Pharmaceutical preparation for diagnosing and treating alzheimer's disease

Abstract

The present invention relates to the field of biomedicine. Provided are a marker that can be used for early diagnosis of Alzheimer's disease, and the use thereof. Specifically provided is a marker for early diagnosis of Alzheimer's disease. The marker is a Maf1 gene or the protein thereof. High expression of the Maf1 gene or the protein thereof in neuronal cells indicates that a subject is at high risk of developing Alzheimer's disease. The method provides a new diagnostic and therapeutic target for AD.

Description

Medical preparations for diagnosing and treating Alzheimer's disease Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to a marker that can be used for early diagnosis of Alzheimer's disease and a pharmaceutical preparation for its treatment. Background Art

[0002] Alzheimer's disease (AD) is a progressive, irreversible, and degenerative brain disease characterized by progressive dementia. The pathological changes of this disease are relatively extensive brain atrophy, also known as diffuse cerebral atrophy. As human life expectancy increases and age increases, the incidence of this disease has also tended to increase, and it has attracted increasing attention. The clinical manifestations of Alzheimer's disease are gradual onset. In the early stages, there are mild personality changes, intellectual impairment, decreased judgment ability, lack of interest in surrounding things, fatigue, nervousness, anxiety and irritability, restless sleep, headaches, and dizziness. Then it manifests as: ① memory impairment, mainly forgetting recent events; ② thinking and judgment disorders; ③ personality changes; ④ emotional disorders: depression, silence, etc.; ⑤ hallucinations and delusions: mainly auditory hallucinations, more common at night; ⑥ loss of the ability to integrate information obtained from sight, hearing, touch, and smell. As a result, patients become unable to live independently. As the disease progresses, they may lose the names of loved ones or even recognize them. They speak incoherently and stutter, have poor appetite, and experience significant weight loss. Eventually, their physical condition deteriorates to the point of being bedridden, suffering from incontinence. These symptoms often lead to death from infections. The primary symptom of Alzheimer's disease is organic dementia, but various psychiatric symptoms may also occur. Strecker et al. classify Alzheimer's disease into five types: simple dementia, delirium, paranoid, anxiety-depressive, and progeroid. Memory impairment is a hallmark symptom of Alzheimer's disease, but this differs from common insomnia and amnesia. Common insomnia and amnesia is the loss of memory traces in the brain, manifesting as an inability to recall previously perceived events. This temporary amnesia can be restored under appropriate conditions. Furthermore, patients with common insomnia and amnesia generally maintain intact insight, meaning they are aware of their abnormal mental activity, feel distressed by it, and actively seek medical help. These symptoms can be improved through psychological adjustment or other relaxation techniques. Alzheimer's patients generally lack self-awareness and are unable to recognize their own symptoms. They also experience permanent amnesia, with no recollection of events or experiences over a period of time. This is because the memory impairment in Alzheimer's disease often has an organic basis in the brain.

[0003] While the etiology of Alzheimer's disease (AD) remains unclear, several risk factors are known, and preventive measures targeting these factors should be effective. Causes of AD are categorized as follows: head trauma, educational level, family history of dementia, Down syndrome and Parkinson's disease, previous medical history, and aluminum pans. Boxers who experience repeated head trauma are more likely to develop AD, known as Dementia Pugilistica (Punchdrunk syndrome). Studies have shown a significant increased risk of developing the disease (RR 1.8) in those with a history of head trauma (Monique MB, Breteler, Jules J. Claus, Cornelia M. Van Duijn, et al. Epidemiology of Alzheimer's Disease. Epidemiologic Reviews, 1992, 14:59-82). Controlled studies have also found a positive correlation between head trauma with loss of consciousness and the development of AD. A history of head trauma in the 10 years prior to onset increases the risk of developing the disease. Traumatic disease is more common in men. Previous medical studies have shown an association between Alzheimer's disease and a history of thyroid disease. Therefore, while both genetic and environmental factors can independently increase the risk of AD, it's also conceivable that their combined impact could even be greater. A study by Cornelia M et al. showed that individuals with both head trauma and a family history of dementia had an odds ratio (OR) of 9.2.

[0004] The hippocampus is a crucial organ in the central nervous system, involved in higher-order physiological functions such as learning, memory, and emotion. Damage to hippocampal neurons can affect hippocampal function, ultimately leading to learning disabilities, memory impairment, depression, and temporal lobe epilepsy, which are among the pathological hallmarks of Alzheimer's disease. By inhibiting hippocampal damage and improving hippocampal neuroplasticity, Alzheimer's disease symptoms can be alleviated to a certain extent.

[0005] Neuroinflammation also plays a significant role in neurodegenerative diseases. Neuroinflammation is an inflammatory response in the brain that can be caused by a variety of factors, including brain trauma, β-amyloid deposition, impaired energy metabolism, and even aging. Studies have shown that the massive release of proinflammatory cytokines can damage neurons and cause synaptic loss and neuronal death, which is associated with the progression of the disease and plays a crucial role in assessing Alzheimer's disease.

[0006] Studies have found that decreased antioxidant capacity and the accumulation of free radicals in Alzheimer's patients are key contributors to neuronal toxicity, which in turn affects learning and memory. SOD and GSH-PX, two important antioxidant enzymes in the body, exhibit decreased activity in patients with learning and memory impairments, leading to the production of large amounts of free radicals and impaired brain function.

[0007] Currently, the clinical diagnosis of Alzheimer's disease is based on (1) clinical examination showing dementia and a Mini-Mental State Examination (MMSE) (1) The diagnosis of cerebral ischemia is supported by the following: (1) positive results of the Dementia Rating Scale (SE), Blessed Dementia Rating Scale, Hasegawa Dementia Rating Scale (HDS) and Wechsles Adult Intelligence Scale, or other neuropsychiatric tests; (2) two or more cognitive impairments; (3) progressive worsening of memory and other cognitive impairments; (4) unconsciousness; (5) most cases occur after the age of 65; (6) other brain lesions that may cause progressive memory and cognitive impairment are excluded; (7) laboratory examination: normal CSF in lumbar puncture, normal EEG or increased nonspecific slow waves; (8) progressive cerebral atrophy is shown on CT, often prominent in the frontal lobe; (9) radioisotope cistern scan shows enlarged ventricles with rapid emptying; (10) early EEG shows low amplitude and decreased alpha rhythm, gradually with widespread disappearance of theta and alpha waves, and later with bursts or scattered delta waves, which may also be asymmetric on both sides. It is generally believed that the diagnosis of Alzheimer's disease can only be made by pathological examination (neurofibrillary tangles and granulovacuolar degeneration and senile plaques in neurons). However, a detailed clinical course and relevant examinations can exclude other organic diseases that cause dementia, and a clinical diagnosis can still be made. The above diagnostic criteria are called NINCDS-ADRDA and are used by the United States and other countries (Epidemiology of Alzheimer's Disease; Wang Zhijin et al., Chinese Journal of Epidemiology 1998, (03), 173-176).

[0008] Early-onset AD is mainly associated with autosomal dominant inheritance, while late-onset AD is more closely associated with acquired factors. Studies have shown that high-risk factors for late-onset AD include hypertension, atherosclerosis, diabetes, smoking, and metabolic syndrome (NAGAI M, DOTE K, KATO M, et al. Visit-to-visit blood pressure variability and Alzheimer's disease: links and risks [J]. J Alzheimers Dis, 2017, 59(2): 515-526.); its pathological manifestations are mainly intracellular neurofibrillary tangles (NFTs) and extracellular Aβ deposition. In addition, an increase in microglia can be seen in senile plaques (KENNEY K, IACONO D, EDLOW BL, et al. Dementia after moderate-severe traumatic brain injury: coexistence of multiple proteinopathies [J]. J Neuropathol Exp Neurol, 2018, 77(1): 50-63).

[0009] It is worth noting that AD is also a fatal neurodegenerative disease. AD pathological characteristics include senile plaques formed by the aggregation of beta-amyloid protein (Aβ) in the brain, neurofibrillary tangles (NFTs) formed by the aggregation of hyperphosphorylated Tau protein, chronic inflammatory response, synaptic loss and neuronal death, neurotransmitter deficiency, oxidative stress, inflammation, gene mutation, excitotoxic neurotoxins, etc. (Paasila, PJ, et al., Synapses, Microglia, and Lipids in Alzheimer's Disease. Front Neurosci, 2021.15: p.778822. 2022 Alzheimer's disease facts and figures. Alzheimers Dement, 2022.18(4): p.700-789.). Recent studies have also shown that in many Alzheimer's patients who do not have senile plaques and neurofibrillary tangles in their brains, the morphology and function of synapses have been significantly degraded, and some neurons have even died. Compared with amyloid plaque formation or neuronal loss, synaptic loss is the most obvious morphological correlate of cognitive impairment in early AD, and synaptic degeneration has become a biological hallmark of early AD (Lleó, A., et al., Changes in Synaptic Proteins Precede Neurodegeneration Markers in Preclinical Alzheimer's Disease Cerebrospinal Fluid. Mol Cell Proteomics, 2019. 18(3): p. 546-560.). A recent study also found that transcriptional regulation coordinates and regulates synaptic plasticity (Michels, AA, et al., mTORC1 directly phosphorylates and regulates human MAF1. Mol Cell Biol, 2010. 30(15): p. 3749-57.). In addition, studies have found that many transcriptional regulators in the brain after AD undergo significant changes (Mathys, H., et al., Single-cell transcriptomic analysis of Alzheimer's disease. Nature, 2019. 570 (7761): p. 332-337.). However, the role of these transcription factors after AD is still unclear. Studies have also shown that NMDA receptors are ligand-gated ion channels that play a key role in memory formation. Presynaptic NMDA receptors regulate glutamate release and synaptic plasticity, which may be independent of Mg. 2+and Ca 2+ Controls spontaneous release, whereas evoked release is Mg-dependent 2+ Activation of NMDA extrasynaptic receptors can lead to long-term depression (LTD), spine retraction, and synaptic loss, and can cause glutamate excitotoxicity and lead to AD (WANG R, REDDY PH. Role of glutamate and NMDA receptors in Alzheimer's disease[J]. J Alzheimers Dis, 2017, 57(4):1041-1048). Therefore, NMDA is one of the targets for the treatment of AD.

[0010] Maf1 is a highly conserved protein found in humans, rats, mice, and lower animals, such as Drosophila and Bombyx mori. First discovered in Saccharomyces cerevisiae, Maf1 is a transcriptional regulator of RNA polymerase III and plays essential roles in tumorigenesis, glucose metabolism, and lipid metabolism by activating the PTEN pathway. Recently, Maf1 has also been found to bind to and block transcription initiation and elongation regulated by RNA polymerase III. More recently, it has been found to regulate the activity of both RNA polymerase I and RNA polymerase II. Notably, Maf1 activity in yeast is regulated by various environmental factors, including rapamycin, nutritional restriction caused by glucose deprivation, DNA damage, and yeast secretion defects. Human Maf1 activity is altered in response to DNA damage signals and rapamycin. Studies have also shown that Maf1 regulates mitochondrial IN function in yeast cells. In addition to influencing mitochondrial function, Maf1 also regulates glucose metabolism, autophagy, and lipid metabolism, potentially playing a role in tumorigenesis, fertility, obesity, growth and development, and life expectancy. It is also highly expressed in the central nervous system, particularly in the hippocampus and cortex. In addition, the latest research has shown that Maf1 can negatively regulate the growth of hippocampal neuron dendrites through the PI3K-AKT-mTOR signaling pathway, and negatively regulate the growth of dendritic spines to affect the learning and memory ability of mice (Chen, K., et al., Maf1 regulates dendritic morphogenesis and influences learning and memory. Cell Death Dis, 2020.11(7): p.606.). The report also confirmed the neuroprotective effect of Maf1 on the survival period after RGC injury and provided a potential therapeutic strategy for traumatic optic neuropathy. As a result, Maf1 has become a hot spot in the central nervous system. Therefore, exploring the morphology and potential function of Maf1 in regulating neuronal synapses and finding small molecules that regulate Maf1 are of great significance for the diagnosis and treatment of Alzheimer's disease. Summary of the Invention

[0011] In the present invention, under the pathological state of AD, the expression of the transcriptional regulatory protein factor Maf1 increases. Maf1 binds to the promoter region of Grin1, thereby regulating the expression of NMDAR1, further regulating calcium homeostasis, changing the morphology and number of dendritic spines, and thus affecting synaptic function. The present invention reveals that the Maf1-NMDAR1 pathway causes synaptic and calcium defects and discovers small molecule compounds that can act on this pathway, providing a new diagnostic and therapeutic approach for AD. Based on this, the present invention is completed.

[0012] In a first aspect, the present invention provides a marker for early diagnosis of Alzheimer's disease, wherein the marker is the Maf1 gene or its protein. When the Maf1 gene or its protein is highly expressed in neuronal cells, it indicates that the test subject is at high risk of developing Alzheimer's disease.

[0013] In a second aspect, the present invention provides a reagent or kit for early diagnosis of Alzheimer's disease; the reagent or kit contains a reagent capable of detecting the expression of Maf1 gene or its protein.

[0014] In a third aspect, the present invention provides an application of the Maf1 gene or its protein in the preparation of a product for early diagnosis of Alzheimer's disease, wherein the application is to determine whether the patient is at high risk of Alzheimer's disease based on the expression of the Maf1 gene or its protein in neuronal cells.

[0015] Furthermore, when the Maf1 gene or its protein is highly expressed in neuronal cells, the test subject is determined to be a high-risk group for Alzheimer's disease.

[0016] Furthermore, the product includes a chip and a test kit.

[0017] In a fourth aspect, the present invention provides an inhibitor for inhibiting the expression of Maf1 protein.

[0018] Furthermore, the inhibitors include but are not limited to chemically synthesized, natural compounds and / or biosynthetic substances.

[0019] Furthermore, the inhibitor includes one or more of compounds, proteins, enzymes, nucleic acids, hormones, antibodies and cytokines.

[0020] Furthermore, the structure of the inhibitor is as follows:

[0021] (ETHYL4-[3-(3-{[2-(AZEPAN-1-YL)ETHYL]CARBAMOYL}PIPERIDIN-1-YL)-3-OXOPROPYL]-3,5-DIMETHYL-1H-PYRROLE-2-CARBOXYLATE)

[0022] In a fifth aspect, the present invention provides a promoter for promoting the expression of Maf1 protein.

[0023] Furthermore, the promoter includes but is not limited to chemically synthesized, natural compounds and / or biosynthetic preparations.

[0024] Furthermore, the promoter includes one or more of compounds, proteins, enzymes, nucleic acids, hormones, antibodies and cytokines.

[0025] In a sixth aspect, the present invention provides a use of a promoter for promoting the expression of Maf1 gene or protein in preparing an animal model, wherein the promoter is an experimental preparation.

[0026] Furthermore, the animal model can be a Maf1 overexpression model, a cognitive dysfunction model, etc.

[0027] In a seventh aspect, the present invention provides a use of an inhibitor for inhibiting the expression of Maf1 gene or its protein in the preparation of a drug for treating AD.

[0028] Furthermore, the inhibitors include but are not limited to chemically synthesized, natural compounds and / or biosynthetic substances.

[0029] Furthermore, the inhibitor includes one or more of compounds, proteins, enzymes, nucleic acids, hormones, antibodies and cytokines.

[0030] Furthermore, the structure of the inhibitor is as follows:

[0031] (ETHYL4-[3-(3-{[2-(AZEPAN-1-YL)ETHYL]CARBAMOYL}PIPERIDIN-1-YL)-3-OXOPROPYL]-3,5-DIMETHYL-1H-PYRROLE-2-CARBOXYLATE)

[0032] In an eighth aspect, the present invention provides a pharmaceutical preparation for treating AD, wherein the pharmaceutical preparation contains an inhibitor for inhibiting the expression of Maf1 gene or its protein, and further comprises a pharmaceutically acceptable carrier thereof.

[0033] Furthermore, the structure of the inhibitor is as follows:

[0034] (ETHYL4-[3-(3-{[2-(AZEPAN-1-YL)ETHYL]CARBAMOYL}PIPERIDIN-1-YL)-3-OXOPROPYL]-3,5-DIMETHYL-1H-PYRROLE-2-CARBOXYLATE) Beneficial effects

[0035] In this study, we found that Maf1 regulates NMDAR1 expression by binding to the Grin1 promoter region, further regulating neuronal calcium homeostasis and synaptic remodeling. Therefore, this study reveals that the Maf1-NMDAR1 pathway causes synaptic and calcium defects and provides a new diagnostic and therapeutic target for AD. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1. Increased Maf1 expression in AD patients and APP / PS1 mice. (A) Heatmap of total differentially expressed genes in the GSE5281 database of AD and normal human brains. (B) Heatmap of Maf1 expression in the database of normal and AD patients. (C) Maf1 expression is elevated in the AD human brain database compared to corresponding non-demented controls (n = 13 and n = 10, respectively). (D-E) Quantitative Western blot analysis of primary hippocampal neurons showing increased Maf1 expression in the hippocampus of APPswe virus-transfected mice compared to the vector and APP WT viruses. Western blot electrophoresis and statistical graphs. (F-G) Comparison of Maf1 protein levels in hippocampal neurons of 6-month-old APP / PS1 mice compared to WT mice. n = 4 mice per group. (H-I) Immunohistochemistry results for Maf1 in 6-month-old APP / PS1 mice. n = 4 mice per group. (J-K) Immunofluorescence results for Maf1 in 6-month-old APP / PS1 mice. Data are expressed as mean ± SEM. *p<0.05; **p<0.01; ***p<0.001.

[0037] Figure 2. Maf1 expression in dendrites of primary hippocampal neurons. (A) NeuN purity in primary neurons was observed by laser confocal microscopy. Scale bar: 250 μm. (B) Immunostaining of Maf1 and MAP2 in cultured hippocampal neurons and brain slices from 6-month-old mice for 14 days using laser confocal microscopy. Scale bars: top, 25 μm; bottom, 50 μm.

[0038] Figure 3. Construction of Maf1-eCKO1-APP / PS1 transgenic knockout mice. (A) Schematic diagram of the design strategy for constructing Maf1-eCKO1 conditional knockout mice. Based on the principle of homologous recombination, the Maf1 gene was modified using flox via homologous recombination in fertilized eggs. (B) Schematic diagram of the hybridization of Maf1-eCKO1-APP / PS1 mice. (C) PCR identification of DNA from Maf1-eCKO1-APP / PS1 hybrid mice. (D) Schematic diagram of the stereotaxic injection of adeno-associated virus. (E) Schematic diagram of the experimental design. Morris water maze (MWM) tests were performed one month after viral injection. (F) Following injection of AAV-Cre virus, Western blotting confirmed successful knockdown of Maf1 and corresponding reduction of NMDAR1 in Maf1-eCKO1-APP / PS1 transgenic mice. (G) Fluorescence image of the hippocampus of Maf1-eCKO1-APP / PS1 hybrid mice following AAV-Cre virus injection. Scale bar: 20 μm.

[0039] Figure 4. Conditional knockout of Maf1 improves learning and memory in AD mice. (A) Representative images of water maze trajectories of mice in each group on day 5 of the acquisition training phase. (B) Measurement of the latency to find the escape platform during the acquisition training phase on days 1–5. (C) Representation of water maze trajectories of mice in each group on day 6 of the spatial exploration test phase. (D-E) Percentage of time spent in the target quadrant and number of crossings into the target platform area during the spatial exploration phase for mice in the three groups. n = 10 mice per group. Data are expressed as mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001. Figure 5. Conditional knockout of Maf1 in hippocampal neurons promotes dendritic spine maturation in AD. (A) Golgi staining of mouse hippocampal neurons. Analysis of dendritic spines in hippocampal neurons from mice after virus injection. Neurons were selected under a 40x microscope, and the number of dendritic spines was analyzed under a 100x microscope. (B) High-magnification of dendritic spine expression in hippocampal neurons from WT and Maf1-eCKO1-APP / PS1 mice injected with AAV-syn-Cre-GFP and AAV-syn-GFP vectors after Golgi staining. Scale bar, 10 μm. (C) Statistical analysis of dendritic spine density in neurons from the three groups of mice. (D) Statistical graph of the percentage of classified dendritic spines in neurons from the three groups of mice. n = 7-10 neurons per group. (E) Fluorescence microscopy of GFP fluorescence in primary hippocampal neurons transfected with shSCR and shMaf1 plasmids. Magnified images are shown below. Scale bars: upper, 20 μm; lower, 2 μm. (F) Statistical analysis of dendritic spine density in neurons in vitro. (G) Statistical graph of the percentage of classified dendritic spines in neurons in vitro. n = 3-6 neurons per group. Data are expressed as mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.

[0040] Figure 6. Construction of shRNA and full-length viruses targeting the target gene Maf1 and their validation in cell lines and primary neurons. (A) Virus was transfected into 293T cell lines, and GFP green fluorescence intensity was high 72 hours after transfection. (B-C) Western blotting assays were used to detect the knockdown of Maf1 by shRNA and the effects of Maf1 overexpression in 293T cell lines. (D-E) Western blotting assays were used to detect the knockdown of Maf1 by shRNA and the effects of Maf1 overexpression in primary neurons. (F) Neurons were transfected with a Flag-tagged Maf1 overexpression plasmid and immunofluorescence staining was performed after 14 days of culture.

[0041] Figure 7. Knockout of endogenous Maf1 in hippocampal neurons improves cognitive function in AD.

[0042] (A) AAV-GFP green fluorescence is observed in mouse hippocampal slices one month after viral injection. (B) Western blotting analysis of Maf1 expression in the hippocampus of AD mice injected with AAV-shMaf1. (C) Golgi staining of mouse hippocampal neurons. Selected neurons were analyzed under a 40x microscope and 100x microscope for dendritic spine morphology and number. (D) Representative images of dendritic spines in hippocampal neurons from WT and APP / PS1 mice injected with AAV-syn-shSCR and AAV-syn-shMaf1 after Golgi staining. Scale bar, 10 μm. (E) Statistical analysis of dendritic spine density in neurons from the three groups of mice. (F) Statistical graph of the percentage of classified dendritic spines in neurons from the three groups of mice. n = 7-10 neurons per group. (G) Latency to find the escape platform was measured on days 1-5 of the acquisition phase. (HI) Percentage of time spent in the target quadrant and number of crossings into the target platform area during the spatial exploration phase for the three groups of mice. n = 10 mice per group. Data are expressed as mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.

[0043] Figure 8. Knockout of Maf1 affects calcium homeostasis and amyloid plaque deposition in AD hippocampal neurons.

[0044] (A) Primary hippocampal neurons were cultured in vitro after infection with APP, shSCR, and shMaf1 lentiviruses. Green fluorescence under a fluorescence microscope represents Fura-4 / AM intensity. (B) Statistical quantification of fluorescence intensity obtained in four groups. (C-D) Immunohistochemical and statistical results of Aβ plaques in 6-month-old Maf1-eCKO1-APP / PS1 mice. (E-F) Immunohistochemical and statistical results of Aβ plaques in 6-month-old Maf1-eCKO1-APP / PS1 mice. *p < 0.05; **p < 0.01; ***p < 0.001.

[0045] Figure 9. Conditional knockout of Maf1 rescues synaptic dysfunction in AD mice. (A) mEPSCs were recorded from neurons in the CA1 region of the hippocampus of WT and Maf1-eCKO1-APP / PS1 mice injected with AAV-syn-Cre-GFP and AAV-syn-GFP vectors, following the protocol for acute brain slice electrophysiology. (B) Mean mEPSC amplitude is shown on the right, and mean mEPSC amplitude is shown on the left. Calibration: 15 Pa, 1 s. WT, n = 15 neurons from 4 mice; AAV-syn-vector, n = 12 neurons from 4 mice; AAV-syn-Cre, n = 12 neurons from 4 mice. (C) The upper panel shows fEPSP recordings from the CA3-CA1 pathway. The stimulating electrode was placed in the Schaffer area of ​​CA3, and the recording pipette was placed in the stratum radiatum of CA1. Stimulating electrode and recording pipette. During LTP recordings, the baseline and final 10 min represent fEPSP recordings. Calibration: 0.5 mV, 10 ms. (D) Quantification of the average fEPSP slope during the last 10 min of LTP in four mice: WT, n = 9 neurons; AAV-syn-vector, n = 9 neurons from four mice; AAV-syn-Cre, n = 11 neurons from four mice. Data are expressed as mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.

[0046] Figure 10. RNAseq analysis suggests that Maf1 regulates the downstream gene Grin1, which is involved in calcium signaling pathways and synaptic function.

[0047] (A) RNAseq sequencing examined changes in neuronal gene expression profiles following Maf1 depletion in AD. A volcano plot shows 884 differentially expressed genes, of which 320 were upregulated (red scatter) and 564 were downregulated (blue scatter). (B) A heatmap of differentially expressed genes demonstrates differences in gene expression between the two groups. (C) Gene Ontology (GO) enrichment analysis was performed on different genes, with the top 30 entries shown. (D) A heatmap shows that Grin1 is significantly downregulated following Maf1 depletion. (E) KEGG pathway enrichment map of the top five differentially expressed genes. (E) Gene set enrichment analysis (GSEA) demonstrates an association between the calcium signaling pathway and Grin1.

[0048] Figure 11. Figure 6. CUT&Tag sequencing reveals protein-DNA interactions between Maf1 and Grin1. (A) Annotation of Maf1 binding peaks within gene functional element regions. (B) Distribution of distances between Maf1 binding peaks and gene translation start sites (TSSs). (C) GO enrichment analysis of the top 10 binding site genes indicates associations with synapses and calcium binding. (D) KEGG enrichment analysis of the binding sites indicates a close association between calcium signaling and synaptic glutamine secretion. (E) Schematic representation of genes co-intersecting between GO-synaptic and KEGG-synaptic enriched genes. (F) GO and KEGG protein interaction network analysis reveals Grin1 as a core protein.

[0049] Figure 12. Maf1 regulates Grin1 promoter activity and promotes NMDAR1 expression.

[0050] (A) NMDAR1 protein levels in mouse hippocampus; (B) Statistical quantification of in vivo Western blotting results. (C) Changes in NMDAR1 protein levels in primary neurons; (D) Statistical quantification of in vitro Western blotting results. (EF) Immunoprecipitation of Maf1 and NMDAR1 in hippocampal neurons. Maf1 does not directly bind to NMDAR1. (G) Four primers were designed based on the Grin1 promoter. ChIP-quantitative PCR results showed that four sequences in fragments 1, 2, and 3 were enriched in IP-Maf1. (H) Schematic diagram of the construction of luciferase plasmids expressing wild-type Grin1 promoter (Luc) and mutant Grin1 promoter. (I) Grin1 wild-type and mutant promoter plasmids (MT) were co-transfected with pcDNA-NC and pcDNA-Maf1 into HEK293T cells. Luciferase activity was measured using a dual-luciferase reporter assay. (JL) Grin1 wild-type and mutant promoter plasmids (MT1, MT2, MT3) were co-transfected with pcDNA-NC and pcDNA-Maf1 into HEK293T cells.

[0051] Figure 13. Grin1 promoter mutation attenuates the morphological effects of Maf1 knockdown.

[0052] (A) Representative GFP fluorescence images of primary hippocampal neurons transfected with shSCR, shMaf1, Grin1WT, and MT plasmids under a fluorescence microscope. Magnifications of the sections in the white boxes are shown below. Scale bars: Top, 20 μm; Bottom, 2 μm. (B) Statistical analysis of dendritic spine density in vitro. (C) Statistical graph of the percentage of classified dendritic spines in vitro. n = 7-20 neurons per group. Data are expressed as mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.

[0053] Figure 8. The mechanism by which the Maf1-NMDAR1 signaling pathway regulates neuronal calcium homeostasis and participates in synaptic remodeling in Alzheimer's disease. In AD, increased expression of the transcriptional regulator Maf1 binds to the Grin1 promoter, further regulating calcium homeostasis and altering the morphology and number of dendritic spines, thereby affecting synaptic function and regulating NMDAR1 expression. Ultimately, this modulates synaptic remodeling, impacting learning and memory.

[0054] Figure 15. Establishment and detection of Maf1 protein-analyte interaction model

[0055] Figure 16. Results and trends of drug concentration changes in mouse blood

[0056] Figure 17. Detection of compound content changes in mouse brain tissue and comparison of blood / brain tissue content

[0057] Figure 18. IC50 curve of compound I in 293T cell line

[0058] Figure 19. IC50 curve of compound I in primary neurons

[0059] Figure 20. IC50 curves of compound II in cell lines and primary neurons

[0060] Figure 21. Compound intervention can improve the density of dendritic spines in AD in vitro models

[0061] Figure 22: Compound intervention can improve learning and memory abilities in AD animal models

[0062] Figure 23. Compound intervention can improve the density of dendritic spines in AD animal models

[0063] Figure 24. Changes in gene transcriptomes in AD hippocampal tissue after compound intervention DETAILED DESCRIPTION

[0064] The following is a further description of specific embodiments of the present invention. It should be noted that the description of these embodiments is intended to facilitate understanding of the present invention and does not constitute a limitation of the present invention. In addition, the technical features involved in the embodiments described below may be combined with each other as long as they do not conflict with each other.

[0065] The term "diagnosing Alzheimer's disease" as used herein includes determining whether a subject has already developed Alzheimer's disease, and also includes determining whether a subject is at risk of developing Alzheimer's disease.

[0066] The term "Aβ" as used herein refers to beta-amyloid protein.

[0067] The term "NFTs" as used herein refers to neurofibrillary tangles.

[0068] The term "NMDA" as used herein refers to the NMDA receptor, N-methyl-D-aspartate receptor, an ionotropic glutamate receptor subtype that is crucial in shaping the nervous system and synaptic plasticity as a key excitatory ionotropic glutamate receptor.

[0069] The term "CaN" as used herein 2+ Calcineurin.

[0070] The term "CaMKII" as used herein refers to calmodulin-dependent protein kinase II.

[0071] The term "LTP" as used herein: Long-Term Potential.

[0072] The term "LTD" as used herein refers to long-term depression.

[0073] The term "mEPSC" as used herein refers to a miniature excitatory postsynaptic potential.

[0074] As used herein, the term "fEPSPs" refers to field excitatory postsynaptic potentials.

[0075] The term "HFS" as used herein refers to high frequency stimulation.

[0076] The term "ACSF" as used herein refers to artificial cerebrospinal fluid.

[0077] The term "MWM" described herein refers to the Morris water maze test.

[0078] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0079] Example

[0080] 1. Animals

[0081] APP / PS1 transgenic mice are derived from the Shanghai Model Organisms with a C57BL / 6J genetic background. Shanghai Model Organisms constructed Maf1-eCKO1 transgenic mice by floxing the homologously modified Maf1 gene in fertilized eggs. Based on the principle of homologous recombination, CRISPR / Cas9-mediated gene editing was used in C57BL / 6J mice. Tissue-specific infection with localized AAV-Cre virus, coupled with a neuron-specific promoter driving the Cre gene, enabled stronger tissue- and neuron-specific gene recombination. Maf1-eCKO1 transgenic mice were further crossed with APP / PS1 mice to generate Maf1-eCKO1-APP / PS1 transgenic mice. ICR mice were purchased from Shanghai Jiesijie Laboratory. Animals were housed in a specific pathogen-free environment (23±2°C, 45±5% humidity, 12h light / dark cycle) with free access to pelleted chow and water.

[0082] 2. Generation of Plasmid and Viral Constructs

[0083] Design three shRNA target sequences and one scramble shRNA sequence based on the Maf1 gene, and synthesize primers. The primer sequences are as follows:

[0084] shRNA1:TTGGAGAACTCCAGCTTTGAGGCCATCAA;

[0085] shRNA2:TCTGCTTAGCTGAGTG TGACATCTACAGC;

[0086] shRNA3:CCTCAATGAGTCCTTCCGGCCAGACTATG;

[0087] scramble shRNA (shSCR): GCACTACCAGAGCTAACTCAGATAGTACT.

[0088] The following single-stranded primers were annealed to double-stranded oligo sequences and ligated to the double-enzyme-digested linearized RNA interference vector. Transformants were verified by sequencing and high-purity plasmids were extracted.

[0089] Maf1 shRNA plasmids were constructed using the pGFP-CMV-ShLenti vector and further packaged into lentivirus. Maf1 interfering adeno-associated virus (AAV) was constructed using the pAAV-hSyn-EGFP-3xFLAG-WPRE vector. Cre interfering adeno-associated virus (AAV) was constructed using the pAAV-hSyn-EGFP-WPRE vector. APP695swe (K595N / M596L) virus was expressed in the pSLenti-CMV vector. Both lentivirus and AAV were purchased from Obio Technology (Shanghai) and stored at −80°C.

[0090] 3. Cell Culture and Transfection

[0091] Primary hippocampal cultures were prepared from embryonic day 18 mouse brains (Xu, NJ and M. Henkemeyer, Ephrin-B3 reverse signaling through Grb4 and cytoskeletal regulators mediates axon pruning. Nat Neurosci, 2009. 12(3): p. 268-76.). Neurons isolated from hippocampal tissue were inoculated with polylysine and cultured in neurobasal medium containing B27 supplement and GlutaMAX. For lentiviral-infected neurons, concentrated lentivirus was added to the culture medium on day 6 in vitro and the cells were transfected. After cell lysis, transfection efficiency was verified by fluorescence and protein levels. APPswe virus was transfected for 6 days in vitro (DIV), followed by calcium phosphate transfection of shRNA plasmids for 2 days, and then continued for 10 days to verify the regulatory effect of Maf1 on neuronal dendritic growth. When two plasmids were transfected simultaneously, the plasmid carrying GFP was mixed with the other plasmid at a ratio of 1:3.

[0092] 4. Real-time Quantitative PCR

[0093] Total RNA was extracted from primary hippocampal cultures using Trizol reagent (Invitrogen, Carlsbad, CA, USA). RNA was reverse transcribed into cDNA using a Hieff SYBR Green Master Mix (Yeasen) was used, and real-time qPCR was performed on a 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA).

[0094] 5. Western Blotting

[0095] Mouse hippocampi were dissected, homogenized, and lysed in lysis buffer at 4°C for 30 minutes. The lysate was centrifuged at 12,000 g for 20 minutes at 4°C to remove insoluble sediment, and protein concentration was estimated using a bicinchoninic acid (BCA) protein assay kit (Thermo Scientific, Rockford, IL, USA). Proteins were then denatured by boiling at 95°C for 10 minutes in sodium dodecyl sulfate (SDS) loading buffer. Proteins were run on a 10% polyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was blocked in TBST (150 mM NaCl, 10 mM Tris, 0.1% Tween 20, pH 7.6) containing 5% BSA for 1 hour at room temperature. Primary antibodies were diluted in blocking buffer and incubated overnight at 4°C. After washing with TBST, the blot was incubated with an HRP-conjugated secondary antibody at room temperature for 1 hour. After washing again, the blot was exposed to an enhanced chemiluminescence substrate. Quantification was performed using ImageJ software to analyze the relative density of the exposed membrane. For primary antibodies, we used rabbit anti-Maf1 (1:500, Abcam, catalog ab230499), rabbit anti-β-actin antibody (1:1000, Cell Signaling Technology, catalog 8457S), mouse anti-GAPDH (1:3000, Invitrogen, catalog MA5-15738-D680), rabbit anti-NMDAR1 (1:1000, Abcam, catalog ab109182), mouse anti-NMDAR1 (1:1000, Abcam, catalog ab134308), rabbit anti-APP (6E10) antibody (1:1000, Novusbio, catalog NBP2-62566), and immunoprecipitation-rabbit IgG (1:1000, Abcam, catalog ab172730).

[0096] 6. Immunohistochemistry and Immunofluorescence

[0097] Primary hippocampal neurons were fixed with 4% paraformaldehyde (PFA) in PBS for 30 minutes and stored at 4°C. Mice were perfused, and brains were fixed overnight with 4% PFA in PBS at 4°C. 30 μm coronal brain slices were generated using a VT1000 vibratome (Leica Biosystems, Wetzlar, Germany). For immunohistochemistry (IHC), endogenous peroxidase activity was blocked with 3% H₂O₂ for 10 minutes at room temperature and with blocking solution: 0.03% Triton X-100 (MilliporeSigma) and 10% donkey serum (Invitrogen) in PBS for 10 minutes at room temperature. Sections were then incubated with primary antibodies in an antibody solution (0.03% Triton X-100 and 2% donkey serum in PBS) overnight at 4°C. The following day, sections were incubated with an enzymatic anti-rabbit antibody and stained using a DAB kit (Vector Labs, Carlsbad, CA, USA). For immunofluorescence (IF), sections were blocked with blocking buffer for 30 minutes, incubated with primary antibodies, and cell nuclei were stained with DAPI in antibody solution overnight. Sections were rinsed in PBS for 10 minutes and then incubated with Alexa Fluor secondary antibodies for 2 hours at room temperature. Sections were rinsed in PBS for 10 minutes, then mounted with mounting medium and imaged. The following antibodies were used: rabbit anti-Maf1 (1:150, Abcam, catalog ab230499), chicken anti-Map2 (1:10,000, Abcam, catalog ab5392), and Alexa Fluor secondary antibodies (Alexa Fluor 488, Alexa Fluor 555, Alexa Fluor 647; 1:500, Thermo Fisher).

[0098] 7. Image Analysis and Quantification

[0099] High-resolution images of double immunofluorescence experiments were obtained using a confocal microscope (Leica SP8). Z series of 7-12 images were taken at a resolution of 1024 × 1024 pixels, with a depth interval of 0.5 μm-1 μm, and each image was averaged twice. The composite stack was flattened into a single image using maximum intensity projection (Jaworski, J., et al., Control of dendritic arborization by the phosphoinositide-3'-kinase-Akt-mammalian target of rapamycin pathway. J Neurosci, 2005. 25(49): p. 11300-12.). The fluorescence intensity and cellular localization of the target protein were measured using a × 20 objective lens. For the analysis of dendritic spines, neurons were imaged with a × 63 objective lens and 2 zoom at a pixel resolution of 1024 × 1024. Spine shape was further quantitatively determined, and neuronal spine shape was classified and GFP-positive cells were evaluated. Image J was used.

[0100] 8. Quantification of RNA-sequencing and Data Analysis

[0101] Total RNA was extracted using the mirVana miRNA Isolation Kit (Ambion). RNA integrity was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Samples with an RNA integrity number (RIN) ≥ 7 were subjected to subsequent analysis. Libraries were constructed using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, CA, USA). These libraries were then sequenced on an Illumina sequencing platform (HiSeq™ 2500 or Illumina HiSeq XTen) and 125 bp / 150 bp paired-end reads were generated. Transcriptome sequencing and analysis were performed by OE biotech Co., Ltd. (Shanghai, China). Cutting and labeling analysis After anesthesia, hippocampal tissue and brain tissue were isolated, and lysis buffer was added to the collected tissue to break up the tissue mass and promote rapid release of the nucleus. ConA magnetic beads resuspended in Binding buffer were added. The target protein was bound to the primary antibody and incubated with the secondary antibody. Next, ChiTag transposases were activated using antibodies to fragment the target DNA. Finally, DNA was extracted, PCR was performed, and DNA was purified and sequenced in silico. Shanghai Ouyi Biomedical Technology Co., Ltd. assisted with sequencing and data analysis.

[0102] 9. Co-immunoprecipitation (CoIP) assay

[0103] Thermo Scientific IP Lysis Buffer (Catalog No. 87787) was used. 1 μg of Maf1 or NMDAR1 antibody was added to the protein extracts and reacted overnight at 4°C. The extracts were then incubated with Protein G beads for 3 hours at 4°C. Immunoblotting was performed and detected with the indicated antibodies.

[0104] 10. Chromatin Immunoprecipitation (ChIP)

[0105] Using Pierce TM ChIP assays were performed using an agarose ChIP kit (Thermo Fisher Scientific). Chromatin was extracted and DNA was cut into 0.2 kb to 1 kb fragments. Primary hippocampal neurons were cross-linked with 1% formaldehyde, and chromatin was immunoprecipitated with the antibody Maf1 (Abcam). IgG was used as a negative control. DNA was resuspended in 50 μL TE buffer and amplified by PCR. PCR products were measured on a 1.5% agarose gel. DNA was purified (TransGen Biotech, catalog number: No. EP101) and further analyzed by qPCR using primers targeting the Grin1 promoter. The ChIP-PCR primers used in this study are as follows:

[0106] Grin1-promoter-F1: GCCCAAGAAGAGCCCAAGAA,

[0107] R1: CCAGGGAAGATTTGTCACGC;

[0108] Grin1-promoter-F2: GACAGGGGTCTTAGACAGTGC,

[0109] R2: ACCCACACGTTCACACTCC;

[0110] Grin1-promoter-F3: CTTTACATGGCAGGAGGGGG,

[0111] R3: CATCTTGCTCCCAGCAGTCA;

[0112] Grin1-promoter-F4: CGGATCCAAGGTGGTGTT,

[0113] R4:TCTAGAGGGTGAGATAGGATTGCT.

[0114] 11. Dual luciferase reporter gene assay

[0115] Interaction between Maf1 and the Grin1 promoter region. The pGL3 promoter vector was used. Maf1 overexpression plasmids, wild-type Grin1 promoter-expressing luciferase (Luc), and mutant Grin1 promoter-expressing luciferase were constructed by Genomeditech Co. Ltd. Cells were co-transfected with either the WT or MT plasmids and Maf1 or a negative control using Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific, Inc.). Forty-eight hours after transfection, relative luciferase activity was measured using a dual-luciferase reporter assay kit (Promega, Madison, WI, USA). Firefly luciferase activity was normalized to Renilla luciferase activity. Experiments were performed in triplicate. Mutations in the Grin1 promoter were constructed at -1774 to 951 (MT), -1774 to -1697 (MT1), -1308 to -1217 (MT2), and -1039 to -951 (MT3).

[0116] 12. Calcium Imaging Experiment

[0117] Primary hippocampal neurons were treated with the appswe and shmaf1 lentiviruses at DIV8. Calcium imaging experiments were performed between DIV14 and DIV16. Neurons were incubated with Fura-4 AM (Biyuntian, Catalog No. S1061M) at a final concentration of 2 μmol / ml at 37°C for 30 minutes. After rinsing with saline, the cells were observed at 510 nm using an inverted fluorescence microscope after the fluorescence exited the cells at 340 nm.

[0118] 13. Stereotaxic Injection

[0119] Mice were anesthetized using 1% sodium pentobarbital solution (50 mg / kg, intraperitoneally). A hole was drilled above the CA1 region of the hippocampus (anterior / posterior = ± 1.25 mm, medial / lateral = ± 1.7 mm, dorsal / ventral = ± 1.6 mm). AAV2 / 9-syn-shSCR-GFP, AAV2 / 9-syn-shMaf1-GFP, AAV-syn-GFP vector or AAV-syn-Cre-GFP (1012 IU / mL, 2 μL) was microinfused bilaterally into the hippocampus via a cannula connected to a Hamilton (Reno, NV) microinjector. The infusion rate was 0.2 μL / min, and the cannula was left in place for 10 min after the infusion was completed.

[0120] 14. Morris Water Maze

[0121] Learning and memory were assessed one month after AAV2 / 9 injection. The Morris water maze consists of a white, circular pool (120 cm in diameter) filled with water and stained white with milk. A platform (6 cm in diameter, 30 cm in height) was placed in one of the quadrants of the pool. The pool was filled with water at 20 ± 1°C, and the platform was hidden 1 cm below the surface. The day before the experiment, mice were placed in the same room as the water maze to acclimate to the environment. During the acquisition phase, mice were gently lowered into the water from the inner wall of the pool in the non-target quadrant. Simultaneously, recording began for a total of 60 seconds. If a mouse found the platform and remained there for 3 seconds or longer, it was considered to have found the platform, and recording automatically stopped. For mice that failed to find the platform within 60 seconds, the latency was recorded as 60 seconds, and the mouse was guided to remain on the platform for 20 seconds. The latency and distance traveled by the mouse to find the platform were recorded. Spatial exploration phase: On day 6, the circular platform in the target quadrant was removed, and the point of entry for the mouse was the furthest from the platform in a straight line. Mice were allowed to swim in water for 60 seconds, and parameters such as the number of times the mice crossed the platform, the total distance traveled, and the percentage of time spent in each quadrant were recorded. The ANY-maze automated video system (MED Associates, Georgia, VT, United States) was used to record all mouse activities via video camera. The results were collected and calculated for statistical analysis, measuring the latency to reach the platform position, the percentage of time spent in the target quadrant, and the number of times the mice crossed the platform.

[0122] 15. Golgi Apparatus Staining

[0123] Mice were anesthetized using a 1% sodium pentobarbital solution (50 mg / kg, intraperitoneally). After immersion in a mordant solution for 3 days and then in a 1.5% AgNO 3 solution at room temperature in a dark environment for 5 days, the brain tissue was dehydrated in a graded ethanol series (70%, 2h; 80%, 2h; 90%, overnight; 95%, 90min×2; and 100%, 40min×2), transparent in xylene (20min×2), embedded in paraffin, and serially cut into 60μm sections. Using digital images at 1000× magnification, 15 or more completely impregnated neurons that were not obscured by adjacent neurons were randomly selected from the sections for analysis for each group of mice. Dendritic spine density (number / μm) was calculated using Image J.

[0124] 16. Electrophysiological Recordings from Brain Slices

[0125] The brains were rapidly disassembled and sliced ​​in a medium containing (in mM): 125 NaCl, 2.5 KCl, 2 CaCl2, 1 MgCl2, 25 NaHCO3, 1.25 NaH2PO4, and 12.5 glucose. Coronal brain slices (300 μm thick) were prepared on a vibratome and immersed in ACSF containing 95% O2 and 5% CO2 at 31°C for 1 hour before being stored at room temperature (22-25°C). Miniature excitatory postsynaptic potentials (mEPSCs) at -70 mV were recorded in the presence of 100 μM microtoxin and 1 μM tetrodotoxin. To record long-term potentiation (LTP), extracellular field excitatory postsynaptic potentials (FESPs) of the Schaffer collateral pathway were synaptically evoked in the CA1 region. LTP was induced by high-frequency stimulation (HFS), consisting of a 1-sequence 100 Hz train, each at an intensity of 70-80%, eliciting peak FEPS. Data were analyzed in pCLAMP 10.6 (Molecular Devices) with an average of 3 cells per plate and 2-3 cells recorded per mouse.

[0126] 17. Statistical Analysis

[0127] All statistical analyses were performed in GraphPad Prism 6.01. Data are presented as the mean ± standard error of the mean (SEM) of at least three biological replicates. One-way or two-way ANOVA followed by a Dunnett's test or a t-test was used. Nonnormal distributions were analyzed using the Kruskal–Wallis test. Differences between groups were considered statistically significant when p < 0.05. Asterisks indicate statistical significance: *p < 0.05; **p < 0.01; ***p < 0.001.

[0128] Example 1 Expression of Maf1 in the hippocampus of AD patients and APP / PS1 mice

[0129] Memory loss and intellectual impairment in AD are directly related to neuronal morphology and function. Maf1, as a transcription factor, may regulate other genes involved in AD pathogenesis. Therefore, a genomic analysis of human brain GSE5281 in the GEO database was performed using R software version 4.0.5 and the limma toolkit. This process identified all differentially expressed genes between AD and normal hippocampal tissue.

[0130] The experimental results showed that the expression of Maf1 in the human brain database of AD patients was elevated compared with the corresponding non-dementia control groups (n=13 and n=10, respectively); that is, the expression level of Maf1 in AD was significantly increased (Figure 1A, B and C; P value = 0.007256926).

[0131] When cultured in vitro, primary hippocampal neurons were transfected with APPswe virus. The results showed that compared with Vector and APP WT viruses, Maf1 protein was significantly increased in primary hippocampal neurons transfected with APPswe virus (Figures 1D and E). At the same time, proteins were extracted from the hippocampus of 6-month-old APP / PS1 mice, and the levels of Maf1 protein were also significantly increased (Figures 1F and G). In addition, we confirmed the increased expression of Maf1 protein in AD by immunohistochemistry and immunofluorescence (Figures 1H-K). Therefore, these data indicate that Maf1 expression levels are abnormally elevated in AD.

[0132] To further verify whether the above results exist in neurons in AD models and AD transgenic mice, in order to explore the expression of Maf1 in hippocampal neurons, primary hippocampal neurons extracted from fetal mouse hippocampus were used as an in vitro model; first, NeuN staining was used to verify the purity of primary neurons extracted in vitro; and immunofluorescence technology was used to explore the expression of Maf1 in hippocampal neurons in vivo and in vitro.

[0133] The experimental results are shown in Figure 2A , where NeuN expression was found in more than 90% of the cells, proving that the extracted cells were relatively pure primary neurons.

[0134] The experimental results are shown in Figure 2B , which showed that Maf1 and MAP2 (neuronal markers) were co-labeled in brain slices and primary neurons in vitro, indicating that Maf1 is expressed in both the cell bodies and dendrites of hippocampal neurons.

[0135] Example 2 Conditional knockout of Maf1 in hippocampal neurons improves learning and memory function

[0136] The CRISPR-Cas9 system was used to generate Maf1 conditional knockout mice (Maf1-eCKO1) to investigate the effects of Maf1 deficiency on hippocampal neurons in AD. Guide RNAs were designed to target specific exons to construct Maf1-eCKO1 mice, and these transgenic mice were crossed with APP / PS1 mice to generate Maf1-eCKO1-APP / PS1 mice (Figures 3A-B). Genotyping was performed from the tail tip of the mice, and PCR confirmed the homozygous Maf1 gene flox and APP / PS1 mice to be conditionally knockout (Figure 3C). At 5 months of age, AAV-hsyn-Cre-GFP or AAV-hsyn-GFP vectors were injected into the CA1 region of the hippocampus of Maf1-eCKO1-APP / PS1 mice using stereotactic microinjection (Figures 3D and E). One month after viral injection, the mice underwent a 5-day MWM learning and acquisition test, and on the 6th day, a probe test was performed to measure the mice's ability to locate the quadrant that previously contained the hidden platform (Figure 3E). After injection of AAV-hsyn-Cre-GFP into the hippocampus, Maf1 protein loss was confirmed by immunofluorescence, and Western blot analysis was performed on the mouse hippocampus ( Fig. 3F and G ).

[0137] The experimental results showed that the Maf1 band in Maf1-eCKO1-APP / PS1 mice injected with AAV-hsyn-Cre-GFP was significantly reduced compared with the control Maf1-eCKO1-APP / PS1 mice injected with the virus (Figure 3F).

[0138] After verifying the effectiveness of the conditional knockout, the mice were subjected to the Morris water maze behavioral test to determine the effect of hippocampal Maf1 expression on learning and memory behavior. During the acquisition test, the average escape latency of Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice was significantly shortened on training days 2, 3, 4, and 5 compared with Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice. Moreover, conditional knockout of Maf1 resulted in a shortened latency on day 5 in Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP mice compared with Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice (Figure 4A and B).

[0139] From the probe test, we first analyzed the percentage of time spent in the target quadrant and found that WT and Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice swam primarily in or near the target quadrant. In contrast, Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice swam less near the target quadrant (Figure 4C). Compared with Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice, Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice spent more time in the target quadrant (Figure 4D). In addition, the number of platform crossings in Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice was significantly higher than that in Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice (Figure 4E).

[0140] Taken together, these results suggest that Maf1 is important for cognitive function in AD.

[0141] Example 3 Effects of Maf1 Knockdown on Synapses

[0142] Research has shown that synaptic loss and dysfunction directly contribute to the decline in cognitive function in AD patients. This is manifested by a decrease in the number of mushroom-shaped dendritic spines and a decline in learning and memory. These changes in neuronal morphology and basic functions contribute to cognitive impairment in AD patients. Notably, the structure, number, and function of synapses are crucial for maintaining brain function.

[0143] Golgi-Cox staining was used to examine spine density (Figure 5A) to test whether the behavioral recovery induced by Maf1 knockout was associated with structural changes in dendritic spine density in vivo. Compared with Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice, the spine density of Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice increased by 18% (Figure 5, B and C); the density of mushroom-like spines also increased by approximately 10%, while the density of thin / filopodia-like spines decreased by approximately 17% (Figure 5D). This suggests that Maf1 knockdown can significantly restore dendritic spine damage in AD hippocampal neurons.

[0144] Therefore, primary neurons were isolated and transfected with APP lentivirus, followed by transfection with shSCR and shMaf1 plasmids to validate this phenomenon in an in vitro AD model (5E). Consistent with the in vivo studies, knockout of Maf1 increased the density of mushroom spines and decreased the density of filopodia / lamellae in vitro (Figure 5F and G).

[0145] Overall, knockdown of endogenous Maf1 expression in hippocampal neurons promotes the growth and development of dendritic spines in AD pathology, increasing their density. More so, the predominant dendritic spine type is mushroom. This suggests that Maf1 plays a crucial role in AD disease progression by regulating synapses through dendritic spines.

[0146] To verify this phenomenon in vitro, three shRNA sequences were designed, including a scrambled shRNA with nonspecific sequence interference as a control sequence and a Maf1 overexpression plasmid with a Flag tag (Maf1-OE).

[0147] The experimental results showed that after lentiviral transfection of 293T cells, a higher GFP green fluorescence intensity was observed under fluorescence microscopy 72 hours after transfection (Figure 6A); compared with neurons transfected with shSCR, ShRNAs targeting Maf1 effectively reduced endogenous protein levels, among which shMaf1-2 had the best effect (Figure 6B). In addition, the expression of Maf1 was significantly increased in the Western blotting experiment, and the presence of marker proteins confirmed the successful overexpression of Maf1 (Figure 6C).

[0148] ShSCR, shMaf1, and Maf1-OE lentiviruses were further used to transfect mature primary hippocampal neurons in vitro. It was observed that both shMaf1-2 and shMaf1-3 lentiviruses effectively reduced the expression level of Maf1 in hippocampal neurons (Figure 6D). After transfection with Maf1-OE lentivirus, the protein level of Maf1 was also significantly increased (Figure 6E). All subsequent viral experiments used shMaf1-3, with shMaf1 as the representative.

[0149] The results showed that Maf1 was highly expressed in neuronal dendrites and dendritic spines (Figure 6F).

[0150] AAV-syn-shSCR-GFP and AAV2 / 9-syn-shMaf1-GFP were injected into the hippocampus of AD mice for study. The effects of Maf1 knockdown in the mouse hippocampus were confirmed by immunofluorescence and western blot analysis (Figure 7A and B).

[0151] Consistent with the phenomena observed in Maf1-eCKO1-APP / PS1, knockout of Maf1 affected the number and morphology of neuronal dendritic spines (Figure 7C-F) and improved learning and memory dysfunction in mice (Figure 7G-I).

[0152] Example 4 Effects of Maf1 on Calcium Homeostasis and Amyloid Plaque Deposition in AD Hippocampal Neurons

[0153] In neural activity, many biological effects, such as synaptic transmission of nerve cells, transmitter release, cell morphology and growth, and activation of various enzymes, are related to calcium signaling pathways. Calcium signaling in dendritic spines plays an important role in controlling synaptic plasticity. Previous studies have also shown that calcium imbalance may be an important cause of AD. Ca2+ in the endoplasmic reticulum of AD and aging neurons is significantly increased. 2+ levels, leading to subsequent compensatory changes and neuronal Ca 2+ Signal transduction defects. Given the increasing evidence that Ca 2+ Overload can block LTP, leading to synaptic loss and neurodegeneration. We then examined whether Maf1 regulates intracellular Ca 2+ Signals affect neuronal morphology and function. Primary hippocampal neurons were isolated and transfected with APP lentivirus, followed by shSCR and shMaf1 plasmids. Total Ca was then estimated using Fura-4 / AM calcium imaging. 2+ internal flow.

[0154] Under AD conditions, Ca2+ levels in primary hippocampal neurons were found to be 2+ In addition, Maf1 knockout reduced Ca 2+ Thus, our findings suggest that Maf1 can regulate calcium concentrations in primary hippocampal neurons.

[0155] To further determine whether increased Maf1 expression is associated with AD pathology, we performed Aβ immunohistochemistry and immunofluorescence staining. We found that Maf1 knockout in Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice significantly reduced hippocampal Aβ plaques compared to Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice (Figure 8C-F).

[0156] Example 5 MEPSCs and LTP are rescued by Maf1 conditional knockout in hippocampal neurons

[0157] Synaptic plasticity is the ability of synapses to respond to temporal increases or decreases in neuronal activity. Many studies have proposed potential mechanisms of synaptic plasticity, including changes in the amount of neurotransmitter released presynaptically and the number of receptors on the postsynaptic membrane, leading to changes in the efficiency of the postsynaptic cell's response to neurotransmitters. Notably, long-term potentiation (LTP) is one of the most commonly used electrophysiological techniques to assess changes in synaptic plasticity. Furthermore, mEPSC, a spontaneous synaptic activity that refers to a shift in the postsynaptic current caused by the action of individual vesicles on the postsynaptic membrane, reflects synaptic development and maturation. Previously, we found that Maf1 knockdown can restore the morphology and structure of dendritic spines in APP / PS1 mice. Whether this restoration can reverse neurophysiological dysfunction, we further investigated changes in hippocampal synaptic plasticity.

[0158] Maf1-eCKO1-APP / PS1 mice after stereotaxic injection of AAV-hsyn-GFP vector or AAV-hsyn-Cre-GFP. To examine synaptic function, whole-cell patch clamp electrophysiology was used to measure mEPSCs (postsynaptic potentials) in brain slices, and it was observed that the frequency of mEPSCs in these neurons of Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice was reduced, while the hippocampal neurons of Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice returned to WT levels (Figure 9A and B). LTP (long-duration potential) in the Schaffer collateral-CA1 pathway, a key cellular mechanism of learning and memory, was also examined.

[0159] Compared with wild-type mice, LTP levels were reduced in Maf1-eCKO1-APP / PS1+AAV-hsyn-GFP vector mice and restored in Maf1-eCKO1-APP / PS1+AAV-hsyn-Cre-GFP mice (Figures 9C and 9D), demonstrating that Maf1 knockout can restore hippocampal synaptic plasticity.

[0160] Example 6 Verification of Maf1 Regulating Grin1 and Involving Synaptic Function and Calcium Signaling Pathways

[0161] RNAseq experiments were performed to screen for genes and signaling pathways that were altered after Maf1 knockdown in AD. The analysis revealed 884 differentially expressed genes after Maf1 knockdown in AD, of which 564 were downregulated and 320 were upregulated (Figure 10A-C).

[0162] GO enrichment analysis and KEGG pathway analysis of these different genes showed that the down-regulated genes were mainly related to synapses, calcium signaling pathways, nerve-related ligand-receptor reactions, etc. The up-regulated genes showed that the up-regulated genes were mainly related to immune system diseases, complement and coagulation cascade reactions.

[0163] Among genes related to synaptic function and calcium signaling pathways, Grin1 was found to have the highest compliance (Figure 10D-F). The protein encoded by the Grin1 gene, NMDAR1, is crucial for neuronal calcium homeostasis and synaptic remodeling. Therefore, these results suggest that Maf1 may regulate synaptic function by regulating Grin1 gene expression.

[0164] CUT&Tag experiments further explored the mechanism of Maf1 (Figure 11A and B). GO analysis suggested that synapses are related to calcium ion binding (Figure 11C), and KEGG suggested that genes that may bind to Maf1 are closely related to calcium ion signaling pathways and synaptic glutamine secretion (Figure 11D). GO analysis and KEGG pathway analysis enriched 409 synapse-related genes and 74 synapse-related genes, respectively; 30 genes, including Grin1, Grin2a, Grin2b, and Gria1, intersected with each other (Figure 11E). We further analyzed the protein interaction network of these 30 genes. Notably, Grin1 was located in a core position (Figure 11F), indicating that Maf1-NMDAR1 may regulate synaptic function by regulating calcium homeostasis in AD.

[0165] Example 7 Maf1 regulates NMDAR1 transcription by binding to the Grin1 promoter region

[0166] Previous sequencing and biomarker analyses suggested that Maf1 may regulate calcium homeostasis and synaptic function by regulating Grin1 in AD. Conditional knockout of Maf1 in hippocampal neurons revealed downregulation of NMDAR1 protein levels (Figure 12A and B), which was also confirmed in primary neurons (Figure 12C and D).

[0167] To clarify the molecular mechanism by which Maf1 regulates dendritic spine remodeling through the Grin1-encoded protein NMDAR1, thereby affecting cognitive function, we first verified the protein interaction between Maf1 and NMDAR1 through Co-IP (co-immunoprecipitation) experiments. Co-IP experiments revealed no co-IP between Maf1 and NMDAR1 proteins in hippocampal neurons, demonstrating that Maf1 and NMDAR1 proteins in hippocampal neurons do not interact (Figure 12E and F).

[0168] Given the gene regulatory role of Maf1 as a transcription factor, we further investigated its interaction with the Grin1 gene in the nucleus. To screen for Maf1 binding sites, four primers targeting the 2000 bp upstream region of the Grin1 gene were designed in a Chromatin Immunoprecipitation (CH-IP) experiment (see Figure 10. Chromatin Immunoprecipitation (Ch-IP)). Ch-IP-qPCR results confirmed a potential Maf1 binding site in the Grin1 promoter region (Figure 12G).

[0169] Subsequently, a dual-luciferase reporter assay was performed to verify that Maf1 promotes Grin1 transcription. Following the instructions for ChIP, Maf1 NC and overexpression plasmids were constructed, a Grin1 promoter plasmid was constructed, and the Grin1 promoter sites were mutated to obtain MT, MT1, MT2, and MT3 (Figure 12H). Furthermore, a luciferase reporter plasmid was used to detect Grin1 promoter activity in 293T cells.

[0170] Overexpression of the Grin1 promoter WT and Maf1 enhanced the activity of the luciferase reporter gene, suggesting that Maf1 can interact with the Grin1 promoter and exert an enhanced regulatory effect at a specific site on the Grin1 promoter (Figure 12I-L). It was found that the active luciferase reporter gene of the mutant Grin1 promoter was not affected by Maf1 activation (Figure 12I-L). There was no difference in the activity of the luciferase reporter gene of the four mutant plasmids of the Grin1 promoter, suggesting that there is a synergistic effect between the three sites on the Grin1 promoter.

[0171] The results of CH-IP analysis and dual-luciferase reporter gene analysis showed that Maf1 promoted Grin1 transcription by binding to the Grin1 promoter.

[0172] Example 8 Grin1 promoter mutation weakens the morphological effects of Maf1 knockdown

[0173] To further confirm that Maf1 affects the specificity of neuronal dendritic spines by regulating the Grin1 promoter, a "rescue" experiment was performed using a Grin1 promoter mutant vector. To this end, hippocampal neurons were transfected with GFP-fluorescent shSCR and shMaf1 plasmids, as well as GFP-free Grin1 promoter wild-type and mutant plasmids (Figure 13A), and the morphology and number of neuronal dendritic spines were analyzed. The experiment found that compared with the SCR group, the density of dendritic spines in the shMaf1+Grin1WT group was significantly increased, and the number of mature dendritic spines was also significantly increased (Figure 13B and C), which is consistent with the phenotype of Maf1 in the aforementioned gene knockout mice. Compared with the shMaf1+Grin1WT group, whether the three sites of the Grin1 promoter were mutated separately (MT1 / 2 / 3) or the whole promoter was mutated (MT), the dendritic spine density of these four groups of neurons was significantly reduced, and the number of mushroom dendritic spines was also reduced (Figure 13B and C), indicating that there is a synergistic effect between the three binding sites and Maf1 participates in the regulation of dendritic spines through the Grin1 gene.

[0174] The Maf1-NMDAR1 signaling pathway regulates neuronal calcium homeostasis and participates in a new mechanism of synaptic remodeling in AD. Under the pathological state of AD, the expression of the transcriptional regulatory protein factor Maf1 increases. By binding to the promoter region of Grin1, it regulates the expression of NMDAR1, further regulating calcium homeostasis, changing the morphology and number of dendritic spines, and thus affecting synaptic function. Ultimately, it regulates synaptic remodeling and affects learning and memory function (Figure 14)

[0175] Example 9 Screening of compounds binding to Maf1 protein

[0176] Screening method:

[0177] SPR single-concentration detection technology: Surface plasmons are electromagnetic waves on the surface of metals, generated by the interaction between freely vibrating photons and electrons. Surface plasmon resonance (SPR) is an optical phenomenon that occurs at the interface between two media and can be induced by photons or electrons. When light is incident from a denser medium into a less dense medium, it undergoes total reflection, forming an evanescent wave that enters the less dense medium. When the reflected evanescent wave meets the plasmon wave on the metal surface, resonance may occur, causing a decrease in the energy of the reflected light and a resonance peak in the reflected light energy spectrum. This resonance is called surface plasmon resonance. The angle of incidence that triggers surface plasmon resonance is called the SPR angle. SPR biosensors provide a sensitive, label-free technique for monitoring intermolecular interactions in real time. The sensor detects changes in the SPR angle, which is related to the refractive index of the metal surface. When analytes bind to the chip surface, the refractive index of the chip surface changes, which in turn causes changes in the SPR angle. This is the fundamental principle of SPR biosensors for real-time detection of intermolecular interactions. During interaction analysis, changes in the SPR angle are recorded in real time on the sensorgram. Surface plasmon resonance (SPR) technology was used to establish a target protein-analyte interaction assay model and assay the analytes. Protein immobilization was performed using amino coupling. Maf1 protein antibodies were diluted to several concentrations in a 96-well plate and allowed to interact with the target protein from low to high concentrations through the chip. The flow rate was 30 μL / min, and the duration was 150 s. The analyte stock solutions were all prepared to 10 mM in DMSO and diluted to 100 μM in PBS (5% DMSO) in a 96-well plate before testing. The samples were then sequentially interacted with the proteins. After each concentration point was passed through, the chip was regenerated with 10 mM glycine hydrochloride (pH 2.0) solution for 5 minutes. This process was repeated until all analyte concentrations were reached. Sample data were collected using BIAcore T200 Control software (v.2.0, GE Healthcare), and the reference channel data were subtracted from the data. The data were globally fitted to a 1:1 Langmuir binding model using BIAcore T200 evaluation software (v.2.0, GE Healthcare). Signal values ​​(RU) were obtained for analytes tested at a single concentration, and association and dissociation constants were obtained for analytes tested at multiple concentrations.

[0178] Filter Results:

[0179] Based on SPR affinity detection, we screened out 8 compounds that can actually bind to Maf1 protein.

[0180] Figure 15A: Maf1 protein coupling diagram; Figure 15B: Interaction determination between Maf1 protein and Maf1 protein antibody (top: interaction sensor diagram; bottom: quality control); Figure 15C: Single point screening result diagram.

[0181] Example 10: Pharmacokinetic Verification of Compounds

[0182] Compound preparation: The commercially purchased compound of formula I was dissolved and diluted in a solution prepared by 10% DMSO + 90% (20% HP-β-CD).

[0183] Research methods: Balb / c mice were given a single intraperitoneal injection of 2.5 mg / kg, and the compound content in the serum was detected at 0.25, 0.5, 1, 2, 4, 6, 8, and 24 hours after injection; secondly, the brain tissue of mice was taken 0.5, 4, and 24 hours after injection for compound content detection to evaluate the blood-brain barrier passage rate.

[0184] Single-dose blood drug concentration detection in mice

[0185] The table below shows the changes in the average blood concentration of the compound of formula I over time after intraperitoneal injection of mice at a concentration of 2.5 mg / kg. The test results show that the blood concentration of this compound gradually decreases 0.25, 0.5, 1, 2, and 4 hours after a single injection, and is not detected in the animals after 6 hours (see Figure 16).

[0186] Brain tissue drug content test after single administration

[0187] The figure below (Figure 17) shows the concentration of the compound of formula I in the brain tissue of mice 0.5, 4, and 24 hours after intraperitoneal injection at a concentration of 2.5 mg / kg. The test results show that this compound can be detected in the animal brain tissue 0.5 hours after a single injection, but the concentration is low, indicating that this small molecule compound can penetrate the blood-brain barrier and enter the brain tissue.

[0188] Example 11: Compound Toxicity Test

[0189] The CCK8 cell viability assay (CCK8) is based on the reduction of WST-8 (chemical name: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonic acid benzene)-2H-tetrazolium monosodium salt). In the presence of living cells, WST-8 can be reduced by mitochondrial dehydrogenases to produce a highly water-soluble orange-yellow formazan product. The color intensity is proportional to the number of viable cells, so the absorbance of the formazan product (usually at a wavelength of 450nm) can be used to indirectly reflect the number of viable cells. The CCK-8 assay is widely used in cell proliferation assays, cytotoxicity assays, and tumor drug sensitivity testing.

[0190] In vitro compound stock solutions were prepared at 10 mM in DMSO and diluted with culture medium before use. Initial compound concentration exploration was performed using the 293T cell line, with a concentration gradient of 5 μmol, 10 μmol, 20 μmol, 40 μmol, 80 μmol, and 160 μmol. Cells were treated with the compound for 24 hours, and cell viability was calculated using the CCK8 assay kit based on absorbance values ​​measured on a microplate reader. Data were processed using Graphpad Prism software, and IC50 curves were plotted. Cell viability is shown in the table below:

[0191] The IC50 curve of the compound of formula I was drawn as shown in the following figure (Figure 18).

[0192] Considering that the next step is to conduct drug efficacy phenotype identification on neurons, further use primary neurons extracted from mouse brain tissue to explore the preliminary concentration of the compound.

[0193] Primary hippocampal neuron culture: After anesthetizing ICR fetal mice (E18-E21) at gestational day 18-21, dissect the fetuses in a clean area and soak them in 75% ethanol for 1-2 minutes. Remove the mouse head, remove the surface skull with microscissors, and transfer the brain tissue to dissection buffer. Under a microscope, remove blood vessels and meninges, isolate the hippocampus, and place the removed hippocampus in a 3.5 cm dish containing dissection buffer. Use microscissors to cut the hippocampus into small pieces. Use a pipette to transfer the minced hippocampus to a 7 ml EP tube. Centrifuge at 1000 rpm for 3-5 minutes and discard the dissection buffer. Add 0.5-1 ml of papain digestion solution to the above EP tube and place it in a 37°C incubator for 30 minutes. Add 300 μL of Trituration buffer 300 (DNase) and 5 ml of complete culture medium, and gently pipette the hippocampus tissue more than 10 times. Let the cell solution stand for 3 minutes, and use a pipette to gently draw 3-4 ml of supernatant into a 15 ml tube. Add 3-4 ml of complete culture medium again, and use a pipette to gently blow the hippocampal tissue more than 10 times. Repeat step 8, and transfer 3-4 ml of supernatant to the same 15 ml tube again. Repeat the previous step again. Centrifuge the collected supernatant at 1000 rpm, remove the supernatant, add 5 ml of complete culture medium, gently blow to suspend, and centrifuge again at 1000 rpm for 5 minutes. Add complete culture medium to resuspend the cells, and draw a portion of the cells for counting. Generally speaking, when planting neuronal cells in a 24-well plate, the concentration of the cell suspension is generally 2×10 5 / ml, inoculate 500 μl per well. Plate the resuspended and diluted neuronal cells onto a PDL-treated glass slide, place in a 37°C incubator for 10 minutes, add an appropriate amount of complete culture medium, and continue culturing in the incubator.

[0194] A compound concentration gradient was set: 5 μmol, 10 μmol, 20 μmol, 40 μmol, 80 μmol, and 160 μmol. The compound was added to the primary neurons cultured in vitro for 13 days. After treating the cells for 24 hours, the CCK8 detection kit was used to calculate the cell viability based on the absorbance value detected by the microplate reader. The data was processed in Graphpad Prism software and the IC50 curve was drawn. The cell viability is shown in the table below:

[0195] Draw the IC50 curve as shown in the figure below (Figure 19).

[0196] Meanwhile, the compound of formula II, which has an inhibitory effect on MAF1 protein, was subjected to CCK8 toxicity tests on 293T cells and primary neurons, and IC50 curves were plotted. The IC50 values ​​were 38.65 μmol (293T cell line) and 1.665 μmol (primary neurons), respectively. This indicates that the concentration that reaches the cell half-lethal dose is low and the compound is highly toxic. Therefore, further studies are not considered. As shown in the following figure (Figure 20):

[0197] The structure of the compound of formula II is as follows:

[0198] Example 12: In vitro efficacy experiments of compounds

[0199] Experimental methods:

[0200] The extraction and culture of primary neurons were the same as above (toxicity experiment part).

[0201] To transduce neurons using plasmid calcium: Remove the neuronal culture medium (replace half of the medium) and place in a 37°C waterbath for later use. Add Neurobase 1 A to a 24-well plate. Dissolve 500ng of plasmid DNA in 12.5μl of CaCl2 solution and centrifuge. Add 12.5μl of HBS to an EP tube and centrifuge. Add the mixture to the 24-well plate, gently shake, and return the plate to a 37°C incubator for 90 minutes. Pipette fresh Neurobase 1 A into a new 15ml EP tube and perfuse with CO2 to saturate the Neurobase 1 A. Once the Neurobase 1 A turns yellow, discard the original culture medium from the 24-well plate and replace it with the CO2-saturated Neurobase 1 A. Place the plate in a 37°C incubator for 15 minutes. Discard the culture medium and add the original culture medium and fresh complete culture medium in a 1:1 ratio. Return the 24-well plate to the incubator and continue incubating. After 24-48 hours, observe the transfection progress under a microscope. Neuronal cells were collected at DIV 14 and fixed with paraformaldehyde to observe the changes in dendritic spines.

[0202] Lentiviral neuronal infection method:

[0203] Planting about 2.0×10 4 Neurons were cultured at a concentration of 1 ml / well of cell culture medium at 37°C in a 5% CO2 incubator. On day 6 of in vitro culture (DIV6), the original culture medium was semi-quantitatively collected and the lentiviral stock solution (100 μl) was diluted 1:60-1:40 with the original culture medium (10 ml). The diluted virus-containing medium was added to each well of a 24-well culture dish at a rate of 1 ml / well. 8-12 hours after infection of neurons, the lentiviral-containing cell culture medium was removed and an equal volume of the original culture medium (1 ml / well) was added. The cells were then cultured in a 24-well incubator.

[0204] On day 4 of in vitro culture, primary neurons were transfected with a GFP plasmid, which imparted green fluorescence to the neurons, facilitating visualization of their dendrites. On day 6, they were transfected with the APPsw lentivirus, thereby mimicking an in vitro model of Alzheimer's disease. Compound stock solutions were prepared in DMSO at a 10 mM concentration. On day 13 of in vitro culture, the primary neurons were diluted in culture medium to a concentration of 2.5 μmol, and the compounds were added to treat the cells for 24 hours. After 14 days of in vitro culture, neurons were fixed with 4% PFA and photographed under a confocal fluorescence microscope at 100x magnification using an oil immersion lens. The density of dendritic spines per 10 μm of neuronal length was calculated by observing GFP green fluorescence.

[0205] Result analysis:

[0206] The green fluorescence image in the figure below (Figure 21) is a representative pattern diagram of the three groups (the upper part is the whole neuron, and the lower part is the dendritic spine branch). The right figure is a statistical diagram of the dendritic spine density of the three groups (normalized to the control group, n=8). The results show that compared with the blank control, the total density of dendritic spines of neurons in the in vitro AD model (APPsw virus) is reduced, while the density of dendritic spines increases after compound intervention. The results suggest that compound intervention can increase the number of dendritic spines of neurons in the in vitro AD model and have an improving effect on synapses, as shown in Figure 21:

[0207] The number of dendritic spines of the neurons in the statistical graph is shown in the table below (normalized to the control group):

[0208] Example 13 In vivo efficacy experiment of compound

[0209] Experimental methods:

[0210] Thy1-GFP mice are commonly used in neuroscience research. GFP fluorescent labeling facilitates the observation and tracking of specific cell types, particularly neurons. APP / PS1 transgenic mice (an animal model for Alzheimer's disease) were crossed with Thy1-GFP mice. At 5 months of age, the hybrids were intraperitoneally injected with a compound solution at a concentration of 2.5 mg / kg for one month. At 6 months of age, behavioral testing (Morris water maze) was performed to assess learning and memory abilities (Figure 22).

[0211] Water Maze: The water maze experimental apparatus consisted of a circular stainless steel tube with a diameter of 100 cm and a height of 50 cm. The water pool was divided into four quadrants, oriented according to the four directions of east, south, west, and north. A circular black hidden platform with a diameter of 9 cm and a height of 27 cm was placed in the center of the target quadrant. During the acquisition training phase, the hidden platform's position remained unchanged, and the water temperature was maintained at 22-24°C. A camera directly above the pool simultaneously recorded the mice's movements, which were analyzed using the EthovisionXT monitoring and analysis system. The first day of the experiment consisted of a visible platform test, followed by five consecutive days of the hidden platform acquisition phase, and the seventh day of the spatial exploration phase. Mice were placed in the water maze chamber one day prior to the start of the experiment to acclimate to the environment. During the hidden platform acquisition phase, mice were trained twice daily at the same time, with the same mouse entering the water from a different quadrant each time, but different mice entered the water at the same location. The swimming time was 60 seconds. Mice that found the platform and stayed there for at least 5 seconds were considered to have found the platform. Mice that did not find the platform within 60 seconds were guided to the platform and allowed to stay there for 15 seconds. Spatial Exploration Experiment: On the 7th day, the platform was removed from the pool. The mice were placed into the water at the entry point farthest from the platform. The mice swam in the water for 60 seconds, and the percentage of time they spent in the quadrant where the target platform was located was recorded, which represents their learning and memory abilities.

[0212] After the water maze behavioral test, the mice were anesthetized and perfused, and brain tissue sections were taken. The density of neuronal dendritic spines was observed by GFP green fluorescence under a confocal fluorescence microscope.

[0213] Result analysis:

[0214] Figure 22 shows a heat map of the swimming trajectories of mice in each group over a 60-second period during the spatial exploration phase on day 7. The trajectories of the Alzheimer's disease model mice (APP / PS1) were observed to be close to the wall edge. Statistical analysis of the percentage of time spent in the platform quadrant (upper right) for the three groups revealed that compared with WT mice, APP / PS1 mice spent less time in the platform quadrant, while compound-treated mice spent more time in the platform quadrant. These results suggest that continuous compound injections can improve learning and memory in AD mice.

[0215] The values ​​of the statistical chart are shown in the table below:

[0216] Figure 23 is a representative image of hippocampal neurons in brain slices from three groups of mice. Statistical analysis results show that compared with Ctrl, the total density of dendritic spines in hippocampal neurons of AD mice is reduced, while the density of dendritic spines increases after compound intervention, as shown in Figure 23. The right figure is a statistical graph of dendritic spine density in the three groups:

[0217] The values ​​of the statistical graph are shown in the table below (normalized to the control group):

[0218] Example 14 Transcriptomic Detection of Hippocampal Tissue after Compound Intervention

[0219] After behavioral water maze testing, mice in the AD group and the AD + compound intervention group were anesthetized and perfused, and hippocampal tissue was removed for transcriptomic sequencing. This analysis explored the genes and signaling pathways involved in changes after compound intervention, compared to the AD group. Further enrichment analysis and KEGG pathway analysis of differentially expressed genes revealed that, compared with the transcriptional levels of genes in the hippocampus of AD mice, genes with altered transcriptional levels after compound intervention were primarily involved in the nervous system, neurodegenerative diseases, and signal transduction. For example, the transcriptional levels of 50 genes in the nervous system-related gene set and 16 genes in the neurodegenerative disease-related gene set were altered. Transcriptomic analysis suggests that the pathways through which small molecule compounds exert their effects after binding to the target Maf1 protein may be related to neural signaling.

Claims

1. A marker for early diagnosis of Alzheimer's disease, wherein the marker is Maf1 gene or its protein. When the Maf1 gene or its protein is highly expressed in neuronal cells, it indicates that the test subject is a high-risk group for Alzheimer's disease.

2. A reagent or kit for early diagnosis of Alzheimer's disease; the reagent or kit contains a reagent that can detect the expression of Maf1 gene or its protein.

3. An application of Maf1 gene or its protein in the preparation of a product for early diagnosis of Alzheimer's disease, wherein the application is to determine whether the patient is a high-risk group for Alzheimer's disease based on the expression of Maf1 gene or its protein in neuronal cells.

4. The use of the Maf1 gene or its protein as claimed in claim 3 in the preparation of a product for early diagnosis of Alzheimer's disease, characterized in that: When the Maf1 gene or its protein is highly expressed in neuronal cells, the test subject is judged to be a high-risk group for Alzheimer's disease.

5. An inhibitor for inhibiting the expression of Maf1 protein, wherein the mechanism of the inhibitor is as follows:

6. The inhibitor for inhibiting the expression of Maf1 protein according to claim 5, characterized in that: The inhibitors include, but are not limited to, chemically synthesized, naturally occurring compounds, and / or biosynthesized substances.

7. A promoter for promoting the expression of Maf1 protein.

8. Use of a promoter for promoting the expression of Maf1 gene or protein in preparing an animal model, wherein the promoter is an experimental preparation.

9. Use of the inhibitor for inhibiting the expression of Maf1 gene or its protein according to claim 5 in the preparation of a drug for treating AD.

10. A pharmaceutical preparation for treating AD, the pharmaceutical preparation containing a substance that inhibits the expression of Maf1 gene or its protein, the structure of the substance being as follows:

Images