constructed using methods well known to those skilled in the art. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be effectively linked to a suitable promoter within the expression vector to drive mRNA synthesis. The expression vector may also include a ribosome binding site as a translation initiation site and a transcription terminator.

[0039] Preferred examples of the recombinant vector of the present invention are VIGS vectors or RNAi vectors. VIGS (Virus-induced gene silencing) refers to a phenomenon in which, when a plant gene is introduced into a viral vector and then infected with the plant, the expression of the endogenous plant gene of the introduced gene is suppressed. This is a type of PTGS (post-transcriptional gene silencing) and has the characteristics of post-transcriptional, RNA turnover, and nucleotide sequence specificity. The VIGS vector can be used as a transient expression vector that can temporarily express a foreign gene in a plant into which a foreign gene has been introduced, and as a plant expression vector that can permanently express a foreign gene in a plant into which a foreign gene has been introduced. A preferred example of a plant expression vector is the Ti-plasmid vector, which, when present in a suitable host such as Agrobacterium tumefaciens, is capable of transferring part of itself, the so-called T-region, into plant cells. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences into plant cells or protoplasts from which new plants can be produced in which the hybrid DNA is suitably integrated into the plant genome. A particularly preferred form of Ti-plasmid vector is the so-called binary vector, as claimed in EP 0 120 516 B1 and U.S. Pat. No. 4,940,838.

[0040] The expression vector will preferably include one or more selectable markers. These markers are typically nucleic acid sequences with properties that can be selected chemically, and include any gene that can distinguish transformed cells from untransformed cells. Examples include, but are not limited to, herbicide resistance genes such as glyphosate or phosphinothricin, and antibiotic resistance genes such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol.

[0041] In the recombinant vector of the present invention, the promoter may optionally be a plant promoter known in the art, such as a T7 promoter, an SP6 promoter, a CaMV 35S promoter, an actin promoter, a ubiquitin promoter, a pEMU promoter, a MAS promoter, or a histone promoter, and may also be a meiosis-specific promoter capable of specifically inhibiting the expression of a target gene at the meiotic stage of a cell, such as the SPO11-1 (SPORULATION 11-1) promoter or the DMC1 (DNA meiotic recombinase 1) promoter, but is not limited thereto. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in a plant cell.

[0042] In the recombinant vector of the present invention, conventional terminators can be used, including, but not limited to, nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, and phaseolin terminator. Regarding the necessity of terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly preferred in the context of the present invention.

[0043] Plant transformation refers to any method for transferring DNA into plants. Such transformation methods do not necessarily require regeneration and / or tissue culture. Transformation of plant species is now commonplace, encompassing both dicotyledonous and monocotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA of the present invention into a suitable progenitor cell. Methods include the calcium / polyethylene glycol method for protoplasts (Krens, FA et al, 1982, Nature 296, 72-74; Negrutiu I et al, 1987, Plant Mol Biol 8, 363-373), electroporation of protoplasts (Shillito RD et al, 1985 Bio / Technol 3, 1099-1102), microinjection with plant elements (Crossway A et al, 1986, Mol Gen Genet 202, 179-185), particle bombardment of various plant elements (Klein TM et al, 1987, Nature 327, 70), infection by (non-complete) viruses in Agrobacterium tumefaciens-mediated gene transfer by infiltration of plants or transformation of mature pollen or microspores (EP 0 301 316, etc.) can be suitably selected. A preferred method according to the present invention includes Agrobacterium-mediated DNA transfer.

[0044] Additionally, the manufacturing method of the present invention includes a step of regenerating a transgenic plant from the transformed plant cell. Any method known in the art can be used to regenerate a transgenic plant from the transgenic plant cell.

[0045] The present invention also provides a transgenic plant having an increased number of crossover recombination of homologous chromosomes compared to a wild type produced by the above method, and a transformed seed thereof.

[0046] In one embodiment of the present invention, the plant may be a dicotyledonous plant such as Arabidopsis thaliana, potato, eggplant, tobacco, pepper, tomato, burdock, crown daisy, lettuce, bellflower root, spinach, radish, sweet potato, carrot, water parsley, cabbage, Chinese cabbage, mustard greens, watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney bean, pea, or a monocotyledonous plant such as rice, barley, wheat, rye, corn, sugarcane, oats, onion, and preferably a dicotyledonous plant, and more preferably Arabidopsis thaliana, but is not limited thereto.

[0047] The present invention also provides a composition for increasing the number of homologous chromosome crossover recombination during meiosis of a plant cell, comprising as an active ingredient a substance that inhibits the function of the J3 chaperone protein.

[0048] In the composition according to the present invention, the J3 chaperone protein function inhibitor may be at least one selected from the group consisting of compounds, peptides, peptide mimetics, substrate analogs, aptamers, and antibodies that specifically bind to the J3 chaperone protein; or at least one selected from the group consisting of antisense oligonucleotides, siRNA (small interfering RNA), shRNA (small hairpin RNA), miRNA (microRNA), and ribozymes that inhibit the expression of the J3 chaperone protein encoding gene, but is not limited thereto.

[0049] In addition, the composition of the present invention may further include, but is not limited to, a substance that inhibits the function of one or more crossover inhibitory proteins selected from the group consisting of FANCM (Fanconi anemia group M protein), RECQ4A (ATP-dependent DNA helicase Q-like 4A), RECQ4B, FIGL1 (AAA-ATPase FIDGETIN-LIKE 1), HCR1 (HIGH CROSSOVER RATE 1 / PROTEIN PHOSPHATASE X1), and HCR2 (HIGH CROSSOVER RATE 2 / HEAT SHOCK FACTOR BINDING PROTEIN). The substance that inhibits the function of the FANCM, RECQ4A, RECQ4B, FIGL1, HCR1, and HCR2 proteins may be an antibody or aptamer specific to each protein; or miRNA, siRNA, or antisense RNA capable of inhibiting the expression of each protein-coding gene.

[0050]

[0051] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0052]

[0053] Materials and Methods

[0054] 1. Plant materials

[0055] Arabidopsis plants were grown at 22°C, 50–60% humidity, and under a 16 / 8-h light / dark cycle. Seeds were cultured in the dark at 4°C for 3–4 days to induce germination. Fluorescent tagged (FTL) lines expressing in seeds and FTL lines expressing in pollen were used in the invention (Wu, G., et al., (2015) Genetics 200:35–45; Melamed-Bessudo, C., et al., (2005) Plant J. 43:458–66). T-DNA insertion lines j3-1 (SALK_132923), zip4-2 (SALK_068052), mus81-2 (SALK_107515), hei10-2 (SALK_014624) and the EMS mutant fancm-1 were provided by NASC (Nottingham Arabidopsis Stock Centre). The wild-type allele was genotyped using the primer sets j3-1_geno_F and j3-1_geno_R, and the T-DNA allele was genotyped using the primer sets j3-1_geno_F and LBb1.3. The genotyping of hcr3 was performed by PCR amplification using hcr3_dCAPS_BamHI_F and hcr3_dCAPS_R, followed by BamHI digestion. The genotyping of zip4-2, mus81-2, and fancm-1 was performed according to the previous method (Yelina, NE et al., (2015) Genes Dev. 29:2183-202; F. Hartung et al., (2006), Nucleic Acids Research, 34(16):4438-4448).

[0056] 본 발명에 사용된 프라이머 정보PrimerSequence (5'-3') (서열번호)hcr3_dCAPS_BamHI_FCACATTTCAAGGAGGCTCCAGATTTGGATTT (4)hcr3_dCAPS_RGCTATATGTGTCCTAGGTTCAT (5)LBb1.3ATTTTGCCGATTTCGGAAC (6)j3-1_geno_FTGTTGAATTTTGATCCGATCTG (7)j3-1_geno_RCCCTTTCTCTTGAACTTTGGGG (8)pPZP211-gJ3_GA_FGCCTGCAGGTCGACTCTAGAGAAATCAGTGATGATCAAATTACTTAC (9)pPZP211-gJ3_GA_RAGGCGCCCTCGAGTTGAACTCTTTTTAAAATACAACTGGTATG (10)pJ3(2.2. kb)_Lv0_F(GGAG)CCGAAGACGGCTCAGGAGCCAACCTACTTGCATGTTAACAAGAAACTATTATTC (11)pJ3_Lv0_R(CCAT)CCGAAGACGGCTCGATGGCTTTTCGCCGTTGTAACGAAAAC (12)J3_Lv0_F(AATG)AAAGAAGACAACTCAAATGTTCGGTAGAGGACCCTC (13)J3 Lv0_R(TTCG)AAAGAAGACAAACCTTTACTGCTGGGCACATTGC (14)J3(G155R)_SDM_FATTGAGAAGGACTGAGACTGAGGACCATTC (15)J3(G155R)_SDM_RGGCTCCAGATTTTGATCTCTTTCTGCAAT (16)J3-Ter_Lv0_F(GCTT)CCGAAGACGGCTCAGCTTGTAACTCCTTAGAGAGAGACTTTGAC (17)J3-Ter_Lv0_R(CGCT)CCGAAGACGGCTCGAGCGAACTCTTTTTAAAATACAACTGGTATG (18)pDMC1(1.5kb)_Lv0_F(GGAG)CCGAAGACGGCTCAGGAGAAAGAAACCAAAGTTCCATGTCCAT (19)pDMC1_Lv0_R(AATG)CCGAAGACGGCTCGCATTCCGATCACTGACACAAGCAAAAATAAA (20)HEI10_Lv0_GA_F(AATG)CCCGAAGACGGCTCAAATGATGAGATGCAACGCGTGTTGGA (21)HEI10_Lv0_GA_R(ggTTCG)CCGAAGACGGCTCGCGAACCTAGCGTGAACAGCTGAGGGCGGGAA (22)MSH5_Lv0_GA_F(AATG)CCGAAGACGGCTCAAATGATGGAGGAAATGGAGGACACTG (23)MSH5_Lv0_GA_R(ggTTCG)CCGAAGACGGCTCGCGAACCGGAAGTGAAGATATCTTGAAAG (24)PTD_Lv0_GA_F(AATG)CCGAAGACGGCTCAAATGATGGCGACGGCGGGATCA (25)PTD_Lv0_GA_R(ggTTCG)CCGAAGACGGCTCGCGAACCTCAGTTGAATTTGGGACTGAG (26)pRPS5A_Lv0_F(GGAG)CCGAAGACGGCTCAGGAGCCATAATCGTGAGTAGATATATTACTCAAC (27)pRPS5A_Lv0_R(AATG)CCGAAGACGGCTCGCATTGGCTGTGGTGAGAGAAACAGAGCGTGAGCTC (28)pREC8_Lv0_F(GGAG)CCCGAAGACGGCTCAGGAGATGGAGGTAGCGGGATAATTGA (29)pREC8_Lv0_R(AATG)CCCGAAGACGGCTCGCATTCCCGCGTGCAATGTAGCGGCCATCCTTAAGAAGAAGAAA (30)pASY1(1.3kb)_Lv0_F(GGAG)CCCGAAGACGGCTCAGGAGTGGCAGGATATATTGTGGTG (31)pASY1_Lv0_R(AATG)CCCGAAGACGGCTCGCATTCCTTTTGCAGAAGTGTGAAACGA (32)pSPO11-1_Lv0_F(GGAG)CCCGAAGACGGCTCAGGAGGACCTCTCTGTTCTTAATTCC (33)pSPO11-1_Lv0_R(AATG)CCCGAAGACGGCTCGCATTCCCTCTTTCGAGTTTCAAAACTGAAA (34)pSDS_Lv0_F(GGAG)CCCGAAGACGGCTCAGGAGTGGCAGGATATATTGTGGTG (35)pSDS_Lv0_R(AATG)CCCGAAGACGGCTCGCATTCCTTTTTCTCCGTACGAAAGCTTGAAA (36).

[0057]

[0058] 2. Mutagenesis through EMS (Ethyl methanesulfonate) treatment

[0059] Approximately 10,000 seeds of 420GR / ++ hemizygous plants obtained from the cross between 420(GR / GR) homozygotes and wild-type Arabidopsis (Col-0) were soaked in 40 ml of 100 mM phosphate buffer (pH 7.5) for 1 h, washed with fresh phosphate buffer, treated with 0.3% (v / v) EMS, and incubated at room temperature for 12 h (Fig. 1a). The EMS-treated seeds were washed 10 times with distilled water and immediately planted in soil. Approximately 7,000 M1 plants germinated and grew from these seeds. Approximately 600 M2 populations were generated by combining seeds from 12 independent M1 plants. Approximately 150 seeds from each M2 population were designated as 420GR / ++ hemizygotes based on red and green fluorescence, grown, and selfed. The resulting seeds were used for 420 crossover frequency analysis.

[0060]

[0061] 3. Measurement of crossover frequency and interference using fluorescent seeds and fluorescent pollen.

[0062] Crossover frequencies were analyzed by counting fluorescent and non-fluorescent seeds of FTL / ++ hemizygous plants using the CellProfiler image analysis program. CellProfiler was used to count green singly fluorescent seeds (N Green ), red single fluorescent seeds (N Red ) and total number of seeds (N Total ) can be quantified, and the crossover frequency (cM) was calculated using the following formula. The significance of the crossover frequency between genotypes was verified using Welch's t-test.

[0063] cM = 100 x (1-[1[2(N Green +N Red ) / N Total ] 1 / 2 )

[0064] Pollen FTLs were generated in a qrt-1 mutant background and are composed of four pollen products of male meiosis fused together. FTLs express eYFP (Y), dsRed (R), or eCFP (C) under the control of the LAT52 promoter. Measurements of pollen tetrad FTL-based crossing-over frequency and interference were performed using DeepTetrad (Berchowitz, LE & Copenhaver, GP (2008) Nat. Protoc. 3:41-50; Lim, EC et al., (2020) Plant J. 101:473-483). DeepTetrad is a deep-learning-based image analysis system that can recognize pollen tetrad types in FTL intervals.

[0065] The FTL interval (I1bc, I1fg, I2fg, I3bc and I5ab) produces 12 tetramolecular types: no recombination (A), single crossover interval 1 (B; SCO-i1), single crossover interval 2 (C; SCO-i2), two-strand double crossover (D; 2st DCO), three-strand double crossover a (E; 3st DCOa), three-strand double crossover b. (F; 3st DCOb), four-strand double crossover (G; 4st DCO), non-parental ditype interval 1, non-crossover interval 2 (H; NPD-i1 NCO-i2), non-crossover interval 1, non-parental ditype interval 2 (I; NCO-i1 NPD-i2), non-parental ditype interval 1, single crossover interval 2 (J; NPD-i1) SCO-i2), single crossover interval 1, Non-parental ditype interval 2 (K; SCO-i1 NPD-i2) and non-parental ditype interval 1, non-parental ditype interval 2 (L; NPD-i1 NPD-i2). Fluorescent seed states were identified using DeepTetrad, and crossover frequencies and interferences were calculated using Perkin's equation.

[0066] The cross interference ratio (IFR=σ) in two connected intervals is the intersection X γ Genetic map distance with adjacent intersection X δ The ratio of genetic map distances that do not include , calculated with DeepTetrad using the following formula.

[0067]

[0068]

[0069] 4. Confirmation of hcr3 mutation using DNA sequencing and SHOREmap

[0070] Fifty hcr3BC1F2 individuals with a higher 420 crossover frequency than the wild type were identified, and 5 mg of seeds from each BC1F2 individual were collected. The sterilized seeds were germinated on 1 / 2 MS solid medium, and 7-day-old seedlings were collected. Approximately 3 g of the collected seedlings were powdered using liquid nitrogen. The powder was homogenized using 40 ml of nuclear isolation buffer (25 mM Tris-HCl, pH 7.5, 0.44 M sucrose, 10 mM MgCl2, 0.5% Triton X-100, 10 mM β2 mM spermine, EDTA-free Protease Inhibitor Cocktail). The lysate was stirred and reacted on ice for 30 minutes, then centrifuged at 4°C and 3,000 g for 25 minutes, and the pellet was used for DNA extraction using CTAB (Cetyl trimethylammonium bromide). The extracted and purified DNA was fragmented into 200–500 bp sizes using a Bioruptor sonicator. The purified DNA was used for library construction using the Illumina Truseq Nano DNA LT library prep kit, and the hcr3BC1F2 library was sequenced using an Illumina Genome Analyser (100 bp paired) Hiseq 2000 instrument.

[0071] SHOREmap (v.3.0) was used to align paired-end reads to the TAIR10 reference genome using the GenomeMapper tool. Raw reads were trimmed based on quality values ​​with a Phred score cutoff of +33 or +64 using the SHORE import function, and the SHORE consensus function was used to detect sequence variations between hcr3BC1F2 and the TAIR10 reference assembly. Single nucleotide polymorphisms (SNPs) with high marker scores (>40) were subjected to allele frequency analysis using the SHOREmap backcross function. Mutations were screened for those with (i) an allele frequency ≥80% and (ii) non-synonymous mutations, splice site changes, or premature stop codon changes within predicted genes. Candidate mutations were also screened based on their location within genes with predicted or known functions related to meiosis, nuclear protein localization, and known molecular functions provided in the TAIR database.

[0072]

[0073] 5. Identification of the J3 dominant negative allele HCR3

[0074] A 4.1-kb genomic DNA fragment containing the 2.2-kb promoter and gene of HCR3 / J3 was amplified using the primer sets pPZP211-gJ3_GA_F and pPZP211-gJ3_GA_R. The PCR product was cloned into the pPZP211 vector using the Gibson assembly method. The cloned vector was introduced into the Agrobacterium GV3101-pSoup strain by electroporation, and the Agrobacterium strain was transformed into plants by floral dipping. T1 plants were selected through genotyping using primer sets specific for kanamycin resistance and the HCR3 / J3 transgene.

[0075]

[0076] 6. J3 family tree

[0077] The neighbor-joining method was used to construct the J3 phylogenetic tree. The amino acid sequences used in the multiple sequence alignment are as follows: AtJ3, AtJ2, OsDNAJ (XP 015630926.1), SlDNAJ-like (NP 001234241.2), GmDNAJ (NP 0001354212.1), PpDNAJ (XP024402168.1), XlDNAJA2 (NP 001080625.1), DrDNAJ (NP 998658.1), CeDNAJ (NP 493570.1), HsDNAJA1 (NP 001530.1), DmDnaJ-like-2 (NP 650283.1), ScYDJ1, SpMas5 (NP 595428.1), EcHSP40.

[0078]

[0079] 7. Production of HCR3 / J3 dominant negative mutant plants

[0080] To generate plants expressing the HCR3 dominant negative allele, wild-type genomic DNA containing the promoter and 5'-UTR of the J3, DMC1, RPS5A, REC8, ASY1, SPO11-1, or SDS genes was amplified with forward and reverse primers and cloned into the Lv0 vector (pICH41331). The HCR3 / J3 genomic DNA was amplified from the genomic DNA of the hcr3 mutant plant with forward and reverse primers and cloned into the Lv0 vector (pICH41331). Each promoter and the hcr3Lv0 vector were assembled into the Lv1 position 2 vector (pICH47742). The constructed Lv1 vector was assembled into the Lv2 binary vector (pAGM4723) together with a linker (pICH41744) and the antibiotic resistance gene BAR (pICSL11017). The Lv2 binary vector was introduced into Agrobacterium strain GV3101-pSoup and transformed into Arabidopsis thaliana via the flower stem immersion method.

[0081]

[0082] 8. GBS and cross-checking of F2 plants

[0083] J3:J3 for sequencing library preparation G155RGenomic DNA was extracted from Col / Ler F296 individuals using CTAB. 150 ng of DNA was fragmented (final volume 15 μl) with 0.3 units of dsDNA Shearase (Zymo Research), and the sheared DNA was end-repaired in 30 μl of a reaction solution (3 units of T4 DNA polymerase (New England Biolabs), 10 units of T4 polynucleotide kinase (Thermo Fisher Scientific), 1.25 units of Klenow fragment (New England Biolabs), and 0.4 mM dNTPs) at 20°C for 30 min. DNA fragments were cleaned using AMPure XP magnetic SPRI beads (Beckman-Coulter, A63881). DNA was A-tailed and ligated with barcoded Illumina adapters in a 20 μL reaction volume according to a previously described method (Rowan, BA, et al., (2015) G3 (Bethesda). 5:385-98). Eight DNA libraries were pooled, washed, and eluted in 30 μL elution buffer (10 mM Tris-HCl, pH 8.0). 30 μL of the mixture was added to a tube containing 16 μL of AMPure XP magnetic SPRI beads, incubated at room temperature for 5 minutes, and placed on a magnetic rack for 2 minutes. The supernatant (42 μL) was transferred to a new tube and mixed with 0.23 times the volume of SPRI beads. After incubating at room temperature for 5 minutes and placing on a magnetic rack for 2 minutes, the supernatant was removed, and the beads were washed with 80% ethanol for 30 seconds, repeating this process twice. Afterwards, the beads were air-dried for 10 minutes and DNA was eluted using 20 μl of 10 mM Tris (pH 8.0).Twelve microliters of the eluate was PCR amplified using the KAPA HiFi Hot-Start ReadyMix PCR kit (Kapabiosystems) and known DNA oligonucleotides (Rowan, BA, et al., (2015)). PCR products were purified using SPRI beads and quantified using a Bioanalyzer. Six barcoded libraries were sequenced using an Illumina HiSeqX instrument using paired-end 150-bp sequencing.

[0084]

[0085] 9. Cytological analysis of wild-type and hcr3 meiotic progenitor cells

[0086] Chromosome experiments in Arabidopsis meiotic progenitor cells were performed using fixed flower buds and DAPI staining as previously reported (Chelysheva, L. et al. (2010) Cytogenet. Genome Res. 129:143-53). Cells in the anaphase to metaphase were immunostained for ASY1 and J3, cells in the late metaphase were immunostained for HEI10, and cells in the replicative to mitotic phase were immunostained for MLH1. Meiotic progenitor cells in the anaphase were immunostained for ASY1 and RAD51 using fresh flower buds. Antibodies used included α-ASY1 (rat, 1:200 or 1:500 dilution), α-ZYP1 (rabbit, 1:200 dilution), α-MLH1 (rabbit, 1:200 dilution), and α-RAD51 (rabbit, 1:300 dilution). Microscopic examinations were performed using a DeltaVision personal DV microscope (Applied precision / GE Healthcare) equipped with a CDD Coolsnap HQ2 camera. Image capture was performed using SoftWoRx software version 5.5. For ASY1 and RAD51 co-immunostaining of quaternary nuclei, individual cell images were acquired as 10 Z-stacks with an optical density of 0.2 μM each, and maximum intensity projections were determined for each cell using ImageJ. The number of MLH1 foci per meiotic cell and the number of RAD51 foci per cell were manually scored relative to the axis protein ASY1. Welch's test was used to evaluate significant differences in MLH1 and RAD51 foci in wild-type and hcr3.

[0087]

[0088] 10. Quantitative analysis of ZMM protein in protoplasts and transgenic plants

[0089] Transient expression vectors in protoplasts were constructed using Golden Gate cloning. PCR-amplified genomic DNAs of HCR3 / J3, HEI10, PTD, and MSH5 were cloned into the Lv0 universal vector (pICH41331). The Lv0 vector, which contains a coding region lacking a stop codon for epitope tagging, was assembled into the Lv1 vector (pICH4742) using the 35S promoter vector (pICH51266), N-terminal or C-terminal vectors (Myc tag / pICSL50010 and HA tag / pICSL50009), and the NOS terminator vector (pICH41421).

[0090] To generate transgenic plants expressing epitope-tagged proteins, the HCR3 / J3Lv1 vector and each of the HEI10, PTD, and MSH5Lv1 vectors constructed by the above method were assembled into the Lv2 binary vector (pAGM4723) together with a linker (pICH41744) and the antibiotic resistance gene BAR (pICSL11017). The completed Lv2 binary vector was introduced into Agrobacterium strain GV3101-pSoup, and Arabidopsis thaliana was transformed using the flower stalk dipping method.

[0091] Plasmid DNA and mesophyll protoplasts were prepared according to previously described methods (Hwang, I. & Sheen, J. (2001) Nature 413:383-389). 4x10 4Protoplasts of dogs were transfected with 40 μg of total plasmid DNA and cultured at room temperature for 10 h. Total protein was extracted using extraction buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, protease inhibitor cocktail (Roche), and 1% Triton X-100). The extracted buffer was developed by SDS-PAGE using 8% polyacrylamide gel, transferred to nitrocellulose membrane, and confirmed using anti-HA-HRP (1:2,000 Roche 12013819001) or anti-Myc-HRP (1:2,000 Santa Cruz sc-9E10) antibodies.

[0092] For in vivo protein analysis, approximately 0.1 g of young flower buds containing meiotic progenitor cells between 5 and 6 weeks of age were collected and powdered using liquid nitrogen. Total protein was extracted using a lysis buffer (25 mM HEPES, 5 mM EDTA, 2% SDS), and subsequent procedures were performed in the same manner as described above.

[0093]

[0094] Example 1. Increased crossover through HCR3 / J3 mutation

[0095] Previous studies have shown that increased crossing over in plants can be achieved through mutations in crossing over suppressor genes (FANCM, RECQ4A / B, FIGL1, HCR1 / PPX1) or overexpression of crossing over promoting genes (HEI10). In the present invention, to secure a new crossing over suppressor gene, EMS was treated to a fluorescent seed crossing measurement line and mutants with increased crossing over were screened (Fig. 1).

[0096] As a result, we obtained an hcr3 mutant with increased crossover, and confirmed through next-generation sequencing (NGS) that the cause of the increased crossover in the mutant was due to a mutation in the At3g44110 gene encoding the J3 chaperone (Fig. 2). Increased crossover was confirmed in a J3 loss-of-function mutant induced by T-DNA insertion into the J3 gene (Fig. 2c), and it was confirmed that when a J3 dominant-negative mutant allele is expressed, it causes additional increase in crossover than a loss-of-function mutation of a single gene by suppressing the function of J3 homologous genes endogenous to the plant (Fig. 2d). Although cases of controlling the crossover rate through changes in the transcript expression of crossover regulatory genes have been reported in previous studies, this is the first report of a case in which a phenotype of increased crossover was confirmed by controlling the level of a crossover regulatory protein during meiosis.

[0097]

[0098] Example 2. Increased crossover through meiosis-specific HCR3 gene expression.

[0099] The J3 chaperone contributes to protein stabilization under conditions such as high temperatures that are not suitable for plant growth. Loss-of-function mutants of J3 have a reduced ability to respond to environmental changes, and double mutations with J2, a homologous gene of J3, cause plant lethality in early development. Therefore, to express the dominant-negative mutant form of J3 in a meiotic manner, a meiosis-specific promoter was used to confirm the pattern of increased crossover rate (Fig. 2e). When the SPO11-1 promoter was used, plants showing a higher increase in crossover rate were obtained than with the endogenous J3 promoter, and this pattern was confirmed to increase the crossover rate in proportion to the expression amount of the J3 dominant-negative mutant (Fig. 2f). In addition, when the J3 dominant-negative mutant was expressed in the hybrid generation using the SPO11-1 promoter, a higher crossover rate was confirmed than when the endogenous J3 promoter was used (Figs. 4k and 4l). These results confirmed that the increase in crossover rate can be increased or decreased by controlling the timing and amount of expression of the J3 dominant negative mutation using various promoters.

[0100]

[0101] Example 3. Additional increase in crossover number through crossover suppressor genes and hcr3 double mutation.

[0102] Previous studies have shown that double or triple mutations of Class II crossover suppressor genes (FANCM, RECQ4A / 4B) and Class I crossover suppressor genes (HCR1, HCR2), as well as hcr3, further increase the number of crossovers compared to single mutations (Fig. 7e). This is significant because it suggests that existing methods for increasing crossover rates can further increase the number of crossovers.

Claims

1. A method for increasing the number of crossover recombination of homologous chromosomes during meiosis of a plant cell, comprising a step of inhibiting the function of a J3 chaperone protein.

2. A method for increasing the number of crossover recombination of homologous chromosomes during meiosis of a plant cell, characterized in that in the first paragraph, the inhibition of the function of the J3 chaperone protein is achieved by inhibiting the expression of a J3 chaperone protein coding gene, inducing a loss-of-function mutant by inserting T-DNA into the J3 chaperone protein coding gene, or increasing the expression of a J3 chaperone dominant-negative mutant protein coding gene.

3. A method for increasing the number of crossover recombination of homologous chromosomes during meiosis of a plant cell, wherein in the second paragraph, the J3 chaperone protein is composed of an amino acid sequence of sequence number 3, and the J3 chaperone dominant-negative mutant protein is characterized in that the 155th amino acid in the amino acid sequence of sequence number 3 is substituted from glycine to arginine.

4. A method for increasing the number of crossover recombination of homologous chromosomes during meiosis of a plant cell, characterized in that the expression of the J3 chaperone dominant negative mutant protein coding gene in the second paragraph is controlled by a constitutive promoter or a meiosis-specific promoter.

5. A method for increasing the number of crossover recombination of homologous chromosomes during meiosis of a plant cell, characterized in that, in accordance with claim 1, the expression or function of one or more crossover repression proteins is additionally inhibited simultaneously with the inhibition of the function of the J3 chaperone protein.

6. A method for increasing the number of crossover recombination of homologous chromosomes during meiosis of a plant cell, characterized in that the crossover suppression protein is FANCM (Fanconi anemia group M protein), RECQ4A (ATP-dependent DNA helicase Q-like 4A), RECQ4B, FIGL1 (AAA-ATPase FIDGETIN-LIKE 1), HCR1 (HIGH CROSSOVER RATE 1 / PROTEIN PHOSPHATASE X1) or HCR2 (HIGH CROSSOVER RATE 2 / HEAT SHOCK FACTOR BINDING PROTEIN).

7. A method for producing a transgenic plant having an increased number of crossover recombination of homologous chromosomes compared to a wild type, comprising the steps of inhibiting the expression of a J3 chaperone protein coding gene in a plant cell, inducing a loss-of-function mutant by inserting T-DNA into a J3 chaperone protein coding gene, or increasing the expression of a J3 chaperone dominant-negative mutant protein coding gene.

8. A method for producing a transgenic plant having an increased number of crossover recombination between homologous chromosomes compared to a wild type, wherein the J3 chaperone protein is composed of an amino acid sequence of sequence number 3, and the J3 chaperone dominant-negative mutant protein is characterized in that the 155th amino acid in the amino acid sequence of sequence number 3 is substituted from glycine to arginine.

9. A transgenic plant having an increased number of crossover recombination events between homologous chromosomes compared to a wild type produced by the method of Article 7.

10. Transformed seeds of plants according to Article 9. 11.J3 A composition for increasing the number of homologous chromosome crossover recombination during meiosis of a plant cell, comprising as an active ingredient a substance that inhibits the function of a chaperone protein.

12. A composition according to claim 11, wherein the J3 chaperone protein function inhibitor is at least one selected from the group consisting of compounds, peptides, peptide mimetics, substrate analogs, aptamers, and antibodies that specifically bind to the J3 chaperone protein; or at least one selected from the group consisting of antisense oligonucleotides, siRNA (small interfering RNA), shRNA (small hairpin RNA), miRNA (microRNA), and ribozymes that inhibit the expression of the J3 chaperone protein coding gene.

13. The composition of claim 11, characterized in that it further comprises a substance that inhibits the function of one or more proteins selected from the group consisting of FANCM (Fanconi anemia group M protein), RECQ4A (ATP-dependent DNA helicase Q-like 4A), RECQ4B, FIGL1 (AAA-ATPase FIDGETIN-LIKE 1), HCR1 (HIGH CROSSOVER RATE 1 / PROTEIN PHOSPHATASE X1), and HCR2 (HIGH CROSSOVER RATE 2 / HEAT SHOCK FACTOR BINDING PROTEIN).

Images