Polypeptide for biosynthesis of 1,2-propanediol and use thereof

By expressing and purifying polypeptides with 1,5-sysilol-6-phosphate isomerase activity and expressing relevant enzyme systems in host cells, the existing complex and cost-effective 1,2-propylene glycol production technology is solved, and an efficient and environmentally friendly biosynthesis process is achieved.

WO2025112748A1PCT designated stage expired Publication Date: 2025-06-05TIANJIN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/116467
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-29
Filing Date
2024-09-03
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

The existing 1,2-propylene glycol production technology is complex, consumes a lot of raw materials and energy, has high production costs, and has many by-products, which affects environmental protection.

Method used

The polypeptide with 1,5-syringol-6-phosphate isomerase activity and expression of the relevant enzyme system in the host cell catalyzed the production of 1,5-syringol-6-phosphate into 1,2-propanediol.

Benefits of technology

The efficient biosynthesis of 1,2-propylene glycol is achieved, which reduces production costs, reduces the demand for raw materials and energy, and improves the environmental protection of the products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024116467_05062025_PF_FP_ABST
    Figure CN2024116467_05062025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a 1,5-anhydroglucitol-6-phosphate isomerase and the use thereof, in particular the use thereof in the synthesis of 1,2-propanediol.
Need to check novelty before this filing date? Find Prior Art

Description

Polypeptide for 1,2-propanediol biosynthesis and its use

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese Patent Application No. 202311617289.7 filed on November 29, 2023, the entire contents of which are incorporated herein by reference in their entirety. Technical Field

[0003] The present application generally relates to the fields of genetic engineering, enzyme engineering and bioinformatics; specifically, the present application provides a new sugar degradation pathway, 1,5-glycidol-6-phosphate isomerase involved in the pathway and their uses, especially in the synthesis of 1,2-propanediol. Background Art

[0004] 1,2-Propanediol is primarily used in the production of coatings and unsaturated polyester resins, as well as plasticizers and hydraulic brake fluids. Furthermore, 1,2-Propanediol serves as a good solvent for inks and epoxy resins. It can also be used in nonionic detergents, acting as an enzyme stabilizer and solvent, and as an antifreeze agent and humectant in the pharmaceutical, cosmetic, animal food, and tobacco industries.

[0005] Common 1,2-propylene glycol production technologies include direct and indirect hydration of propylene oxide, direct catalytic oxidation of propylene, and dimethyl carbonate (DMC) / propylene glycol co-production. However, these methods often require complex chemical equipment, consume large amounts of raw materials and energy, produce by-products, and have high production costs and poor atom economy.

[0006] Given that 1,2-propylene glycol is an important industrial raw material with significant value and uses, research on its synthesis pathway has important scientific research and industrial application value.

[0007] SUMMARY OF THE INVENTION

[0008] In a first aspect, the present application provides a polypeptide comprising an amino acid sequence shown in SEQ ID NO: 1 or 97 or a functional variant thereof, wherein the functional variant has 1,5-glycidol-6-phosphate isomerase activity.

[0009] In some embodiments of the first aspect, the polypeptide comprises the amino acid sequence shown in SEQ ID NO: 1 or a functional variant thereof, wherein the functional variant has 1,5-glucitol-6-phosphate isomerase activity. In some embodiments, the polypeptide has an active site defined as follows in spatial conformation: the active site comprises amino acid residues H165, H282, S283, H334, C441, E443, R453, T455, L562, S662, I664, and G786, which are close to each other in spatial conformation with reference to SEQ ID NO: 1.

[0010] In some embodiments of the first aspect, the functional variant is a natural isoenzyme of the amino acid sequence shown in SEQ ID NO: 1.

[0011] In some embodiments of the first aspect, the polypeptide comprises the amino acid sequence shown in SEQ ID NO: 97 or a functional variant thereof, wherein the functional variant has 1,5-mannitol-6-phosphate isomerase activity. In some embodiments, the polypeptide has an active site defined as follows in spatial conformation: the active site comprises amino acid residues Q162, H169, S277, S278, R323, F331, P335, C431, E433, D445, Y628, V630, and G752, which are close to each other in spatial conformation with reference to SEQ ID NO: 97.

[0012] In some embodiments of the first aspect, the functional variant is a natural isoenzyme of the amino acid sequence shown in SEQ ID NO:97.

[0013] In some embodiments of the first aspect, the substrate of the polypeptide is 1,5-glycidol-6-phosphate.

[0014] In some embodiments of the first aspect, the functional variant is produced by insertion, substitution and / or deletion of one or more amino acids based on the amino acid sequence shown in SEQ ID NO: 1 or 97 or its natural isoenzyme.

[0015] In a second aspect, the present application provides a nucleic acid molecule encoding the polypeptide described in the first aspect.

[0016] In a third aspect, the present application provides an expression cassette comprising the nucleic acid molecule described in the second aspect.

[0017] In a fourth aspect, the present application provides an expression vector comprising the nucleic acid molecule described in the second aspect or the expression cassette described in the third aspect.

[0018] In a fifth aspect, the present application provides a host cell comprising the nucleic acid molecule described in the second aspect, the expression cassette described in the third aspect, or the expression vector described in the fourth aspect.

[0019] In some embodiments of the fifth aspect, the host cell is capable of expressing and producing: a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1 or 97 or a functional variant thereof, wherein the functional variant has 1,5-glycidol-6-phosphate isomerase activity.

[0020] In some embodiments of the fifth aspect, the host cell further expresses: an activating enzyme, an aldolase, a hydroxyacetone reductase, and / or a transport complex.

[0021] In some embodiments of the fifth aspect, the transport complex has phosphoenolpyruvate-phosphotransferase system transport activity.

[0022] In some embodiments of the fifth aspect, the host cell is a eukaryotic cell or a prokaryotic cell.

[0023] In some embodiments of the fifth aspect, the eukaryotic cell is a yeast cell.

[0024] In some embodiments of the fifth aspect, the prokaryotic cell is selected from the group consisting of Escherichia, Klebsiella, Streptococcus, Lactobacillus, Bifidobacterium, Bacteroidetes, and Firmicutes.

[0025] In a sixth aspect, the present application provides a composition comprising the polypeptide described in the first aspect.

[0026] In some embodiments of the sixth aspect, the composition is used to catalyze the production of 1,2-propylene glycol from 1,5-glycidol-6-phosphate.

[0027] In the seventh aspect, the present application provides the use of the polypeptide described in the first aspect, the nucleic acid molecule described in the second aspect, the expression cassette described in the third aspect, the expression vector described in the fourth aspect, and the host cell described in the fifth aspect in preparing a composition for catalyzing 1,5-dihydroglycidol-6-phosphate to produce 1,2-propylene glycol.

[0028] In an eighth aspect, the present application provides a method for producing 1,2-propanediol, comprising culturing the host cell described in the fifth aspect in a culture medium containing 1,5-glycidol to obtain 1,2-propanediol.

[0029] In a ninth aspect, the present application provides a method for producing 1,2-propylene glycol, comprising contacting the composition according to the sixth aspect with 1,5-glycidol-6-phosphate to obtain 1,2-propylene glycol. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 is a schematic diagram of free radical-dependent hydroglycolysis. A. The gene cluster in Lactiplantibacillus plantarum (including the gene expressing 1,5-glucitol-6-phosphate isomerase shown in SEQ ID NO:2) and the YbiW-dependent hydroglycolysis pathway. B. The gene cluster in Escherichia coli (including the gene expressing 1,5-glucitol-6-phosphate isomerase shown in SEQ ID NO:98) and the PflD-dependent hydroglycolysis pathway.

[0031] Figure 2 shows the electron paramagnetic resonance (EPR) spectra and LC-MS enzymatic reaction analysis of YbiW. A. ​​EPR spectra of LpYbiW with LpYbiY and titanium(III) citrate in the presence or absence of S-adenosylmethionine (SAM). B. LC-MS analysis of the formation of 1-deoxyfructose-6-phosphate (1-deoxy-F6P) during the isomerization of 1,5-glucitol-6-phosphate (1,5-AG-6P) catalyzed by LpYbiW. The extracted ion chromatogram (EIC) at m / z = 243 in negative ion mode monitors the formation of 1-deoxy-F6P (t R =18.40 min). CD. Mass spectra of compound 1 (1-deoxy-F6P) and compound 2 (1,5-AG-6P) corresponding to the EIC peaks in B, respectively (negative ion mode). E. HPLC elution profiles of DNPH derivatives of the reaction products and standards in the reaction analysis of LpFsaA coupled to LpYbiW. FH. ESI (-) m / z mass spectra of DNPH-3-phosphoglyceraldehyde (peak 3) and DNPH-hydroxyacetone (peaks 4 and 5) in E. Wherein, w / o indicates absence.

[0032] Figure 3 shows the electron paramagnetic resonance (EPR) spectra and LC-MS enzymatic reaction analysis of PflD. A. EPR spectra of EcPflD with EcPflC and titanium (III) citrate in the presence or absence of SAM. B. LC-MS analysis of the formation of 1-deoxyfructose-6-phosphate (1-deoxy-F6P) during the EcPflD-catalyzed isomerization of 1,5-glycidol-6-phosphate (1,5-AM-6P). The formation of 1-deoxy-F6P was monitored by the extracted ion chromatogram (EIC) at m / z = 243 in negative ion mode (t R=18.40 min). CD. Mass spectra of compound 1 (1-deoxy-F6P) and compound 6 (1,5-AM-6P) corresponding to the EIC peak in B (negative ion mode). E. Analysis of the reaction of EcFsaB coupled to EcPflD. HPLC elution profiles of the reaction products and DNPH derivatives of the standard. FH. Mass spectra of DNPH-3-phosphoglyceraldehyde (peak 3) and DNPH-hydroxyacetone (peaks 4 and 5) in E. I. Spectrophotometric determination of EcGldA-EcFsaB coupled to EcPflD, monitoring NADH consumption as hydroxyacetone is reduced. "w / o" indicates absence.

[0033] Figure 4 shows the X-ray diffraction crystal structures of EcYbiW and SdPflD. AB. Structures of monomers EcYbiW and SdPflD in each asymmetric unit. CD. Structures of the active sites of the complexes formed by EcYbiW with 1,5-AG-6P and SdPflD with 1,5-AM-6P, respectively. Hydrogen atom transfer pathways are indicated by arrows, hydrogen bonds are represented by black dashed lines, and distances between key atoms are indicated. The 2Fo-Fc electron density of the substrate is 1.0σ. EF. Catalytic mechanism of EcYbiW and SdPflD.

[0034] Figure 5 shows the YbiW-dependent glycolytic pathway induced by 1,5-glucitol (1,5-AG) and the PflD-dependent glycolytic pathway induced by 1,5-glucitol (1,5-AM) in Escherichia coli. A. Growth of wild-type E. coli MG1655 and the ΔybiW strain using 1,5-AG as the sole carbon source. The positive control used glucose as the sole carbon source, and the negative control (w / o glucose) did not add any carbon source. B. SDS-PAGE analysis of wild-type E. coli MG1655 using glucose (lane 2), 1,5-AG (lane 3), or ΔybiW using glucose (lane 4). Arrows indicate two ~95 kDa bands containing PtsA and YbiW, a ~42 kDa band identified as GldA, and a ~27 kDa band identified as containing FsaB and FsaA. C. Growth of E. coli MG1655 wild-type and ΔpflD strains using 1,5-AM as the sole carbon source. The positive control used glucose as the sole carbon source, while the negative control did not add any carbon source. D. SDS-PAGE analysis of E. coli MG1655 wild-type and ΔpflD strains using glucose (lane 2), 1,5-AM (lane 3), or glucose (lane 4) as the sole carbon source. The arrow indicates the ~95 kDa band identified as PtsA, the ~90 kDa band identified as PflD, the ~42 kDa band identified as GldA, and the ~27 kDa band identified as FsaB. E. coli genomic neighborhood of YbiW (SEQ ID NO: 1) and PflD (SEQ ID NO: 98) in E. coli MG1655. F. 1,5-AG hydrolysis pathway and 1,5-AM hydrolysis pathway in E. coli. Here, w / o means not containing.

[0035] Figure 6 shows SDS-PAGE analysis of purified proteins used for enzymatic assays and biochemical characterization. A. LpYbiW; B. MBP-LpYbiY; C. LpFsaA; D. EcPflD; E. MBP-EcPflC; F. EcFsaB; G. EcGldA. Lanes 1 to 4 of each 4-20% gradient gel (Bis-Tris) contain protein molecular weight markers and 1, 2, and 4 μg of recombinant protein, respectively.

[0036] Figure 7. Characterization of recombinant LpYbiY. A. Quantification of [Fe–S] clusters in LpYbiY, where the assay was performed in triplicate and the standard deviation is shown. B. The UV-Vis absorption spectrum of LpYbiY was separated and reconstructed, corresponding to the [4Fe-4S] 2+The cluster's 410 nm feature disappears upon reduction with the strong reducing agent titanium(III) citrate. C. LC-MS elution profiles of the reaction mixture for LpYbiY-catalyzed SAM cleavage in the presence and absence of Ti(III), using commercially available 5'-deoxyadenosine (5'-dA) as a standard. D. Positive ionization mass spectrum of the 5'-dA peak eluting at 27.22 minutes in C.

[0037] Figure 8. Characterization of recombinant EcPflC. A. Quantification of [Fe–S] clusters in EcPflC, where the assay was performed in triplicate and the standard deviation is presented. B. UV–visible absorption spectra of EcPflC separated and reconstructed, corresponding to [4Fe-4S] in reconstructed EcPflC. 2+ The cluster's 410 nm feature disappears upon reduction with the strong reducing agent Ti(III) citrate. C. LC-MS elution profile of the reaction mixture for EcPflC-catalyzed SAM cleavage in the presence and absence of Ti(III), using commercially available 5'-deoxyadenosine (5'-dA) as a standard. D. Positive ionization mass spectrum of the 5'-dA peak eluting at 27.22 minutes in C.

[0038] Figure 9 shows an LC-MS enzyme activity assay of LpFsaA and EcFsaB in catalyzing the aldol addition reaction of hydroxyacetone to 3-phosphoglyceraldehyde. AB. Extracted ion chromatograms (m / z = 243, negative ion mode) of the LpFsaA- and EcFsaB-catalyzed reaction mixture, monitoring the formation of 1-deoxyfructose-6-phosphate (1-deoxy-F6P). CD. Negative ionization mass spectra of 1-deoxyfructose-6-phosphate formed by LpFsaA and EcFsaB. "w / o" indicates absence.

[0039] Figure 10 shows enzyme kinetic data for LpYbiW. A. ​​Dose-dependent LpFsaA-EcGldA coupled enzyme activity assay of LpYbiW, with the amount of LpYbiW used in the assay indicated. B. Michaelis-Menten kinetics of LpYbiW. Error bars represent the standard deviation of three separate experiments.

[0040] Figure 11 shows enzyme kinetic data for EcPflD. A. Dose-dependent EcFsaB-EcGldA coupled enzyme activity assay for EcPflD. The amount of EcPflD used in the assay is shown. B. Michaelis-Menten kinetics of EcPflD. Error bars represent the standard deviation of three separate experiments.

[0041] Figure 12 shows SDS-PAGE and SEC analysis of purified EcYbiW (E114A, E115A, and K117A) and SdPflD for protein crystallization. A. 4-20% gradient gel (Bis-Tris): Lane 1 is a protein molecular weight marker; Lanes 2-4 contain 1, 2, and 4 μg of purified EcYbiW (E114A, E115A, and K117A), respectively. B. 4-20% gradient gel (Bis-Tris): Lane 1 is a protein molecular weight marker; Lanes 2-4 contain 1, 2, and 4 μg of purified SdPflD, respectively. C. SEC standard curve established using bovine thyroglobulin (669 kDa), equine apoferritin (443 kDa), sweet potato β-amylase (200 kDa), yeast alcohol dehydrogenase (150 kDa), BSA (66 kDa), and bovine carbonic anhydrase (29 kDa) (Sigma MWGF 1000-1KT). D. Elution profiles of EcYbiW (E114A, E115A, and K117A) and SdPflD using Superdex200 gel filtration chromatography, with estimated molecular weights of 154.9 kDa and 77.9 kDa, respectively.

[0042] Figure 13 shows the gas chromatography (GC) analysis of fermentation broths of wild-type E. coli MG1655 grown with glucose, 1,5-AG, and 1,5-AM. "w / o glucose" indicates the absence of glucose, serving as a negative control; glucose serves as a positive control.

[0043] Figure 14 shows the YbiW and PflD clusters constructed using the Sequence Similarity Network (SSN) tool, with each node representing sequences with 80% or greater similarity. The arrows in the two clusters indicate the nodes where EcYbiW and EcPflD reside, respectively.

[0044] Figure 15 is an exemplary distribution map of gene clusters including natural isozymes of 1,5-glucitol-6-phosphate isomerase shown in SEQ ID NO: 1, glycine free radical enzyme activating enzyme of S-adenosylmethionine free radical enzyme family, and 1-deoxyfructose-6-phosphate aldolase (the direction of the gene indicates the direction of the coding chain, from 5' to 3').

[0045] Figure 16 is an exemplary distribution diagram of gene clusters including natural isozymes of 1,5-mannitol-6-phosphate isomerase shown in SEQ ID NO: 97, S-adenosylmethionine free radical enzyme family glycine free radical enzyme activating enzyme, 1-deoxyfructose-6-phosphate aldolase, and hydroxyacetone reductase.

[0046] Figure 17 shows SDS-PAGE analysis of the purified proteins used for biochemical characterization. A. EcYbiW; B. MBP-EcYbiY; C. SdPflD; D. MBP-SdPflC. Lanes 1 to 4 of each 4-20% gradient gel (Bis-Tris) contain protein molecular weight markers and 1, 2, and 4 μg of recombinant protein, respectively.

[0047] Figure 18 shows the LC-MS analysis of the enzymatic reaction of E. coli species YbiW. A. ​​Detection of the formation of 1-deoxyfructose-6-phosphate (1-deoxy-F6P) during the isomerization of 1,5-glucitol-6-phosphate (1,5-AG-6P) catalyzed by EcYbiW by LC-MS. In negative ion mode, the extracted ion chromatogram (EIC) at m / z = 243 monitors the formation of 1-deoxy-F6P (t R =18.40min). BC. Mass spectra (negative ion mode) of compound 1 (1-deoxy-F6P) and compound 2 (1,5-AG-6P) corresponding to the EIC peaks in A, respectively. Wherein, w / o means not contained.

[0048] Figure 19 shows the gene cluster and LC-MS enzymatic reaction analysis of the PflD gene of Streptococcus dysgalactiae subsp. Equisimilis. A. The gene cluster in Streptococcus dysgalactiae subsp. Equisimilis (including the gene expressing 1,5-glycidol-6-phosphate isomerase shown in SEQ ID NO: 97). B. LC-MS analysis of the formation of 1-deoxyfructose-6-phosphate (1-deoxy-F6P) during the isomerization of 1,5-glycidol-6-phosphate (1,5-AM-6P) catalyzed by SdPflD. In negative ion mode, the extracted ion chromatogram (EIC) at m / z = 243 monitors the formation of 1-deoxy-F6P (t R =18.40 min). CD. Mass spectra (negative ion mode) of compound 1 (1-deoxy-F6P) and compound 6 (1,5-AM-6P) corresponding to the EIC peaks in B. Wherein, w / o means not contained.

[0049] Sequence Description

[0050] SEQ ID NO: 1 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed in Escherichia coli and having Uniprot accession number P75793.

[0051] SEQ ID NO: 2 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Lactobacillus plantarum with Uniprot accession number A0A807DR53.

[0052] SEQ ID NO: 3 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Lactobacillus selangorensis with Uniprot accession number A0A0R2FVZ1.

[0053] SEQ ID NO: 4 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Streptococcus uberis and having Uniprot accession number A0A0A6S4M4.

[0054] SEQ ID NO: 5 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Olsenella sp. oral taxon 807 and having Uniprot accession number A0A0K1F3T2.

[0055] SEQ ID NO: 6 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Leptotrichia wadei with Uniprot accession number A0A134AK54.

[0056] SEQ ID NO: 7 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Senella sp. DNF00959 with Uniprot accession number A0A134A1S1.

[0057] SEQ ID NO: 8 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Streptococcus parauberis with Uniprot accession number A0A0E2UQR7.

[0058] SEQ ID NO: 9 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Anaerostipes hadrus with Uniprot accession number A0A173RRH3.

[0059] SEQ ID NO: 10 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Senella sp. HMSC062G07 with Uniprot accession number A0A1E8VV95.

[0060] SEQ ID NO: 11 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Selenomonas ruminantium with Uniprot accession number A0A1I3HGA4.

[0061] SEQ ID NO: 12 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Orenia metallireducens and having Uniprot accession number A0A285HLM7.

[0062] SEQ ID NO: 13 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Bifidobacterium primatium with Uniprot accession number A0A2M9H9C8.

[0063] SEQ ID NO: 14 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Leptotrichia hofstadii F0254, with Uniprot accession number C9N0T4.

[0064] SEQ ID NO: 15 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Ligilactobacillus agilis DSM 20509 and having Uniprot accession number A0A0R2AF79.

[0065] SEQ ID NO: 16 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Senella profusa F0195 and having Uniprot accession number U2TM27.

[0066] SEQ ID NO: 17 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Clostridium butyricum with Uniprot accession number A0A0A6PW80.

[0067] SEQ ID NO: 18 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Orenia metallireducens with Uniprot accession number A0A1C0A9L3.

[0068] SEQ ID NO: 19 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Vibrio ishigakensis and having Uniprot accession number A0A0B8PMP8.

[0069] SEQ ID NO: 20 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by a Coriobacteriaceae bacterium and having Uniprot accession number A0A425WQY7.

[0070] SEQ ID NO: 21 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Coriobacterium glomerans strain ATCC 49209 / DSM 20642 / JCM 10262 / PW2 with Uniprot accession number F2N714.

[0071] SEQ ID NO: 22 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Eggerthia catenaformis OT 569 and having Uniprot accession number M2NEK5.

[0072] SEQ ID NO: 23 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Clostridium baratii str. Sullivan with Uniprot accession number A0A0A7FYZ2.

[0073] SEQ ID NO: 24 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by the Clostridiales bacterium CHKCI006 with Uniprot accession number A0A143X8V0.

[0074] SEQ ID NO: 25 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by the Firmicutes bacterium HGW-Firmicutes-5 with Uniprot accession number A0A2N2BBI5.

[0075] SEQ ID NO: 26 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Clostridium vincentii with Uniprot accession number A0A2T0BJ14.

[0076] SEQ ID NO: 27 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Streptococcus downei MFe28 and having Uniprot accession number A0A380JDF6.

[0077] SEQ ID NO: 28 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by an Erysipelotrichaceae bacterium with Uniprot accession number A0A847CI73.

[0078] SEQ ID NO: 29 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Quinella sp. 3Q1 and having Uniprot accession number A0A8J6Z417.

[0079] SEQ ID NO: 30 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by the termite Sebaldella termitidis (strain ATCC 33386 / NCTC 11300) with Uniprot accession number D1AFQ7.

[0080] SEQ ID NO: 31 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Ligilactobacillus animalis and having Uniprot accession number A0A062WZ81.

[0081] SEQ ID NO: 32 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Liquorilactobacillus satsumensis DSM 16230 and having Uniprot accession number A0A0R1V613.

[0082] SEQ ID NO: 33 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Clostridium botulinum with Uniprot accession number A0A0M0A869.

[0083] SEQ ID NO: 34 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Acetivibrio ethanolgignens with Uniprot accession number A0A0V8QAB4.

[0084] SEQ ID NO: 35 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Aeromonas sobria with Uniprot accession number A0A2N3J357.

[0085] SEQ ID NO: 36 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Clostridium cadaveris with Uniprot accession number A0A1I2MD83.

[0086] SEQ ID NO: 37 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Streptococcus bovimastitidis with Uniprot accession number A0A1L8MKJ9.

[0087] SEQ ID NO: 38 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Sodalis ligni with Uniprot accession number A0A4R1NC63.

[0088] SEQ ID NO: 39 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Lactococcus raffinolactis and having Uniprot accession number A0A5R9CBU2.

[0089] SEQ ID NO: 40 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Lactobacillus ultunensis DSM 16047 and having Uniprot accession number C2ELS4.

[0090] SEQ ID NO: 41 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Leptotrichia sp. OH3620 with Uniprot accession number A0A3P1W4E8.

[0091] SEQ ID NO: 42 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Lucifera butyrica with Uniprot accession number A0A498R759.

[0092] SEQ ID NO: 43 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Fonticella tunisiensis with Uniprot accession number A0A4V6Q2Z2.

[0093] SEQ ID NO: 44 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Cronobacter sakazakii strain ATCC BAA-894 and having Uniprot accession number A7MME9.

[0094] SEQ ID NO: 45 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Liquorilactobacillus uvarum DSM 19971 and having Uniprot accession number A0A0R1Q920.

[0095] SEQ ID NO: 46 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Anaeromassilibacillus sp. An250 and having Uniprot accession number A0A1Y4F189.

[0096] SEQ ID NO: 47 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Anaerotruncus sp. 22A2-44 and having Uniprot accession number A0A498D0T9.

[0097] SEQ ID NO: 48 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Leptotrichia hofstadii with Uniprot accession number A0A510JEA5.

[0098] SEQ ID NO: 49 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Beauveria bassiana D1-5 with Uniprot accession number A0A0A2VZ96.

[0099] SEQ ID NO: 50 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Cedecea lapagei with Uniprot accession number A0A447V187.

[0100] SEQ ID NO: 51 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Streptococcus pneumoniae strain CGSP14 with Uniprot accession number B2ISH7.

[0101] SEQ ID NO: 52 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Streptococcus suis 6407 and having Uniprot accession number A0A075SG00.

[0102] SEQ ID NO: 53 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Lactobacillus plantarum with Uniprot accession number A0A0R2GM47.

[0103] SEQ ID NO: 54 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Aeromonas veronii with Uniprot accession number A0A1Q8F4Y7.

[0104] SEQ ID NO: 55 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Lactococcus raffinolactis and having Uniprot accession number A0A290PWH6.

[0105] SEQ ID NO: 56 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed in Escherichia coli and having Uniprot accession number A0A447Y009.

[0106] SEQ ID NO: 57 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Streptococcus sanguinis with Uniprot accession number A0A0B7GIL0.

[0107] SEQ ID NO: 58 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Actinomyces succiniciruminis with Uniprot accession number A0A1L7RNK7.

[0108] SEQ ID NO: 59 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed in Escherichia coli and having Uniprot accession number A0A376TJI4.

[0109] SEQ ID NO: 60 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Vagococcus humatus with Uniprot accession number A0A3R9YDI0.

[0110] SEQ ID NO: 61 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Streptococcus pneumoniae and having Uniprot accession number A0A064C019.

[0111] SEQ ID NO: 62 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Vibrio alginolyticus with Uniprot accession number A0A0P7FGJ3.

[0112] SEQ ID NO: 63 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Ligilactobacillus acidipiscis with Uniprot accession number A0A0R2KGV0.

[0113] SEQ ID NO: 64 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Pilibacter termitis with Uniprot accession number A0A1T4P4Y5.

[0114] SEQ ID NO: 65 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Lactiplantibacillus plantarum with Uniprot accession number A0A1E3KU28.

[0115] SEQ ID NO: 66 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by a Lachnospiraceae bacterium with Uniprot accession number A0A349BXL4.

[0116] SEQ ID NO: 67 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Aeromonas hydrophila with Uniprot accession number A0A3T0ZV83.

[0117] SEQ ID NO: 68 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Enterococcus ratti and having Uniprot accession number A0A1L8WPN6.

[0118] SEQ ID NO: 69 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Kandleria vitulina with Uniprot accession number A0A0R2H5D7.

[0119] SEQ ID NO: 70 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Clostridium pasteurianum DSM 525 and having Uniprot accession number A0A0H3J4P2.

[0120] SEQ ID NO: 71 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Aeromonas allosaccharophila with Uniprot accession number A0A0T6U3W3.

[0121] SEQ ID NO: 72 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Enterobacter sakazakii and having Uniprot accession number K8CC45.

[0122] SEQ ID NO: 73 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Pantoea alhagi with Uniprot accession number A0A1W6B1J9.

[0123] SEQ ID NO: 74 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Peptacetobacter hiranonis strain DSM 13275 / JCM 10541 / KCTC 15199 / TO-931 with Uniprot accession number B6FW14.

[0124] SEQ ID NO: 75 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Edwardsiella piscicida with Uniprot accession number A0A034T1M9.

[0125] SEQ ID NO: 76 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Cedecea neteri with Uniprot accession number A0A089PXZ6.

[0126] SEQ ID NO: 77 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Chelonobacter oris with Uniprot accession number A0A0A3AQL5.

[0127] SEQ ID NO: 78 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Aeromonas sp. L_1B5_3 with Uniprot accession number A0A0D0QVG1.

[0128] SEQ ID NO: 79 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Clostridium sp. IBUN125C and having Uniprot accession number A0A0F4VRP2.

[0129] SEQ ID NO: 80 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Vibrio gazogenes DSM 21264 and having Uniprot accession number A0A1M5EXF5.

[0130] SEQ ID NO: 81 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Melissococcus plutonius with Uniprot accession number A0A2Z5Y0I5.

[0131] SEQ ID NO: 82 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Tolumonas sp. and having Uniprot accession number A0A5C7QZ11.

[0132] SEQ ID NO: 83 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by a bacterium belonging to the family Erysipelothrixaceae and having Uniprot accession number A0A3D0GQ55.

[0133] SEQ ID NO: 84 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Loigolactobacillus coryniformis subsp. coryniformis KCTC 3167 and having Uniprot accession number A0A0R1F6B2.

[0134] SEQ ID NO: 85 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Zooshikella ganghwensis with Uniprot accession number A0A4P9VTG8.

[0135] SEQ ID NO: 86 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Vibrio sp. and having Uniprot accession number A0A829T2C0.

[0136] SEQ ID NO: 87 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Photobacterium lipolyticum with Uniprot accession number A0A2T3N2G3.

[0137] SEQ ID NO: 88 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed in Escherichia coli and having Uniprot accession number A0A8S7XWX0.

[0138] SEQ ID NO: 89 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Agrilactobacillus composti DSM 18527 and having Uniprot accession number X0PS46.

[0139] SEQ ID NO: 90 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Vibrio sp. JCM 19052 and having Uniprot accession number A0A061Q2Y5.

[0140] SEQ ID NO: 91 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Clostridium symbiosum with Uniprot accession number A0A174H662.

[0141] SEQ ID NO: 92 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Melissococcus plutonius strain ATCC 35311 / CIP 104052 / LMG 20360 / NCIMB 702443 with Uniprot accession number F3Y874.

[0142] SEQ ID NO: 93 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Aerococcus sp. HMSC035B07 and having Uniprot accession number A0A1S1BRH2.

[0143] SEQ ID NO: 94 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase expressed by Senella sp. An293 and having Uniprot accession number A0A1Y4BCL8.

[0144] SEQ ID NO: 95 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase with Uniprot Accession No. A0A7Z0VH52.

[0145] SEQ ID NO: 96 shows the amino acid sequence of 1,5-glucitol-6-phosphate isomerase with Uniprot accession number A0A0I9WIZ4.

[0146] SEQ ID NO: 97 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Streptococcus dysgalactiae subsp. Equisimilis with NCBI accession number OCX05109.1.

[0147] SEQ ID NO: 98 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Escherichia coli strain K12 with Uniprot accession number P32674.

[0148] SEQ ID NO: 99 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Firmicutes bacteria with Uniprot accession number A0A7C9H654.

[0149] SEQ ID NO: 100 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Pseudoleptotrichia goodfellowii and having Uniprot Accession No. A0A510J954.

[0150] SEQ ID NO: 101 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Edwardsiella tarda and having Uniprot accession number D4F6M7.

[0151] SEQ ID NO: 102 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Serratia odorifera DSM 4582 and having Uniprot accession number D4E0C4.

[0152] SEQ ID NO: 103 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Gilliamella apicola with Uniprot accession number A0A2V4E297.

[0153] SEQ ID NO: 104 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Vibrio ER1A with Uniprot accession number A0A084T2T3.

[0154] SEQ ID NO: 105 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Lactobacillus selangorensis with Uniprot accession number A0A0R2FPV6.

[0155] SEQ ID NO: 106 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Caloranaerobacter sp. and having Uniprot accession number A0A0N8NM72.

[0156] SEQ ID NO: 107 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Pilibacter termitis with Uniprot accession number A0A1T4K0K6.

[0157] SEQ ID NO: 108 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Caloranaerobacter azorensis H53214 and having Uniprot accession number A0A096BHK0.

[0158] SEQ ID NO: 109 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Salmonella enteritidis with Uniprot accession number A0A725B0Z8.

[0159] SEQ ID NO: 110 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Vibrio sp. JCM 19236 and having Uniprot accession number A0A0B8Q7B9.

[0160] SEQ ID NO: 111 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed in Escherichia coli and having Uniprot accession number A0A037YM28.

[0161] SEQ ID NO: 112 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Tolumonas auensis strain DSM 9187 / TA4 with Uniprot accession number C4LFY8.

[0162] SEQ ID NO: 113 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Senella porci and having Uniprot accession number A0A6N7XPT4.

[0163] SEQ ID NO: 114 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by a Mycobacterium family bacterium with Uniprot accession number A0A4S2F5T8.

[0164] SEQ ID NO: 115 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Fonticella tunisiensis with Uniprot accession number A0A4R7KVA0.

[0165] SEQ ID NO: 116 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by the Coriobacteriales bacterium OH1046 with Uniprot accession number A0A437UWZ5.

[0166] SEQ ID NO: 117 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Bacillus sp. HMF5848 with Uniprot accession number A0A3R9P0U8.

[0167] SEQ ID NO: 118 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Actinobacillus rossii with Uniprot accession number A0A380TM32.

[0168] SEQ ID NO: 119 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Lactobacillus ultunensis DSM 16047 and having Uniprot accession number C2ELS8.

[0169] SEQ ID NO: 120 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by the Firmicutes bacterium HGW-Firmicutes-7 with Uniprot accession number A0A2N2B0Z5.

[0170] SEQ ID NO: 121 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Clostridium estertheticum subsp. esterificus with Uniprot accession number A0A1J0GF99.

[0171] SEQ ID NO: 122 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Geosporobacter ferrireducens and having Uniprot accession number A0A1D8GPW2.

[0172] SEQ ID NO: 123 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Vibrio ishigakensis and having Uniprot accession number A0A0B8PE23.

[0173] SEQ ID NO: 124 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Streptococcus merionis with Uniprot accession number A0A239SQG5.

[0174] SEQ ID NO: 125 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Shigella boydii with Uniprot accession number A0A823B0Q1.

[0175] SEQ ID NO: 126 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Agrilactobacillus composti DSM 18527 and having Uniprot accession number X0PU04.

[0176] SEQ ID NO: 127 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Lactobacillus selangorensis with Uniprot accession number A0A0R2FH98.

[0177] SEQ ID NO: 128 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Vagococcus elongatus with Uniprot accession number A0A430AQ99.

[0178] SEQ ID NO: 129 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Clostridium acidisoli DSM 12555 and having Uniprot accession number A0A1W1WZ75.

[0179] SEQ ID NO: 130 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed in Escherichia coli and having Uniprot accession number A0A376L3P4.

[0180] SEQ ID NO: 131 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Caloramator quimbayensis with Uniprot accession number A0A1T4WMT8.

[0181] SEQ ID NO: 132 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Clostridium uliginosum and having Uniprot accession number A0A1I1H9K1.

[0182] SEQ ID NO: 133 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Enterobacter asburiae with Uniprot accession number A0A143I1W1.

[0183] SEQ ID NO: 134 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Atopobium minutum with Uniprot accession number N2BYX9.

[0184] SEQ ID NO: 135 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by a bacterium of the family Rhodopseudomonas, with Uniprot accession number A0A4S2EVE2.

[0185] SEQ ID NO: 136 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Thermophilibacter immobilis and having Uniprot Accession No. A0A7S7M803.

[0186] SEQ ID NO: 137 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Photorhabdus lipolytica with Uniprot accession number A0A2T3N2G1.

[0187] SEQ ID NO: 138 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Citrobacter amalonaticus with Uniprot accession number A0A381GG45.

[0188] SEQ ID NO: 139 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Escherichia coli G3 and having Uniprot accession number A0A0A0F8F5.

[0189] SEQ ID NO: 140 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Enterobacter aegypti with Uniprot accession number A0A0J0GCD9.

[0190] SEQ ID NO: 141 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Clostridium pastoriensis with Uniprot accession number A0A0H3J2B1.

[0191] SEQ ID NO: 142 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by the termite Sebarrudinium strain ATCC 33386 / NCTC 11300 and having Uniprot accession number D1AJA5.

[0192] SEQ ID NO: 143 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Acididesulfobacillus acetoxydans with Uniprot accession number A0A8S0W6S0.

[0193] SEQ ID NO: 144 shows the amino acid sequence of 1,5-mannitol-6-phosphate isomerase expressed by Clostridium sp. with Uniprot accession number A0A7W2G1V0.

[0194] SEQ ID NO: 145 shows the amino acid sequence of LpYbiY expressed by Lactiplantibacillus plantarum with Uniprot accession number A0A162FGG2.

[0195] SEQ ID NO: 146 shows the amino acid sequence of LpFsaA expressed by Lactiplantibacillus plantarum with Uniprot accession number A0A0M4CJJ6.

[0196] SEQ ID NO: 147 shows the amino acid sequence of EcPflC expressed by E. coli strain K12 with Uniprot accession number P32675.

[0197] SEQ ID NO: 148 shows the amino acid sequence of EcFsaB expressed by E. coli strain K12 with Uniprot accession number P32669.

[0198] SEQ ID NO: 149 shows the amino acid sequence of EcGldA expressed by E. coli strain K12 with Uniprot accession number P0A9S5.

[0199] SEQ ID NO: 150 shows the amino acid sequence of PtsA, a subunit of the PTS with Uniprot accession number P32670, expressed by Escherichia coli strain K12.

[0200] SEQ ID NO: 151 shows the amino acid sequence of subunit FrwB of the PTS expressed by the Escherichia coli strain K12 with Uniprot accession number P69816.

[0201] SEQ ID NO: 152 shows the amino acid sequence of subunit FrwC of the PTS expressed by the Escherichia coli strain K12 with Uniprot accession number P32672.

[0202] SEQ ID NO: 153 shows the amino acid sequence of subunit FrwD of the PTS expressed by the Escherichia coli strain K12 with Uniprot accession number P32676.

[0203] SEQ ID NO: 154 shows the nucleotide sequence of primer 1F.

[0204] SEQ ID NO: 155 shows the nucleotide sequence of primer 1R.

[0205] SEQ ID NO: 156 shows the nucleotide sequence of primer 2F.

[0206] SEQ ID NO: 157 shows the nucleotide sequence of primer 2R.

[0207] SEQ ID NO: 158 shows the nucleotide sequence of primer 3F.

[0208] SEQ ID NO: 159 shows the nucleotide sequence of primer 3R.

[0209] SEQ ID NO: 160 shows the nucleotide sequence of primer 4F.

[0210] SEQ ID NO: 161 shows the nucleotide sequence of primer 4R.

[0211] SEQ ID NO: 162 shows the nucleotide sequence of primer 5F.

[0212] SEQ ID NO: 163 shows the nucleotide sequence of primer 5R.

[0213] SEQ ID NO: 164 shows the nucleotide sequence of primer 6F.

[0214] SEQ ID NO: 165 shows the nucleotide sequence of primer 6R.

[0215] SEQ ID NO: 166 shows the nucleotide sequence of primer 7F.

[0216] SEQ ID NO: 167 shows the nucleotide sequence of primer 7R.

[0217] SEQ ID NO: 168 shows the nucleotide sequence of primer 8F.

[0218] SEQ ID NO: 169 shows the nucleotide sequence of primer 8R.

[0219] SEQ ID NO: 170 shows the nucleotide sequence of primer 9F.

[0220] SEQ ID NO: 171 shows the nucleotide sequence of primer 9R.

[0221] SEQ ID NO: 172 shows the nucleotide sequence of primer 10F.

[0222] SEQ ID NO: 173 shows the nucleotide sequence of primer 10R.

[0223] SEQ ID NO: 174 shows the nucleotide sequence of primer 11F.

[0224] SEQ ID NO: 175 shows the nucleotide sequence of primer 11R.

[0225] SEQ ID NO: 176 shows the nucleotide sequence of primer 12F.

[0226] SEQ ID NO: 177 shows the nucleotide sequence of primer 12R.

[0227] SEQ ID NO: 178 shows the nucleotide sequence of primer 13F.

[0228] SEQ ID NO: 179 shows the nucleotide sequence of primer 13R.

[0229] SEQ ID NO: 180 shows the nucleotide sequence of primer 14F.

[0230] SEQ ID NO: 181 shows the nucleotide sequence of primer 14R.

[0231] SEQ ID NO: 182 shows the nucleotide sequence of primer 15F.

[0232] SEQ ID NO: 183 shows the nucleotide sequence of primer 16F.

[0233] SEQ ID NO: 184 shows the nucleotide sequence of primer 16R.

[0234] SEQ ID NO: 185 shows the nucleotide sequence of primer 17F.

[0235] SEQ ID NO: 186 shows the nucleotide sequence of primer 17R.

[0236] SEQ ID NO: 187 shows the nucleotide sequence of the guide RNA contained in the pRed_Cas9_recA_ΔybiW plasmid.

[0237] SEQ ID NO: 188 shows the nucleotide sequence of the guide RNA contained in the pRed_Cas9_recA_ΔpflD plasmid.

[0238] SEQ ID NO: 189 shows the nucleotide sequence of primer 18F.

[0239] SEQ ID NO: 190 shows the nucleotide sequence of primer 18R.

[0240] SEQ ID NO: 191 shows the nucleotide sequence of primer 19F.

[0241] SEQ ID NO: 192 shows the nucleotide sequence of primer 19R.

[0242] Detailed Description of the Invention

[0243] Through bioinformatics analysis, the inventors of this application discovered two new free radical-dependent glycolysis pathways for the first time. By heterologous expression and purification of the relevant enzymes in these two new pathways, LC-MS detection was used to verify the enzyme activity and characterize the enzyme kinetic parameters. Combined with protein crystallographic analysis, the catalytic mechanism of key enzymes (such as 1,5-glucitol-6-phosphate isomerase or 1,5-glucitol-6-phosphate isomerase) was explored. When 1,5-glucitol and 1,5-glucitol-6-phosphate isomerase were used as the sole carbon sources, the relevant pathway proteins were expressed in large quantities in E. coli cells. However, knocking out key genes (such as those encoding 1,5-glucitol-6-phosphate isomerase or 1,5-glucitol-6-phosphate isomerase) prevented E. coli from growing when 1,5-glucitol or 1,5-glucitol was used as the sole carbon source. This indicates that E. coli can utilize these two new glycolytic pathways discovered by the inventors of this application to produce energy and grow. This is a new glycolytic pathway since the discovery of the EMP, ED, and pentose phosphate pathways in the 1920s and 1950s. Both of these new pathways can produce 1,2-propanediol.

[0244] Unless otherwise specified, the terms used in this application have the meanings commonly understood by those skilled in the art.

[0245] definition

[0246] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxyl orientation, respectively. Numerical ranges are inclusive of the numbers defining the range. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides may be referred to by their generally accepted single-letter codes. The above defined terms are more fully defined with reference to the specification as a whole. As used herein, amino acid residues are abbreviated as follows: alanine is Ala or A; arginine is Arg or R; asparagine is Asn or N; aspartic acid is Asp or D; cysteine ​​is Cys or C; glutamic acid is Glu or E; glutamine is Gln or Q; glycine is Gly or G; histidine is His or H; isoleucine is Ile or I; leucine is Leu or L; lysine is Lys or K; methionine is Met or M; phenylalanine is Phe or F; proline is Pro or P; serine is Ser or S; threonine is Thr or T; tryptophan is Trp or W; tyrosine is Tyr or Y; and valine is Val or V.

[0247] As used herein, "polypeptide" and "protein" are used interchangeably to refer to polymers of amino acid residues and variants thereof and synthetic and naturally occurring analogs thereof. Thus, these terms apply to naturally occurring amino acid polymers and naturally occurring chemical derivatives thereof, as well as amino acid polymers in which one or more amino acid residues are synthetic non-naturally occurring amino acids (such as chemical analogs of the corresponding naturally occurring amino acids). Such derivatives include, for example, post-translational modifications and degradation products, including phosphorylated, glycosylated, oxidized, isomerized, carboxylated, and deaminated variants of polypeptide fragments.

[0248] As used herein, the term "enzyme active center" refers to the site in the enzyme molecule that can directly bind to the substrate molecule and catalyze the chemical reaction of the substrate. This site becomes the active center of the enzyme.

[0249] As used herein, the term "amino acid" refers to a compound in which a hydrogen atom on a carboxylic acid carbon atom is replaced by an amino group, and the amino acid molecule contains both amino and carboxyl functional groups. It includes naturally occurring and non-naturally occurring amino acids, as well as amino acid analogs and mimetics. Naturally occurring amino acids include the 20 (L)-amino acids used in protein biosynthesis, as well as other amino acids, such as 4-hydroxyproline, hydroxylysine, carboxylysine, desmosine, isodesmosine, homocysteine, citrulline, and ornithine. Non-naturally occurring amino acids include, for example, (D)-amino acids, norleucine, norvaline, p-fluorophenylalanine, ethylthionine, etc., which are known to those skilled in the art. Amino acid analogs include modified forms of natural and non-naturally occurring amino acids. Such modifications may include, for example, replacing chemical groups and moieties on the amino acid, or derivatizing the amino acid. Amino acid mimetics include, for example, organic structures that exhibit functionally similar properties, such as the charge and charge space characteristics of an amino acid. For example, an organic structure that mimics arginine (Arg or R) has a positively charged moiety that is located in a similar molecular space and has the same degree of mobility as the e-amino group of the side chain of the naturally occurring Arg amino acid. Mimetics also include constrained structures to maintain optimal steric and charge interactions of amino acids or amino acid functional groups. One skilled in the art can determine what structures constitute functionally equivalent amino acid analogs and amino acid mimetics.

[0250] As used herein, the term "isozyme" refers to enzymes that catalyze the same reaction in an organism but have different molecular structures.

[0251] As used herein, the term "nucleic acid" refers to mRNA, RNA, cRNA, cDNA or DNA, including single-stranded and double-stranded forms of DNA. The term generally refers to a polymeric form of nucleotides of at least 10 bases in length, which are ribonucleotides or deoxynucleotides or modified forms of either type of nucleotide.

[0252] As used herein, the term "encoding" refers to a nucleic acid that contains the necessary information for directing translation of a nucleotide sequence into a specific protein. Codons are used to represent protein-encoding information. Protein-encoding nucleic acids may contain non-translated sequences (e.g., introns) within the translated region of the nucleic acid or may lack such intervening non-translated sequences (e.g., as in cDNA).

[0253] As used herein, "full-length sequence" of a particular polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. A full-length polynucleotide encodes the full-length, catalytically active form of the particular protein.

[0254] As used herein, the term "isolated" refers to a polypeptide or nucleic acid, or biologically active portion thereof, that is substantially or essentially free from components that normally accompany or react with the protein or nucleic acid as found in its naturally occurring environment. Thus, an isolated polypeptide or nucleic acid is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.

[0255] As used herein, the term "expression vector" is a recombinantly or synthetically produced nucleic acid construct that has a series of specific nucleic acid elements that allow for the transcription of a particular nucleic acid in a host cell.

[0256] As used herein, the term "host cell" refers to a cell that receives foreign genes in transformation and transduction (infection). The host cell may be a eukaryotic cell such as a yeast cell or a prokaryotic cell such as Escherichia coli.

[0257] As used herein, the term "phosphoenolpyruvate phosphotransferase system (PTS)" refers to an enzyme complex widely found in bacteria, fungi, and some archaea. It is composed of phosphotransferases such as the cytoplasmic enzyme I (EI) or histidine phosphate carrier protein (HPr or NPr) and the sugar-specific enzyme II complex, and has both catalytic and transport functions and a wide range of regulatory functions. The bacterial phosphoenolpyruvate phosphotransferase system primarily phosphorylates various sugars and their derivatives through a phosphorylation cascade reaction and then transports them into the cell. All PTSs rely on the cytoplasmic enzyme I (EI) and the histidine phosphate carrier protein (HPr). The latter phosphorylates sugars through the sugar-specific EII complex, which is composed of two cytoplasmic domains (EIIA and EIIB) and one or two membrane domains (EIIC or EIID). The EIIC or EIID domain is membrane-bound and transfers sugars to the cytoplasm, where they undergo a multi-stage phosphorylation process involving the EIIA and EIIB domains. The phosphate group of phosphoenolpyruvate is transferred from EI to HPr, from HPr to EIIA, and from EIIA to EIIB. The phosphate group is then transferred to a sugar transported by EIIC or EIID. Most bacteria use the phosphoenolpyruvate-phosphotransferase system (PTS) to transport carbohydrates such as glucose. EI catalyzes the phosphotransferase reaction from the glycolytic intermediate phosphoenolpyruvate (PEP) to HPr. HPr then transfers the phosphate group to a different EIIA and then to EIIB. Finally, the sugar is transported across the membrane by EIIC and EIID while being phosphorylated by EIIB. Specific implementation plan

[0258] In a first aspect, the present application provides a polypeptide comprising an amino acid sequence shown in SEQ ID NO: 1 or 97 or a functional variant thereof, wherein the functional variant has 1,5-glycidol-6-phosphate isomerase activity.

[0259] In some embodiments of the first aspect, the present application provides a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1 or a functional variant thereof, wherein the functional variant has 1,5-glucitol-6-phosphate isomerase activity. In some embodiments, the polypeptide has an active site defined as follows in spatial conformation: the active site comprises amino acid residues H165, H282, S283, H334, C441, E443, R453, T455, L562, S662, I664, and G786, which are close to each other in spatial conformation with reference to SEQ ID NO: 1.

[0260] In some embodiments of the first aspect, the functional variant is a natural isoenzyme of the amino acid sequence shown in SEQ ID NO: 1.

[0261] In some embodiments of the first aspect, the natural isoenzyme of the amino acid sequence shown in SEQ ID NO: 1 is from: Lactiplantibacillus plantarum, Escherichia coli, Lactobacillus selangorensis, Streptococcus uberis, Olsenella sp., Leptotrichia wadei, Streptococcus parauberis, Anaerostipes hadrus, Senella sp., Selenomonas ruminantium, Orenia metallireducens, Bifidobacterium primatium, Leptotrichia hofstadii, Ligilactobacillus agilis, Senella profusa, Clostridium butyricum, Vibrio ishigakensis, Mycobacteriaceae, Coriobacterium glomerans, Eggerthia catenaformis, Clostridium baratii str. Sullivan, Clostridiales, Firmicutes, Clostridium vincentii, Streptococcus downei, Erysipelotrichaceae, Quinella sp., Sebaldella termitidis, Ligilactobacillus animalis, Liquorilactobacillus satsumensis, Clostridium botulinum, Acetivibrio ethanolgignens, Aeromonas sobria, Clostridium cadaveris, Streptococcus bovimastitidis, Sodalis ligni, Lactococcus raffinolactis, Lactobacillus ultunensis, Leptotrichia sp., Lucifera butyrica, Fonticella tunisiensis, Cronobacter sakazakii, Liquorilactobacillus uvarum, Anaeromassilibacillus sp., Anaerobic rod-shaped bacteria (Anaerotruncus sp.), Beauveria bassiana, Cedecea lapagei, Streptococcus pneumoniae, Streptococcus suis, Aeromonas veronii, Lactococcus raffinolactis, Streptococcus sanguinis, Actinomyces succiniciruminis, Vagococcus humatus, Vibrio alginolyticus, Ligilactobacillus acidipiscis, Pilibacter termitis, Lachnospiraceae, Aeromonas hydrophila, Enterococcus ratti, Kandleria vitulina, Clostridium pasteurianum), Aeromonas allosaccharophila, Pantoea alhagi, Peptacetobacter hiranonis, Edwardsiella piscicida, Cedecea neteri, Chelonobacter oris, Aeromonas sp., Clostridium sp., Vibrio gazogenes, Melissococcus plutonius, Tolumonas sp., Loigolactobacillus coryniformis, Zooshikella ganghwensis, Vibrio sp., Photobacterium lipolyticum, Agrilactobacillus composti, Clostridium symbiosum, and Aerococcus sp.).

[0262] In some specific embodiments of the first aspect, the natural isoenzyme of the amino acid sequence shown in SEQ ID NO: 1 comprises the amino acid sequence shown in any one of SEQ ID NOs: 2-96.

[0263] In some embodiments of the first aspect, the present application provides a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 97 or a functional variant thereof, wherein the functional variant has 1,5-mannitol-6-phosphate isomerase activity. In some embodiments, the polypeptide has an active site defined as follows in spatial conformation: the active site comprises amino acid residues Q162, H169, S277, S278, R323, F331, P335, C431, E433, D445, Y628, V630, and G752, which are close to each other in spatial conformation with reference to SEQ ID NO: 97.

[0264] In some embodiments of the first aspect, the functional variant is a natural isoenzyme of the amino acid sequence shown in SEQ ID NO:97.

[0265] In some embodiments of the first aspect, the natural isoenzyme of the amino acid sequence shown in SEQ ID NO: 97 is from: Escherichia coli, Streptococcus dysgalactiae subsp. Equisimilis, Firmicutes, Pseudoleptotrichia goodfellowii, Edwardsiella tarda, Serratia odorifera, Gilliamella apicola, Vibrio, Lactobacillus selangorensis, Caloranaerobacter sp., Pilibacter termitis, Caloranaerobacter azorensis, Salmonella enteritidis, Tolumonas auensis, Senella porci, Mycobacteriaceae, Fonticella tunisiensis, Coriobacteriales, Bacillus sp., Actinobacillus rossii, Lactobacillus ultunensis, Clostridium estertheticum, Geosporobacter ferrireducens, Vibrio ishigakensis, Streptococcus merionis, Shigella boydii, Agrilactobacillus composti, Lactobacillus selangorensis, Vagococcus elongatus, Clostridium acidisoli, Caloramator quimbayensis, Clostridium uliginosum, Enterobacter asburiae, Atopobium minutum, Thermophilibacter immobilis, Photobacterium lipolytica, Citrobacter amalonaticus, Clostridium pasteurianum, Sebaruella termitinensis, Acididesulfobacillus acetoxydans and Clostridium spp.

[0266] In some specific embodiments of the first aspect, the natural isoenzyme of the amino acid sequence shown in SEQ ID NO: 97 comprises the amino acid sequence shown in any one of SEQ ID NOs: 98-144.

[0267] In some specific embodiments of the first aspect, the substrate of the polypeptide is 1,5-glycidol-6-phosphate.

[0268] In some specific embodiments of the first aspect, the 1,5-glycidol-6-phosphate is 1,5-glucitol-6-phosphate or 1,5-glycidol-6-phosphate.

[0269] In some specific embodiments of the first aspect, when the polypeptide has 1,5-glucitol-6-phosphate isomerase activity, it isomerizes 1,5-glucitol-6-phosphate to generate 1-deoxyfructose-6-phosphate as the product.

[0270] In some specific embodiments of the first aspect, when the polypeptide has 1,5-mannitol-6-phosphate isomerase activity, it isomerizes 1,5-mannitol-6-phosphate to generate 1-deoxyfructose-6-phosphate as the product.

[0271] In some embodiments of the first aspect, the functional variant is produced by insertion, substitution and / or deletion of one or more amino acids based on the amino acid sequence shown in SEQ ID NO: 1 or 97 or its natural isoenzyme.

[0272] In some embodiments of the first aspect, the insertion, substitution and / or deletion does not occur in the active site.

[0273] In some embodiments of the first aspect, the number of amino acid insertions, substitutions and / or deletions is 1-30, preferably 1-20, more preferably 1-10, wherein the obtained functional variants substantially retain unchanged 1,5-glucitol-6-phosphate isomerase (e.g., 1,5-glucitol-6-phosphate isomerase or 1,5-mannitol-6-phosphate isomerase) activity.

[0274] In some embodiments of the first aspect, the functional variant differs from the amino acid sequence shown in SEQ ID NO: 1 or 97 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid insertions, substitutions and / or deletions.

[0275] In some embodiments of the first aspect, the functional variant differs from the amino acid sequence shown in SEQ ID NO: 1 or 97 by about 1, 2, 3, 4 or 5 amino acid insertions, substitutions and / or deletions.

[0276] In some embodiments of the first aspect, the polypeptide is an isolated polypeptide.

[0277] In some embodiments of the first aspect, the polypeptide belongs to the glycine free radical enzyme family. When the polypeptide has 1,5-glucitol-6-phosphate isomerase or 1,5-mannitol-6-phosphate isomerase activity, its catalysis involves glycine and cysteine ​​free radicals.

[0278] In a second aspect, the present application provides a nucleic acid molecule encoding the polypeptide described in the first aspect.

[0279] In some embodiments of the second aspect, the nucleic acid molecule of the present application comprises a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence encoding a polypeptide as shown in any one of SEQ ID NOs: 1-96, or consists of a nucleic acid sequence that specifically hybridizes to a nucleotide sequence encoding a polypeptide as shown in any one of SEQ ID NOs: 1-96 and encodes a polypeptide that is functionally equivalent to the polypeptide as shown in any one of SEQ ID NOs: 1-96.

[0280] In some embodiments of the second aspect, the nucleic acid molecule of the present application comprises a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence encoding a polypeptide as shown in any one of SEQ ID NOs: 97-144, or consists of a nucleic acid sequence that specifically hybridizes to a nucleotide sequence encoding a polypeptide as shown in any one of SEQ ID NOs: 97-144 and encodes a polypeptide that is functionally equivalent to the polypeptide as shown in any one of SEQ ID NOs: 97-144.

[0281] Those skilled in the art can routinely select stringent conditions for DNA hybridization. Generally, longer probes require higher temperatures for proper annealing, while shorter probes require lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when the complementary strands are in an environment below their melting temperature. The higher the degree of homology between the probe and the hybridizable sequence, the higher the relative humidity that can be used. Thus, higher relative humidity often makes the reaction conditions more stringent, while at lower temperatures, the stringency is lower. For a detailed description of stringent conditions for hybridization reactions, please refer to Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

[0282] In some embodiments of the second aspect, the stringent conditions used for DNA hybridization include: 1) low ionic strength and high temperature during washing, such as 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate at 50°C; 2) use of a denaturing agent such as formamide during hybridization, such as 50% (v / v) formamide plus 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polydiene pyrrolidone / 50 mM sodium phosphate buffer, pH 6.5, and 750 mM sodium chloride and 75 mM sodium citrate at 42°C; or (3) overnight hybridization at 42°C, with a hybridization solution containing 50% formamide, 5×SSC (0.75 M sodium chloride, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5×Denhardt's solution, ultrasonicated salmon sperm DNA (50 mg / mL), 0.1% SDS and 10% dextran sulfate are then washed in 0.2×SSC (sodium chloride / sodium citrate) at 42° C. for 10 minutes, followed by a high stringency wash in 0.1×SSC containing EDTA at 55° C. Moderate stringency conditions can be determined as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989. Moderate stringency conditions involve the use of wash solutions and hybridization conditions (such as temperature, ionic strength, and SDS percentage) that are less stringent than those described above. For example, moderate stringency conditions involve hybridization with at least about 16% v / v to at least about 30% v / v formamide and at least about 0.5 M to at least about 0.9 M salt at 42° C., and a wash with at least about 0.1 M to at least about 0.2 M salt at 55° C. Moderately stringent conditions may also include hybridization with 1% bovine serum albumin (BSA), 1 mM EDTA, 0.5 M NaHPO4 (pH 7.2), and 7% SDS at 65°C, and washing with (i) 2×SSC, 0.1% SDS; or (ii) 0.5% BSA, 1 mM EDTA, 40 mM NaHPO4 (pH 7.2), and 5% SDS at 60-65°C. Practitioners will adjust temperature, ionic strength, and other factors based on probe length, among other factors. The degree of stringency when hybridizing nucleic acids depends on the length of the nucleic acid molecules and the degree of complementarity, as well as other variables well known in the art. The greater the similarity or homology between two nucleotide sequences, the greater the Tm of the nucleic acid hybrid containing those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybrids decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. Preferably, the minimum length of hybridizable nucleic acids is at least about 12 nucleotides, preferably at least about 16, more preferably at least about 24, and most preferably at least about 36 nucleotides.

[0283] The nucleic acid molecules of the present application can be combined with other DNA sequences, such as promoters, polyadenylation signals, other restriction enzyme cutting sites, multiple cloning sites, other coding segments, etc., so that their total length can vary significantly. It is therefore contemplated that polynucleotide fragments of almost any length can be utilized; the total length is preferably limited by the convenience of preparation and use in the intended recombinant DNA protocol.

[0284] Can utilize any one of known and obtainable multiple mature technology in the art to prepare, manipulate and / or express polynucleotide and its fusion.For example, the nucleic acid molecule of the polypeptide of coding present application or its functional variant can be used for recombinant DNA molecule to instruct polypeptide to express in suitable host cell.Due to the inherent degeneracy of genetic code, other DNA sequence dna of coding substantially identical or functionally equivalent amino acid sequence also can be used in the application, and these sequences can be used for cloning and expressing given polypeptide.

[0285] Furthermore, the nucleic acid molecules of the present application can be modified using methods well known in the art, including but not limited to changes in cloning, processing, expression and / or activity of gene products.

[0286] In some embodiments of the second aspect, the nucleic acid molecule is produced by artificial synthesis, such as direct chemical synthesis or enzymatic synthesis.

[0287] In some embodiments of the second aspect, the nucleic acid molecule is produced by recombinant technology.

[0288] In some embodiments of the second aspect, the nucleic acid molecule is an isolated nucleic acid molecule.

[0289] In a third aspect, the present application provides an expression cassette comprising the nucleic acid molecule described in the second aspect.

[0290] In some specific embodiments of the third aspect, the expression cassette may further comprise a 5' leader sequence, which can function to enhance translation.

[0291] In preparing the expression cassette, the various DNA fragments may be manipulated to provide the DNA sequence in the proper orientation and, where appropriate, the proper reading frame. To achieve this, adapters or linkers may be employed to join the DNA fragments, or other manipulations may be involved to provide convenient restriction sites, remove excess DNA, remove restriction sites, etc. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, and then substitutions, such as transitions and transversions, may be involved.

[0292] In a fourth aspect, the present application provides an expression vector comprising the nucleic acid molecule described in the second aspect or the expression cassette described in the third aspect.

[0293] In some embodiments of the fourth aspect, any suitable expression vector can be used in the present application, for example, the expression vector can be a vector suitable for the E. coli system of the present application. In some embodiments, the expression vector can be any one of HT, pACYC and the like.

[0294] In some embodiments of the fourth aspect, a nucleic acid molecule encoding a polypeptide shown in any one of SEQ ID NOs: 1-96, or a nucleic acid molecule encoding a polypeptide shown in any one of SEQ ID NOs: 97-144 is cloned into a vector to form a recombinant vector containing the nucleic acid molecule described in the present application.

[0295] In some embodiments of the fourth aspect, the expression vector used to clone the polynucleotide is a plasmid vector.

[0296] In some embodiments of the fourth aspect, the expression vector further comprises a regulatory sequence for regulating expression of the nucleic acid molecule, wherein the nucleic acid molecule is operably linked to the regulatory sequence.

[0297] As used herein, the term "regulatory sequence" refers to a polynucleotide sequence required to achieve expression of the coding sequence to which it is linked. The nature of such regulatory sequences varies depending on the host organism. In prokaryotes, such regulatory sequences generally include promoters, ribosome binding sites, and terminators; in eukaryotes, such regulatory sequences generally include promoters, terminators, and, in some cases, enhancers. Thus, the term "regulatory sequence" includes all sequences whose presence is minimally necessary for expression of the gene of interest, and may also include other sequences whose presence is beneficial for expression of the gene of interest, such as leader sequences.

[0298] As used herein, the term "operably linked" refers to a situation in which the sequences involved are in a relationship permitting them to function in their intended manner. Thus, for example, a regulatory sequence "operably linked" to a coding sequence allows expression of the coding sequence to be achieved under conditions compatible with the regulatory sequences.

[0299] In some embodiments of the fourth aspect, an expression vector comprising a nucleotide sequence encoding a polypeptide set forth in any one of SEQ ID NOs: 1-96 or a nucleotide sequence encoding a polypeptide set forth in any one of SEQ ID NOs: 97-144 and appropriate transcriptional / translational regulatory elements is constructed using methods well known to those skilled in the art. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, and the like (Sambroook et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1989). The nucleotide sequence is operably linked to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include: the lac or trp promoter of Escherichia coli; the PL promoter of λ phage; eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoter, retroviral LTRs, and other known promoters that can control gene expression in prokaryotes or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Inserting an enhancer sequence into a vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors of DNA expression, typically about 10 to 300 base pairs, that act on the promoter to increase gene transcription. Examples include the SV40 enhancer on the late side of the replication origin (100 to 270 base pairs), the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

[0300] In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as those encoding resistance to kanamycin sulfate, resistance to ampicillin, and the like.

[0301] In a fifth aspect, the present application provides a host cell comprising the nucleic acid molecule described in the second aspect, the expression cassette described in the third aspect, or the expression vector described in the fourth aspect.

[0302] In some embodiments of the fifth aspect, the host cell is capable of expressing and producing: a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1 or 97 or a functional variant thereof, wherein the functional variant has 1,5-glycidol-6-phosphate isomerase activity.

[0303] In some embodiments of the fifth aspect, the host cell is capable of expressing and producing: a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1 or a functional variant thereof, wherein the functional variant has 1,5-glucitol-6-phosphate isomerase activity. In some embodiments, the polypeptide has an active site defined as follows in spatial conformation: the active site comprises amino acid residues H165, H282, S283, H334, C441, E443, R453, T455, L562, S662, I664, and G786, which are close to each other in spatial conformation with reference to SEQ ID NO: 1.

[0304] In some embodiments of the fifth aspect, the host cell is capable of expressing and producing: a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 97 or a functional variant thereof, wherein the functional variant has 1,5-mannitol-6-phosphate isomerase activity. In some embodiments, the polypeptide has an active site defined as follows in spatial conformation: the active site comprises amino acid residues Q162, H169, S277, S278, R323, F331, P335, C431, E433, D445, Y628, V630, and G752, which are close to each other in spatial conformation with reference to SEQ ID NO: 97.

[0305] In some embodiments of the fifth aspect, the host cell further expresses: an activating enzyme, an aldolase, a hydroxyacetone reductase, and / or a transport complex.

[0306] In some embodiments of the fifth aspect, the host cell further expresses the S-adenosylmethionine free radical enzyme family glycine free radical enzyme activating enzyme (enzyme classification number is EC: 1.97.1.4), 1-deoxyfructose-6-phosphate aldolase (also known as fructose-6-phosphate aldolase, its enzyme classification number is EC: 4.1.2-), hydroxyacetone reductase (also known as glycerol dehydrogenase, its enzyme classification number is EC: 1.1.1.6), and / or the transport complex of the polypeptide of the first aspect.

[0307] In some embodiments of the fifth aspect, the transport complex has phosphoenolpyruvate-phosphotransferase system transport activity.

[0308] In some embodiments of the fifth aspect, the transport complex is a phosphoenolpyruvate-phosphotransferase system.

[0309] In some embodiments of the fifth aspect, the transport complex comprises at least one of SEQ ID NOs: 150-153 or a functional variant thereof.

[0310] In some embodiments of the fifth aspect, the transport complex comprises at least two of SEQ ID NOs: 150-153 or functional variants thereof.

[0311] In some embodiments of the fifth aspect, the transport complex comprises at least three of SEQ ID NOs: 150-153 or functional variants thereof.

[0312] In some embodiments of the fifth aspect, the transport complex comprises SEQ ID NO: 150-153 or a functional variant thereof.

[0313] In some embodiments of the fifth aspect, SEQ ID NOs: 150-153 represent the amino acid sequences of multiphosphoryl transfer protein 2 (PtsA), PTS system fructose-like EIIB component 2 (FrwB), PTS system fructose-like permease EIIC component 2 (FrwC), and PTS system fructose-like EIIB component 3 (FrwD), respectively.

[0314] In some specific embodiments of the fifth aspect, the four sequences shown in SEQ ID NO: 150-153 constitute a phosphoenolpyruvate-phosphotransferase system, wherein PtsA contains EⅠ and EⅡA domains, FrwC is EⅡC, and FrwB and FrwD are EⅡB.

[0315] In some specific embodiments of the fifth aspect, PtsA, FrwB, FrwC, and FrwD interact to form a transport complex that exerts phosphoenolpyruvate-phosphotransferase system transport activity. In some embodiments, the transport complex transports 1,5-glycidol (e.g., 1,5-glucitol or 1,5-glycidol) into the host cell for subsequent glycolysis.

[0316] In some embodiments of the fifth aspect, the functional variant of any one of SEQ ID NOs: 150-153 differs from the corresponding amino acid sequence shown in any one of SEQ ID NOs: 150-153 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid insertions, substitutions and / or deletions.

[0317] In some embodiments of the fifth aspect, the functional variant of any one of SEQ ID NOs: 150-153 differs from the corresponding amino acid sequence shown in any one of SEQ ID NOs: 150-153 by about 1, 2, 3, 4 or 5 amino acid insertions, substitutions and / or deletions.

[0318] In some embodiments of the fifth aspect, the host cells used are cells containing the above-mentioned expression vectors, which may be eukaryotic cells. For example, yeast cell culture systems can be used to express the polypeptides of the present application. The host cells may also be prokaryotic cells containing the above-mentioned expression vectors, for example, selected from the genus Escherichia (e.g., Escherichia coli), Klebsiella, Streptococcus, Lactobacillus, Bifidobacterium, Bacteroidetes, and Firmicutes.

[0319] In some specific embodiments of the fifth aspect, the host cell is a yeast cell or Escherichia coli.

[0320] In some specific embodiments of the fifth aspect, the nucleic acid molecules encoding one or more enzymes of the present application may exist in the host cell in the form of a free vector, or may be integrated into the genome of the host cell.

[0321] In some embodiments of any of the above aspects, the isolated nucleic acid is operably linked to a regulatory sequence that can be recognized by a host cell transformed with the expression vector.

[0322] The expression vector can be introduced into the host cell using any technique known in the art, including transformation, transduction, transfection, viral infection, gene gun or Ti-mediated gene transfer. Specific methods include calcium phosphate transfection, DEAE-dextran-mediated transfection, lipofection or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)). As an example, when the host is a prokaryotic organism such as Escherichia coli, competent cells can be harvested after the exponential growth phase and transformed using the CaCl2 method well known in the art.

[0323] In a sixth aspect, the present application provides a composition comprising the polypeptide described in the first aspect.

[0324] In some embodiments of the sixth aspect, the composition further comprises: an activase, an aldolase, and / or a hydroxyacetone reductase.

[0325] In some specific embodiments of the sixth aspect, the composition comprises: 1,5-glycidol-6-phosphate isomerase, S-adenosylmethionine free radical enzyme family glycine free radical enzyme activating enzyme, 1-deoxyfructose-6-phosphate aldolase, and hydroxyacetone reductase.

[0326] In some embodiments of the sixth aspect, the S-adenosylmethionine free radical enzyme family glycine free radical enzyme activating enzyme is an activating enzyme of 1,5-glycidol-6-phosphate isomerase. In some embodiments, the S-adenosylmethionine free radical enzyme family glycine free radical enzyme activating enzyme comprises a [Fe-S] cluster. In some embodiments, the S-adenosylmethionine free radical enzyme family glycine free radical enzyme activating enzyme comprises a [4Fe-4S] cluster, i.e., comprises 4 Fe and 4 S. In some embodiments, the S-adenosylmethionine free radical enzyme family glycine free radical enzyme activating enzyme catalyzes the cleavage of S-adenosylmethionine (SAM).

[0327] In some embodiments of the sixth aspect, the aldolase is 1-deoxyfructose-6-phosphate aldolase.

[0328] In some embodiments of the sixth aspect, the composition is used to catalyze the production of 1,2-propylene glycol from 1,5-glycidol-6-phosphate.

[0329] In some embodiments of the sixth aspect, the 1,5-glucitol-6-phosphate is 1,5-glucitol-6-phosphate or 1,5-glucitol-6-phosphate.

[0330] In the seventh aspect, the present application provides the use of the polypeptide described in the first aspect, the nucleic acid molecule described in the second aspect, the expression cassette described in the third aspect, the expression vector described in the fourth aspect, and the host cell described in the fifth aspect in preparing a composition for catalyzing 1,5-dihydroglycidol-6-phosphate to produce 1,2-propylene glycol.

[0331] In some embodiments of the seventh aspect, the 1,5-glucitol-6-phosphate is 1,5-glucitol-6-phosphate or 1,5-glycidol-6-phosphate.

[0332] In some specific embodiments, 1,5-glucitol is transported into the host cell by the transport complex (e.g., a transport complex having phosphoenolpyruvate-phosphotransferase system transport activity) and is phosphorylated (e.g., at the C-6 position) to generate 1,5-glucitol-6-phosphate; 1,5-glucitol-6-phosphate is converted into 1-deoxyfructose-6-phosphate under the catalysis of 1,5-glucitol-6-phosphate isomerase; 1-deoxyfructose-6-phosphate is cleaved by aldolase (e.g., 1-deoxyfructose-6-phosphate aldolase) to generate hydroxyacetone and 3-phosphate glyceraldehyde; and hydroxyacetone is reduced by hydroxyacetone reductase to generate 1,2-propanediol.

[0333] In some specific embodiments, 1,5-mannitol is transported into the host cell by the transport complex (e.g., a transport complex having phosphoenolpyruvate-phosphotransferase system transport activity) and is phosphorylated (e.g., at the C-6 position) to generate 1,5-mannitol-6-phosphate; 1,5-mannitol-6-phosphate is catalyzed by 1,5-mannitol-6-phosphate isomerase to generate 1-deoxyfructose-6-phosphate; 1-deoxyfructose-6-phosphate is cleaved by aldolase (e.g., 1-deoxyfructose-6-phosphate aldolase) to generate hydroxyacetone and 3-phosphate glyceraldehyde; hydroxyacetone is reduced by hydroxyacetone reductase to generate 1,2-propanediol.

[0334] In an eighth aspect, the present application provides a method for producing 1,2-propanediol, comprising culturing the host cell according to the fifth aspect in a culture medium containing 1,5-glycidol to obtain 1,2-propanediol.

[0335] In some embodiments of the eighth aspect, the 1,5-glycidol is 1,5-glucitol or 1,5-glycidol.

[0336] In some embodiments of the eighth aspect, the method further comprises the steps of collecting the culture and purifying the 1,2-propanediol.

[0337] In a ninth aspect, the present application provides a method for producing 1,2-propylene glycol, comprising contacting the composition according to the sixth aspect with 1,5-glycidol-6-phosphate to obtain 1,2-propylene glycol.

[0338] In some embodiments of the ninth aspect, the 1,5-glucitol-6-phosphate is 1,5-glucitol-6-phosphate or 1,5-glycidol-6-phosphate.

[0339] Example

[0340] The following examples are illustrative only and are not intended to limit the scope of the embodiments of the present application or the scope of the appended claims.

[0341] Example 1. Identification, characterization, and testing of YbiW-related pathways

[0342] Materials and Methods

[0343] Experimental Materials

[0344] Tryptone and yeast extract used to prepare LB medium were purchased from Oxoid Limited (Hampshire, UK). Ultrapure deionized water from Millipore Direct-Q was used. TALON resin was purchased from Clontech Laboratories Inc (California, USA). 1,5-anhydroglucitol (1,5-AG) was purchased from Shanghai Yuanye Biotechnology Co., Ltd., and 1,5-anhydroglucitol-6-phosphate (1,5-AG-6P) was chemically synthesized by Tianjin Xiens Biochemical Technology Co., Ltd. Direct-Q oligonucleotide primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. All protein purification chromatography experiments were performed in The anaerobic experiments were performed in a Lab2000 glove box (Etelux) protected by N2 (oxygen concentration less than 5 ppm).

[0345] Gene synthesis and cloning

[0346] LpYbiW (Uniprot accession number: A0A807DR53) and LpYbiY (Uniprot accession number: A0A162FGG2) gene fragments and the codon-optimized LpFsaA (Uniprot accession number: A0A0M4CJJ6) gene fragment from E. coli were synthesized by Beijing Qingke Biotechnology Co., Ltd. LpYbiW and LpFsaA were inserted into the SspI site of the HT plasmid (optimized pET28 vector) to express proteins with an N-terminal His6 tag. LpYbiY was inserted into the NdeI site of the pACYC-MBP vector to express the maltose binding protein (MBP) protein with an N-terminal His6 tag.

[0347] For biochemical characterization, EcYbiW (Uniprot Accession No.: P75793) and EcYbiY (Uniprot Accession No.: P75794) were amplified from the E. coli MG1655 genome using primers 18F / 18R and 19F / 19R (Table 6). EcYbiW was inserted into the SspI site of the HT plasmid (an optimized pET28 vector) to express the protein with an N-terminal His6 tag. EcYbiY was inserted into the NdeI site of the pACYC-MBP vector to express the maltose binding protein (MBP) protein with an N-terminal His6 tag.

[0348] Expression and purification of LpYbiW, LpYbiY, and LpFsaA

[0349] HT-LpYbiW, pACYC-MBP-LpYbiY and HT-LpFsaA were plasmidized and transformed into Escherichia coli BL21 (DE3) cells to express the corresponding proteins. LpYbiW and LpFsaA were screened on LB agar plates containing 50 μg / mL kanamycin, while LpYbiY positive clones were screened on LB agar plates containing 25 μg / mL chloramphenicol. The cells were cultured overnight in 4 mL of LB medium and then transferred to fresh LB medium (usually 1 L in a 2.6 L flask) and grown in a shaking incubator at 37 ° C and 220 rpm. When the OD 600 When the pH reaches approximately 0.8, the temperature is lowered to 18°C ​​and isopropyl β-D-1-thiogalactopyranoside (IPTG) is added to a final concentration of 0.3 mM to induce the production of the target protein. After 16-20 hours, the cells are harvested by centrifugation (8000 g, 4°C for 10 minutes). The harvested cells are resuspended in 40 mL of lysis buffer (50 mM Tris / HCl, pH 8.0, 100 mM KCl, 1 mM phenylmethylsulfonyl fluoride (PMSF), 0.2 mg / mL lysozyme, 0.03% Triton X-100, and 0.02 mg / mL DNase I) and stored in a -80°C freezer.

[0350] The above-mentioned frozen cells were thawed and incubated at room temperature (RT, 25°C) for 20 minutes, during which time cell lysis occurred. 5mM β-mercaptoethanol (BME) was added and nucleic acids were removed by precipitation with 1% streptomycin sulfate. Cell debris was removed by centrifugation at 10,000×g for 10 minutes at 4°C. For LpYbiW and LpFsaA, the supernatant was filtered with a 0.22 μm filter and loaded into 5 mL TALON Co pre-equilibrated with buffer A (20mM Tris / HCl, pH 7.5, 200mM KCl and 5mM BME). 2+ The protein was eluted using a 10-column volume of buffer A on a 400 nm HPLC column (Takara Bio USA, Inc.). Contaminants were washed off using 10 column volumes of buffer A, followed by elution of the protein with 5 column volumes of buffer A containing 150 mM imidazole. The eluted protein (~20 mL) was dialyzed against 2 L of buffer A at 4°C for 3 hours, concentrated, aliquoted, frozen in liquid nitrogen, and stored at -80°C. For LpYbiY, the supernatant was filtered and loaded onto a 10 mL amylose column (New England Biolabs, Massachusetts, USA). Contaminants were washed off using 10 column volumes of buffer A, followed by elution of the target protein with buffer A containing 10 mM maltose.

[0351] The purified proteins were detected by SDS-PAGE using commercial gels (SurePAGE, Bis-Tris, 4-20%). The absorption of the proteins at 280 nm was measured using an ultra-micro UV-visible spectrophotometer (Hangzhou Miou Instrument Co., Ltd.) to calculate their concentrations. 280 =104,630M -1 cm -1 ),MBP-LpYbiY(ε 280 =100,730M -1 cm -1 ),LpFsaA(ε 280 =20,400M -1 cm -1 )].

[0352] Expression and purification of EcYbiW and EcYbiY for biochemical characterization

[0353] The protein expression and purification methods and processes, SDS-PAGE detection methods, and concentration determination methods are the same as those for LpYbiW and LpYbiY. 280 =99,700M -1 cm -1 ),MBP-EcYbiY(ε 280 =97,750M -1 cm -1 )].

[0354] Reconstruction and Characterization of LpYbiY Prosthetic Group [Fe-S] Cluster

[0355] Sequence alignment revealed that LpYbiY contains only one [4Fe–4S] cluster in the radical SAM domain, with a theoretical maximum of 4Fe and 4S per monomer. The LpYbiY protein solution was degassed with argon and brought into a glove box. To the deoxygenated protein solution, a final concentration of 100 mM Tris / HCl, pH 7.5, 10 mM DTT, 4 equivalents of ferrous ammonium sulfate, and sodium sulfide were added, and the solution was incubated overnight at 4°C in a metal bath (Dry Bath H2O3-100°C; Coyote Bioscience, Beijing, China). 4 equivalents of EDTA were then added, and the solution was repeatedly concentrated using centrifugal ultrafiltration tubes (1.5 mL Ym-30 Amicon; Millipore) and diluted with buffer (20 mM Tris-HCl, pH 7.5, 100 mM KCl).

[0356] The iron content of unconstructed and constructed LpYbiY was determined using phenanthroline [3-(2-pyridyl)-5,6-diphenyl-1,2,4-triazine-p,p'-disulfonic acid monosodium salt]. A calibration curve for Fe was constructed over the range of 0–600 μM using an AAS iron standard. The sulfur content of unconstructed and constructed LpYbiY was determined by measuring the absorbance of methylene blue formed by reaction with N,N-dimethyl-p-phenylenediamine dihydrochloride (DPD). A calibration curve for S was constructed over the range of 0–600 μM using Na2S.

[0357] LpYbiY UV-Vis absorption spectra in the 200-800 nm range were measured using a nanophotometer NP80 Mobile (Germany). Unconstructed and reconstituted LpYbiY were diluted to 10 μM in a buffer containing 20 mM Tris / HCl, pH 7.5, and 100 mM KCl and transferred to a septum-sealed anaerobic cuvette for measurement. To measure the reduced form, 10 equivalents of titanium(III) citrate were added to the reconstituted LpYbiY solution and incubated for 10 minutes.

[0358] LC-MS Analysis of S-adenosylmethionine (SAM) Cleavage Catalyzed by LpYbiY

[0359] A 500 μL reaction containing 20 mM Tris / HCl, pH 7.5, 100 mM KCl, 200 μM titanium (III) citrate, 20 μM reconstituted LpYbiY, and 1 mM SAM was incubated overnight at room temperature in a glove box. Titanium (III) citrate was not added for the negative control. The reaction was quenched by adding formic acid (5% v / v final concentration) and incubated in a boiling water bath for 1 minute to denature the protein. Precipitated protein was removed by centrifugation at 14,000 × g for 15 minutes. The supernatant was filtered using a 0.22 μm PES membrane and analyzed by LC-MS. The method was as follows: 20 μL of sample was loaded onto an Agilent 6420 Triple Quadrupole LC / MS instrument (Agilent Technologies) equipped with a C18 reverse-phase column. UV absorbance was monitored at 257 nm. The mobile phase consisted of water (A) and acetonitrile (B), with a linear gradient of 0-16% B over 30 minutes at a flow rate of 0.5 mL / min. The formation of LpYbiY-catalyzed SAM cleavage products was verified by mass spectrometry using commercial 5'-dA as a standard.

[0360] Electron paramagnetic resonance (EPR) spectroscopy detection of LpYbiW free radical generation

[0361] The LpYbiW glycine radical was characterized using continuous wave X-band electron paramagnetic resonance (EPR) spectroscopy. A 200 μL reaction containing 20 mM Tris / HCl, pH 7.5, 100 mM KCl, 100 μM titanium(III) citrate, 1 mM SAM, 80 μM reconstituted LpYbiY, and 40 μM LpYbiW was incubated in a glove box at room temperature for 15 minutes. 10% glycerol was added and the reaction mixture was placed in a 4 mm outer diameter, 8-inch long EPR tube (Wilmad Lab Glass, 734-LPV-7). The tube was sealed with a rubber stopper, removed from the glove box, and frozen in liquid nitrogen prior to EPR analysis. The experimental spectrum of the glycine radical was modeled using a Bruker Xepr spin fit to obtain g values, hyperfine coupling constants, and line widths. Double integration of the simulated spectrum was used to measure the spin concentration. The EPR spectrum was obtained by superposition of 30 scans, and the test conditions were as follows: temperature, 90 K; central field, 3370.00 Gauss; range, 200 Gauss; microwave power, 10 μW; microwave frequency, 9.43 MHz; modulation amplitude, 0.5 mT; modulation frequency, 100 kHz; time constant, 20.48 ms; conversion time, 25 ms; scan time, 20 s; and receiving gain, 43 dB.

[0362] LC-MS analysis of LpYbiW activity assay

[0363] LpYbiW was activated as described for the EPR experiment above, except that glycerol was not added. A 200 μL reaction mixture containing 10 μM activated LpYbiW, 0.1 mM titanium(III) citrate, and 10 mM 1,5-AG-6P was incubated in a glove box at room temperature for 1 hour. Negative controls were performed without the addition of 1,5-AG-6P, SAM, or activated LpYbiW. Protein was precipitated by adding 200 μL of acetonitrile to the reaction mixture, and the precipitate was removed by centrifugation. The supernatant was filtered through a 0.22 μm PES membrane and analyzed by LC-MS.

[0364] LC-MS analysis was performed on an Agilent 6420 Triple Quadrupole LC / MS instrument (Agilent Technologies). The drying gas temperature was maintained at 300°C, the flow rate was 9 L / min, and the nebulizer pressure was 15 psi. A ZIC-HILIC column (5 mm, LC-MS analysis was performed using a 150 × 4.6 mm (150 × 4.6 mm; Merck). HPLC conditions were as follows: mobile phase A was 90% 20 mM ammonium acetate and 10% acetonitrile, and mobile phase B was acetonitrile; gradient elution was performed from 90% B to 70% B over 10 minutes and from 70% B to 50% B over 20 minutes. The flow rate was set at 0.5 mL / min. The mass spectrometer was operated in ESI negative ion mode.

[0365] LC-MS analysis of EcYbiW activity assay

[0366] The LC-MS analysis experimental method for EcYbiW activity determination was the same as the LC-MS analysis method for LpYbiW activity determination.

[0367] LC-MS analysis of the activity of LpFsaA coupled to LpYbiW

[0368] A 200 μL reaction mixture containing 10 μM activated LpYbiW, 0.1 mM titanium(III) citrate, and 10 mM 1,5-AG-6P was incubated in a glove box at room temperature for 1 hour before the enzymatic activity of LpFsaA coupled to LpYbiW was determined. After adding 10 μM LpFsaA to the reaction system and incubating for an additional hour in the glove box, 50 μL of the reaction sample was mixed with 550 μL of 0.73 M sodium acetate (pH 5.0) and then with 400 μL of freshly prepared 2,4-dinitrophenylhydrazine (DNPH) solution (20 mg dissolved in 50 mL of methanol). The mixture was then incubated at 50°C for 1 hour. The mixture was centrifuged at 13,000 × g for 5 minutes and filtered prior to LC-MS analysis. Product standards were prepared by treating 3-phosphoglyceraldehyde (5 mM, Sigema-Aldrich) and hydroxyacetone (2 mM, TCI) standards with sodium acetate (pH 5.0) and freshly prepared 2,4-dinitrophenylhydrazine (DNPH) for 1 h.

[0369] LC-MS analysis was performed on an Agilent ZORBAX SB-C18 reversed-phase column (4.6 x 250 mm) using negative ion electrophoresis (ESI) mode. The solvent system consisted of solvents C (deionized ultrapure water containing 0.1% formic acid) and D (chromatographic acetonitrile containing 0.1% formic acid). Liquid chromatography analysis was performed using the following procedure: elution from 15% to 100% D over 15 minutes at a flow rate of 1.0 mL / min, with detection set at a wavelength of 360 nm.

[0370] LC-MS analysis of LpFsaA activity

[0371] The activity of LpFsaA in catalyzing the aldol condensation of hydroxyacetone and glyceraldehyde-3-phosphate was also assayed: a 200 μL reaction containing 50 mM Tris / HCl, pH 8.0, 100 mM KCl, 5 mM glyceraldehyde-3-phosphate, 10 mM hydroxyacetone, and 10 μM LpFsaA was incubated at room temperature for 1 hour. A negative control without the addition of glyceraldehyde-3-phosphate, hydroxyacetone, or LpFsaA was performed. LC-MS analysis was performed using a ZIC-HILIC column, using the same sample preparation and elution conditions as described for the LpYbiW activity assay.

[0372] Determination of Michaelis-Menten kinetic parameters of LpYbiW

[0373] The Michaelis-Menten kinetic parameters of LpYbiW were determined by coupling LpFsaA and EcGldA. 340nm The reaction rate of LpYbiW was monitored by measuring the consumption of NADH at 50 nm. Using a micro-volume UV-visible spectrophotometer in cuvette mode (1 cm path length) in a glove box, the absorbance change at 340 nm was measured every 5 seconds. These reactions consisted of 100 nM activated LpYbiW, 20 mM Tris / HCl, pH 7.5, 100 mM KCl, varying concentrations of 1,5-glucitol-6-phosphate, 5 μM LpFsaA, 5 μM EcGldA, and 0.4 mM NADH.

[0374] Construction of EcYbiW expression plasmid for crystallographic studies

[0375] The Escherichia coli gene encoding YbiW (EcYbiW, Uniprot Accession No. P75793) was amplified by PCR using primer pair 5F / 5R and inserted into the NdeI site of the pACYC vector. Site-directed mutagenesis of the plasmid pACYC-EcYbiW was then performed using primer pair 6F / 6R. This generated plasmid pACYC-EcYbiW (E114A, E115A, and K117A, representing amino acid mutations from glutamic acid (E) and lysine (K) to alanine (A) at positions 114, 115, and 117, respectively). This mutant expresses EcYbiW with reduced surface entropy, improving the success rate of protein crystallization screening.

[0376] Expression and purification of EcYbiW for crystallographic studies

[0377] Plasmid pACYC-EcYbiW (E114A, E115A, and K117A) was transformed into E. coli BL21 (DE3) cells and positive clones were screened using LB agar plates containing 25 μg / mL chloramphenicol. A single clone was cultured overnight in 4 mL of LB medium, inoculated into 1 L of fresh LB medium, and cultured at 37°C, 220 rpm until OD 600About 0.8, 0.3mM IPTG was added to induce expression at 18 ° C for 16 hours. The cells in 1L culture were collected by centrifugation (8000×g, 10 minutes) and resuspended in 40mL lysis buffer (50mM Tris / HCl, pH 8.0, 100mM KCl, 0.03% Triton X-100). The cells were lysed by ultrasonication and centrifuged at 10000×g for 10 minutes at 4 ° C to remove the insoluble cell pellet. The supernatant was filtered through a 0.45μm filter and applied to 10mL TALONC Co 2+ The protein of the present invention is concentrated into 500mM KCl and 100mM BME buffer solutions.Then the protein solution is washed with 10 times of column volumes of buffer A (20mM Tris / HCl, pH 7.5, 200mM KCl and 5mM BME), and eluted with the buffer A that contains 150mM imidazoles of 5 column volumes.This eluent was dialyzed 3 hours at 2L buffer B (20mM Tris / HCl, pH 7.5, 5mM BME), then loaded onto 10mL DEAE posts, and carried out linear elution with the buffer B that is 0 to 500mM KCl with 30 times of column volumes of salt gradient.Collect the component that contains EcYbiW, and be concentrated to about 5mL by ultrafiltration.Then the protein solution is injected among the Superdex200 gel filtration column (300mL), and with buffer C (20mM Tris / HCl, pH 7.5, 100mM KCl, 1mM DTT) elution.The sample eluent from gel filtration column is concentrated into 13.3mg / mL again, is used for crystallographic research.

[0378] Crystallization, data collection, and structure determination of EcYbiW

[0379] Initial screening of EcYbiW crystals was performed by the sitting drop method using an automated liquid handling robotic system in a 96-well format (Gryphon, Art Robbins). Screening was performed at 291 K using various crystal screening kits from Hampton Research and Molecular Dimensions. After further optimization using the hanging drop method in 24-well plates, crystals were obtained for single crystal X-ray diffraction studies. The optimal conditions for producing EcYbiW bulk crystals were 0.2 M NaCl, 0.1 M Tris, pH 8.0, 25% PEG3350 plus 10 mM 1,5-AG-6P, and a 6.7 mg / mL EcYbiW protein solution. A crystallization solution containing 15% glycerol was used as a cryoprotectant and rapidly cooled in liquid nitrogen. Diffraction data were collected and processed on BL10U2 at the Shanghai Synchrotron Radiation Facility (SSRF) with a resolution of Molecular replacement was performed using the PHENIX software using a crystal structure model created using the PHYRE2 website. The structure was manually constructed using Coot software based on electron cloud orientation and further refined in PHENIX before being uploaded to the RCSB Protein Data Bank (accession code: 8ID7). The appendix contains data for data collection and the final refined crystal structure (Table 1). All structural figures were generated using UCSF Chimera (Figures 4A and 4B).

[0380] Identification of the active site of 1,5-glucitol-6-phosphate isomerase

[0381] The obtained crystals of EcYbiW and 1,5-AG-6P complex (resolution ) were displayed using UCSF Chimera software. The amino acid residues within the range are displayed. Based on the hydrogen bond distance formed between the substrate and the amino acid residue, the key amino acid residues in the active center of 1,5-glucitol-6-phosphate isomerase that bind to the substrate were determined. Combined with the catalytic mechanism of glycine free radical 1,2-lyase in the literature, the key amino acid residues in the active center of 1,5-glucitol-6-phosphate isomerase were determined.

[0382] Identification of Isozymes of 1,5-Glucitol-6-phosphate Isomerase

[0383] To identify isoenzymes of 1,5-glucitol-6-phosphate isomerases within the glycine radical enzyme (GRE) family, a sequence similarity network (SSN) was constructed of 25,347 unique sequences from InterPro family IPR004184 using the web-based Enzyme Function Initiative-Enzyme Similarity Tool (EFI-EST). The alignment score threshold was set to 250, and the minimum sequence length was set to 650. The representative node network (RepNode network) at 80% similarity was visualized using Cytoscape v3.519. Under these settings, previously characterized GREs with different catalytic activities were grouped into distinct clusters.

[0384] Sequences with a similarity of 80% or greater were represented by a single node. Sequences were collapsed to reduce the total number of nodes, making less complex networks easier to load in Cytoscape. For clusters formed by YbiW, a representative sequence was selected from each node. Based on the crystal structure of the complex formed by EcYbiW and its substrate, amino acid residues that interact with the substrate were identified as conserved sites for multiple sequence alignment. Sequences containing these conserved sites were retained. These sequences were further analyzed for their proximity to adjacent genes, retaining sequences containing aldolase within the gene cluster and ultimately selecting a representative sequence.

[0385] Results, Analysis, and Discussion

[0386] While conducting a bioinformatics analysis of glycine radical enzyme (GRE) sequences in the UniProt database, the inventors of the present application noticed that a GRE of unknown function (YbiW) appeared in a gene cluster involved in sugar metabolism. In addition to YbiW and its activating enzyme (YbiY), the gene cluster also contains an aldolase (FsaA). This aldolase catalyzes the conversion of hydroxyacetone, 1,3-dihydroxyacetone, and 3-phosphoglyceraldehyde to the corresponding 2-keto-hexose-6-phosphate. Based on this, the inventors of the present application hypothesized that this GRE is involved in sugar metabolism, and its substrate may be a hexose phosphate. Combined with molecular docking results, the inventors of the present application speculated that the substrate of YbiW is 1,5-glucitol-6-phosphate (1,5-AG-6P), and proposed a new free radical-dependent glycolysis pathway. In this pathway, 1,5-AG-6P is catalyzed by YbiW to cleave the CO bond, generating 1-deoxyfructose-6-phosphate. This product is further cleaved by the aldolase FsaA to produce hydroxyacetone and glyceraldehyde-3-phosphate (Figure 1A).

[0387] To prove the conjecture of the present inventors, the present inventors selected YbiW, YbiY and FsaA genes from Lactiplantibacillus plantarum, then heterologously expressed them in Escherichia coli BL21 (DE3) cells, and characterized the activities of these proteins.

[0388] The inventors of this application reconstructed the prosthetic group [Fe-S] of the activating enzyme LpYbiY 2+ The anaerobic reconstitution of the [4Fe-4S] cluster resulted in the production of 1.54±0.12Fe and 2.01±0.08S per monomer (a radical SAM domain, the theoretical maximum of 4Fe and 4S for the [4Fe-4S] cluster) and a representative UV-visible spectrum of proteins containing [4Fe-4S], molar extinction coefficient ε 410nm 8.85mM -1 cm-1 (Figure 7B). The ε of each [4Fe-4S] cluster 410nm About 15mM -1 cm -1 , the inventors estimated that each monomer contained approximately 0.59 [4Fe-4S], which is roughly consistent with the measured Fe and S contents (Figure 7A). LC-MS analysis revealed that, like other free radical SAM enzymes, LpYbiY catalyzed the cleavage of SAM in the presence of the reducing agent titanium(III) citrate, forming 5'-deoxyadenosine (Figures 7C-7D). EPR spectroscopy revealed the formation of free radicals upon incubation of LpYbiW, LpYbiY, SAM, and Ti(III), with the generated free radicals quantified at 0.017 Gly· / dimer (Figure 2A).

[0389] To determine the activity of LpYbiW, activated LpYbiW was incubated with 1,5-AG-6P and analyzed by LC-MS (Figures 2B-2D). It can be seen that there is a new peak with m / z(-)=243.0 in the whole reaction group at t R =18.40min. In the activity experiment of LpFsaA catalyzing the aldol condensation reaction of hydroxyacetone and 3-phosphoglyceraldehyde, a new peak (m / z(-)=243.0, t R =18.40 min) (Figures 9A, 9C). The Michaelis-Menten kinetic parameters of LpYbiW were also determined (Figure 10, k cat =43.38±2.96s -1 / LpYbiW,K M =36.52±6.66 mM). The reaction was coupled with LpFsaA and LpYbiW, and LC-MS analysis revealed the production of the corresponding products, hydroxyacetone and 3-phosphoglyceraldehyde (Figures 2E-2H). These data indicate that LpYbiW catalyzes the CO bond cleavage of 1,5-AG-6P to produce 1-deoxyfructose-6-phosphate (1-deoxy-F6P).

[0390] According to the LC-MS analysis results, it can be seen that there is a new peak with m / z(-)=243.0 in the whole reaction group. R =18.40 min ( FIG18A ), the mass spectrum corresponding to this new peak is shown in FIG18B , and the mass spectrum corresponding to the substrate is shown in FIG18C . LC-MS results indicate that EcYbiW has 1,5-glucitol-6-phosphate isomerase activity.

[0391] In order to further study the catalytic mechanism of YbiW, the inventors of the present application determined the crystal structure of the complex of EcYbiW and 1,5-AG-6P (resolution Each asymmetric unit of YbiW contains one monomer. Each monomer exhibits the typical β / α barrel fold common to other GREs (Figure 4A), as well as a radical-like conformation with Gly· and Cys· rings. From this crystal structure, the inventors of the present application can see that the S atom of the Cys· residue Cys441 is adjacent to the H atom at the C2 position of the substrate at a distance of This is consistent with a catalytic mechanism involving "C2 hydrogen atom abstraction by Cys." The 2-OH group of the substrate 1,5-AG-6P forms a hydrogen bond with Glu443; the phosphate group coordinates with His165, His334, and Arg453 of YbiW; the 1-O atom forms hydrogen bonds with His334, and the 3-OH forms hydrogen bonds with S662 (Figure 4C). Glu443 participates in the protonation of the substrate's 2-OH group, consistent with the role of base in the catalytic mechanism of GRE 1,2-eliminase.

[0392] Based on the crystal structure of YbiW, the inventors of this application proposed the following YbiW catalytic mechanism. Similar to other GRE 1,2-eliminases, Cys441· captures the H atom at the C2 position from the substrate 1,5-AG-6P, generating a C2 substrate free radical. Then, Glu443 deprotonates the substrate 2-OH, and the substrate free radical translocates to the C1 position, and the CO bond breaks to form a product free radical. The product free radical then captures the H atom captured by Cys441 from the substrate to generate the product 1-deoxy-F6P and regenerate Cys441· (Figure 4E).

[0393] Based on the crystal structure of the complex formed by EcYbiW and the substrate 1,5-glucitol-6-phosphate, the key amino acid residues in the active center of 1,5-glucitol-6-phosphate isomerase that bind to the substrate were identified by referring to the hydrogen bond distances between the substrate and the amino acid residues. Combined with the catalytic mechanism of glycine radical 1,2-lyases reported in the literature, the key amino acid residues in the active center of 1,5-glucitol-6-phosphate isomerase were also identified. In EcYbiW (SEQ ID NO: 1), these residues are H165, H282, S283, H334, C441, E443, R453, T455, L562, S662, I664, and G786.

[0394] According to SSN (Sequence Similarity Network) data analysis, the YbiW cluster shows a total of 207 nodes and a total of 2333 sequences. The inventors of the present application selected a representative sequence from each node. According to the crystal structure of EcYbiW (Uniprot accession number: P75793), the amino acid residues that interact with the substrate (with reference to H165, H282, S283, H334, C441, E443, R453, T455, L562, S662, I664 and G786 of SEQ ID NO: 1) were used as conserved sites for multiple sequence alignment. Sequences containing these conserved sites were retained, and a total of 173 isozyme sequences were screened out. Further, the adjacent genes of these 173 sequences were analyzed, and the sequence containing the aldolase FsaA in the gene cluster was retained. Finally, a total of 95 representative sequences (Figures 14 and 15) were listed. Table 2 shows the accession numbers, strain origins, and amino acid sequence numbers of 95 1,5-glucitol-6-phosphate isomerase isozymes found from the Uniprot database.

[0395] Example 2. Identification, Characterization, and Testing of PflD-Related Pathways

[0396] Experimental Materials

[0397] Tryptone and yeast extract used to prepare LB medium were purchased from Oxoid Limited (Hampshire, UK). Ultrapure deionized water from Millipore Direct-Q was used. TALON resin was purchased from Clontech Laboratories Inc (California, USA). 1,5-anhydromannitol (1,5-AM) and 1,5-anhydromannitol-6-phosphate (1,5-AM-6P) were chemically synthesized by Tianjin Xiens Biochemical Technology Co., Ltd. Direct-Q oligonucleotide primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. All protein purification chromatography experiments were performed in The anaerobic experiments were performed in a Lab2000 glove box (Etelux) protected by N2 (oxygen concentration less than 5 ppm).

[0398] Gene synthesis and cloning

[0399] EcPflD (Uniprot Accession No.: P32674), EcPflC (Uniprot Accession No.: P32675), EcFsaB (Uniprot Accession No.: P32669), and EcGldA (Uniprot Accession No.: P0A9S5) were obtained by amplifying the E. coli MG1655 genome using primer pairs 1F / 1R, 2F / 2R, 3F / 3R, and 4F / 4R, respectively (Table 3). EcPflD, EcFsaB, and EcGldA were each inserted into the SspI site of the HT plasmid (optimized pET28 vector) to express proteins with an N-terminal His6 tag. EcPflC was inserted into the SspI site of the HMT vector to express a protein with an N-terminal His6 tag, maltose binding protein (MBP).

[0400] For biochemical characterization, gene fragments of SdPflD (NCBI accession number OCX05109.1) and SdPflC (NCBI accession number OCX05103.1) were synthesized by Beijing Qingke Biotechnology Co., Ltd. SdPflD was inserted into the SspI site of the HT plasmid (optimized pET28 vector) to express the protein with an N-terminal His6 tag. SdPflC was inserted into the NdeI site of the pACYC-MBP vector to express the maltose binding protein (MBP) with an N-terminal His6 tag.

[0401] Expression and purification of EcPflD, EcPflC, EcFsaB, and EcGldA

[0402] HT-EcPflD, HMT-EcPflC, HT-EcFsaB, and HT-EcGldA were plasmidized and transformed into Escherichia coli BL21 (DE3) cells to express the corresponding proteins. Positive clones were screened using LB agar plates containing 50 μg / mL kanamycin. The cells were cultured overnight in 4 mL of LB medium and then transferred to fresh LB medium (usually 1 L in a 2.6 L flask) and cultured in a shaking incubator at 37°C and 220 rpm. When the OD 600 When the pH reaches approximately 0.8, the temperature is lowered to 18°C ​​and isopropyl β-D-1-thiogalactopyranoside (IPTG) is added to a final concentration of 0.3 mM to induce expression of the target protein. After 16-20 hours, the cells are harvested by centrifugation (8000 × g, 4°C for 10 minutes). The harvested cells are resuspended in 40 mL of lysis buffer (50 mM Tris / HCl, pH 8.0, 100 mM KCl, 1 mM phenylmethylsulfonyl fluoride (PMSF), 0.2 mg / mL lysozyme, 0.03% Triton X-100, and 0.02 mg / mL DNase I) and stored in a -80°C freezer.

[0403] The above-mentioned frozen cells were thawed and incubated at room temperature (RT, 25°C) for 20 minutes, during which time cell lysis occurred. 5mM β-mercaptoethanol (BME) was added and nucleic acids were removed by precipitation with 1% streptomycin sulfate. Cell debris was removed by centrifugation at 10,000 × g for 10 minutes at 4°C. For EcPflD, EcFsaB and EcGldA, the supernatant was filtered with a 0.22 μm filter and loaded into 5 mL TALON Co pre-equilibrated with buffer A (20mM Tris / HCl, pH 7.5, 200mM KCl and 5mM BME). 2+ The protein was eluted with 5 column volumes of buffer A containing 150 mM imidazole. The eluted protein (~20 mL) was dialyzed against 2 L of buffer A at 4 ° C for 3 hours, concentrated and aliquoted, frozen with liquid nitrogen, and stored at -80 ° C. For EcPflC, the supernatant was filtered and loaded onto a 10 mL amylose column (New England Biolabs, Massachusetts, USA), 10 column volumes of buffer A were used to wash away impurities, and the target protein was eluted with buffer A containing 10 mM maltose.

[0404] The purified proteins were detected by SDS-PAGE using commercial gels (SurePAGE, Bis-Tris, 4-20%). The absorption of the proteins at 280 nm was measured using an ultra-micro UV-visible spectrophotometer (Hangzhou Miou Instrument Co., Ltd.) to calculate their concentrations. 280 =74,720M -1 cm -1 ),MBP-EcPflC(ε 280 =88,810M -1 cm -1 ),EcFsaB(ε 280 =18,450M -1 cm -1 ),EcGldA(ε 280 =32,890M -1 cm -1 )].

[0405] Expression and purification of SdPflD and SdPflC for biochemical characterization

[0406] The protein expression and purification methods and processes, SDS-PAGE detection methods, and concentration determination methods are the same as those for LpYbiW and LpYbiY. 280=86,070M -1 cm -1 ),MBP-SdPflC(ε 280 =107,260M -1 cm -1 )].

[0407] Reconstruction and Characterization of EcPflC Prosthetic Group [Fe-S] Cluster

[0408] Sequence alignment revealed that EcPflC contains only one [4Fe–4S] cluster in the radical SAM domain, with a theoretical maximum of 4Fe and 4S per monomer. The EcPflC protein solution was degassed with argon and brought into a glove box. To the deoxygenated protein solution, a final concentration of 100 mM Tris-HCl, pH 7.5, 10 mM DTT, 4 equivalents of ferrous ammonium sulfate, and sodium sulfide were added, and the solution was incubated overnight at 4°C in a metal bath (Dry Bath H2O3-100°C; Coyote Bioscience, Beijing, China). 4 equivalents of EDTA were then added, and the solution was repeatedly concentrated using centrifugal ultrafiltration tubes (1.5 mL Ym-30 Amicon; Millipore) and diluted with a buffer (20 mM Tris / HCl, pH 7.5, 100 mM KCl).

[0409] The iron content of unconstructed and constructed EcPflC was determined using phenanthroline [3-(2-pyridyl)-5,6-diphenyl-1,2,4-triazine-p,p'-disulfonic acid monosodium salt]. A calibration curve for Fe was established in the range of 0-600 μM using an AAS iron standard. The sulfur content of unconstructed and constructed EcPflC was determined by measuring the absorbance of methylene blue formed by reaction with N,N-dimethyl-p-phenylenediamine dihydrochloride (DPD). A calibration curve for S was established in the range of 0-600 μM using Na2S.

[0410] The UV-Vis absorption spectrum of EcPflC in the 200-800 nm range was measured using a nanophotometer NP80 Mobile (Germany). Unconstructed and reconstituted EcPflC were diluted to 10 μM in a buffer containing 20 mM Tris-HCl, pH 7.5, and 100 mM KCl and transferred to a septum-sealed anaerobic cuvette for measurement. To measure the reduced form of EcPflC, 10 equivalents of titanium(III) citrate were added to the reconstituted EcPflC solution and incubated for 10 minutes.

[0411] LC-MS analysis of EcPflC-catalyzed SAM cleavage

[0412] A 500 μL reaction containing 20 mM Tris / HCl, pH 7.5, 100 mM KCl, 200 μM titanium (III) citrate, 20 μM reconstituted EcPflC, and 1 mM SAM was incubated overnight at room temperature in a glove box. Titanium (III) citrate was not added for the negative control. The reaction was quenched by adding formic acid (5% v / v final concentration) and incubated in a boiling water bath for 1 minute to denature the protein. Precipitated protein was removed by centrifugation at 14,000 × g for 15 minutes. The supernatant was filtered using a 0.22 μm PES membrane and analyzed by LC-MS. The method was as follows: 20 μL of sample was loaded onto an Agilent 6420 Triple Quadrupole LC / MS instrument (Agilent Technologies) equipped with a C18 reverse-phase column. UV absorbance was monitored at 257 nm. The mobile phase consisted of water (A) and acetonitrile (B) with a linear gradient of 0-16% B over 30 minutes at a flow rate of 0.5 mL / min. The formation of EcPflC-catalyzed SAM cleavage products was verified by mass spectrometry using commercial 5'-dA as a standard.

[0413] Electron paramagnetic resonance (EPR) spectroscopy detection of EcPflD free radical generation

[0414] The EcPflD glycine radical was characterized using continuous wave X-band electron paramagnetic resonance (EPR) spectroscopy. A 200 μL reaction containing 20 mM Tris / HCl, pH 7.5, 100 mM KCl, 100 μM citrate peptide Ti(III), 1 mM SAM, 80 μM reconstituted EcPflC, and 40 μM EcPflD was incubated in a glove box at room temperature for 15 minutes. 10% glycerol was added and the reaction was then placed in a 4 mm outer diameter, 8-inch long EPR tube (Wilmad Lab Glass, 734-LPV-7). The tube was sealed with a rubber stopper, removed from the glove box, and frozen in liquid nitrogen prior to EPR analysis. The experimental spectrum of the glycine radical was modeled using a Bruker Xepr spin fit to obtain g values, hyperfine coupling constants, and line widths. Double integration of the simulated spectrum was used to determine the spin concentration. The EPR spectrum was obtained by superposition of 30 scans, and the test conditions were as follows: temperature, 90 K; central field, 3370.00 Gauss; range, 200 Gauss; microwave power, 10 μW; microwave frequency, 9.43 MHz; modulation amplitude, 0.5 mT; modulation frequency, 100 kHz; time constant, 20.48 ms; conversion time, 25 ms; scan time, 20 s; and receiving gain, 43 dB.

[0415] LC-MS analysis of EcPflD activity assay

[0416] A 200 μL reaction mixture containing 10 μM activated EcPflD, 0.1 mM titanium(III) citrate, and 10 mM 1,5-AM-6P was incubated in a glove box at room temperature for 1 hour. Negative controls were performed without the addition of 1,5-AM-6P, SAM, or activated EcPflD. Protein was precipitated by adding 200 μL of acetonitrile to the reaction mixture, and the precipitate was removed by centrifugation. The supernatant was filtered through a 0.22 μm PES membrane and analyzed by LC-MS.

[0417] LC-MS analysis was performed on an Agilent 6420 Triple Quadrupole LC / MS instrument (Agilent Technologies). The drying gas temperature was maintained at 300°C, the flow rate was 9 L / min, and the nebulizer pressure was 15 psi. A ZIC-HILIC column (5 mm, LC-MS analysis was performed using a 150 × 4.6 mm (150 × 4.6 mm; Merck). HPLC conditions were as follows: mobile phase A was 90% 20 mM ammonium acetate and 10% acetonitrile, and mobile phase B was acetonitrile; gradient elution was performed from 90% B to 70% B over 10 minutes and from 70% B to 50% B over 20 minutes. The flow rate was set at 0.5 mL / min. The mass spectrometer was operated in ESI negative ion mode.

[0418] LC-MS analysis of SdPflD activity assay

[0419] The LC-MS analysis experimental method for Streptococcus dysgalactiae subsp. Equisimilis species SdPflD is the same as the LC-MS analysis method for EcPflD activity determination.

[0420] LC-MS analysis of the activity of EcFsaB coupled to EcPflD

[0421] A 200 μL reaction mixture containing 10 μM activated EcPflD, 0.1 mM titanium(III) citrate, and 10 mM 1,5-AM-6P was incubated in a glove box at room temperature for 1 hour before the enzymatic activity of EcFsaB-coupled EcPflD was determined. After adding 10 μM EcFsaB to the reaction system and incubating for an additional hour in the glove box, 50 μL of the reaction sample was mixed with 550 μL of 0.73 M sodium acetate (pH 5.0) and then with 400 μL of freshly prepared 2,4-dinitrophenylhydrazine (DNPH) solution (20 mg dissolved in 50 mL of methanol). The mixture was then incubated at 50°C for 1 hour. The mixture was centrifuged at 13,000 × g for 5 minutes and filtered prior to LC-MS analysis. Positive controls were prepared by treating 3-phosphoglyceraldehyde (5 mM, Sigema-Aldrich) and hydroxyacetone (2 mM, TCI) standards with sodium acetate (pH 5.0) and freshly prepared DNPH solution for 1 h.

[0422] LC-MS analysis was performed on an Agilent ZORBAX SB-C18 reversed-phase column (4.6 x 250 mm) using negative ion electrophoresis (ESI) mode. The solvent system consisted of solvent C (deionized ultrapure water containing 0.1% formic acid) and solvent D (acetonitrile containing 0.1% formic acid). Analysis was performed using the following procedure: elution from 15% to 100% D over 15 minutes at a flow rate of 1.0 mL / min, with detection at a wavelength of 360 nm.

[0423] Coupled spectrophotometric assay of EcPflD, EcFsaB, and EcGldA

[0424] A reaction mixture containing 20 mM Tris / HCl, pH 7.5, 100 mM KCl, 10 mM 1,5-AM-6P, 40 nM activated EcPflD, 5 μM EcFsaB, 5 μM EcGldA, and 0.4 mM NADH was incubated at room temperature in a 1 cm Eppendorf cuvette in a glove box. The absorbance at 340 nm was monitored every 5 seconds using the cuvette mode of an ultra-micro UV-visible spectrophotometer (Hangzhou Miou Instrument Co., Ltd.) in the glove box. A negative control was prepared by not adding 1,5-AM-6P, SAM, or EcPflD.

[0425] LC-MS analysis of EcFsaB activity

[0426] The activity of EcFsaB in catalyzing the aldol condensation of hydroxyacetone and glyceraldehyde-3-phosphate was also assayed: a 200 μL reaction mixture containing 50 mM Tris / HCl, pH 8.0, 100 mM KCl, 5 mM glyceraldehyde-3-phosphate, 10 mM hydroxyacetone, and 10 μM EcFsaB was incubated at room temperature for 1 hour. A negative control without glyceraldehyde-3-phosphate, hydroxyacetone, or EcFsaB was performed. LC-MS analysis was performed using a ZIC-HILIC column, using the same sample preparation and elution conditions as described for the EcPflD activity assay.

[0427] Determination of Michaelis-Menten kinetic parameters of EcPflD

[0428] The reaction system containing 20 mM Tris / HCl, pH 7.5, 100 mM KCl, 40 nM activated EcPflD and different substrate concentrations of 1,5-AM-6P, 2 μM EcFsaB, 2 μM EcGldA and 0.4 mM NADH was carried out in a 1 cm Eppendorf cuvette using an ultra-micro-volume UV-visible spectrophotometer (Hangzhou Miou Instrument Co., Ltd.) in the cuvette mode in a glove box. A was monitored at 5 s intervals. 340nm reduction.

[0429] Construction of SdPflD expression plasmid for crystallographic studies

[0430] The E. coli codon-optimized DNA fragment encoding PflD from Streptococcus dysgalactiae subsp. Equisimilis (SdPflD, NCBI accession number: OCX05109.1) was synthesized by Beijing Qingke Biotechnology Co., Ltd. and inserted into the SspI site of the vector HT.

[0431] Expression and purification of SdPflD for crystallographic studies

[0432] For crystallographic studies of SdPflD, E. coli BL21 (DE3) carrying the plasmid HT-SdPflD was cultured in 2 L of LB medium containing 50 μg / mL kanamycin. The cells were harvested and lysed using the same method as for EcYbiW, and 10 mL of TALON Co 2+The supernatant of cell lysis was purified by column, and the eluate was premixed with recombinant His6-tagged TEV protease (the molar ratio of TEV protease to SdPflD was approximately 1:10) and dialyzed overnight with 2 L of buffer A (20 mM Tris / HCl, pH 7.5, 200 mM KCl and 5 mM BME) containing 5 mM BME. The dialyzed sample was loaded onto a 10 mL TALON Co 2+ The 5-mer was added to the column to retain the TEV protease and His6 tag. The flow-through was collected and dialyzed with 2 L of buffer B (20 mM Tris / HCl, pH 7.5, 5 mM BME) and loaded onto a 10 mL DEAE column using the same method as described above. The main peak containing SdPflD was concentrated and purified using a Superdex200 gel filtration column. The sample from the gel filtration column was concentrated to a final concentration of 9.9 mg / mL.

[0433] Crystallization, data collection, and structure determination of SdPflD

[0434] Initial screening of SdPflD crystals was performed by the sitting drop method using an automated liquid handling robotic system in a 96-well format (Gryphon, Art Robbins). Screening was performed at 291 K using various crystal screening kits from Hampton Research and Molecular Dimensions. After further optimization using the hanging drop method in 24-well plates, crystals were obtained for single crystal X-ray diffraction studies. The optimal conditions for producing SdPflD bulk crystals were a 5.0 mg / mL SdPflD protein solution, 1.2 M sodium citrate, 0.1 M sodium HEPES, pH 8.0, and 10 mM 1,5-AM-6P. The bulk crystals were cryoprotected with 10% glycerol. The diffraction data were collected and processed on a BL10U2 at the Shanghai Synchrotron Radiation Facility (SSRF) with a resolution of Molecular replacement was performed using the PHENIX software using a crystal structure model created using the PHYRE2 website. The structure was manually constructed using Coot software based on electron cloud orientation and further refined in PHENIX before being uploaded to the RCSB Protein Data Bank (accession code: 8ID0). The appendix contains data for data collection and the final refined crystal structure (Table 1). All structural figures were generated using UCSF Chimera (Figures 4B and 4D).

[0435] Identification of the active site of 1,5-mannitol-6-phosphate isomerase

[0436] The obtained crystals of SdPflD and 1,5-AM-6P complex (resolution ) were displayed using UCSF Chimera software. The amino acid residues within the range are displayed. Based on the hydrogen bond distance formed between the substrate and the amino acid residue, the key amino acid residues in the active center of 1,5-glycidol-6-phosphate isomerase that bind to the substrate were determined. Combined with the catalytic mechanism of glycine free radical 1,2-lyase in the literature, the key amino acid residues in the active center of 1,5-glycidol-6-phosphate isomerase were determined.

[0437] Identification of Isozymes of 1,5-Mannitol-6-Phosphate Isomerase

[0438] To identify isoenzymes of 1,5-glycidol-6-phosphate isomerases within the glycine radical enzyme (GRE) family, a sequence similarity network (SSN) was constructed of 25,347 unique sequences from InterPro family IPR004184 using the Enzyme Function Initiative Enzyme Similarity Tool (EFI-EST) web-based tool. The alignment score threshold was set to 250, and the minimum sequence length was set to 650. The representative node network (RepNode network) at 80% similarity was visualized using Cytoscape v3.519. These settings allowed previously characterized GREs with distinct catalytic activities to be grouped into distinct clusters.

[0439] Sequences with a similarity of 80% or greater were represented by a single node. Sequences were collapsed to reduce the total number of nodes, making less complex networks easier to load in Cytoscape. For each PflD cluster, a representative sequence was selected from each node. Based on the crystal structure of the complex formed by SdPflD and its substrate, amino acid residues that interact with the substrate were identified as conserved sites for multiple sequence alignment. Sequences containing these conserved sites were retained. The adjacent genes of these sequences were further analyzed, and sequences containing aldolase in the gene cluster were retained. Finally, representative sequences were selected.

[0440] Results, Analysis, and Discussion

[0441] The genome of Escherichia coli MG1655 harbors a gene cluster involved in sugar metabolism. Bioinformatics analysis of this cluster revealed the involvement of a GRE (PflD) of unknown function. In addition to PflD and the glycine radical enzyme activating enzyme (PflC), a member of the S-adenosylmethionine free radical enzyme family, this gene cluster also contains a 1-deoxyfructose-6-phosphate aldolase (FsaB), a hydroxyacetone reductase (GldA), and a complete phosphoenolpyruvate-dependent phosphotransferase system (PTS), comprising PtsA, FrwB, FrwC, and FrwD. The PTS functions by transferring the phosphate group of phosphoenolpyruvate (PEP) to sugars entering the cell through a series of sequential steps involving different PTS components. The PTS is composed of cytoplasmic components and membrane-associated enzymes. The cytoplasmic components lack sugar specificity, while the membrane-associated enzymes are specific for only a few sugars. This PTS transport complex may be involved in hexose uptake and substrate phosphorylation. The aldolase FsaB catalyzes the conversion of hydroxyacetone, 1,3-dihydroxyacetone, and glyceraldehyde-3-phosphate to the corresponding 2-keto-hexose-6-phosphate. GldA catalyzes the dehydrogenation of glycerol or propylene glycol to produce 1,3-dihydroxyacetone or hydroxyacetone. Based on this, the inventors hypothesize that this GRE is involved in sugar metabolism, and its substrate may be a hexose phosphate. Combined with molecular docking results, the inventors hypothesize that the substrate of PflD is 1,5-glycidol-6-phosphate (1,5-AM-6P), and propose a novel free radical-dependent glycolysis pathway. In this pathway, PflD catalyzes the cleavage of the CO bond of 1,5-AM-6P to produce 1-deoxy-F6P. This product is further cleaved by the aldolase FsaB to produce hydroxyacetone and glyceraldehyde-3-phosphate. Hydroxyacetone is reduced to 1,2-propanediol by hydroxyacetone reductase GldA (Figure 1B).

[0442] To prove the inventors' hypothesis, they selected PflD, PflC, FsaB and GldA genes from Escherichia coli MG1655, then heterologously expressed them in Escherichia coli BL21 (DE3) cells, and characterized the activities of these proteins.

[0443] The inventors of this application reconstructed the prosthetic group [Fe-S] of the activating enzyme EcPflC 2+The anaerobic reconstitution of the [4Fe-4S] cluster resulted in the production of 2.15±0.12Fe and 2.30±0.07S per monomer (a radical SAM domain, the theoretical maximum for a [4Fe-4S] cluster is 4Fe and 4S) and a representative UV-visible spectrum of a [4Fe-4S]-containing protein, with a molar extinction coefficient ε 410nm 9.45mM -1 cm -1 ε of each [4Fe-4S] cluster 410nm About 15mM -1 cm -1 Therefore, the inventors estimated that each monomer contains approximately 0.63 [4Fe-4S], which is roughly consistent with the measured Fe and S contents (Figures 8A-8B). LC-MS analysis showed that, like other free radical SAM enzymes, EcPflC catalyzes the cleavage of SAM in the presence of the reducing agent titanium(III) citrate, forming 5'-deoxyadenosine (Figures 8C-8D). EPR spectroscopy revealed the formation of free radicals upon incubation of EcPflD, EcPflC, SAM, and Ti(III), with the generated free radicals quantified at 0.060 Gly· / dimer (Figure 3A).

[0444] To determine the activity of EcPflD, activated EcPflD was incubated with 1,5-AM-6P and analyzed by LC-MS. It can be seen that there is a new peak with m / z(-)=243.0 in the whole reaction group at t R =18.40min (Figure 3B-3D). In the activity experiment of EcFsaB catalyzing the aldol condensation reaction of hydroxyacetone and 3-phosphoglyceraldehyde, a new peak (m / z(-)=243.0, t R =18.40 min) (Figures 9B-9D). The Michaelis-Menten kinetic parameters of EcPflD were also determined (Figure 11, k cat =33.47±0.79s -1 / EcPflD,K M =1.33±0.12mM). The reaction was carried out by coupling EcFsaB with EcPflD, and the production of the corresponding products hydroxyacetone and 3-phosphoglyceraldehyde was detected by LC-MS analysis (Figures 3E-3H). The spectrophotometric determination of EcPflD, EcFsaB and EcGldA showed that only in the full reaction group, A 340nm The decrease in , indicating that the substrate 1,5-AM-6P was catalyzed by EcPflD to break the CO bond to produce 1-deoxy-F6P, which was then cleaved by EcFsaB to produce hydroxyacetone and 3-phosphoglyceraldehyde; hydroxyacetone was reduced by EcGldA to produce 1,2-propanediol (Figure 3I).

[0445] The PflD gene cluster in Streptococcus dysgalactiae subsp. Equisimilis is shown in FIG19A. According to the LC-MS analysis results, it can be seen that there is a new peak with m / z(-)=243.0 in the whole reaction group. R =18.40 min ( FIG19B ). The mass spectrum corresponding to this new peak is shown in FIG19C , and the mass spectrum corresponding to the substrate is shown in FIG19D . LC-MS results indicate that SdPflD has 1,5-mannitol-6-phosphate isomerase activity.

[0446] In order to further study the catalytic mechanism of PflD, the inventors of the present application determined the crystal structure of the complex of SdPflD and 1,5-AM-6P (resolution Each asymmetric unit of PflD contains one monomer. Each monomer exhibits the typical β / α barrel fold common to other GREs (Figure 4B), as well as a radical-like conformation with Gly· and Cys· rings. From this crystal structure, it can be seen that the S atom of the Cys· residue Cys431 is adjacent to the H atom at the C2 position of the substrate, with a distance of This is consistent with a catalytic mechanism involving "C2 hydrogen atom abstraction by Cys." The 2-OH group of the substrate 1,5-AM-6P forms a hydrogen bond with Glu433; the phosphate group coordinates with Gln162, Ser277, and Arg323 of PflD; the 1-O atom forms hydrogen bonds with His169 and Glu445, and the 3-OH forms hydrogen bonds with S278 (Figure 4D). Glu433 participates in the deprotonation of the substrate's 2-OH group, consistent with the role of base in the catalytic mechanism of GRE 1,2-eliminase.

[0447] Based on the crystal structure of PflD, which is similar to other GRE 1,2-eliminases, the inventors of this application proposed the following catalytic mechanism of PflD. Cys431· extracts the H atom at the C2 position from the substrate 1,5-AM-6P, generating a C2 substrate radical. Glu433 then deprotonates the substrate 2-OH, and the substrate radical translocates to the C1 position, where the CO bond cleaves to form a product radical. The product radical then extracts the H atom extracted from the substrate by Cys431, generating the product 1-deoxy-F6P and regenerating Cys431· (Figure 4F).

[0448] Based on the crystal structure of the complex formed by SdPflD and the substrate 1,5-mannitol-6-phosphate, the key amino acid residues in the active center of 1,5-mannitol-6-phosphate isomerase that bind to the substrate were identified based on the hydrogen bond distances between the substrate and the amino acid residues. Combined with the catalytic mechanism of glycine radical 1,2-lyases reported in the literature, the key amino acid residues in the active center of 1,5-mannitol-6-phosphate isomerase were identified. In SdPflD, these residues are Q162, H169, S277, S278, R323, F331, P335, C431, E433, D445, Y628, V630, and G752.

[0449] According to SSN sequence analysis, the PflD cluster showed a total of 89 nodes and a total of 953 sequences. The inventors selected a representative sequence from each node. Based on the crystal structure of SdPflD (NCBI accession number is OCX05109.1), the amino acid residues (Q162, H169, S277, S278, R323, F331, P335, C431, E433, D445, Y628, V630 and G752) that interact with the substrate were used as conserved sites for multiple sequence alignment. Sequences containing these conserved sites were retained, and a total of 77 isozyme sequences were screened out. Further analysis of the adjacent genes of these 77 sequences was performed, and sequences containing the aldolase FsaB in the gene cluster were retained. Ultimately, a total of 47 representative sequences were listed (Figures 14 and 16).

[0450] Example 3. Experiments on Escherichia coli using 1,5-glucitol and 1,5-glycidol

[0451] Gene knockout in Escherichia coli MG1655

[0452] The CRISPR-assisted homologous recombination strategy was used to knock out ybiW and pflD in Escherichia coli MG1655, respectively. The inventors of the present application designed 7F / 7R and 8F / 8R primer pairs to amplify the upstream and downstream sequences of ybiW, 500bp at the 5' end and 504bp at the 3' end, respectively, to produce fragments 1 and 2. Fragments 1 and 2 were assembled using PCR using primers 7F and 8R to produce fragment 3. Fragments 4 and 5 were obtained by PCR amplification using 9F / 9R and 10F / 10R primer pairs using the pRed_Cas9_recA plasmid as a template. Fragments 3, 4, and 5 were Gibson assembled to produce the recombinant pRed_Cas9_recA_ΔybiW plasmid, which contains the guide RNA sequence "GCCTGCCAGAAAGTCTGCGG" (SEQ ID NO: 187), which is intended to introduce Cas9-catalyzed cleavage near the homologous recombination site to increase the rate of the desired homologous recombination.

[0453] The construction method of the recombinant plasmid pRed_Cas9_recA_ΔpflD is similar to that of pRed_Cas9_recA_ΔybiW. Primer pairs 11F / 11R and 12F / 12R were used to amplify the upstream (500bp) and downstream (505bp) sequences of pflD to produce fragments 6 and 7. Similarly, fragments 6 and 7 were used as templates, and 11F and 12R were used as primers to produce fragment 8. Fragments 9 and 10 were PCR amplified using primer pairs 9F / 13R and 13F / 10R with pRed_Cas9_recA as a template. PRed_Cas9_recA_ΔpflD containing the guide RNA sequence "AAATACCAGAACCCGCGCGG" (SEQ ID NO: 188) was constructed using fragments 8, 9, and 10 using the Gibson assembly method. DNA sequencing using primers 14F, 14R, and 15F confirmed the recombinant plasmids pRed_Cas9_recA_ΔybiW and pRed_Casa9_recA_ΔpflD.

[0454] To generate E. coli MG1655_ΔybiW and E. coli MG16.55_ΔpflD strains, pRed_Cas9_recA_ΔybiW and pRed_Cas9_recA_ΔpflD, respectively, were transformed into competent E. coli MG1655 cells by electroporation. Positive transformants were selected on LB agar plates containing 50 μg / mL kanamycin in a 30°C incubator. Single colonies were cultured in 5 mL of LB medium containing 50 mg / L kanamycin and 2 g / L arabinose at 30°C for 24 hours. Cells were harvested and plated on LB agar plates containing 50 g / L kanamycin and 2 g / L arabinose at 30°C. Single colonies were picked and streaked onto LB agar plates and incubated at 37°C to expel the recombinant plasmids. Colony PCR verification using primers 16F / 16R for ΔybiW and 17F / 17R for ΔpflD yielded a theoretically large DNA fragment of approximately 1500 bp. Agarose gel electrophoresis demonstrated successful genomic knockout, a result further confirmed by DNA sequencing using the same primer pairs.

[0455] Anaerobic growth of Escherichia coli strains on 1,5-AG / 1,5-AM as the sole carbon source

[0456] A single colony of E. coli MG1655 WT, ΔybiW, and ΔpflD strains freshly grown on LB agar plates was inoculated into 5 mL of LB medium and incubated at 37°C in a shaker for 4 hours. 100 μL of cells from this culture was centrifuged and transferred to an anaerobic flask containing 5 mL of anaerobic LB medium and incubated at 37°C for 6 hours. 100 μL of cells from this culture were harvested by centrifugation and transferred to an anaerobic vial containing 5 mL of anaerobic M9 medium and incubated at 37°C for 3 days. 1 mL of cells was harvested, washed three times with anaerobic M9 medium without glucose, and resuspended in this medium. 100 μL of the cell suspension was transferred to anaerobic flasks, each containing 5 mL of either glucose-free M9 medium or the same medium supplemented with 20 mg of sugar (glucose, 1,5-AG, or 1,5-AM). The anaerobic flasks were then placed in a 37°C incubator for 7 days before being photographed and the cells collected for SDS-PAGE gel analysis.

[0457] Protein identification by SDS / PAGE and mass spectrometry

[0458] Cells were harvested by centrifugation, lysed by boiling in Laemmli loading buffer, and analyzed on 10% SDS / PAGE gels. Significant protein bands induced in cells cultured with glucose, 1,5-glucitol, and 1,5-glucitol were manually excised. After in-gel digestion and extraction, the peptide mixture was analyzed by a Fusion Lumos mass spectrometer coupled to an Easy nLC 1200 system (Thermo Fisher Scientific). The MS / MS spectra of each LC-MS / MS run were searched against the Escherichia coli protein database (released on April 1, 2021) using the in-house Proteome Discoverer (version 2.2) search algorithm, which contains 15,862 sequence entries from UniProt. Protein identification was performed based on Sequest HT.

[0459] GC analysis of fermentation broth

[0460] Wild-type Escherichia coli MG1655 was cultured at 37°C for 7 days in different carbon sources, and the cells were removed by centrifugation. 200 μL of fermentation broth was aspirated and added to 800 μL of chromatographic-grade anhydrous ethanol. The mixture was vortexed and centrifuged to remove the insoluble precipitate. The filtrate was then filtered through a 0.45 μm organic filter membrane, and analyzed by gas chromatography. A commercial standard of (R)-1,2-propanediol was dissolved in chromatographic-grade anhydrous ethanol.

[0461] Gas chromatography (GC) analysis was performed using an Agilent 6820 G1176A gas chromatograph (Agilent Technologies). The GC column used was AT TMAn Aquawax-DA (Alltech) gas chromatography column (30 m × 0.53 mm, 1.0 μm) was used. GC conditions were as follows: high-purity nitrogen carrier gas at a constant column flow rate of 1.0 mL / min; inlet temperature of 230°C, detector temperature of 240°C; hydrogen flow rate of 20 mL / min; and air flow rate of 200 mL / min. A temperature program was used: the column temperature was initially set at 60°C, held for 2 minutes, then increased at a rate of 20°C / min to 80°C, held for 3 minutes, then increased at a rate of 20°C / min to 160°C, held for 2 minutes, and then increased at a rate of 15°C / min to 220°C, held for 10 minutes.

[0462] Results, Analysis, and Discussion

[0463] E. coli MG1655_wild-type and E. coli MG1655_ΔybiW strains were cultured anaerobically in M9 medium using 1,5-AG as the sole carbon source. A positive control used glucose as the sole carbon source, while a negative control did not add any carbon source. The E. coli MG1655_wild-type strain grew on both glucose and 1,5-AG as carbon sources, whereas the E. coli MG1655_ΔybiW strain could only grow on glucose as the sole carbon source (Figure 5A). Further SDS-PAGE analysis revealed that when the E. coli MG1655_wild-type strain used 1,5-AG as the sole carbon source, the expression of proteins in the YbiW-dependent pathway was induced. Combined with protein profiling, the induced bands were identified: two ~95 kDa bands containing PtsA and YbiW; a ~42 kDa band was identified as GldA; and a ~27 kDa band contained FsaB and FasA (Figure 5B).

[0464] E. coli MG1655_wild-type and E. coli MG1655_ΔpflD strains were cultured anaerobically using M9 medium with 1,5-AM as the sole carbon source. A positive control used glucose as the sole carbon source, while a negative control did not add any carbon source. The E. coli MG1655_wild-type strain grew on both glucose and 1,5-AM as carbon sources, while the E. coli MG1655_ΔpflD strain could only grow on glucose as the sole carbon source (Figure 5C). Further SDS-PAGE analysis showed that when the E. coli MG1655_wild-type strain used 1,5-AM as the sole carbon source, the expression of proteins in the PflD-dependent pathway was induced. Combined with protein profiling, the induced bands were identified as PtsA at ~95 kDa, PflD at ~90 kDa, GldA at ~42 kDa, and FsaB at ~27 kDa (Figure 5D). GC analysis showed that E. coli MG1655 could produce 1,2-propylene glycol under anaerobic conditions when 1,5-AG and 1,5-AM were used as the sole carbon sources, with a retention time of 8.85 min ( FIG13 ).

[0465] The YbiW and PflD gene clusters are present in the E. coli MG1655 genome (Figure 5E). Based on growth results on different carbon sources, SDS-PAGE analysis, and protein profiling, the inventors of this application believe that 1,5-AG can induce the expression of the YbiW and PflD-related gene clusters in E. coli MG1655. 1,5-AG utilizes the PTS transport system within the PflD gene cluster to enter the cell, inducing high expression of FsaB and GldA within the PflD gene cluster, as well as YbiW and FsaA within the YbiW gene cluster. 1,5-AG is transported into the cell by the PTS transport system, where it is phosphorylated at the C-6 position, producing 1,5-AG-6P. Under the catalysis of YbiW, the CO bond cleaves, producing 1-deoxy-F6P. This product is cleaved by FsaB and FsaA to produce hydroxyacetone and 3-phosphoglyceraldehyde. Hydroxyacetone is reduced by EcGldA to produce 1,2-propanediol.

[0466] However, 1,5-AM can only induce high expression of PflD-related pathway proteins. The substrate is transported into the cell by the PTS transport system in the gene cluster and phosphorylated at the C-6 position to produce 1,5-AM-6P. Under the catalysis of PflD, the CO bond breaks, producing 1-deoxy-F6P. This product is cleaved by FsaB to produce hydroxyacetone and 3-phosphoglyceraldehyde. The hydroxyacetone is reduced by GldA to produce 1,2-propanediol (Figure 5F).

[0467] Table 1. Data collection and optimization statistics for EcYbiW and SdPflD crystals Note: Statistics for the highest resolution shell are shown in parentheses

[0468] Table 2. Accession numbers, strain sources, and amino acid sequence numbers of 1,5-glucitol-6-phosphate isomerase isozymes

[0469] Table 3. Primers used for plasmid construction Note: * represents the genome of Escherichia coli MG1655

[0470] Table 4. Accession numbers, strain sources, and amino acid sequence numbers of 1,5-dihydromannitol-6-phosphate isomerase isozymes

[0471] Table 5. Primers used to construct E. coli ΔybiW and ΔpflD strains Note: represents the genome of Escherichia coli MG1655WT; # represents the genome of ΔybiW; * represents the genome of ΔPflD.

[0472] Table 6. Primers used for plasmid construction Note: * represents the genome of Escherichia coli MG1655

[0473] The above describes exemplary embodiments of the various inventions of the present application. However, without departing from the essence and scope of the present application, those skilled in the art will be able to modify or improve the exemplary embodiments described in the present application, and the resulting variations or equivalents also fall within the scope of the present application.

Claims

1. A polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1 or 97 or a functional variant thereof, wherein the functional variant has 1,5-glycidol-6-phosphate isomerase activity.

2. The polypeptide according to claim 1, comprising the amino acid sequence shown in SEQ ID NO: 1 or a functional variant thereof, wherein the functional variant has 1,5-glucitol-6-phosphate isomerase activity; Preferably, the polypeptide has an active site defined as follows in spatial conformation: the active site comprises amino acid residues H165, H282, S283, H334, C441, E443, R453, T455, L562, S662, I664 and G786, which are close to each other in spatial conformation with reference to SEQ ID NO:

1.

3. The polypeptide according to claim 2, wherein the functional variant is a natural isozyme of the amino acid sequence shown in SEQ ID NO: 1; Preferably, the natural isozymes are from: Lactiplantibacillus plantarum, Escherichia coli, Lactobacillus selangorensis, Streptococcus uberis, Olsenella sp., Leptotrichia wadei, Streptococcus parauberis, Anaerostipes hadrus, Senella sp., Selenomonas ruminantium, Orenia metallireducens, Bifidobacterium primatium, Leptotrichia hofstadii, Ligilactobacillus agilis, Senella profusa, Clostridium butyricum, Vibrio ishigakensis, Coriobacteriaceae, Coriobacterium glomerans, Eggerthia catenaformis, Clostridium baratii str.Sullivan, Clostridiales, Firmicutes, Clostridium vincentii, Streptococcus downei, Erysipelotrichaceae, Quinella sp., Sebaldella termitidis, Ligilactobacillus animalis, Liquorilactobacillus satsumensis, Clostridium botulinum, Acetivibrio ethanolgignens, Aeromonas sobria, Clostridium cadaveris, Streptococcus bovimastitidis, Sodalis ligni, Lactococcus raffinolactis, Lactobacillus ultunensis, Leptotrichia sp., Lucifera butyrica, Fonticella tunisiensis, Cronobacter sakazakii, Liquorilactobacillus uvarum, Anaeromassilibacillus sp., Anaerotruncus sp.), Beauveria bassiana, Cedecea lapagei, Streptococcus pneumoniae, Streptococcus suis, Aeromonas veronii, Lactococcus raffinolactis, Streptococcus sanguinis, Actinomyces succiniciruminis, Vagococcus humatus, Vibrio alginolyticus, Ligilactobacillus acidipiscis, Pilibacter termitis, Lachnospiraceae, Aeromonas hydrophila, Enterococcus ratti, Kandleria vitulina, Clostridium pasteurianum), Aeromonas allosaccharophila, Pantoea alhagi, Peptacetobacter hiranonis, Edwardsiella piscicida, Cedecea neteri, Chelonobacter oris, Aeromonas sp., Clostridium sp., Vibrio gazogenes, Melissococcus plutonius, Tolumonas sp., Loigolactobacillus coryniformis, Zooshikella ganghwensis, Vibrio sp., Photobacterium lipolyticum, Agrilactobacillus composti, Clostridium symbiosum, and Aerococcus spp. (Aerococcus sp.); More preferably, the natural isozyme comprises the amino acid sequence shown in any one of SEQ ID NOs: 2-96.

4. The polypeptide according to claim 1, comprising the amino acid sequence shown in SEQ ID NO: 97 or a functional variant thereof, wherein the functional variant has 1,5-glycidol-6-phosphate isomerase activity; Preferably, the polypeptide has an active site defined as follows in spatial conformation: the active site comprises Q162, H169, S277, S278, R323, F331, P335, C431, E433, D445, Y628, V630 and G752 amino acid residues, which are close to each other in spatial conformation and refer to SEQ ID NO:

97.

5. The polypeptide according to claim 4, wherein the functional variant is a natural isozyme of the amino acid sequence shown in SEQ ID NO: 97; Preferably, the natural isozymes are from: Escherichia coli, Streptococcus dysgalactiae subsp. Equisimilis, Firmicutes, Pseudoleptotrichia goodfellowii, Edwardsiella tarda, Serratia odorifera, Gilliamella apicola, Vibrio, Lactobacillus selangorensis, Caloranaerobacter sp., Pilibacter termitis, Caloranaerobacter azorensis, Salmonella enteritidis, Tolumonas auensis, Senella porci, Mycobacteriaceae, Fonticella tunisiensis, Coriobacteriales, Bacillus sp., Actinobacillus rossii, Lactobacillus ultunensis, Clostridium estertheticum, Geosporobacter ferrireducens, Vibrio ishigakensis, Streptococcus merionis, Shigella boydii, Agrilactobacillus composti, Lactobacillus selangorensis, Vagococcus elongatus, Clostridium acidisoli, Caloramator quimbayensis, Clostridium uliginosum, Enterobacter asburiae, Atopobium minutum, Thermophilibacter immobilis, Photobacterium lipolytica, Citrobacter amalonaticus, Clostridium pasteurianum, Sebarudium termitum, Acididesulfobacillus acetoxydans and Clostridium spp.; More preferably, the natural isozyme comprises the amino acid sequence shown in any one of SEQ ID NOs: 98-144.

6. The polypeptide according to any one of claims 1 to 5, wherein the substrate thereof is 1,5-glycidol-6-phosphate; preferably, the 1,5-glycidol-6-phosphate is 1,5-glucitol-6-phosphate or 1,5-glycidol-6-phosphate.

7. A polypeptide as described in any one of claims 1 to 6, wherein the functional variant is produced by insertion, substitution and / or deletion of one or more amino acids based on the amino acid sequence shown in SEQ ID NO: 1 or 97 or its natural isozyme, and optionally, the insertion, substitution and / or deletion does not occur in the active site.

8. A nucleic acid molecule encoding the polypeptide of any one of claims 1 to 7.

9. An expression cassette comprising the nucleic acid molecule of claim 8.

10. An expression vector comprising the nucleic acid molecule of claim 8 or the expression cassette of claim 9.

11. A host cell comprising the nucleic acid molecule of claim 8, the expression cassette of claim 9, or the expression vector of claim 10.

12. The host cell of claim 11, further expressing: an activating enzyme, an aldolase, a hydroxyacetone reductase, and / or a transport complex; Preferably, the host cell further expresses the S-adenosylmethionine free radical enzyme family glycine free radical enzyme activating enzyme, 1-deoxyfructose-6-phosphate aldolase, hydroxyacetone reductase, and / or the transport complex of the polypeptide according to any one of claims 1 to 7.

13. A host cell as described in claim 12, wherein the transport complex has the transport activity of the phosphoenolpyruvate-phosphotransferase system; preferably, the transport complex is a phosphoenolpyruvate-phosphotransferase system; more preferably, the transport complex comprises at least one of SEQ ID NOs: 150-153 or a functional variant thereof.

14. The host cell according to any one of claims 11 to 13, which is a eukaryotic cell or a prokaryotic cell; Preferably, the eukaryotic cell is a yeast cell; and / or Preferably, the prokaryotic cell is selected from: Escherichia, Klebsiella, Streptococcus, Lactobacillus, Bifidobacterium, Bacteroidetes and Firmicutes, etc.; more preferably, the Escherichia is Escherichia coli.

15. A composition comprising the polypeptide of any one of claims 1 to 7; Preferably, the composition further comprises: an activating enzyme, an aldolase, and / or a hydroxyacetone reductase; More preferably, the composition further comprises an S-adenosylmethionine free radical enzyme family glycine free radical enzyme activating enzyme, 1-deoxyfructose-6-phosphate aldolase, and / or hydroxyacetone reductase of the polypeptide according to any one of claims 1 to 7.

16. The composition according to claim 15, which is used for catalyzing 1,5-glycidol-6-phosphate to generate 1,2-propylene glycol; preferably, the 1,5-glycidol-6-phosphate is 1,5-glucitol-6-phosphate or 1,5-glycidol-6-phosphate.

17. Use of the polypeptide according to any one of claims 1 to 7, the nucleic acid molecule according to claim 8, the expression cassette according to claim 9, the expression vector according to claim 10, or the host cell according to any one of claims 11 to 14 in preparing a composition for catalyzing 1,5-glucitol-6-phosphate to generate 1,2-propanediol; preferably, the 1,5-glucitol-6-phosphate is 1,5-glucitol-6-phosphate or 1,5-glucitol-6-phosphate.

18. A method for producing 1,2-propanediol, comprising culturing the host cell according to any one of claims 11 to 14 in a culture medium containing 1,5-glycidol to obtain 1,2-propanediol; Preferably, the 1,5-glycidol is 1,5-glucitol or 1,5-glycidol.

19. A method for producing 1,2-propylene glycol, comprising contacting the composition of claim 15 or 16 with 1,5-glycidol-6-phosphate to obtain 1,2-propylene glycol; Preferably, the 1,5-glucitol-6-phosphate is 1,5-glucitol-6-phosphate or 1,5-glycidol-6-phosphate.

Citation Information

Patent Citations

  • Methanol dehydrogenase fusion proteins

    US20190085303A1