Modulation of gene expression

Abstract

The present embodiments provide methods of modulating gene expression by recruitment of endogenous transcription factors.

Description

[0001] MODULATION OF GENE EXPRESSION Cross-Reference to Related Applications This application claims the benefit of priority to US Provisional Application No.63 / 602,183 , filed November 22, 2023, which is incorporated by reference herein in its entirety for any purpose. Sequence Listing The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled CORE0174SEQ.xml created on November 8, 2024, which is 153 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Field The present embodiments provide methods of modulating gene expression by recruitment of endogenous transcription factors. Background Gene expression in mammals is regulated by epigenetic regulation, which can affect chromatin structure. BET family proteins are characterized by two tandem bromodomains and an extra-terminal domain. The bromodomains specifically bind to acetylated lysines in histones, and the BET family proteins are transcriptional regulators. BRD4 is a transcriptional activator that is associated with chromatin decompaction and transcriptional activation of target nucleic acids. Oligomeric agents comprising antisense oligonucleotides bind specifically to target sites in nucleic acids of interest. Summary Embodiments provided herein are directed to methods of regulating gene expression by the recruitment of endogenous transcription factors including BET family proteins. In certain embodiments, an oligomeric agent comprising one or more BET binding moiety modulates transcription of a target nucleic acid. Brief Description of the Drawings Figure 1 shows BRD4 knockdown by Compound Nos. BRD4 siRNA 137041 and BRD4 siRNA 137042. Figure 2 shows cell viability at varying concentrations of oligomeric agent. Detailed Description It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety. It is understood that throughout the specification, the first letter in a peptide sequence is the first amino acid of the peptide at the N-terminus and the last letter in a peptide sequence is the last amino acid of the peptide at the C-terminus unless indicated otherwise. Similarly, the first nucleoside in a nucleotide sequence represents the 5’-end of the nucleotide, and the last letter in the nucleotide sequence represents the 3’-end, unless indicated otherwise. Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety. Unless otherwise indicated, the following terms have the following meanings: As used herein, “2’-deoxynucleoside” means a nucleoside comprising a 2’-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2’-deoxynucleoside is a 2’-β-D-deoxynucleoside and comprises a 2’-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil). As used herein, “2’-MOE” means a 2’-OCH2CH2OCH3group in place of the 2’-OH group of a furanosyl sugar moiety. A “2’-MOE sugar moiety” means a sugar moiety with a 2’-OCH2CH2OCH3group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-MOE sugar moiety is in the β-D-ribosyl configuration. “MOE” means O-methoxyethyl. As used herein, “2’-MOE nucleoside” means a nucleoside comprising a 2’-MOE sugar moiety. As used herein, “2′-OMe” or “2′-O-methyl” means a 2′-OCH3group at the 2′-position of a furanosyl sugar moiety. A “2′-OMe sugar moiety” or “2′-O-methyl sugar moiety” means a sugar moiety with a 2′-OCH3group at the 2′-position of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-OMe sugar moiety is in the β-D-ribosyl stereochemical configuration. As used herein, “2’-OMe nucleoside” means a nucleoside comprising a 2’-OMe sugar moiety. As used herein, “2’-F” means a 2’-F group in place of the 2’-OH group of a furanosyl sugar moiety. A“2’-fluoro sugar moiety” or “2’-F sugar moiety” means a sugar moiety with a 2’-F group in place of the 2’- OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-F sugar moiety is in the β-D-ribosyl configuration. As used herein, “2’-F nucleoside” means a nucleoside comprising a 2’-F sugar moiety. As used herein, “2’-NMA” means a –O-CH2-C(=O)-NH-CH3group in place of the 2’-OH group of a ribosyl sugar moiety. A “2’-NMA sugar moiety” is a sugar moiety with a 2’–O-CH2-C(=O)-NH-CH3group in place of the 2’-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2’-NMA sugar moiety is in the β-D configuration. “NMA” means O-(N-methyl)acetamide. As used herein, “2’-NMA nucleoside” means a nucleoside comprising a 2’-NMA sugar moiety. As used herein, “2′-substituted nucleoside” means a modified nucleoside comprising a 2′-substituted furanosyl sugar moiety.2′-substituted nucleosides include, but are not limited to, e.g., a 2′-OMe nucleoside, a 2′-MOE nucleoside, a 2′-F nucleoside, a 2′-NMA nucleoside, a cEt nucleoside, a LNA nucleoside. As used herein, “5-methylcytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5- methylcytosine is a modified nucleobase. As used herein, “5-methylcytosine” means a cytosine modified with a methyl group attached at the 5 position. A 5-methylcytosine is a modified nucleobase. As used herein, “antisense activity” means any detectable and / or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is the modulation of the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound to the target. As used herein, “antisense oligonucleotide” means an oligonucleotide having at least one region (a “targeting region ”) that is complementary to a target nucleic acid (e.g., a target region). An antisense oligonucleotide may be paired with a second oligonucleotide (herein, a “sense oligonucleotide”) that is complementary to the antisense oligonucleotide (for example, forming an “oligomeric duplex”), may be an unpaired antisense oligonucleotide (herein, a single-stranded antisense oligonucleotide), or may be a “hairpin oligonucleotide” that has at least one region that is self-complementary. As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising a furanosyl sugar moiety and a second ring, wherein the second ring is formed via a bridge connecting two non-geminal atoms in the ring of the furanosyl sugar moiety, thereby forming a bicyclic structure. Examples of bicyclic sugar moieties include locked nucleic acid (LNA) sugar moieties and constrained ethyl (cEt) sugar moieties as defined herein. As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. As used herein, “branching group” means a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups. In certain embodiments, a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and / or a cleavable moiety. As used herein, a “BET binding moiety” means a conjugate moiety that interacts with a one or more of BET family proteins, including BRD2, BRD3, BRD4, and BRDT. JQ1 is a BET binding moiety. As used herein, “BET” refers to the “Bromodomain and Extra-Terminal Domain” family of proteins, which have two tandem bromodomains and an extra-terminal domain. The mammalian BET family proteins include BRD2, BRD3, BRD4, and BRDT. As used herein, “BRD4” refers to a mammalian protein or fragment thereof having at least 85% sequence identity to SEQ ID NO: 1, NCBI NP_001366220.1 (homo sapiens), SEQ ID NO: 2, GenBank: AAL67833.1 (mus musculus), SEQ ID NO: 3, GenBank AAL67834.1 (mus musculus), or SEQ ID NP: 4 ,NCBI NP_001094373.1 (rattus novegicus). As used herein, “constrained ethyl” or “cEt” or “cEt sugar moiety” means a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4′-carbon and the 2′-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4′-CH(CH3)-O-2′, and wherein the methyl group of the bridge is in the S configuration. As used herein, “cEt nucleoside” means a nucleoside comprising a cEt sugar moiety. As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are oligomeric compounds disclosed herein. In certain embodiments, the oligomeric compounds are antisense compounds. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides. As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, or a subject. As used herein, “complementary nucleobases” means nucleobases that form hydrogen bonds with one another when aligned on opposing strands of nucleic acids (including, but not limited to oligonucleotides). Complementary nucleobase pairs include, but are not limited to, adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that are complementary to unmodified nucleobases or to other modified nucleobases are known in the art. For example, hypoxanthine, the nucleobase of the nucleoside inosine (I), can pair with adenine, cytosine, thymine, or uracil. Herein, hypoxanthine (I) is considered a complementary nucleobase to thymine (T), adenine (A), uracil (U), and cytosine (C). As used herein, “complementary” refers to two nucleobase sequences in which some or all of the nucleobases in the two sequences are complementary nucleobases when the sequences are aligned. A “nucleobase sequence” means the order of contiguous nucleobases in a strand of linked nucleosides or a region thereof (e.g., an oligonucleotide or region thereof, or a target nucleic acid or region thereof) independent of any sugar or internucleoside linkage modification. Each of the two nucleobase sequences may be a sequence corresponding to the nucleobase sequence of any strand of linked nucleosides or region thereof. For example, complementary nucleobase sequences may be the nucleobase sequences of two separate strands of linked nucleosides or region thereof (e.g., an oligonucleotide and a region of a target nucleic acid, or an antisense oligonucleotide and its paired sense oligonucleotide) or complementary nucleobase sequences may be two regions of a single strand of linked nucleosides (e.g., self-complementary regions of a hairpin oligonucleotide). As used herein, when a first strand of linked nucleosides (e.g., an oligonucleotide) or region thereof is described as being complementary to a second strand of linked nucleosides or region thereof (e.g., a target nucleic acid or another oligonucleotide), it means that the nucleobase sequence of the first strand of linked nucleosides or region thereof is complementary to the nucleobase sequence of the second strand of linked nucleosides or region thereof. Not every pair of nucleobases in the aligned nucleobase sequences needs to be complementary for the two sequences to be “complementary.” Rather, some mismatches are tolerated. Where complementarity is expressed as a percent, such percent represents the percent of nucleobases within one nucleobase sequence that are complementary to nucleobases within an equal length second sequence when the sequences are aligned. Unless otherwise specified, “complementary” is assumed to be at least 70%. Complementary nucleobase sequences may be 75%, 80%, 85%, 90%, 95%, or 100% complementary. For example, if the nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is 80% complementary to another nucleobase sequence, then 16 of the nucleobase pairs are complementary nucleobases, and there are 4 mismatches when the sequences are aligned. If the nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is at least 80% complementary to another nucleobase sequence, then 16, 17, 18, 19, or 20 of the nucleobase pairs are complementary nucleobases, and there are 0-4 mismatches when the sequences are aligned. As used herein, “fully complementary” or “100% complementary” means that each nucleobase pair of the two nucleobase sequences is complementary when the equal length sequences are aligned. As used herein, “conjugate group” means a group of atoms including a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide. As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide. As used herein, “conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker. For example, a conjugate moiety may comprise one or more BET binding moieties as described herein. As used herein, “deoxy region” means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides comprise a 2’-deoxy sugar moiety. In certain embodiments, each nucleoside is selected from a 2’-β-D-deoxynucleoside, a bicyclic nucleoside, and a 2’-substituted nucleoside. In certain embodiments, a deoxy region supports RNase H activity. In certain embodiments, a deoxy region is the gap or internal region of a gapmer. As used herein, “hybridization” means the annealing of oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target. As used herein, “identity,” or “percent identity”, with regard to an amino acid sequence or nucleic acid sequence, means the percentage of amino acids or nucleobases that are identical between two amino acid sequences when the amino acid or nucleic acid sequences are aligned for maximal similarity. Percent identity can be determined by a program such as BLASTP or BLASTN (Altschul, et al., J. Mol. Biol., 1990; Altschul, et al., Nucleic Acids Research, 1997) or Clustal Omega (Sievers, et al., Molecular Sys.Biol., 2011; Goujon et al., Nucleic Acids Research, 2010; McWilliam, et al., Nucleic Acids Research 2013). As used herein, the term “internucleoside linkage” is the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom. As used herein, “gene expression” or “expression” means the process by which a nucleic acid is translated into a protein. An increase in expression leads to an increases in amount or concentration of a protein encoded by a nucleic acid. As used herein “expression level” means the amount or concentration of a protein in a sample. In certain embodiments, the expression level of a protein is measured at a specific time point following contacting a cell or treating a subject with an oligomeric agent described herein. As used herein, “JQ1(+)” means the compound having this formula: . As used herein, when attached to a linker or other molecule, “JQ1” means a fragment having Formula I: Formula I. As used herein, “mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned. As used herein, “motif” means the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages, in an oligonucleotide. As used herein, “natural amino acid” means Gly or theL-isomer of each of the following: Ala, Arg, Asn, Asp, Cys, Gln, Glu, His, Ile, Lys, Leu, Met, Phe, Pro, Ser, Thr, Trp, Tyr, Val. As used herein, “non-natural amino acid” means any amino acid other than the standard twenty amino acids encoded by the human genetic code, includingD-isomers of each of the following: Ala, Arg, Asn, Asp, Cys, Gln, Glu, His, Ile, Lys, Leu, Met, Phe, Pro, Ser, Thr, Trp, Tyr, Val. A non-natural amino acid may have a modified or functionalized side chain (e.g., through the attachment of a linker) Examples of non- natural amino acids include, but are not limited to, allo-isoleucine, 2-amino-3-ethyl-pentanoic acid, aminoisobutyric acid, aminobutyric acid, azetidine, 7-azatryptophan, 6-azidolysine, β-cyclobutylalanine, β- methyl isoleucine, 4, 4-biphenylalanine, cis-hydroxyproline, cyclobutyl glycine, cyclohexyl glycine, cyclopentyl alanine, cyclopentyl glycine, 2,6-dimethyl tyrosine, 3,3-diphenyl alanine, 4-trans-hydroxy-L- proline, 1-napthaylalanine, 2-napthylalanine, N-methyl alanine, 1-methyl histidine, 3-methyl histidine, N- methyl-tryptophan, pipecolic acid,4-pyridylalanine, sarcosine, t-butyl alanine, or 3-t-butyl tyrosine. As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring. As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A “5-methylcytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification. As used herein, “the nucleobase sequence of” or “the sequence of” a reference nucleobase SEQ ID NO, refers only to the nucleobase sequence provided in such SEQ ID NO and therefore, unless otherwise indicated, includes compounds wherein each sugar moiety and each internucleoside linkage, independently, may be modified or unmodified, irrespective of the presence or absence of modifications, indicated in the referenced SEQ ID NO. As used herein, “tandem repeat” means a sequence of 2-6 nucleotides that is repeated three or more times in a head-to-tail manner on a chromosome. A trinucleotide repeat is an example of a tandem repeat. As used herein, “the peptide sequence of” or “the polypeptide sequence of” or “the sequence of” a reference peptide / polypeptide SEQ ID NO refers to the linear, amide-bond-linked amino acid sequence provided in such SEQ ID NO, even in cases where the given peptide or polypeptide contains one or more modified side chains that that link to another moiety. As used herein, “nucleoside” means a compound or fragment of a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “oligomeric agent” means an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound. An oligomeric agent may be a single-stranded oligomeric compound or may be an oligomeric duplex formed by two complementary oligomeric compounds. As used herein, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a terminal group or linker. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound. The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage independently may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications. As used herein, “overlap” with respect to two or more target regions of a target nucleic acid means that the two regions have at least one nucleotide in common. As used herein, “peptide” means a compound or a fragment of a compound consisting of 3 or more amino acids linked together via amide bonds. As used herein, “polypeptide” means a compound or fragment of a compound consisting of 60 or more amino acids linked together via amide bonds. A protein may comprise one or more peptides or polypeptides, or a combination thereof. As used herein, “peptide sequence” or “polypeptide sequence” means the order of contiguous amino acids in a peptide or polypeptide main chain. As used herein, “pharmaceutically acceptable carrier or diluent ” means an ingredient in a pharmaceutical composition suitable for use in administering to a subject. Typically, a “carrier” or “diluent” lacks pharmacological activity but is desirable in preparing a pharmaceutical composition. As used herein, “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric agent and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines. As used herein “prodrug” means a therapeutic agent in a first form outside the body that is converted to a second form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzyme (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and / or by physiologic conditions. In certain embodiments, the first form of the prodrug is less active than the second form. As used herein, “stabilized phosphate moiety” means a 5′-phosphate analog that is metabolically more stable than a 5′-phosphate as naturally occurs on DNA or RNA. As used herein, “stereorandom” or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not intentionally controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration at that chiral center. It is understood that a stereorandom chiral center may not be racemic because one absolute configuration predominates following synthesis, e.g., due to steric and electronic interactions of reagents with the reactant molecule . The stereorandom chiral center may be at the phosphorous atom of a stereorandom phosphorothioate or stereorandom mesyl phosphoramidate internucleoside linkage. As used herein, “subject” means a human or a non-human animal. The subject may be a human. As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, "sugar surrogate" means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to an internucleoside linkage. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids. As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an antisense oligonucleotide has complementarity with. Target RNA means an RNA transcript and includes pre-mRNA and mRNA unless otherwise specified. As used herein, “target region” means a region of a target nucleic acid to which the targeting region of an antisense oligonucleotide is at least 90% complementary. “Targeting region” means a region of a oligonucleotide that is complementary to a target region. As used herein, "terminal group" means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide. As used herein, “antisense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides. As used herein, “sense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide. As used herein, “treating” means improving a subject’s disease or condition by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves a symptom relative to the same symptom in the absence of the treatment. In certain embodiments, treatment reduces the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the increase in severity or frequency of a symptom. As used herein, “therapeutically effective amount” means an amount of an oligomeric agent or pharmaceutical composition that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves a symptom of a disease. CERTAIN EMBODIMENTS The present disclosure provides the following non-limiting numbered embodiments: Embodiment 1. A method of modulating the expression of a target nucleic acid in a cell, comprising contacting the cell with an oligomeric agent comprising a modified oligonucleotide and at least one BET binding ligand; wherein the modified oligonucleotide comprises a targeting region that is complementary to a target region of the target nucleic acid. Embodiment 2. The method of embodiment 1, wherein the target nucleic acid does not comprise a tandem repeat. Embodiment 3. The method of embodiment 1, wherein the target region of the target nucleic acid does not include a tandem repeat. Embodiment 4. The method of any of embodiments 1-3, wherein the oligomeric agent comprises two or more BET binding ligands. Embodiment 5. The method of embodiment 4, wherein the oligomeric agent comprises 2, 3, 4, or 6 BET binding ligands. Embodiment 6. The method of any of embodiments 1-5, wherein at least one BET binding ligand has Formula IIa: Formula IIa, wherein: Ring A is absent or a 6-membered aryl or heteroaryl ring; Y is -N(H)- or -O-; R1, R2, R3are each independently selected from hydrogen, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; R4is selected from hydrogen, halogen, -NO2, -CN, aryl, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; or R4is -NRARB, wherein RAand RBare each independently selected from hydrogen and C1-C6alkyl; and m is from 1-6. Embodiment 7. The method of embodiment 6, wherein Ring A is absent. Embodiment 8. The method of embodiment 6 or 7, wherein R1, R2, and R3are each methyl. Embodiment 9. The method of any of embodiments 6-8, wherein R4is halogen. Embodiment 10. The method of any of embodiments 6-9, wherein m is 1.

[0002] Embodiment 11. The method of any of embodiments 6-9, wherein the at least one BET binding ligand has Formula IIb: Embodiment 12. The method of any of embodiments 6-11, wherien Ring A is absent, R1, R2, and R3are each methyl, R4is halogen, and m is 1. Embodiment 13. The method of any of embodiments 6-12, wherein R4is Cl. Embodiment 14. The method of any of embodiments 6-13, wherein the at least one BET binding ligand has Formula I: . Embodiment 15. The method of any of embodiments 1-14, wherein each BET binding ligand is the same. Embodiment 16. The method of any of embodiments 1-15, wherein each BET binding ligand has Formula IIa or IIb. Embodiment 17. The method of any of embodiments 1-15, wherein each BET binding ligand has Formula I. Embodiment 18. The method of any of embodiments 4-17, wherein the oligomeric agent comprises a branching group. Embodiment 19. The method of embodiment 18, wherein the branching group has a formula selected from: Embodiment 20. The method of embodiment 19, wherein the oligomeric agent comprises a tether. Embodiment 21. The method of embodiment 20, wherein the tether comprises: , wherein n is from 2-10. Embodiment 22. The method of embodiment 20, wherein the tether has a formula selected from: . Embodiment 23. The method of any of embodiments 1-22, wherein the oligomeric agent comprises a conjugate moiety selected from:

[0003] . Embodiment 24. The method of any of embodiments 1-23, wherein the modified oligonucleotide consists of 16-24, 16-22, 16-20, 16-18, 18-24, 18-22, 18-20, 18, or 20 linked nucleosides. Embodiment 25. The method of embodiment 24, wherein the modified oligonucleotide consists of 16, 18, or 20 linked nucleosides. Embodiment 26. The method of any of embodiments 1-25, wherein the modified oligonucleotide comprises at least one modified sugar moiety. Embodiment 27. The method of embodiment 26, wherein the modified sugar moiety is a non-bicyclic sugar moiety. Embodiment 28. The method of embodiment 27, wherein the non-bicyclic sugar moiety is selected from the group consisting of 2’-NMA, 2’-O-methoxyethyl, 2’-OMe. Embodiment 29. The method of embodiment 26, wherein the modified sugar moiety is a bicyclic sugar moiety. Embodiment 30. The method of embodiment 29, wherein the bicyclic sugar moiety is selected from the group consisting of 4'-(CH2)-O-2' (LNA); 4'-(CH2)2-O-2' (ENA); and 4'-CH(CH3)-O-2' (cEt). Embodiment 31. The method of any of embodiments 26-30, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. Embodiment 32. The method of embodiment 31, wherein the modified sugar moiety is a non-bicyclic sugar moiety is selected from the group consisting of 2’-NMA, 2’-O-methoxyethyl, 2’-OMe. Embodiment 33. The method of embodiment 26-32, wherein each modified sugar moiety is a 2’- O- methoxyethyl. Embodiment 34. The method of any of embodiments 1-33, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. Embodiment 35. The method of embodiment 34, wherein at least one modified internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage. Embodiment 36. The method of embodiment 35, wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage. Embodiment 37. The method of embodiment 35, wherein each internucleoside linkage of the modified oligonucleotide is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage. Embodiment 38. The method of any of embodiments 1-37, wherein gene expression of the target is upregulated. Embodiment 39. The method of embodiment 38, wherein gene expression is upregulated by at least 150%, at least 200%, at least 250%, or at least 300% compared to gene expression in the absence of the oligomeric agent. Embodiment 40. The method of any of embodiments 1-40, wherein the cell is in a subject. Embodiment 41. An oligomeric agent, comprising a modified oligonucleotide and a BET binding ligand, wherein the modified oligonucleotide comprises a targeting region that is complementary to a target region of a target nucleic acid. Embodiment 42. The oligomeric agent of embodiment 41, wherein the target region does not comprise a tandem repeat. Embodiment 43. The oligomeric agent of embodiment 41 or 42, wherein the target nucleic acid does not comprise a tandem repeat. Embodiment 44. The oligomeric agent of embodiment 41 or 42, wherein the oligomeric agent does Embodiment 45. The oligomeric agent of any of embodiments 41-44, wherein the target nucleic acid is not PVT1, XIST, HSP70, MALAT1, ACTB, SCN1A, or SYNGAP1. Embodiment 46. The oligomeric agent of any of embodiments 41-45,wherein at least one BET binding ligand has Formula IIa: Formula IIa, wherein: Ring A is absent or a 6-membered aryl or heteroaryl ring; Y is -N(H)- or -O-; R1, R2, R3are each independently selected from hydrogen, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; R4is selected from hydrogen, halogen, -NO2, -CN, aryl, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; or R4is -NRARB, wherein RAand RBare each independently selected from hydrogen and C1-C6alkyl; and m is from 1-6. Embodiment 47. The oligomeric agent of embodiment 46, wherein Ring A is absent. Embodiment 48. The oligomeric agent of embodiment 46 or 47, wherein R1, R2, and R3are each methyl. Embodiment 49. The oligomeric agent of any of embodiments 46-48, wherein R4is halogen. Embodiment 50. The oligomeric agent of any of embodiments 46-49, wherein m is 1. Embodiment 51. The oligomeric agent of any of embodiments 46-49, wherein the at least one BET binding ligand has Formula IIb: .Embodiment 52. The oligomeric agent of any of embodiments 46-51, wherein Ring A is absent, R1, R2, and R3are each methyl, R4is halogen, and m is 1. Embodiment 53. The oligomeric agent of any of embodiments 46-52, wherein R4is Cl. Embodiment 54. The oligomeric agent of any of embodiments 46-53, wherein the at least one BET binding ligand has Formula I: . Embodiment 55. The oligomeric agent of any of embodiments 41-54, wherein each BET binding ligand is the same. Embodiment 56. The oligomeric agent of any of embodiments 41-55, wherein each BET binding ligand has Formula IIa or IIb. Embodiment 57. The oligomeric agent of any of embodiments 41-55, wherein each BET binding ligand has Formula I. Embodiment 58. The oligomeric agent of any of embodiments 44-57, wherein the oligomeric agent comprises a branching group. Embodiment 59. The oligomeric agent of embodiment 58, wherein the branching group has a formula selected from: Embodiment 60. The oligomeric agent of embodiment 59, wherein the oligomeric agent comprises a tether. Embodiment 61. The oligomeric agent of embodiment 60, wherein the tether comprises: , wherein n is from 2-10. Embodiment 62. The oligomeric agent of embodiment 61, wherein the tether has a formula selected from: . Embodiment 63. The oligomeric agent of any of embodiments 41-62, wherein the oligomeric agent comprises a conjugate moiety selected from: . Embodiment 64. The oligomeric agent of any of embodiments 41-63, wherein the modified oligonucleotide consists of 16-24, 16-22, 16-20, 16-18, 18-24, 18-22, 18-20, 18, or 20 linked nucleosides. Embodiment 65. The oligomeric agent of embodiment 64, wherein the modified oligonucleotide comprises at least one modified sugar moiety. Embodiment 66. The oligomeric agent of embodiment 65, wherein the modified sugar moiety is a non-bicyclic sugar moiety. Embodiment 67. The oligomeric agent of embodiment 66, wherein the non-bicyclic sugar moiety is selected from the group consisting of 2’-NMA, 2’-O-methoxyethyl, 2’-OMe. Embodiment 68. The oligomeric agent of embodiment 67, wherein the modified sugar moiety is a bicyclic sugar moiety. Embodiment 69. The oligomeric agent of embodiment 68, wherein the bicyclic sugar moiety is selected from the group consisting of 4'-(CH2)-O-2' (LNA); 4'-(CH2)2-O-2' (ENA); and 4'-CH(CH3)- O-2' (cEt). Embodiment 70. The oligomeric agent of any of embodiments 65-69, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. Embodiment 71. The oligomeric agent of embodiment 70, wherein the modified sugar moiety is a non-bicyclic sugar moiety is selected from the group consisting of 2’-NMA, 2’-O-methoxyethyl, 2’- OMe. Embodiment 72. The oligomeric agent of embodiment 65-71, wherein each modified sugar moiety is a 2’- O-methoxyethyl. Embodiment 73. The oligomeric agent of any of embodiments 41-72, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. Embodiment 74. The oligomeric agent of embodiment 73, wherein at least one modified internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage. Embodiment 75. The oligomeric agent of embodiment 74, wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage. Embodiment 76. The oligomeric agent of embodiment 74, wherein each internucleoside linkage of the modified oligonucleotide is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage. Embodiment 77. The oligomeric agent of any of embodiments 41-76, wherein gene expression of the target is upregulated. Embodiment 78. The oligomeric agent of embodiment 77, wherein gene expression is upregulated by at least 150%, at least 200%, at least 250%, or at least 300% compared to gene expression in the absence of the oligomeric agent. Embodiment 79. A pharmaceutical composition comprising an oligomeric agent of any of embodiments 41-78. Embodiment 80. A pharmaceutical composition comprising two or more oligomeric agents of any of embodiments 41-79, wherein the modified oligonucleotide of each oligomeric agent is complementary to a different target region of the same target nucleic acid. Embodiment 81. A method of administering an oligomeric agent of any of embodiments 41-78 or a pharmaceutical composition of embodiment 79 or 80 to a subject. Embodiment 82. A method of modulating the expression of a target nucleic acid in a cell, comprising contacting the cell with a composition comprising two or more oligomeric agents; wherein each oligomeric agent is an oligomeric agent of any of embodiments 41-79, and wherein each modified oligonucleotide is complementary to a different, non-overlapping target region of the target nucleic acid. Embodiment 83. The method of embodiment 82, wherein gene expression of the target is upregulated. Embodiment 84. The method of embodiment 83, wherein gene expression is upregulated by at least 150%, at least 200%, at least 250%, or at least 300% compared to gene expression in the absence of the oligomeric agent. Embodiment 85. The method of any of embodiments 83-84, wherein the cell is in a subject. Embodiment 86. A method of modulating the expression of a target nucleic acid in a cell, comprising contacting the cell with an oligomeric agent comprising a modified oligonucleotide and at least one BET binding ligand; wherein the modified oligonucleotide comprises a targeting region that is complementary to a target region of the target nucleic acid. Embodiment 87. The method of embodiment 86, wherein the target nucleic acid does not comprise a tandem repeat. Embodiment 88. The method of embodiment 86, wherein the target region of the target nucleic acid does not include a tandem repeat. Embodiment 89. The method of any of embodiments 86-88, wherein the oligomeric agent comprises two or more BET binding ligands. Embodiment 90. The method of embodiment 89, wherein the oligomeric agent comprises 2, 3, 4, or 6 BET binding ligands. Embodiment 91. A method of modulating the expression of a target nucleic acid in a cell, comprising contacting the cell with two or more oligomeric agents, wherein each oligomeric agent comprises a modified oligonucleotide and at least one BET binding ligand; wherein the first modified oligonucleotide comprises a targeting region that is complementary to a first target region of the target nucleic acid; and the second modified oligonucleotide comprises a targeting region that is complementary to a second target region of the target nucleic acid; wherein the first target region and the second target region do not overlap. Embodiment 92. The method of embodiment 91, comprising contacting the cell with three or more oligomeric agents, each comprising a modified oligonucleotide and at least one BET binding ligand; wherein the third modified oligonucleotide comprises a targeting region that is complementary to a third target region of the target nucleic acid, and where in the first, second, and third target regions do not overlap. Embodiment 93. The method of embodiment 91, comprising contacting the cell with four or more oligomeric agents, each comprising a modified oligonucleotide and at least one BET binding ligand; wherein each modified oligonucleotide comprises a targeting region that is complementary to a target region of the target nucleic acid, and wherein none of the target regions overlap. Embodiment 94. The method of any of embodiments 86-93, wherein at least one BET binding ligand has Formula IIa: Formula IIa, wherein: Ring A is absent or a 6-membered aryl or heteroaryl ring; Y is -N(H)- or -O-; R1, R2, R3are each independently selected from hydrogen, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; R4is selected from hydrogen, halogen, -NO2, -CN, aryl, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; or R4is -NRARB, wherein RAand RBare each independently selected from hydrogen and C1-C6alkyl; and m is from 1-6. Embodiment 95. The method of embodiment 94, wherein Ring A is absent. Embodiment 96. The method of embodiment 94 or 95, wherein R1, R2, and R3are each methyl. Embodiment 97. The method of any of embodiments 94-96, wherein R4is halogen. Embodiment 98. The method of any of embodiments 94-97, wherein m is 1. Embodiment 99. The method of any of embodiments 94-98, wherein the at least one BET binding ligand has Formula IIb: Embodiment 100. The method of any of embodiments 94-99, wherien Ring A is absent, R1, R2, and R3are each methyl, R4is halogen, and m is 1. Embodiment 101. The method of any of embodiments 94-100, wherein R4is Cl. Embodiment 102. The method of any of embodiments 9-101, wherein the at least one BET binding ligand has Formula I: . Embodiment 103. The method of any of embodiments 86-102, wherein each BET binding ligand is the same. Embodiment 104. The method of any of embodiments 86-103, wherein each BET binding ligand has Formula IIa or IIb. Embodiment 105. The method of any of embodiments 86-103, wherein each BET binding ligand has Formula I. Embodiment 106. The method of any of embodiments 89-105, wherein the oligomeric agent comprises a branching group. Embodiment 107. The method of embodiment 106, wherein the branching group has a formula selected from: Embodiment 108. The method of embodiment 107, wherein the oligomeric agent comprises a tether. Embodiment 109. The method of embodiment 108, wherein the tether comprises: , wherein n is from 2-10. Embodiment 110. The method of embodiment 108, wherein the tether has a formula selected from: Embodiment 111. The method of any of embodiments 86-110, wherein the oligomeric agent comprises a conjugate moiety selected from:

[0004] . Embodiment 112. The method of any of embodiments 86-111, wherein the modified oligonucleotide consists of 16-24, 16-22, 16-20, 16-18, 18-24, 18-22, 18-20, 18, or 20 linked nucleosides. Embodiment 113. The method of embodiment 112, wherein the modified oligonucleotide consists of 16, 18, or 20 linked nucleosides. Embodiment 114. The method of any of embodiments 86-113, wherein the modified oligonucleotide comprises at least one modified sugar moiety. Embodiment 115. The method of embodiment 114, wherein the modified sugar moiety is a non-bicyclic sugar moiety. Embodiment 116. The method of embodiment 115, wherein the non-bicyclic sugar moiety is selected from the group consisting of 2’-NMA, 2’-O-methoxyethyl, 2’-OMe. Embodiment 117. The method of embodiment 114, wherein the modified sugar moiety is a bicyclic sugar moiety. Embodiment 118. The method of embodiment 117, wherein the bicyclic sugar moiety is selected from the group consisting of 4'-(CH2)-O-2' (LNA); 4'-(CH2)2-O-2' (ENA); and 4'- CH(CH3)-O-2' (cEt). Embodiment 119. The method of any of embodiments 114-118, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. Embodiment 120. The method of embodiment 119, wherein the modified sugar moiety is a non-bicyclic sugar moiety is selected from the group consisting of 2’-NMA, 2’-O- methoxyethyl, 2’-OMe. Embodiment 121. The method of embodiment 114-120, wherein each modified sugar moiety is a 2’- O-methoxyethyl. Embodiment 122. The method of any of embodiments 86-121, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. Embodiment 123. The method of embodiment 122, wherein at least one modified internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage. Embodiment 124. The method of embodiment 123, wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage. Embodiment 125. The method of embodiment 124, wherein each internucleoside linkage of the modified oligonucleotide is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage. Embodiment 126. The method of any of embodiments 86-125, wherein the expression level of the target is increased. Embodiment 127. The method of embodiment 126, wherein the expression level is increased by at least 150%, at least 200%, at least 250%, or at least 300% compared to the expression level in the absence of the oligomeric agent. Embodiment 128. The method of any of embodiments 86-127, wherein the cell is in a subject. Embodiment 129. An oligomeric agent, comprising a modified oligonucleotide and at least one BET binding ligand, wherein the modified oligonucleotide comprises a targeting region that is complementary to a target region of a target nucleic acid. Embodiment 130. The oligomeric agent of embodiment 129, wherein the target region does not comprise a tandem repeat. Embodiment 131. The oligomeric agent of embodiment 129 or 130, wherein the target nucleic acid does not comprise a tandem repeat.

[0005] Embodiment 132. The oligomeric agent of any of embodiments 129-131, wherein the oligomeric agent does not comprise a region having the formula: . Embodiment 133. The oligomeric agent of any of embodiments 129-132, wherein the target nucleic acid is not PVT1, XIST, HSP70, MALAT1, ACTB, SCN1A, or SYNGAP1. Embodiment 134. The oligomeric agent of any of embodiments 129-133,wherein at least one BET binding ligand has Formula IIa: Formula IIa, wherein: Ring A is absent or a 6-membered aryl or heteroaryl ring; Y is -N(H)- or -O-; R1, R2, R3are each independently selected from hydrogen, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; R4is selected from hydrogen, halogen, -NO2, -CN, aryl, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; or R4is -NRARB, wherein RAand RBare each independently selected from hydrogen and C1-C6alkyl; and m is from 1-6. Embodiment 135. The oligomeric agent of embodiment 134, wherein Ring A is absent. Embodiment 136. The oligomeric agent of embodiment 134 or 135, wherein R1, R2, and R3are each methyl. Embodiment 137. The oligomeric agent of any of embodiments 134-136, wherein R4is halogen. Embodiment 138. The oligomeric agent of any of embodiments 134-137, wherein m is 1. Embodiment 139. The oligomeric agent of any of embodiments 134-138, wherein the at least one BET binding ligand has Formula IIb: .Embodiment 140. The oligomeric agent of any of embodiments 134-139, wherien Ring A is absent, R1, R2, and R3are each methyl, R4is halogen, and m is 1. Embodiment 141. The oligomeric agent of any of embodiments 134-140, wherein R4is Cl. Embodiment 142. The oligomeric agent of any of embodiments 134-141, wherein the at least one BET binding ligand has Formula I: . Embodiment 143. The oligomeric agent of any of embodiments 129-142, wherein each BET binding ligand is the same. Embodiment 144. The oligomeric agent of any of embodiments 129-143, wherein each BET binding ligand has Formula IIa or IIb. Embodiment 145. The oligomeric agent of any of embodiments 129-144, wherein each BET binding ligand has Formula I. Embodiment 146. The oligomeric agent of any of embodiments 129-145, wherein the oligomeric agent comprises a branching group. Embodiment 147. The oligomeric agent of embodiment 146, wherein the branching group has a formula selected from: Embodiment 148. The oligomeric agent of embodiment 147, wherein the oligomeric agent comprises a tether. Embodiment 149. The oligomeric agent of embodiment 148, wherein the tether comprises: , wherein n is from 2-10. Embodiment 150. The oligomeric agent of embodiment 148, wherein the tether has a formula selected from: . Embodiment 151. The oligomeric agent of any of embodiments 129-150, wherein the oligomeric agent comprises a conjugate moiety selected from:

[0006] . Embodiment 152. The oligomeric agent of any of embodiments 129-151, wherein the modified oligonucleotide consists of 16-24, 16-22, 16-20, 16-18, 18-24, 18-22, 18-20, 18, or 20 linked nucleosides. Embodiment 153. The oligomeric agent of embodiment 152, wherein the modified oligonucleotide comprises at least one modified sugar moiety. Embodiment 154. The oligomeric agent of embodiment 153, wherein the modified sugar moiety is a non-bicyclic sugar moiety. Embodiment 155. The oligomeric agent of embodiment 154, wherein the non-bicyclic sugar moiety is selected from the group consisting of 2’-NMA, 2’-O-methoxyethyl, 2’-OMe. Embodiment 156. The oligomeric agent of embodiment 155, wherein the modified sugar moiety is a bicyclic sugar moiety. Embodiment 157. The oligomeric agent of embodiment 156, wherein the bicyclic sugar moiety is selected from the group consisting of 4'-(CH2)-O-2' (LNA); 4'-(CH2)2-O-2' (ENA); and 4'- CH(CH3)-O-2' (cEt). Embodiment 158. The oligomeric agent of any of embodiments 153-157, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. Embodiment 159. The oligomeric agent of embodiment 158, wherein the modified sugar moiety is a non-bicyclic sugar moiety is selected from the group consisting of 2’-NMA, 2’- O-methoxyethyl, 2’-OMe. Embodiment 160. The oligomeric agent of embodiment 153-159, wherein each modified sugar moiety is a 2’- O-methoxyethyl. Embodiment 161. The oligomeric agent of any of embodiments 129-160, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. Embodiment 162. The oligomeric agent of embodiment 161, wherein at least one modified internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage. Embodiment 163. The oligomeric agent of embodiment 162, wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage. Embodiment 164. The oligomeric agent of embodiment 162, wherein each internucleoside linkage of the modified oligonucleotide is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage. Embodiment 165. The oligomeric agent of any of embodiments 129-164, wherein the expression level of the target is increased. Embodiment 166. The oligomeric agent of embodiment 165, wherein the expression level of the target is increased by at least 150%, at least 200%, at least 250%, or at least 300% compared to the expression level in the absence of the oligomeric agent. Embodiment 167. The oligomeric agent of any of embodiments 129-166, wherein the oligomeric agent comprises at least 2, at least 3, at least 4, at least 5, or at least 6 BET binding ligands. Embodiment 168. A pharmaceutical composition comprising an oligomeric agent of any of embodiments 129-167. Embodiment 169. A pharmaceutical composition comprising two or more oligomeric agents of any of embodiments 129-168, each comprising a modified oligonucleotide; wherein each modified oligonucleotide comprises a targeting region that is complementary to a target region of the target nucleic acid, and wherein none of the target regions overlap. Embodiment 170. A method of administering an oligomeric agent of any of embodiments 129- 167 or a pharmaceutical composition of embodiment 168 or 169 to a subject. Embodiment 171. A method of modulating the expression of a target nucleic acid in a cell, comprising contacting the cell with a composition comprising two or more oligomeric agents; wherein each oligomeric agent is an oligomeric agent of any of embodiments 129- 167, and wherein each modified oligonucleotide comprises a targeting region that is complementary to a target region of the target nucleic acid, and wherein none of the target regions overlap. Embodiment 172. The method of embodiment 171, wherein the expression level of the target is increased. Embodiment 173. The method of embodiment 172, wherein the expression level is increased by at least 150%, at least 200%, at least 250%, or at least 300% compared to the expression level in the absence of the oligomeric agent. Embodiment 174. The method of any of embodiments 171-173, wherein the cell is in a subject. Certain Methods of Modulation of Gene Expression In certain embodiments, provided herein are methods of modulating gene expression, comprising administering to a cell or subject an oligomeric agent comprising one or more BET binding moieties. In certain embodiments, gene expression is increased. In certain embodiments, the BET binding moiety binds to BRD4. Certain Oligomeric Agents Comprising a Conjugate Moiety In certain embodiments, provided herein are oligomeric agents comprising an oligonucleotide and a conjugate moiety. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the oligonucleotide is an unmodified oligonucleotide. In certain embodiments, oligomeric agents comprise an oligomeric compound, which comprises an oligonucleotide, a conjugate linker, and a BET binding moiety. In certain embodiments, oligomeric agents comprise an oligomeric compound, which consists of an oligonucleotide, a conjugate linker, and a BET binding moiety. The conjugate linker connects the BET binding moiety to the oligonucleotide. In certain embodiments, an oligomeric agent is single- stranded. Such a single-stranded oligomeric agent or antisense agent consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and BET binding moiety linked by a conjugate linker. In certain embodiments, the BET binding moiety comprises a branching group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the oligonucleotide is 12-30 linked nucleosides in length. In certain embodiments, the BET binding moiety attaches at the 5’- terminus of the oligonucleotide. In certain embodiments, the BET binding moiety attaches at the 3’-terminus nucleoside of the oligonucleotide. In certain embodiments, the BET binding moiety attaches at an internal position of the oligonucleotide, for example, at a 2’-position or to an internucleoside linkage. In certain embodiments, the BET binding moiety is a BRD4 binding moiety. certain embodiments, the BET binding moiety is a derivative of JQ1. Certain Oligonucleotides In certain embodiments, provided herein are oligomeric agents comprising oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified nucleic acids. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage. Certain Modified Nucleosides Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase. Certain Sugar Moieties In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties. In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more acyclic substituent, including, but not limited to, substituents at the 2’, 3’, 4’, and / or 5’ positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 2’- position. Examples of substituent groups suitable for the 2’-position of modified sugar moieties include but are not limited to: -F, -OCH3(“OMe” or “O-methyl”), and -OCH2CH2OCH3(“MOE”). In certain embodiments, 2’-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10alkoxy, O-C1-C10substituted alkoxy, O-C1-C10alkyl, O-C1-C10substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O- alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)- N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl, -O(CH2)2ON(CH3)2(“DMAOE”), or 2’-O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”). And the 2’-substituent groups described in Cook et al., U.S.6,531,584; Cook et al., U.S.5,859,221; and Cook et al., U.S.6,005,087 Synthetic methods for some of these 2’-substituent groups can be found in, e.g., Cook et al., U.S. 6,531,584; and Cook et al., U.S.5,859,221. Certain embodiments of these 2’-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, a 2’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, NH2, N3, OCF3,OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl. In certain embodiments, a 2’-substituted sugar moiety of a modified nucleoside comprises 2’- substituent group selected from: F, OCF3,OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2(“DMAOE”), O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”), and OCH2C(=O)-N(H)CH3(“NMA”). In certain embodiments, a 2’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3(“NMA”). In certain embodiments, a 2’-substituted sugar moiety of a modified nucleoside comprises 2’- substituent group selected from: F, OCH3, and OCH2CH2OCH3. In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, a 2’- deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring β-D- deoxyribosyl configuration. Such modified sugar moieties are described in, e.g., WO2020 / 072991. A 2’- modified sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations. Modified furanosyl sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified. In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 4’- position. Examples of substituent groups suitable for the 4’-position of modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 3’- position. Examples of substituent groups suitable for the 3’-position of modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl). In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 5’- position. Examples of substituent groups suitable for the 5’-position of modified sugar moieties include, but are not limited to, vinyl, alkoxy (e.g., methoxy), and alkyl (e.g., methyl (R or S), ethyl). In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2’-F-5’-methyl sugar moieties, such as described in Migawa et al., US2010 / 0190837, or alternative 2’- and 5’-modified sugar moieties as described in Rajeev et al., US2013 / 0203836. In naturally occurring nucleic acids, sugars are linked to one another 3’ to 5’. In certain embodiments, oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2’ position or inverted 5’ to 3’. For example, where the linkage is at the 2’ position, the 2’-substituent groups may instead be at the 3’-position. Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 4’ and the 2’ furanose ring atoms. Examples of such 4’ to 2’ bridging sugar substituents include, but are not limited to: 4’-CH2-2’, 4’-(CH2)2-2’, 4’-(CH2)3-2’, 4’-CH2-O-2’ (“LNA”), 4’- CH2-S-2’, 4’-(CH2)2-O-2’ (“ENA”), 4’-CH(CH3)-O-2’ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH2-O-CH2-2’, 4’-CH2-N(R)-2’, 4’-CH(CH2OCH3)-O-2’ (“constrained MOE” or “cMOE”) and analogs thereof, 4’-C(CH3)(CH3)-O-2’ and analogs thereof, 4’-CH2-N(OCH3)-2’ and analogs thereof , 4’-CH2-O-N(CH3)-2’ , 4’-CH2-C(H)(CH3)-2’, 4’-CH2-C(=CH2)-2’ and analogs thereof ), 4’-C(RaRb)-N(R)-O-2’, 4’-C(RaRb)-O-N(R)-2’, 4’-CH2-O-N(R)-2’, and 4’-CH2-N(R)-O-2’, wherein each R, Ra, and Rbis, independently, H, a protecting group, or C1-C12alkyl. Representative U.S. patents that teach the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi et al., U.S.7,427,672; Swayze et al., U.S.7,741,457, and Swayze et al., U.S.8,022,193; Seth et al., U.S.8,278,283; Prakash et al., U.S.8,278,425; Seth et al., U.S.8,278,426). In certain embodiments, such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, - C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and -N(Ra)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Raand Rbis, independently, H, a protecting group, hydroxyl, C1-C12alkyl, substituted C1-C12alkyl, C2-C12alkenyl, substituted C2-C12alkenyl, C2-C12alkynyl, substituted C2-C12alkynyl, C5-C20aryl, substituted C5-C20aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7alicyclic radical, substituted C5-C7alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)- H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each J1and J2is, independently, H, C1-C12alkyl, substituted C1-C12alkyl, C2-C12alkenyl, substituted C2-C12alkenyl, C2-C12alkynyl, substituted C2-C12alkynyl, C5-C20aryl, substituted C5-C20aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12aminoalkyl, substituted C1-C12aminoalkyl, or a protecting group. Additional bicyclic sugar moieties are known in the art, see, for example: Wan, et al., J. Medicinal Chemistry, 2016, 59, 9645-9667; Wengel et al., U.S.8,080,644; Ramasamy et al., U.S.6,525,191; Seth et al., U.S.7,547,684; and Seth et al., U.S.7,666,854. In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration. α-L-methyleneoxy (4’-CH2-O-2’) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365- 6372). The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185- 3193). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified. In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5’-substituted and 4’-2’ bridged sugars). In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'- position and / or the 5’ position. In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”), fluoro HNA: (“F-HNA”, see e.g., Elgi, et. al., J Am Chem (2011) 133(41):16642-16649, Swayze et al., U.S.8,088,904; and Swayze et al., U.S.8,440,803) F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran, and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of said modified THP nucleoside: Bx is a nucleobase moiety; T3and T4are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3and T4is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3and T4is H, a hydroxyl protecting group, a linker, or a 5' or 3'-terminal group; q1, q2, q3, q4, q5, q6and q7are each, independently, H, C1-C6alkyl, substituted C1-C6alkyl, C2-C6alkenyl, substituted C2-C6alkenyl, C2-C6alkynyl, or substituted C2-C6alkynyl; and each of R1and R2is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, wherein X is O, S or NJ1, and each J1, J2, and J3is, independently, H or C1-C6alkyl. In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6and q7are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6and q7is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6and q7is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1and R2is F. In certain embodiments, R1is F and R2is H, in certain embodiments, R1is methoxy and R2is H, and in certain embodiments, R1is methoxyethoxy and R2is H. In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported. As used here, the term “morpholino” means a sugar surrogate having the following structure: In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.” In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid ), and nucleosides and oligonucleotides described in Manoharan et al., U.S.10,913,767. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos.5,539,082; 5,714,331; and 5,719,262. In certain embodiments, sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides. UNA is a nucleoside wherein any of the bonds of the sugar moiety has been removed, forming an unlocked sugar surrogate. A representative U.S. publication that teaches the preparation of UNA includes, but is not limited to, US Patent Publication No 2011 / 0313020. In certain embodiments, sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides as depicted below: (S)-GNA where Bx represents any nucleobase. Many other bicyclic and tricyclic sugar and sugar surrogates are known in the art that can be used in modified nucleosides. Certain Modified Nucleobases In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). An “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A 5-methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. In certain embodiments, modified adenine has structure (I): wherein: R2Ais H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6thioalkyl, or substituted C1-C6thioalkyl, C1-C6alkyloxy, or substituted C1-C6alkyloxy; R6Ais H, OH, N(Ra)(Rb), acetyl, formyl, or O-phenyl; Y7Ais N and R7Ais absent or is C1-C6alkyl; or Y7Ais C and R7Ais selected from H, C1-C6alkyl, or CN(Ra)(Rb); Y8Ais N and R8Ais absent, or Y8Ais C and R8Ais selected from H, a halogen, OH, C1-C6alkyl, or substituted C1-C6alkyl; Raand Rbare independently selected from H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, formyl, or together form a 5-7-membered heterocycle; excluding where Y7Ais N; Y8Ais C, R8Ais H, R2Ais H, and R6Ais NH2(unmodified adenine). In certain embodiments, modified guanine has structure (II): II wherein: R2Gis N(Ra)(Rb); R6Gis oxo and R1Gis H, or R6Gis selected from O-C1-C6alkyl or S-C1-C6alkyl and R1Gis absent; Y7Gis N and R7Gis absent or is C1-C6alkyl; or Y7Gis C and R7Gis selected from H, C1- C6alkyl, or CN(Ra)(Rb); Y8Gis N and R8Gis absent, or Y8Gis C and R8Gis selected from H, a halogen, OH, C1- C6alkyl, or substituted C1-C6alkyl; Raand Rbare independently selected from H, C1-C6alkyl, substituted C1- C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, formyl, or together form a 5-7-membered heterocycle; excluding where Y7Gis N; Y8Gis C, R8Gis H, R2Gis NH2, and R6Gis =O (unmodified guanosine). In certain embodiments, modified thymine or modified uracil has structure (III): III wherein: X is selected from O or S and R5Uis selected from H, OH, halogen, O-C1-C12alkyl, O-C1-C12substituted alkyl, C1-C12alkyl , substituted C1-C12alkyl, C1-C12alkenyl, substituted C1-C12alkenyl; wherein if each X is O, R5Uis not H or CH3(unmodified uracil and unmodified thymine, respectively). In certain embodiments, modified cytosine has structure (IV): IV wherein: X is selected from O or S, R4Cis N(Ra)(Rb); R5Cis selected from H, OH, halogen, O-C1-C12alkyl, O-C1-C12substituted alkyl, C1-C12alkyl , substituted C1-C12alkyl, C1-C12alkenyl, substituted C1-C12alkenyl; Raand Rbare independently selected from H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, formyl, or together form a 5-7-membered heterocycle; excluding where X is O, R4Cis NH2and R5Cis H (unmodified cytosine). In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6- azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, 2- aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N- methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- propynyl (-C^C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), N1-methylpseudouracil, 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo (particularly 5-bromo), 5-trifluoromethyl, 5-halouracil, and 5- halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7- deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N- benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza- adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163- 166 and 442-443. Publications that teach the preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases include without limitation, Rogers et al., U.S.5,134,066 ; Benner et al., U.S. 5,432,272; Matteucci et al., U.S.5,502,177 ; Froehler et al., U.S.5,594,121 ; and Cook et al., U.S.5,681,941. Certain Modified Internucleoside Linkages The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, nucleosides of modified oligonucleotides may be linked together using one or more modified internucleoside linkages. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, which contain a phosphodiester bond (“P=O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-O-C(=O)(NH)-S-); siloxane (- O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphodiester internucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art. In certain embodiments, a modified internucleoside linkage is any of those described in WO2021 / 030778, incorporated by reference herein. In certain embodiments, a modified internucleoside linkage comprises the formula: wherein independently for each such internucleoside linking group of a modified oligonucleotide: X is selected from O or S; R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and T is selected from SO2R2, C(=O)R3, and P(=O)R4R5, wherein: R2is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C1-C6alkoxy, C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, substituted C1-C6alkyl, substituted C1-C6alkenyl substituted C1-C6alkynyl, and a linker; R3is selected from an aryl, a substituted aryl, CH3, N(CH3)2, OCH3and a linker; R4is selected from OCH3, OH, C1-C6alkyl, substituted C1-C6alkyl and a linker; and R5is selected from OCH3, OH, C1-C6alkyl, and substituted C1-C6alkyl. In certain embodiments, a modified internucleoside linkage is any of those described in WO2016 / 028187, incorporated by reference herein. In certain embodiments, a modified internucleoside linkage comprises the formula: ; wherein independently for each such internucleoside linking group of a modified oligonucleotide: Z is selected from O, S, Se, C1-4alkyl, NH, BH3; R1and R2are independently selected from H, NR1AR1B, OR3, SR3, S(O)H, S(O)R3, S(O)2H, S(O)2R3, S(O)2NH2, S(O)2NHR3, S(O)2N(R3)2, C1-C10 alkyl, C2-C10 alkenyl, C2-C10 alkynyl, C6-C10 aryl; or R wherein each R1A, R1B, R2A, and R2Bis independently selected from H, C1-C10alkyl, C2-C10alkenyl, C2-C10 alkynyl, or C6-C10 aryl; and R3is selected from C1-C10 alkyl, C2-C10 alkenyl, C2-C10 alkynyl, or C6-C10 aryl. In certain embodiments, a modified internucleoside linkage comprises a modified linking group having a formula: wherein independently for each such internucleoside linking group of a modified oligonucleotide: Z is selected from O, S, Se, C1-4alkyl, NH, BH3; R1, R2, R3, and R4 are each independently selected from H, C1-C10 alkyl, C2-C10 alkenyl, C2- C10 alkynyl, or C6-C10 aryl; or R1and R3are each C(J)2and together form a 5-membered ring and / or R2and R4are each C(J)2and together form a 5-membered ring; or R1 and R2 are each C(J)2 and together form a 5-membered ring; wherein J is selected from H, C1-C10alkyl, C2-C10alkenyl, C2-C10alkynyl, or C6-C10aryl. In certain embodiments, a modified internucleoside linkage comprises a linking group having a formula: . In certain embodiments, a modified internucleoside linkage comprises a mesyl phosphoramidate linking group having a formula: . In certain embodiments, a mesyl phosphoramidate internucleoside linkage may comprise a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

[0007] . Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising such internucleoside linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, populations of modified oligonucleotides comprise mesyl phosphoramidate internucleoside linkages wherein all of the mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each internucleoside linkage having a chiral center. Nonetheless, each individual internucleoside linkage having a chiral center of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate and / or mesyl phosphoramidate internucleoside linkages, each independently in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res.42, 13456 (2014), and WO 2017 / 015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate and / or mesyl phosphoramidate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate and / or mesyl phosphoramidate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase: Unless otherwise indicated, internucleoside linkages having chiral centers of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration. Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2component parts. In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside, as shown below:

[0008] , wherein each Bx independently represents any nucleobase. In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage depicted above will be present. In certain such embodiments, additional features (such as a linker) may be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide. In certain embodiments, nucleic acids can be linked 2’ to 5’ rather than the standard 3’ to 5’ linkage. Such a linkage is illustrated below , wherein each Bx represents any nucleobase. Certain Motifs In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and / or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases). Certain Sugar Motifs In certain embodiments, oligonucleotides comprise one or more type of modified sugar and / or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein. In certain embodiments, each nucleoside of a modified oligonucleotide, or portion thereof, comprises a 2’-substituted sugar moiety, a bicyclic sugar moiety, a sugar surrogate, or a 2’-deoxyribosyl sugar moiety. In certain embodiments, the 2’-substituted sugar moiety is selected from a 2’-MOE sugar moiety, a 2’-NMA sugar moiety, a 2’-OMe sugar moiety, and a 2’-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from morpholino, modified morpholino, PNA, THP, and F-HNA. In certain embodiments, modified oligonucleotides comprise at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleosides comprising a modified sugar moiety. In certain embodiments, the modified sugar moiety is selected independently from a 2’-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2’-substituted sugar moiety is selected from a 2’-MOE sugar moiety, a 2’-NMA sugar moiety, a 2’-OMe sugar moiety, and a 2’-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from morpholino, modified morpholino, THP, and F-HNA. RNAse H Agents In certain embodiments, modified oligonucleotides comprise a deoxy region. In certain embodiments, each nucleoside of the deoxy region comprises a 2’-β-D-deoxyribosyl sugar moiety. In certain embodiments, the deoxy region consists of 5-12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. In certain embodiments, at least one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides within the deoxy region comprise a modified sugar moiety. In certain embodiments, exactly one nucleoside within the deoxy region comprises a modified sugar moiety, and the remainder of the nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, the modified sugar moiety is a 2’-OMe sugar moiety. In certain embodiments, the deoxy region is flanked on the 5’-side by a 5’-region consisting of linked 5’-region nucleosides and on the 3’-side by a 3’-region consisting of linked 3’-region nucleosides; wherein the 3’-most nucleoside of the 5’-region is a modified nucleoside and the 5’-most nucleoside of the 3’-region is a modified nucleoside. At least one nucleoside of the 5’-region comprises a modified sugar moiety; and at least one nucleoside of the 3’-region comprises a modified sugar moiety. The three regions (the 5’-region, the deoxy region, and the 3’-region) form a contiguous sequence of nucleosides. In certain embodiments, such modified oligonucleotides are referred to as “gapmers”. In certain embodiments, the sugar moiety of the 3’- most nucleoside of the 5’-region and the sugar moiety of the 5’-most nucleoside of the 3’-region each differ from the sugar moiety of the respective adjacent nucleoside of the deoxy region, thus defining the boundary between the 5’-region, the deoxy region, and the 3’-region. In certain embodiments, each nucleoside of the 5’-region and each nucleoside of the 3’-region comprises a modified sugar moiety. In certain embodiments, the nucleosides within the 5’-region comprise the same sugar modification. In certain embodiments, the nucleosides within the 5’-region comprise two or more different sugar modifications. In certain embodiments, the nucleosides within the 3’-region comprise the same sugar modification. In certain embodiments, the nucleosides within the 3’-region comprise two or more different sugar modifications. In certain embodiments, the 5’-region and the 3’-region of a modified oligonucleotide each comprises 1-8 nucleosides. In certain embodiments, the 5’-region comprises 1-7 nucleosides. In certain embodiments, the 5’-region comprises 1-6 nucleosides. In certain embodiments, the 5’-region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 3’-region comprises 1-7 nucleosides. In certain embodiments, the 3’-region comprises 1-6 nucleosides. In certain embodiments, the 3’-region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 5’-region and the 3’-region each comprise a modified sugar moiety. In certain embodiments, the deoxy region is 10 nucleosides, with each nucleoside comprising a 2’-β-D- deoxyribosyl sugar moiety. In certain such embodiments, the 5’-region and the 3’-region each comprise exactly three bicyclic nucleosides (A “3-10-3 BNA gapmer”). In certain embodiments, each BNA is a cEt (a “3-10-3 cEt gapmer”, or each BNA is an LNA (a “3-10-3 LNA gapmer”). In certain alternative embodiments, the 5’-region and the 3’-region each comprise exactly five MOE nucleosides (A “5-10-5 MOE gapmer”). In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2’-modification. Certain Nucleobase Motifs In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5’-end of the oligonucleotide. In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2’-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine. Certain Internucleoside Linkage Motifs In certain embodiments, oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs. Certain Lengths It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches. In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence. Certain Populations of Modified Oligonucleotides Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration. Nucleobase Sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid. Oligomeric Duplexes In certain embodiments, oligomeric agents described herein comprise an oligomeric compound comprising an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound Antisense Activity In certain embodiments, oligomeric agents described herein comprise or consist of modified oligonucleotides. In certain embodiments, agents described herein are antisense agents. In certain embodiments, oligomeric agents comprise oligomeric compounds. In certain embodiments, oligomeric compounds or modified oligonucleotides described herein are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and modified oligonucleotides are antisense agents. In certain embodiments, oligomeric agents described herein selectively affect one or more target nucleic acid. Such oligomeric agents comprise an oligonucleotide that comprises a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity. For example, certain oligonucleotides described herein result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, oligonucleotides described herein comprise a deoxy region that is sufficiently “DNA-like” to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the deoxy region is tolerated. In certain antisense activities, compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA). In certain embodiments, hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid, or modulation of expression of the target nucleic acid. Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a phenotypic change in a cell or subject. Certain Target Nucleic Acids In certain embodiments, antisense agents comprise oligomeric compounds, which comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre- mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is the RNA transcriptional product of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule. Complementarity / Mismatches to the Target Nucleic Acid In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length. It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti- tumor activity in vivo. Maher and Dolnick (Nucleic Acids Res.16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and a 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides. In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. Certain Conjugated Compounds In certain embodiments, the oligomeric agents described herein comprise or consist of an oligonucleotide (modified or unmodified) and one or more conjugate groups and / or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and / or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and / or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’-end of oligonucleotides. Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified. Certain conjugate groups include peptides or proteins. Certain reactions that are compatible with both oligonucleotide and peptide chemistry have been previously described and are often called “bioconjugation” reactions. These reactions include strain promoted azide-alkyne cycloaddition (SPAAC), copper-catalyzed azide-alkyne click reaction (CuAAC), active ester conjugation to an amino modified oligonucleotide, maleimide-thiol Michael addition, ketol / hydroxylamine ligation, the Staudinger ligation, reductive amination, thioether formation, disulfide formation, reductive alkylation, catalyst-free N-arylation, sulfur fluoride exchange click reaction (SuFEx), and inverse demand Diels-Alder reaction. Certain such reactions are described in, e.g., Jbara, et al., “Oligonucleotide Bioconjugation with Bifunctional Palladium Reagents”, Angew. Chem. Int. Ed.2021, 60(21)12109-12115; Dong, et al., “Sulfur(VI) Fluoride Exchange (SuFEx): Another Good Reaction for Click Chemistry,” Agnew. Chem. Int. Ed.2014, 53(36):9430-9448.4; Zhang, et al., “Arylation Chemistry for Bioconjugation,” Agnew. Chem. Int. Ed. Engl.2019; 58(15): 4810–4839; Walsh, et al., “Site-selective modification strategies in antibody-drug conjugates” Chem. Soc. Rev., 2021, 50: 1305-1353; Tiefenbrunn, et al., “Chemoselective ligation techniques: modern applications of time-honored chemistry”, Biopolymers, 2010, 94(1):95-106; Drake, et al., Bioconjug. Chem.2014, 25(7):1331-1341; Bode, Acc. Chem. Res., 2017, 50, 9, 2104–2115; J. Magano, B. Bock, et al, Org. Proc. Res. Dev.2014, 18:142-151; Craig S. McKay and M.G. Finn, “Click Chemistry in Complex Mixtures: Bioorthogonal Bioconjugation”, Chemistry & Biology 2014; Mitchell P. Christy et al., Org. Lett.2020, 22: 2365; Ren et al., Angew. Chem. Int. Ed. Engl.2009, 48, 9658–9662; Rohrbacher, F. et al., Helv. Chim. Acta.2018, 101; Baalmaan, et al, “A Bioorthogonal Click Chemistry Toolbox for Targeted Synthesis of Branched and Well-Defined Protein– Protein Conjugates”, Angew. Chem. Int. Ed.2020 (59): 12885-12893; Lang, et al, “Biorthogonal Reactions for Labeling Proteins”, J. Am. Chem. Soc, 2014, 9(1):16-20; Nair, et al., “The Thiol-Michael Addition Click Reaction: A Powerful and Widely Used Tool in Materials Chemistry”, Chem. Mater.201326(1):724-744; Kalia and Raines, “Hydrolytic Stability of Hydrazones and Oximes”, Angew. Chem. Int. Ed., 2008, 47:7523- 7526. Certain Protein Binding Conjugate Groups In certain embodiments, a conjugate group comprises a protein binding conjugate moiety. In certain embodiments, a conjugate group has the general formula: wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0. In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, conjugate groups comprise conjugate moieties that have at least one tethered ligand. In certain embodiments, conjugate moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, conjugate moieties comprise three tethered ligands covalently attached to a branching group. In certain embodiments, a conjugate moiety comprises a branching group comprising one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain embodiments, the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl and ether groups. In certain embodiments, the branching group comprises a mono or polycyclic ring system. In certain embodiments, a branching group has one of the following Formulas: In certain embodiments, each tether of a conjugate moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amid, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group. In certain embodiments, each tether comprises a chain from about 6 to about 20 atoms in length. In certain embodiments, each tether comprises a chain from about 10 to about 18 atoms in length. In certain embodiments, each tether comprises about 10 atoms in chain length. Certain Ligands In certain embodiments, a ligand is a protein binding moiety. In certain embodiments, a ligand is a BET binding moiety. The BET (Bromodomain and Extra-Terminal Domain) family of proteins have two tandem bromodomains and an extra-terminal domain. The mammalian BET family of proteins includes the transcriptional regulators BRD2, BRD3, BRD4, and BRDT. The acetyl-lysine binding site of the BET family proteins is highly conserved, and ligands often bind to more than one BET family protein with varying affinities. In certain embodiments, a BET binding ligand is derived from JQ1 (see Filippakapoulos, et al, Nature, 2010). JQ1 binds to all BET family proteins with varying affinities, and is believed to have the strongest binding to BRD4. In certain embodiments, a BET binding ligand comprises a structure having Formula I . Formula I In certain embodiments, a BET binding ligand comprises a structure having Formula IIa or Formula IIb: Formula IIa Formula IIb; wherein Ring A is absent or a 6-membered aryl or heteroaryl ring; Y is -N(H)- or -O-; R1, R2, R3are each independently selected from hydrogen, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; R4is selected from hydrogen, halogen, -NO2, -CN, aryl, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; or R4is -NRARB, wherein RAand RBare each independently selected from hydrogen and C1-C6alkyl; and m is from 1-6. In certain embodiments, a BET binding ligand comprises a structure having Formula IIIa or Formula IIIb: Formula IIIa Formula IIIb; wherein Ring B is absent or a 5-6-membered aryl or heteroaryl ring or a 4-8 membered heterocycle; Y is -N(H)- or -O-; R5and R6are each independently selected from hydrogen, C1-C6alkyl, C1-C6alkoxy, C1-C6haloalkyl, or C1- C6hydroxyalkyl; R7is selected from hydrogen, halogen, -NO2, -CN, aryl, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; or R4is -NRARB, wherein RAand RBare each independently selected from hydrogen and C1-C6alkyl; and n is from 1-6. In certain embodiments, a BET binding ligand comprises a structure having Formula IVa or IVb: In certain embodiments, a BET binding ligand comprises a structure having Formula Va or Vb: . Formula Va Formula Vb. In certain embodiments, a BET binding ligand comprises a structure having Formula VIa or VIb: . Formula VIa Formula VIb. In certain embodiments, a BET binding ligand comprises a structure having Formula VIIa or VIIb: . Formula VIIa Formula VIIb In certain embodiments, a BET binding ligand comprises a structure having Formula VIIIa or VIIIb: . Formula VIIIa Formula VIIIb In certain embodiments, a BET binding ligand comprises a structure having Formula IXa or IXb: In certain embodiments, a BET binding ligand comprises a structure having Formula Xa or Xb: . In certain embodiments, a BET binding ligand comprises a structure having Formula XI: Formula XI; wherein: R8and R10are each independently selected from alkoxy, alkyl, amino, halogen, and hydrogen; R9is selected from alkoxy, alkyl, alkenyl, alkynyl, amide, amino, halogen, and hydrogen; R11and R12are each independently selected from alkyl, alkoxy, amino, halogen, and hydrogen; if R8is hydrogen, then R10is alkoxy; if R10is hydrogen, then R8is selected from amino and alkoxy; and at least one of R11and R12is independently selected from alkyl, alkoxy, amino, and halogen. In certain embodiments, a BET binding ligand comprises a structure having Formula XII: Formula XII. In certain embodiments, a BET binding ligand comprises a structure having Formula XIII: Formula XIII; wherein: ring C is absent or monocyclic 6-membered aryl or heteroaryl; X is CH or N; L is -N(RA)- or -C(HRA); RAis hydrogen or C1-C3alkyl; R13is C1-C6alkyl or C3-C6cycloalkyl; and R14is halogen, hydrogen, optionally substituted C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl. In certain embodiments, a BET binding ligand comprises a structure having Formula XIII wherein Ring C is: . In certain embodiments, a BET binding ligand comprises a structure having Formula XIV or In certain embodiments, a BET binding ligand comprises: In certain embodiments, a BET binding ligand is derived from any of the following compounds:

[0009] remainder of the conjugate group, based on the crystal structures of each compound bound to BRD4 (see Ember, et al., ACS Chem. Biol., 2014). Where more than one “X” is shown, for any given BET binding ligand, only one such “X” is an attachment point to the remainder of the conjugate group, and each remaining X is absent or H. In certain embodiments, a BET binding ligand has Formula X: , Formula X wherein ring D is a monocyclic 5 or 6-membered aryl or heteroaryl; each of R15, R16, R17, is selected from H, a halogen, C1-C6 alkyl, isopropyl, or one of R15, R16, R17is a 5-membered heterocycle and the other R15, R16, R17are H. In certain embodiments, a BET binding ligand is any of those described in WO2021 / 158707; WO2017 / 172914; or WO2018 / 183679; or is derived from any BET binding compound described in Filippakapoulos, et al, Nature, 2010; Ember, et al., ACS Chem. Biol., 2014; Ayoub, et al., J. Med. Chem., 2017; Yang, et al., ACS Med. Chem. Lett.2019; Gilan, et al., Science, 2020; Cui et al., Angew. Chem. Int. Ed., 2021; Wellaway, J. Med. Chem., 2020; or Wahi, et al., Biorg. Chem., 2023. Certain Conjugate Moieties In certain embodiments, conjugate groups comprise a conjugate moiety having the formula:

[0010] In certain embodiments, conjugate groups comprise a conjugate moiety having the formula: . Certain Conjugate linkers In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group. In certain embodiments, linkers are bifunctional linking moieties, e.g., those known in the art to be useful for attaching two larger molecules to each other. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to react with a particular site on one of the two molecules and the other is selected to react with a particular site on the second molecule. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl. Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1- C10alkyl, substituted or unsubstituted C2-C10alkenyl or substituted or unsubstituted C2-C10alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, the linker comprises a polyethylene glycol (PEG) moiety. In certain embodiments, the linker comprises a PEG of 1-1000 ethylene glycol units, wherein each unit is . In certain embodiments, the linker comprises 1-10 ethylene glycol units. A linker may comprise a cleavable moiety. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable moiety is selected from among: an amide, an ester, an ether, a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphodiester linkage between an oligonucleotide and another chemical moiety attached at the 3’ or 5’-end of the oligonucleotide. Compositions and Methods for Formulating Pharmaceutical Compositions Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, a pharmaceutical composition comprises a compound described herein and a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more compound described herein. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound described herein and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound described herein and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compound described herein and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more compound described herein and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. Pharmaceutical compositions comprising compounds described herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to a subject, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Certain embodiments are drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. Non-limiting disclosure and incorporation by reference While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each reference recited herein, including but not limited to scientific literature, patent publications, GenBank accession numbers, and the like is incorporated by reference in its entirety. The sequence listing accompanying this filing identifies each nucleic acid sequence as either “RNA” or “DNA” as required; however, one of skill in the art will readily appreciate that designation of “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (5-methyl uracil) in place of an uracil of RNA); and certain nucleic acid compounds described herein comprise one or more nucleosides comprising modified sugar moieties having 2’- substituent(s) that are neither OH nor H. One of skill in the art will readily appreciate that labeling such nucleic acid compounds “RNA” or “DNA” does not alter or limit the description of such nucleic acid compounds. Herein, the description of compounds as having “the nucleobase sequence of” a SEQ ID NO. describes only the nucleobase sequence of such compounds, independent of any additional annotation present in the sequence listing. Accordingly, such description of compounds by reference to a nucleobase sequence of a SEQ ID NO. does not limit sugar or internucleoside linkage modifications; and further, includes modified unmodified and nucleobases as described herein. For example, “A” represents unmodified or modified adenine; “C” represents unmodified or modified cytosine, “T” represents unmodified or modified thymidine, “U” represents unmodified or modified uracil, and “G” represents unmodified or modified guanine. Herein, the description of compounds by chemical notation (subscripts and / or superscripts to indicate chemical modifications) without reference to a specific Compound No. include each noted modification and may include additional modifications, unless otherwise indicated. For example, the chemical notation of “AesTkomCezGdsC” indicates a compound wherein the first nucleoside comprises a 2’-MOE sugar moiety (indicated by the “e” subscript) and a modified or unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the “s” subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the “k” subscript) and a modified or unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester linkage (indicated by the “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mesylphosphoramidate linkage (indicated by the “z” subscript); the fourth nucleoside comprises a DNA sugar moiety (indicated by the “d” subscript) and a modified or unmodified guanine nucleobase linked to the fifth nucleoside with a phosphorothioate linkage; and the fifth nucleoside comprises a DNA sugar moiety and a modified or unmodified cytosine nucleobase; and the compound may include additional substituents, such as a conjugate group. Herein, where a specific compound (e.g., with reference to a Compound No.) is described (as in the examples) by chemical notation, each nucleobase, sugar, and internucleoside linkage of such specific compound is assumed to be unmodified, except where otherwise indicated. Accordingly, in the context of a description of a specific compound having a particular Compound No., “AesTkomCezGdsCd” indicates a compound wherein the first nucleoside comprises a 2’-MOE sugar moiety (indicated by the “e” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the “s” subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the “k” subscript) and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester linkage (indicated by the “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mesylphosphoramidate linkage (indicated by the “z” subscript); the fourth nucleoside comprises a DNA sugar moiety (indicated by the “d” subscript) and an unmodified guanine nucleobase linked to the fifth nucleoside with a phosphorothioate linkage; and the fifth nucleoside comprises a DNA sugar moiety and an unmodified cytosine nucleobase; and the compound does not include additional substituents. Herein, sugar, internucleoside linkage, and nucleobase modifications may be indicated within a nucleotide or nucleobase sequence (e.g., by superscript or subscript, as shown above) or may be indicated in text accompanying a sequence (e.g., in separate text that appears within or above or below a table of compounds). Herein, certain specific compounds, including oligonucleotides, are described by way of a drawn chemical structure. One of skill will appreciate that drawn compounds may exist in equilibrium between tautomeric forms and / or as salts in equilibrium with protonated or ionic forms. Drawn structures are intended to capture all such forms of such compounds. While effort has been made to accurately describe compounds in the accompanying sequence listing, should there be any discrepancies between a description in this specification and in the accompanying sequence listing, the description in the specification and not in the sequence listing is the accurate description. Unless otherwise indicated, any compound, including oligomeric compounds, described herein includes a pharmaceutically acceptable salt thereof. Compounds described herein include variations in which one or more atoms are replaced with a non- radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to:2H or3H in place of1H,13C or14C in place of12C,15N in place of14N,17O or18O in place of16O, and33S,34S,35S, or36S in place of32S. EXAMPLES Example 1: Design of uniform MOE modified oligonucleotides conjugated to JQ1 at the 5′-end Modified oligonucleotides were designed and synthesized as described below, then conjugated to JQ1 through a linker a the 5’-end of the oligonucleotide. The JQ1 conjugate has Formula I: Formula I. The modified oligonucleotides in the table below are 20 nucleotides in length, and are uniform MOE modified oligonucleotides with uniform. phosphorothioate internucleoside linkages, wherein each cytosine is a 5-methylcytosine. Compound No.699816 has a 6-aminohexyl phosphoryl group conjugated to the 5′ end. The compounds in the table below are complementary to human SMN. Table 1 20-mer uniform MOE modified oligonucleotides with uniform phosphorothioate internucleoside linkages In the table above, each “e” represents a 2′-MOE sugar moiety, each “s” represents a phosphorothioate internucleoside linkage, and each cytosine is a 5-methylcytosine. The modified oligonucleotides in the table below are 16 nucleotides in length, and are uniform MOE modified oligonucleotides with uniform phosphorothioate internucleoside linkages, wherein each cytosine is a 5-methylcytosine, and are complementary to human ACTN1. Compound No.1770887 has a 6-aminohexyl phosphoryl group conjugated to the 5′ end. Table 2 16-mer uniform MOE modified oligonucleotides with uniform phosphorothioate internucleoside linkages In the table above, each “e” represents a 2′-MOE sugar moiety, each “s” represents a phosphorothioate internucleoside linkage, and each cytosine is a 5-methylcytosine. Conjugation of JQ1 to the 5′ end of modified oligonucleotides To a solution of Compound No.699816 (5 µmol, 1 eq.) dissolved in 0.2 M pH 8.5 borate buffer (1 mL) and DMSO (1 mL) was added a solution of Fmoc-PEG6-NHS ester (18 mg, 26.7 µmol, ~5 eq.) dissolved in DMSO (0.5 mL). The reaction mixture was stirred at room temperature, with reaction monitoring by LC-MS. After 30 minutes, full conversion to the Fmoc-PEG6-ylated product was observed. The reaction mixture was then treated with piperidine (250 µL, 500 eq.) and stirred at room temperature, with reaction monitoring by LC-MS. After 30 minutes, complete removal of the Fmoc group was observed, and the cloudy solution was filtered through an Acrodisc syringe filter to remove precipitate. The filtrate, containing crude product, was then purified by ion-exchange (IEX) HPLC using Gilson IEX resin in a gradient of 0% to 40% mobile phase B (100 mM bicarbonate buffer, 1.5 M NaBr in 30% aq. MeCN) in mobile phase A (100 mM bicarbonate buffer in 30% aq. MeCN). The purified compound was desalted by standard RP HPLC and lyophilized to give Compound No.699816-PEG (75% yield). JQ1 carboxylic acid (7.5 mg, 18.7 µmol, 5 eq.) was dissolved in DMF (0.5 mL), followed by DIPEA (5.1 µL, 29.5 µmol 7.5 eq.) and pentafluoro phenol-trifluoroacetate (PFPTFA, 3.21 µL, 18.7 µmol 5 eq.). The reaction mixture was incubated at room temperature, and the in situ activation of the carboxylic acid was monitored by LC-MS. After the carboxylic acid starting material was consumed, the JQ1 activated ester was added to a resuspended solution of Compound No.699816-PEG (3.75 µmol, 1 eq.) in 0.2 M borate buffer pH 8.5 (1 mL). The reaction was stirred at room temperature and monitored by LC-MS. After 30 minutes, the crude reaction was purified by IEX-HPLC using Gilson IEX resin, in a gradient of 0% to 40% mobile phase B (100 mM bicarbonate buffer, 1.5 M NaBr in 30% aq. MeCN) in 100% mobile phase A (100 mM bicarbonate buffer in 30% aq. MeCN). The purified compound was desalted by standard RP HPLC and lyophilized to give the 5′ JQ1-conjugated modified oligonucleotide Compound No.1784168 (80% yield). Compound No.1784167 is a modified oligonucleotide targeted to ACTN1 conjugated at the 5′ end to JQ1 and was synthesized from Compound No.1770887 in the same manner as described above. Example 2: Design of GFP and BFP reporters for proof-of-concept experiments Reporter constructs containing sites complementary to modified oligonucleotides fused to GFP or BFP were designed to evaluate the ability of a JQ1-conjugated modified oligonucleotide to recruit endogenous BRD4 and activate transcription of GFP or BFP. GFP reporter constructs were designed comprising a CMV promoter, sites that are complementary to a modified oligonucleotide, and GFP. Sequences complementary to a modified oligonucleotide described above were inserted at 1, 2, 4, 6, or 8 sites in the g-block of the 5′ UTR of β-globin (Leppek et al., Nat. Commun.2022, 13, 1536), which was then cloned into pCMV6-AC-GFP Mammalian Expression Vector (Origene Catalog# PS100010). The target sequence for modified oligonucleotides complementary to SMN1 is CCAGCATTATGAAAGTGAAT (SEQ ID NO: 13). The target sequence for modified oligonucleotides complementary to ACTN1 is CACAAAGTTATATTCC (SEQ ID NO: 14). Sequences for the GFP reporter plasmids are presented in the table below, wherein the plain unformatted text indicates the backbone plasmid, the underlined text indicates the CMV promoter sequence, the underlined, and italicized text indicates the UTR sequence, the underlined, bolded, italicized text indicates the sites that are complementary to a modified oligonucleotide, and the bolded text indicates the sequence of GFP. The target of the sites that are complementary to a modified oligonucleotide are indicated in the column titled “Target”, and the number of times the complementary site has been inserted is indicated in the column titled “# of Sites”. Table 3 Sequences of GFP reporter plasmids with inserts BFP reporter polypeptides comprising a CMV promoter, an intronic sequence containing sites complementary to a modified oligonucleotide, and BFP were designed, converted to codon optimized DNA and cloned into a pCDNA3.1+ plasmid backbone. The intronic sequence consists of the fourth intron of HSPA5 (Liang et al., Nat. Commun.2022, 13, 7329.) with either the sequence complementary to an SMN1 modified oligonucleotide (described above) inserted at 2 or 8 sites, or the sequence complementary to an ACTN1 modified oligonucleotide (described above) inserted at 3 or 9 sites. The nucleotide sequences for the BFP reporter plasmids are presented in the table below, wherein the plain unformatted text indicate the backbone plasmid, the underlined text indicates the CMV promoter sequence, the underlined, and italicized text indicates the intronic sequence, the underlined, bolded, italicized text indicates the sites that are complementary to a modified oligonucleotide, and the bolded text indicates the sequence of BFP. The target of the sites that are complementary to a modified oligonucleotide are indicated in the column titled “Target”, and the number of times the complementary site has been inserted is indicated in the column titled “# of Sites”. Table 4 Sequences of BFP reporter plasmids with inserts Example 3: Effect of JQ1-conjugated modified oligonucleotides on the activity of GFP reporter, in vitro Oligomeric compounds described above were tested in HEK293 cells for their effect on GFP reporter activation via recruitment of endogenous BRD4. Modified oligonucleotides conjugated to JQ1 at the 5′-end were tested at various doses in HEK293 cells, transfected with GFP reporters that have 6 sites complementary to a modified oligonucleotide. HEK293 cells plated at a density of 20,000 cells per well were transfected using Lipo2000 with modified oligonucleotide at 6 or 60 nM, and 100 ng / well of either GFP reporter GFP_A_6 or GFP_S_6. After a treatment period of 24 hours, total RNA was isolated from the cells and GFP RNA levels were measured by quantitative real-time RTPCR. GFP mRNA levels were measured using a GFP primer-probe set (forward sequence AGGAGGATCACAGCAACAC, designated herein as SEQ ID NO: 5; reverse sequence CTCTTTCTTCACCGGCATCT, designated herein as SEQ ID NO: 6; probe sequence TTGAAGGCGTGCTGGTACTCCAC, designated herein as SEQ ID NO: 7). GFP RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Amount of GFP RNA is presented in the tables below as percent GFP RNA, relative to the amount of GFP RNA in untreated control cells (% UTC). Table 5 Effect of modified oligonucleotides conjugated to JQ1 on the activity of GFP reporter GFP_A_6 with 6 sites complementary to an ACTN1 modified oligonucleotide Table 6 Effect of modified oligonucleotides conjugated to JQ1 on the activity of GFP reporter GFP_S_6 with 6 sites complementary to an SMN1 modified oligonucleotide Example 4: Dose-dependent effect of JQ1-conjugated modified oligonucleotides on the activation of GFP reporters, in vitro Oligomeric compounds described above were tested in HEK293 cells for their dose-dependent effect on GFP reporter activation via recruitment of endogenous BRD4. The JQ1-conjugated modified oligonucleotides were tested at various doses in HEK293 cells transfected with GFP reporters that have multiple sites complementary to the modified oligonucleotide. HEK293 cells plated at a density of 20,000 cells per well were transfected using Lipo2000 with modified oligonucleotide at doses indicated in the tables below, and 100 ng / well of GFP reporter with 4 or 6 sites complementary to an ACTN1 modified oligonucleotide as indicated in the table titles below. After a treatment period of 24 hours, total RNA was isolated from the cells and GFP RNA levels were measured by quantitative real-time RTPCR using a GFP primer-probe set (described herein above). GFP RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Amount of GFP RNA is presented in the tables below as percent GFP RNA, relative to the amount of GFP RNA in untreated control cells (% UTC). “N.D.” indicates that data was not collected. Each table represents a separate experiment. Table 7 Dose-dependent effect of JQ1-conjugated modified oligonucleotides on the activity of GFP reporter GFP_A_6 with 6 sites complementary to an ACTN1 modified oligonucleotide Table 8 Dose-dependent effect of JQ1-conjugated modified oligonucleotides on the activity of GFP reporter GFP_A_6 with 6 sites complementary to an ACTN1 modified oligonucleotide Table 9 Dose-dependent effect of JQ1-conjugated modified oligonucleotides on the activity of GFP reporter GFP_A_4 with 4 sites complementary to an ACTN1 modified oligonucleotide HEK293 cells plated at a density of 20,000 cells per well were transfected using Lipo2000 with modified oligonucleotide at doses indicated in the tables below, and 100 ng / well of GFP reporter with 4 or 6 sites complementary to an SMN1 modified oligonucleotide as indicated in the table titles below. After a treatment period of 24 hours, total RNA was isolated from the cells and GFP RNA levels were measured by quantitative real-time RTPCR using a GFP primer-probe set (described herein above). GFP RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Amount of GFP RNA is presented in the tables below as percent GFP RNA, relative to the amount of GFP RNA in untreated control cells (% UTC). “N.D.” indicates that data was not collected. Each table represents a separate experiment. Table 10 Dose-dependent effect of JQ1-conjugated modified oligonucleotides on the activity of GFP reporter GFP_S_6 with 6 sites complementary to an SMN1 modified oligonucleotide Table 11 Dose-dependent effect of JQ1-conjugated modified oligonucleotides on the activity of GFP reporter GFP_S_6 with 6 sites complementary to an SMN1 modified oligonucleotide Table 12 Dose-dependent effect of JQ1-conjugated modified oligonucleotides on the activity of GFP reporter GFP_S_4 with 4 sites complementary to an SMN1 modified oligonucleotide Example 5: Effect of the number of complementary sites on activation of a GFP reporter by JQ1- conjugated modified oligonucleotide, in vitro Oligomeric compounds and GFP reporters described above were tested in HEK293 cells to evaluate the effect of the number of sites complementary to the modified oligonucleotide in the 5′ UTR of the GFP reporter. The JQ1-conjugated modified oligonucleotides were tested in HEK293 cells transfected with GFP reporters that have multiple sites complementary to the modified oligonucleotide. HEK293 cells plated at a density of 20,000 cells per well were transfected using Lipo2000 with ACTN1 modified oligonucleotide Compound No.1784167 at 30 nM and 100 ng / well of GFP reporter with 1, 2, 4 or 6 sites complementary to an ACTN1 modified oligonucleotide, as indicated in the tables below. After a treatment period of 24 hours, total RNA was isolated from the cells and GFP RNA levels were measured by quantitative real-time RTPCR. GFP mRNA levels were measured using a GFP primer-probe set (described herein above). GFP RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Amount of GFP RNA for each experiment is presented in the tables below as percent GFP RNA, relative to the amount of GFP RNA in untreated control cells (% UTC). The average amount of GFP RNA and standard deviation for all the experiments was calculated and is also presented in the table below. “N.D.” indicates that data was not collected. Table 13 Effect of number of complementary sites on GFP reporter activity in HEK293 cells treated with 30 nM of Compound No.1784167 HEK293 cells plated at a density of 20,000 cells per well were transfected using Lipo2000 with SMN1 Compound No.1784168 at 30 nM and 100 ng / well of GFP reporter with 1, 2, 4 or 6 sites complementary to an SMN1 modified oligonucleotide, as indicated in the tables below. After a treatment period of 24 hours, total RNA was isolated from the cells and GFP RNA levels were measured by quantitative real-time RTPCR. GFP mRNA levels were measured using a GFP primer-probe set (described herein above). GFP RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Amount of GFP RNA is presented in the tables below as percent GFP RNA, relative to the amount of GFP RNA in untreated control cells (% UTC). The average amount of GFP RNA and standard deviation for all the experiments was calculated and is also presented in the table below. “N.D.” indicates that data was not collected. Table 14 Effect of number of complementary sites on GFP reporter activity in HEK293 cells treated with 30 nM of Compound No.1784168 Example 6: Effect of JQ1-conjugated modified oligonucleotides on the activation of BFP reporters, in vitro Oligomeric compounds described above were tested in HEK293 cells for their effect on BFP reporter activation via recruitment of endogenous BRD4. HEK293 cells plated at a density of 20,000 cells per well were transfected using Lipo2000 with modified oligonucleotides at concentrations indicated in the table below and 100 ng / well of BFP reporter with 3 or 9 sites complementary to an ACTN1 modified oligonucleotide, as indicated in the tables below. After a treatment period of 24 hours, total RNA was isolated from the cells and BFP RNA levels were measured by quantitative real-time RTPCR using a BFP primer-probe set (forward sequence CCATCTGATCGCAAACATCAAG, designated herein as SEQ ID NO: 8; reverse sequence TCCAGTCTGTAGTCCACATAGTA, designated herein as SEQ ID NO: 9; probe sequence ACCCGCTAAGAACCTCAAGATGCC, designated herein as SEQ ID NO: 10). BFP RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Amount of BFP RNA is presented in the tables below as percent BFP RNA, relative to the amount of BFP RNA in untreated control cells (% UTC). “N.D.” indicates that data was not collected. Each table represents a separate experiment. Table 15 Effect of oligomeric compounds on the activity of BFP reporter BFP_A_9 with 9 sites complementary to an ACTN1 modified oligonucleotide Table 16 Effect of Compound No.1784167 on the activity of BFP reporter BFP_A_9 with 9 sites complementary to an ACTN1 modified oligonucleotide Table 17 Effect of Compound No.1784167 on the activity of BFP reporter BFP_A_3 with 3 sites complementary to an ACTN1 modified oligonucleotide HEK293 cells plated at a density of 20,000 cells per well were transfected using Lipo2000 with modified oligonucleotides at concentrations indicated in the table below and 100 ng / well of BFP reporter with 2 or 8 sites complementary to an SMN1 modified oligonucleotide, as indicated in the tables below. After a treatment period of 24 hours, total RNA was isolated from the cells and BFP RNA levels were measured by quantitative real-time RTPCR using a BFP primer-probe set (described herein above). BFP RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Amount of BFP RNA is presented in the tables below as percent BFP RNA, relative to the amount of BFP RNA in untreated control cells (% UTC). Table 18 Effect of oligomeric compounds on the activity of BFP reporter BFP_S_8 with 8 sites complementary to an SMN1 modified oligonucleotide Table 19 Effect of Compound No.1784168 on the activity of BFP reporter BFP_S_8 with 8 sites complementary to an SMN1 modified oligonucleotide Table 20 Effect of Compound No.1784168 on the activity of BFP reporter BFP_S_2 with 2 sites complementary to an SMN1 modified oligonucleotide Example 7: Design of oligomeric compounds targeted to ACTN1 with multiple JQ1 moieties Oligomeric compounds conjugated with multiple JQ1 ligands were designed from ACTN1 modified oligonucleotides as describe above, based on ACTN1 parent Compound No.1770886. The modified oligonucleotides complementary to human ACTN1 are 16 nucleotides in length, and are uniform MOE modified oligonucleotides with uniform phosphorothioate internucleoside linkages. Each modified oligonucleotide has the sequence (5′ to 3′): GGAATATAACTTTGTG (SEQ ID No: 12), wherein each cytosine is a 5-methylcytosine. Compound No.1825253 has two JQ1 ligands, one conjugated at the 5′-end and one conjugated at the 3′-end, as shown below: Compound No.1826597 has three JQ1 ligands conjugated at the 5′-end, as shown below: Compound No.1826598 has six JQ1 ligands, three conjugated at the 5′-end and three conjugated at the 3′- end, as shown below: Example 8: Synthesis of oligonucleotides with multiple JQ1 moieties Synthesis of a modified oligonucleotide with JQ1 at the 5’ -end and the 3’-end A uniform MOE / PS modified oligonucleotide with the sequence (5′ to 3′): GGAATATAACTTTGTG (SEQ ID No: 12), wherein each cytosine is a 5-methylcytosine, was synthesized with a 5’-hexylamino linker, described herein above, and a 3’-C7 amino modifier. The 3’-C7 amino modifier, as shown below, is attached to the 3’-nucleoside via a phosphodiester linkage. The oligonucleotide was dissolved in 0.2 M pH 8.5 borate buffer and an equal volume of DMSO. A solution of Fmoc-PEG6-NHS ester dissolved in DMSO was added. The reaction mixture was stirred at room temperature, with reaction monitoring by LC-MS. After full conversion to the dual Fmoc-PEG6-ylated product, the reaction mixture was then treated with piperidine and stirred at room temperature, with reaction monitoring by LC-MS. After complete removal of the Fmoc group was observed, the solution was filtered through an Acrodisc syringe filter to remove precipitate. The filtrate, containing crude product, was then purified by ion-exchange (IEX) HPLC. The purified compound was desalted by standard RP HPLC and lyophilized. JQ1 carboxylic acid was dissolved in DMF, followed by DIPEA and pentafluorophenol- trifluoroacetate, The reaction mixture was incubated at room temperature, and the in situ activation of the carboxylic acid was monitored by LC-MS. After the carboxylic acid starting material was consumed, the JQ1 activated ester was added to a resuspended solution of the dual-PEG6-ylated product described above in 0.2 M borate buffer pH 8.5 (1 mL). The reaction was stirred at room temperature and monitored by LC-MS. After reaction completion, the crude reaction was purified by IEX-HPLC and desalted by standard RP HPLC and lyophilized. Synthesis of an oligomeric compound with three JQ1 ligands at the 5’ end An oligomeric compound comprising three JQ1 ligands at the 5’ end was synthesized according to the following scheme: Synthesis of a modified oligonucleotide with three JQ1 ligands at each end A modified oligonucleotide comprising three JQ1 ligands at the 5’ end and at the 3’ end was synthesized according to the following scheme, starting from the 5’-hexylamino, 3’-C7 amino modified oligonucleotide described above. Example 9: Design of a GFP reporter A reporter construct containing sites complementary to modified oligonucleotides fused to GFP was designed to evaluate the ability of a JQ1-conjugated modified oligonucleotide to recruit endogenous BRD4 and activate transcription of GFP. A GFP reporter construct comprising a CMV promoter sequence, a GFP reporter sequence, and sites complementary to both SMN1 and ACTN1 modified oligonucleotides, was designed as shown in the table below. The target sequence for modified oligonucleotides complementary to SMN1 is CCAGCATTATGAAAGTGAAT (SEQ ID NO: 13). The target sequence for modified oligonucleotides complementary to ACTN1 is CACAAAGTTATATTCC (SEQ ID NO: 14). The sequence for the GFP reporter plasmid is presented in the table below, wherein the plain unformatted text indicates the backbone plasmid, the underlined text indicates the CMV promoter sequence, the underlined, and italicized text indicates the UTR sequence, the underlined, bolded, italicized text indicates the sites that are complementary to a modified oligonucleotide, and the bolded text indicates the sequence of GFP. The number of inserted sites that are complementary to an SMN1 modified oligonucleotide is indicated in the column titled “# of SMN1 Sites”, and the number of inserted sites that are complementary to an ACTN1 modified oligonucleotide is indicated in the column titled “# of ACTN1 Sites”. Table 21 Sequence of GFP reporter plasmids with inserts complementary to SMN1 and ACTN1 modified oligonucleotides

[0011] Example 10: Effect of JQ1-conjugated modified oligonucleotides on the activity of GFP reporter, in vitro Oligomeric compounds described above were tested in HEK293 cells for their effect on GFP reporter activation via recruitment of endogenous BRD4. Modified oligonucleotides conjugated to JQ1 at the 5′-end were tested at various doses in HEK293 cells, transfected with GFP reporter GFP_S4_A2, which has 4 sites complementary to an SMN1 modified oligonucleotide and 2 sites complementary to an ACTN1 modified oligonucleotide. HEK293 cells plated at a density of 20,000 cells per well were transfected using Lipofectamine2000 with ACTN1 oligomeric compound, SMN1 oligomeric compound, or both. Cells were treated with 30 or 60 nM of oligomeric compound, and 100 ng / well of GFP reporter GFP_S4_A2. After a treatment period of 24 hours, total RNA was isolated from the cells and GFP RNA levels were measured by quantitative real-time RTPCR. GFP mRNA levels were measured using a GFP primer-probe set (described herein above) and were normalized to total RNA content, as measured by RIBOGREEN®. Amount of GFP RNA is presented in the tables below as percent GFP RNA, relative to the amount of GFP RNA in untreated control cells (% UTC). Table 22 Effect of oligomeric compounds on the activity of GFP reporter GFP_S4_A2 with sites complementary to an SMN1 modified oligonucleotide and an ACTN1 modified oligonucleotide Example 11: Effect of number of JQ1 ligands on the activity of GFP reporter, in vitro Oligomeric compounds described above were tested in HEK293 cells for their effect on GFP reporter activation via recruitment of endogenous BRD4. Modified oligonucleotides conjugated to JQ1 at the 5′-end were tested at various doses in HEK293 cells, transfected with GFP with sites complementary to an ACTN1 modified oligonucleotide, as indicated in the tables below. HEK293 cells plated at a density of 20,000 cells per well were transfected using Lipofectamine2000 with ACTN1 oligomeric compounds conjugated to one or more JQ1 ligands. Cells were treated with oligomeric compound at the concentrations indicated in the tables below, and 100 ng / well of GFP reporter GFP_ A_2 or GFP_A_4. After a treatment period of 24 hours, total RNA was isolated from the cells and GFP RNA levels were measured by quantitative real-time RTPCR. GFP mRNA levels were measured using a GFP primer-probe set (described herein above) and were normalized to total RNA content, as measured by RIBOGREEN®. Amount of GFP RNA is presented in the tables below as percent GFP RNA, relative to the amount of GFP RNA in untreated control cells (% UTC). Table 23 Effect of oligomeric compounds on the activity of GFP reporter GFP_A_2 with two sites complementary to an ACTN1 modified oligonucleotide Table 24 Effect of oligomeric compounds on the activity of GFP reporter GFP_A_4 with four sites complementary to an ACTN1 modified oligonucleotide Table 25 Effect of oligomeric compounds on the activity of GFP reporter GFP_A_1 with one site complementary to an ACTN1 modified oligonucleotide Example 12: Methods for the synthesis of alternative oligomeric compounds having multiple JQ1 ligands Synthesis of an oligomeric compound with two JQ1 ligands at the 5’ end An oligomeric comopund comprising two JQ1 ligands at the 5’ end is synthesized according to the following scheme: Synthesis of an oligomeric compound with two JQ1 ligands at each end An oligomeric compound comprising two JQ1 ligands at each end is synthesized according to the following scheme: Example 13: Measurement of binding of JQ1-conjugated modified oligonucleotides to BRD4 in an in vitro FRET-based assay The effect of JQ1 modified oligonucleotides on BRD4 binding was evaluated in a fluorescence resonance energy transfer (FRET)-based assay that measures the inhibition of BRD4 binding to a fluorescent substrate. Compound Nos.387954, 1770886, 1784167, and 1784167 were evaluated using BRD4 (BD1+BD2) TR-FRET Assay Kit (BPS Bioscience, Catalog #32612) according to manufacturer protocol. This kit is designed to measure the level of BRD4 (BD1+BD2) binding to its substrate. Briefly, to each well in a 384- well plate was added Tb-label donor, dye-labeled acceptor, BET Bromodomain Ligand, and modified oligonucleotide at a final concentration indicated in the table below. BRD4 (BD1 + BD2) and Non-acetylated Ligand 1 were added to each well to initiate the reaction, and the reaction mixture was incubated at room temperature for 2 hours. The 384-well plate was then read in a plate reader according to manufacturer recommended settings. Fluorescence emission was normalized relative to an untreated control. Results are summarized in the table below as Normalized Fluorescence Emission (%UTC). A reduction in fluorescence indicates increased binding of JQ1-modified oligonucleotide to BRD4. Table 25 Effect of JQ1 conjugated and unconjugated modified oligonucleotides on FRET-mediated emission Example 14: Effect of JQ1-conjugated modified oligonucleotides and BRD4 knockdown on GFP reporter upregulation, in vitro To elucidate the mechanism of upregulation, the effect of JQ1-conjugated modified oligonucleotide on GFP reporter upregulation was evaluated in a system wherein BRD4 was knocked down by an oligomeric duplex targeted to BRD4 RNA. In this example, Luciferase RNA and an oligomeric duplex targeted to Luc was included as a negative control. BRD4 targeting siRNAs were obtained from ThermoFisher Scientific (ID#137041 and ID#137042). The control luciferase siRNA has an antisense strand sequence of (from 5’-to 3’): UCGAAGUAUUCCGCGUACGUU (SEQ ID NO: 28) and a sense strand sequence of (from 5’-to 3’): CGUACGCGGAAUACUUCGAUU (SEQ ID NO: 29). JQ1-conjugated modified oligonucleotides were tested at various doses in HEK293 cells, transfected with GFP reporter GFP_A_6, described herein above. HEK293 cells plated at a density of 20,000 cells per well were transfected with 100 ng / well of GFP reporter GFP_A_4 (using Lipofectamine 2000), with BRD4 or Luc oligomeric duplex with (at 10nM with RNAimax) as indicated in the table below, and with Compound No.1784167 at concentrations indicated in the table below. After a treatment period of 24 hours, total RNA was isolated from the cells and GFP RNA levels and BRD4 RNA levels were measured by quantitative real- time RTPCR. GFP RNA levels were measured using a GFP primer-probe set (described herein above) and were normalized to total RNA content, as measured by RIBOGREEN®. BRD4 RNA levels were measured using a BRD4 primer-probe set (Hs04188087_m1 from ThermoFisher Scientific) and were normalized to total RNA content, as measured by RIBOGREEN®. The amount of BRD4 RNA is presented in the tables below as percent BRD4 RNA, relative to the amount of BRD4 RNA in untreated control cells (% UTC). BRD4 knockdown was further confirmed by Western blot. HEK293 cell lysate was analyzed by Western blot using a BRD4 primary antibody (Abcam ab128874). A GAPDH primary antibody (Catalog #32233, Santa Cruz Biotechnology) was included as a reference. Results are shown in Figure 1, which shows BRD4 knockdown by Compound Nos. BRD4 siRNA 137041 and BRD4 siRNA 137042. Amount of GFP RNA is presented in the tables below as percent GFP RNA, relative to the amount of GFP RNA in untreated control cells (% UTC). The level of upregulation by Compound No.1784167 is reduced when the level of BRD4 in the system is reduced. Table 26 Effect of Compound No.1784167 on GFP RNA, with BRD4 knockdown in HEK293 cells Table 27 Effect of oligomeric duplexes on BRD4 knockdown in HEK293 cells Example 15: Design of a modified oligonucleotide and a GFP reporter with reverse compliment sequences A modified oligonucleotide with a sequence that is the reverse complement of an SMN1 modified oligonucleotide was designed and synthesized as described below. A reporter construct comprising GFP fused to sites complementary to the reverse complement modified oligonucleotide was also designed. Design and Synthesis of Compound No.1843528 Compound No.1843528 is a uniform MOE modified oligonucleotide with uniform phosphorothioate linkages that is 20 nucleotides in length. Compound No.1843528 has the sequence CCAGCATTATGAAAGTGAAT (SEQ ID NO: 30), wherein each C is a 5-methylcytosine, and is the reverse complement of SMN1 modified oligonucleotide Compound No.1784168 (described herein above). Compound No.1843528 is conjugated to a JQ1 ligand at the 5′-end via a PEG6-amidohexyl phosphoryl linker, and was synthesized from Compound No.1829632, and shown in the scheme below. Compound No. 1829632 has the sequence, sugar motif, and internucleoside motif as Compound No.1843528, but differs in that it is conjugated at the 5′-end to a 6-aminohexyl phosphoryl linker. To a solution of Compound No.1829632 (20 mg, 2.44 µmol, 1.0 eq.) in 0.2 M borate buffer pH 8.5 (1.0 mL) was added a solution of Fmoc-PEG6-NHS (8.2 mg, 12.3 µmol, 5.0 eq.) dissolved in DMSO (2 mL). The reaction mixture was stirred at room temperature for 3 hours, with reaction monitoring by LCMS. Piperidine (24 µL, 245 µmol, 100 eq.) was added directly to the reaction mixture to initiate deprotection. The reaction was stirred at room temperature overnight, with reaction monitoring by LCMS. The next day, DCM was added to dissolved particulates, and the crude reaction was filtered through a fritted funnel, then was purified via Strong Anion Exchange (SAX). A gradient was run from 0 to 50% B @ 6 mL / min (A: 100 mM NaHCO33:7 MeCN:H2O) (B: 100 mM NaHCO3, 1.5 M NaBr, 3:7 MeCN:H2O) on a Waters AP-2 column (10 mm x 100 mm) containing GE Source 30Q strong anion exchange resin. The fractions containing desired product were collected and concentrated in a SpeedVac, then desalted by reverse phase chromatography on a 5g C18 Sep-Pak. The desalted deprotected Compound No.1829632-PEG6 was concentrated to dryness in a SpeedVac. To a solution of JQ-1 carboxylic acid (7.32 µmol, 3.0 eq.) dissolved in DMF (2 mL) was added DIPEA (21.96 µmol, 9.0 eq.), followed by PFPTFA (7.32 µmol, 3.0 eq.). The reaction mixture was stirred at room temperature for 1 hour. Compound No.1829632-PEG6 was dissolved in borate buffer (1 mL) and added to the reaction mixture, which was then stirred at room temperature for 1 hour with reaction monitoring by LCMS. The completed reaction mixture was then diluted with water (2.5 mL) and filtered through a fritted funnel and purified by ion-exchange chromatography on an AKTA HPLC equipped with a Waters AP-2 column (10 mm x 100 mm) containing GE Source 30Q strong anion exchange resin with a gradient from 100% Buffer A / 0% Buffer B to 60% Buffer A / 40% Buffer B. (A: 100 mM NH4OAC 3:7 MeCN:H2O) (B: 100 mM NH4OAC, 1.5 M NaBr, 3:7 MeCN:H2O). The fractions containing desired product were collected, concentrated in a SpeedVac, desalted by reverse phase chromatography on a 5g C18 Sep-Pak, then concentrated to yield Compound No.1843528 as a white solid (0.21 mg, 0.02 µmol, 0.8% yield overall) Design of a GFP reporter with reverse complement sites A GFP reporter construct (GFP_S_2rc) was designed where the sites in GFP_S_2 corresponding to SMN1 were switched to be the reverse compliment. These sequences were inserted at two sites in the g-block of the 5′ UTR of β-globin (Leppek et al., Nat. Commun.2022, 13, 1536), which was then cloned into pCMV6-AC-GFP Mammalian Expression Vector (Origene Catalog# PS100010). Compound No. 1843528, described herein above, has the sequence ATTCACTTTCATAATGCTGG (SEQ ID NO: 11), and is designed to be complementary to the RNA from (GFP_S_2rc). The sequences of the GFP reporter plasmid is presented in the table below, wherein the plain unformatted text indicates the backbone plasmid, the underlined text indicates the CMV promoter sequence, the underlined, and italicized text indicates the UTR sequence, the underlined, bolded, italicized text indicates the sites that are complementary to a modified oligonucleotide, and the bolded text indicates the sequence of GFP. Table 28 Sequence of a GFP reporter plasmid with 2 reverse complementary inserts Example 16: Effect of GFP reporter site sequence on JQ1-conjugated modified oligonucleotide- mediated upregulation The modified oligonucleotide and reporter described in the example above were used to evaluate the ability of a JQ1-conjugated modified oligonucleotide to recruit endogenous BRD4 and activate transcription of GFP. HEK293 cells plated at a density of 20,000 cells per well were transfected using Lipofectamine 2000 with 40 nM of Compound No.1784168 or Compound No.1843528, and 100 ng / well of GFP reporter GFP_S_2 or GFP_S_2rc, as indicated in the tables below. After a treatment period of 24 hours, total RNA was isolated from the cells and GFP RNA levels were measured by quantitative real-time RTPCR. GFP mRNA levels were measured using a GFP primer-probe set (described herein above). GFP RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Amount of GFP RNA for each experiment is presented in the tables below as percent GFP RNA, relative to the amount of GFP RNA in untreated control cells (% UTC). The data in the tables below indicates that the upregulation observed is related to through the binding of the modified oligonucleotide to RNA, and not to DNA. Table 29 Effect of reverse complementary sequence on GFP mRNA using reporter GFP_S_2 Table 30 Effect of reverse complementary sequence on GFP mRNA using reverse complement reporter GFP_S_2rc Example 17: Effect of pre-mRNA accumulation on GFP reporter activity To further elucidate the mechanism by which JQ1-conjugated modified oligonucleotides cause reporter upregulation, GFP reporters with mutations in their intron / exon junctions were designed. GFP reporter constructs with an artificial intron were designed comprising a CMV promoter, an intronic sequence, sites that are complementary to a modified oligonucleotide, and GFP. Sequences complementary to a modified oligonucleotide described above were inserted at 8 or 9 sites in an artificial intron sequence (Liang et all Nat Com 2022, 137329), which was then cloned into pCMV6-AC-GFP Mammalian Expression Vector (Origene Catalog# PS100010) in the middle of the GFP sequence. The target sequence for modified oligonucleotides complementary to SMN1 is CCAGCATTATGAAAGTGAAT (SEQ ID NO: 13). The target sequence for modified oligonucleotides complementary to ACTN1 is CACAAAGTTATATTCC (SEQ ID NO: 14). The sequences of the GFP reporter plasmids are presented in the table below, wherein the plain unformatted text indicates the backbone plasmid, the underlined text indicates the CMV promoter sequence, the underlined, and italicized text indicates the artificial intron sequence, the underlined, bolded, italicized text indicates the sites that are complementary to a modified oligonucleotide, and the bolded text indicates the sequence of GFP. The target of the modified oligonucleotides that each inserted site is complementary to is indicated in the column titled “Target”. Table 31 Sequence of a GFP reporter plasmids with artificial introns and 8 or 9 inserts A second set of GFP reporters was designed based on the sequences of GFP_Si8 and GFP_Ai9 in the table above. The sequence of GFP_Siaa8 and GFP_Aiaa9 differ from GFP_Si8 and GFP_Ai9 respectively in the following ways: 1) the sequence at the 5′ junction of the intronic sequence is AA / AA, changed from AG / GT; and 2) the sequence at the 3′ junction of the intronic sequence is AA / AA, changed from AG / GA. The sequences of the GFP reporter plasmids are presented in the table below, wherein the plain unformatted text indicates the backbone plasmid, the underlined text indicates the CMV promoter sequence, the underlined, and italicized text indicates the artificial intron sequence, the underlined, bolded, italicized text indicates the sites that are complementary to a modified oligonucleotide, and the bolded text indicates the sequence of GFP. Lower case text indicates the mutated nucleobases. The target of the modified oligonucleotides that each inserted site is complementary to is indicated in the column titled “Target”. Table 32 Sequence of a GFP reporter plasmids with artificial introns and mutations at the intron / exon junctions HEK293 cells plated at a density of 20,000 cells per well were transfected using Lipofectamine 2000 with 100 ng / well of the GFP reporter indicated in the tables below and treated with modified oligonucleotides at the doses indicated in the table below using free uptake. Separate samples were transfected with only GFP reporters with mutation intron / exon junctions. After a treatment period of 24 hours, total RNA was isolated from the cells. GFP total RNA levels were measured by quantitative real-time RTPCR using a GFP primer- probe set (described herein above). GFP RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Amount of GFP RNA is presented in the tables below as percent GFP RNA, relative to the amount of GFP RNA in untreated control cells (% UTC). The mutant reporters show higher upregulation of GFP RNA in the presence of JQ1 modified oligonucleotide compared to wild-type reporters. Since the mutant intron-exon sites are splicing deficient and therefore more available, it indicates that the compound is working on pre-mRNA. Table 33 Effect of oligomeric compounds on the upregulation of GFP total RNA using GFP_Si8 or GFP_Siaa8 Table 34 Effect of oligomeric compounds on the upregulation of GFP total RNA levels, using GFP_Ai9 or GFP_Aiaa9 Example 18: Effect of 3xJQ1 on HEK293 cell viability A small molecule comprising three JQ1 ligands linked by a trivalent amino-PEG chain was synthesized then tested in HEK293 cells to evaluate its effect on cell viability.

[0012] Synthesis of 3xJQ1 To a solution of JQ1 carboxylic acid (82.5 mg, 206 µmol, 5 eq.) dissolved in DMF (2 mL) was added DIPEA (36 µl, 206 µmol, 5 eq.) and PFPTFA (35 µL, 206 µmol, 5 eq.). The reaction was stirred at room temperature for 1 hour. Tri(Amino-PEG3-amide)-amine TFA salt (50 mg, 41.2 µmol, 1 eq.) was dissolved in minimal DMF and a portion of DIPEA (36 µl, 206 µmol, 5 eq.) was added. The second mixture was added to the JQ1 reaction mixture, and was stirred at room temperature for 3 hrs. The crude reaction was purified by flash chromatography (0-50% MeOH / DCM) by injecting the crude reaction mixture directly onto a Biotage flash chromatography system equipped with a silica column (25 g). Fractions containing the product were collected and concentrated in vacuo yielding 3xJQ1 as a white solid (36 mg, 46% yield). Cell Viability Assay HEK293 cells were plated at a density of 20,000 cells per well and treated with free JQ1 or free 3xJQ1 at the final concentrations indicated in the table below in the presence of 0.25% DMSO. One set of cells were treated with DMSO alone (control). After a treatment period of 24 hours, total RNA was isolated from the cells and total RNA content was measured by quantitative real-time RTPCR, as measured by RIBOGREEN®. Cell viability is presented in the tables below as total RNA content, relative to the amount of total RNA content in untreated control cells (% control). In the table below, “N.D.” indicates that data point was not obtained for that compound. The data is also presented in FIGURE 2. Table 35 Effect of JQ1 and 3xJQ1 on HEK293 cell viability

Claims

WHAT IS CLAIMED:

1. A method of modulating the expression of a target nucleic acid in a cell, comprising contacting the cell with an oligomeric agent comprising a modified oligonucleotide and at least one BET binding ligand; wherein the modified oligonucleotide comprises a targeting region that is complementary to a target region of the target nucleic acid.

2. The method of claim 1, wherein the target nucleic acid does not comprise a tandem repeat.

3. The method of claim 1, wherein the target region of the target nucleic acid does not include a tandem repeat.

4. The method of any of claims 1-3, wherein the oligomeric agent comprises two or more BET binding ligands.

5. The method of claim 4, wherein the oligomeric agent comprises 2, 3, 4, or 6 BET binding ligands.

6. A method of modulating the expression of a target nucleic acid in a cell, comprising contacting the cell with two or more oligomeric agents, wherein each oligomeric agent comprises a modified oligonucleotide and at least one BET binding ligand; wherein the first modified oligonucleotide comprises a targeting region that is complementary to a first target region of the target nucleic acid; and the second modified oligonucleotide comprises a targeting region that is complementary to a second target region of the target nucleic acid; wherein the first target region and the second target region do not overlap.

7. The method of claim 6, comprising contacting the cell with three or more oligomeric agents, each comprising a modified oligonucleotide and at least one BET binding ligand; wherein the third modified oligonucleotide comprises a targeting region that is complementary to a third target region of the target nucleic acid, and where in the first, second, and third target regions do not overlap.

8. The method of claim 6, comprising contacting the cell with four or more oligomeric agents, each comprising a modified oligonucleotide and at least one BET binding ligand; wherein each modified oligonucleotide comprises a targeting region that is complementary to a target region of the target nucleic acid, and wherein none of the target regions overlap.

9. The method of any of claims 1-8, wherein at least one BET binding ligand has Formula IIa:Formula IIa, wherein: Ring A is absent or a 6-membered aryl or heteroaryl ring; Y is -N(H)- or -O-; R1, R2, R3are each independently selected from hydrogen, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; R4is selected from hydrogen, halogen, -NO2, -CN, aryl, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; or R4is -NRARB, wherein RAand RBare each independently selected from hydrogen and C1-C6alkyl; and m is from 1-6.

10. The method of claim 9, wherein Ring A is absent.

11. The method of claim 9 or 10, wherein R1, R2, and R3are each methyl.

12. The method of any of claims 9-11, wherein R4is halogen.

13. The method of any of claims 9-12, wherein m is 1.

14. The method of any of claims 9-13, wherein the at least one BET binding ligand has Formula IIb: Formula IIb.

15. The method of any of claims 9-14, wherien Ring A is absent, R1, R2, and R3are each methyl, R4is halogen, and m is 1.

16. The method of any of claims 9-15, wherein R4is Cl.

17. The method of any of claims 9-16, wherein the at least one BET binding ligand has Formula I:.

18. The method of any of claims 1-17, wherein each BET binding ligand is the same.

19. The method of any of claims 1-18, wherein each BET binding ligand has Formula IIa or IIb.

20. The method of any of claims 1-18, wherein each BET binding ligand has Formula I.

21. The method of any of claims 4-20, wherein the oligomeric agent comprises a branching group.

22. The method of claim 21, wherein the branching group has a formula selected from:

23. The method of claim 22, wherein the oligomeric agent comprises a tether.

24. The method of claim 23, wherein the tether comprises:, wherein n is from 2-10.

25. The method of claim 23, wherein the tether has a formula selected from:.

26. The method of any of claims 1-25, wherein the oligomeric agent comprises a conjugate moiety selected from:.

27. The method of any of claims 1-26, wherein the modified oligonucleotide consists of 16-24, 16-22, 16-20, 16-18, 18-24, 18-22, 18-20, 18, or 20 linked nucleosides.

28. The method of claim 27, wherein the modified oligonucleotide consists of 16, 18, or 20 linked nucleosides.

29. The method of any of claims 1-28, wherein the modified oligonucleotide comprises at least one modified sugar moiety.

30. The method of claim 29, wherein the modified sugar moiety is a non-bicyclic sugar moiety.

31. The method of claim 30, wherein the non-bicyclic sugar moiety is selected from the group consisting of 2’-NMA, 2’-O-methoxyethyl, 2’-OMe.

32. The method of claim 29, wherein the modified sugar moiety is a bicyclic sugar moiety.

33. The method of claim 32, wherein the bicyclic sugar moiety is selected from the group consisting of 4'-(CH2)-O-2' (LNA); 4'-(CH2)2-O-2' (ENA); and 4'-CH(CH3)-O-2' (cEt).

34. The method of any of claims 29-33, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

35. The method of claim 34, wherein the modified sugar moiety is a non-bicyclic sugar moiety is selected from the group consisting of 2’-NMA, 2’-O-methoxyethyl, 2’-OMe.

36. The method of claim 29-35, wherein each modified sugar moiety is a 2’- O-methoxyethyl.

37. The method of any of claims 1-36, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

38. The method of claim 37, wherein at least one modified internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

39. The method of claim 38, wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

40. The method of claim 38, wherein each internucleoside linkage of the modified oligonucleotide is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage.

41. The method of any of claims 1-40, wherein the expression level of the target is increased.

42. The method of claim 41, wherein the expression level is increased by at least 150%, at least 200%, at least 250%, or at least 300% compared to the expression level in the absence of the oligomeric agent.

43. The method of any of claims 1-42, wherein the cell is in a subject.

44. An oligomeric agent, comprising a modified oligonucleotide and at least one BET binding ligand, wherein the modified oligonucleotide comprises a targeting region that is complementary to a target region of a target nucleic acid.

45. The oligomeric agent of claim 44, wherein the target region does not comprise a tandem repeat.

46. The oligomeric agent of claim 44 or 45, wherein the target nucleic acid does not comprise a tandem repeat.

47. The oligomeric agent of any of claims 44-46, wherein the oligomeric agent does not comprise a region having the formula:.

48. The oligomeric agent of any of claims 44-47, wherein the target nucleic acid is not PVT1, XIST, HSP70, MALAT1, ACTB, SCN1A, or SYNGAP1.

49. The oligomeric agent of any of claims 44-48,wherein at least one BET binding ligand has Formula IFormula IIa, wherein: Ring A is absent or a 6-membered aryl or heteroaryl ring; Y is -N(H)- or -O-; R1, R2, R3are each independently selected from hydrogen, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; R4is selected from hydrogen, halogen, -NO2, -CN, aryl, C1-C6alkyl, C1-C6haloalkyl, or C1-C6hydroxyalkyl; or R4is -NRARB, wherein RAand RBare each independently selected from hydrogen and C1-C6alkyl; and m is from 1-6.

50. The oligomeric agent of claim 49, wherein Ring A is absent.

51. The oligomeric agent of claim 49 or 50, wherein R1, R2, and R3are each methyl.

52. The oligomeric agent of any of claims 49-51, wherein R4is halogen.

53. The oligomeric agent of any of claims 49-52, wherein m is 1.

54. The oligomeric agent of any of claims 49-53, wherein the at least one BET binding ligand has Formula IIb:

55. The oligomeric agent of any of claims 49-54, wherien Ring A is absent, R1, R2, and R3are each methyl, R4is halogen, and m is 1.

56. The oligomeric agent of any of claims 49-55, wherein R4is Cl.

57. The oligomeric agent of any of claims 49-56, wherein the at least one BET binding ligand has Formula I:.

58. The oligomeric agent of any of claims 44-57, wherein each BET binding ligand is the same.

59. The oligomeric agent of any of claims 44-58, wherein each BET binding ligand has Formula IIa or IIb.

60. The oligomeric agent of any of claims 44-59, wherein each BET binding ligand has Formula I.

61. The oligomeric agent of any of claims 47-60, wherein the oligomeric agent comprises a branching group.

62. The oligomeric agent of claim 61, wherein the branching group has a formula selected from:

63. The oligomeric agent of claim 62, wherein the oligomeric agent comprises a tether.

64. The oligomeric agent of claim 63, wherein the tether comprises:, wherein n is from 2-10.

65. The oligomeric agent of claim 63, wherein the tether has a formula selected from:

66. The oligomeric agent of any of claims 44-65, wherein the oligomeric agent comprises a conjugate moiety selected from:.

67. The oligomeric agent of any of claims 44-66, wherein the modified oligonucleotide consists of 16-24, 16-22, 16-20, 16-18, 18-24, 18-22, 18-20, 18, or 20 linked nucleosides.

68. The oligomeric agent of claim 67, wherein the modified oligonucleotide comprises at least one modified sugar moiety.

69. The oligomeric agent of claim 68, wherein the modified sugar moiety is a non-bicyclic sugar moiety.

70. The oligomeric agent of claim 69, wherein the non-bicyclic sugar moiety is selected from the group consisting of 2’-NMA, 2’-O-methoxyethyl, 2’-OMe.

71. The oligomeric agent of claim 70, wherein the modified sugar moiety is a bicyclic sugar moiety.

72. The oligomeric agent of claim 71, wherein the bicyclic sugar moiety is selected from the group consisting of 4'-(CH2)-O-2' (LNA); 4'-(CH2)2-O-2' (ENA); and 4'-CH(CH3)-O-2' (cEt).

73. The oligomeric agent of any of claims 68-72, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

74. The oligomeric agent of claim 73, wherein the modified sugar moiety is a non-bicyclic sugar moiety is selected from the group consisting of 2’-NMA, 2’-O-methoxyethyl, 2’-OMe.

75. The oligomeric agent of claim 68-74, wherein each modified sugar moiety is a 2’- O-methoxyethyl.

76. The oligomeric agent of any of claims 44-75, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

77. The oligomeric agent of claim 76, wherein at least one modified internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

78. The oligomeric agent of claim 77, wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

79. The oligomeric agent of claim 77, wherein each internucleoside linkage of the modified oligonucleotide is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage.

80. The oligomeric agent of any of claims 44-79, wherein the expression level of the target is increased.

81. The oligomeric agent of claim 80, wherein the expression level of the target is increased by at least 150%, at least 200%, at least 250%, or at least 300% compared to the expression level in the absence of the oligomeric agent.

82. The oligomeric agent of any of claims 44-81, wherein the oligomeric agent comprises at least 2, at least 3, at least 4, at least 5, or at least 6 BET binding ligands.

83. A pharmaceutical composition comprising an oligomeric agent of any of claims 44-82.

84. A pharmaceutical composition comprising two or more oligomeric agents of any of claims 44-83, each comprising a modified oligonucleotide; wherein each modified oligonucleotide comprises a targeting region that is complementary to a target region of the target nucleic acid, and wherein none of the target regions overlap.

85. A method of administering an oligomeric agent of any of claims 44-84 or a pharmaceutical composition of claim 83 or 84 to a subject.

86. A method of modulating the expression of a target nucleic acid in a cell, comprising contacting the cell with a composition comprising two or more oligomeric agents; wherein each oligomeric agent is an oligomeric agent of any of claims 44-83, and 87. wherein each modified oligonucleotide comprises a targeting region that is complementary to a target region of the target nucleic acid, and wherein none of the target regions overlap. The method of claim 86, wherein the expression level of the target is increased.

88. The method of claim 87, wherein the expression level is increased by at least 150%, at least 200%, at least 250%, or at least 300% compared to the expression level in the absence of the oligomeric agent.

89. The method of any of claims 87-88, wherein the cell is in a subject.

Images