Human salivary organoid-based epithelial-mesenchymal transition and fibrosis modeling and drug efficacy test method
A human salivary gland organoid-based model for epithelial-mesenchymal transition and fibrosis is developed using a specific culture medium and Activin A treatment, addressing the limitations of two-dimensional models and enhancing the accuracy and relevance of fibrosis modeling for therapeutic agent screening.
Patent Information
- Application Number
- PCT/KR2024/018751
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-27
- Filing Date
- 2024-11-25
- Publication Date
- 2025-06-05
AI Technical Summary
Current fibrosis models for various organs, including the salivary glands, are largely based on two-dimensional cultures, which are inadequate for accurately modeling epithelial-mesenchymal transition and fibrosis due to the complexity of salivary gland cell types.
A method for producing a human salivary gland organoid-based epithelial-mesenchymal transition and fibrosis model involves culturing salivary gland organoids in a specific medium containing TGF-β inhibitors, Wnt activators, BMP inhibitors, FGF family members, receptor tyrosine kinase ligands, and ROCK inhibitors, followed by treatment with Activin A to induce fibrosis.
This approach enables the creation of a robust and relevant three-dimensional model for screening therapeutic agents targeting epithelial-mesenchymal transition and fibrosis, offering improved accuracy and relevance compared to traditional two-dimensional models.
Smart Images

Figure KR2024018751_05062025_PF_FP_ABST
Abstract
Description
Methods for modeling epithelial-mesenchymal transition and fibrosis and testing drug efficacy based on human salivary gland organoids
[0001] The present invention relates to a method for producing and using a human salivary gland organoid-based epithelial-mesenchymal transition and fibrosis model.
[0002] Organoids, also known as mini-organs, are capable of three-dimensional culture and maintaining diverse cell types that comprise specific organs. Their use in embryology and the discovery of various drugs, including anticancer agents, is becoming increasingly widespread. Salivary gland organoids have also been reported to be composed of salivary gland-specific cells, including basal and luminal ductal cells, serous and mucinous acinar cells, and myoepithelial cells.
[0003] Meanwhile, wound healing is a dynamic process that involves the epithelial-mesenchymal transition (EMT) and then the mesenchymal-to-epithelial transition (MST) through the modulation of various cell signals. This process involves removing damaged tissue and cells, as well as dedifferentiation of surrounding epithelial cells and their division to fill the tissue. However, if the wound is severe or chronic, the EMT cannot be reversed back to an epithelial state, and instead progresses to a fibrotic stage characterized by the differentiation of fibroblasts into myofibroblasts and the deposition of extracellular matrix.
[0004] This phenomenon is observed in various organs, and when it occurs in the liver, kidneys, and heart, it can be life-threatening. However, fibrosis in organs less directly related to vital functions, such as the salivary glands, even if it is not immediately life-threatening, can impair organ function and worsen quality of life.
[0005] Therefore, the development of fibrosis models of various organs is urgently needed not only for preserving the life of patients but also for maintaining health. However, many fibrosis models to date have been based on two-dimensional culture, and in the case of salivary glands, there is not even a two-dimensional culture model due to the presence of various cell types.
[0006] Accordingly, the inventors of the present invention completed the present invention by producing an epithelial-mesenchymal transition and fibrosis model based on human salivary gland organoids and confirming that this can be used to screen novel therapeutic agents.
[0007] One object of the present invention is to provide an epithelial-mesenchymal transition and fibrosis model and a method for producing the same.
[0008] Another object of the present invention is to provide a method for screening for epithelial-mesenchymal transition and fibrosis therapeutic agents.
[0009] To avoid confusion due to overlapping content, the description of redundant content will be omitted below. In other words, the content of the invention is not limited to the content described below, and the content of the invention should be interpreted based on the overall content of the invention.
[0010] Hereinafter, the present invention will be described in detail.
[0011] The present invention provides a method for producing an epithelial-mesenchymal transition and fibrosis model.
[0012] The present invention provides a method for producing an epithelial-mesenchymal transition and fibrosis model, comprising the step of treating a culture medium containing Activin A to a salivary gland organoid.
[0013] More specifically, the method for producing the epithelial-mesenchymal transition and fibrosis model is performed through the following steps:
[0014] (a) culturing salivary gland organoids from salivary gland tissue-derived epithelial cells in a culture medium containing a TGF-β inhibitor, a Wnt activator, a BMP inhibitor, an FGF family member, a receptor tyrosine kinase ligand, and a ROCK inhibitor; and
[0015] (b) A step of treating the salivary gland organoid with a culture medium containing Activin A.
[0016] In the present invention, "salivary gland" refers to an organ that produces and secretes saliva. The salivary glands are classified into major salivary glands such as the parotid gland, submaxillary gland, and sublingual gland, and minor salivary glands such as mucous glands, which are distributed in various parts of the oral cavity mucosa.
[0017] In the present invention, “organoid” refers to a cell aggregate created by culturing and recombining cells separated from stem cells or organ-derived cells, and may include an organoid or cell cluster formed from a suspension cell culture.
[0018] In the present invention, "salivary gland fibrosis" occurs due to various causes, including inflammation, radiotherapy, and sialolithiasis. It is a phenomenon in which functional epithelial cells are lost and replaced by connective tissue during the regeneration process. Fibrosis can lead to functional decline, as functional epithelial cells are not restored.
[0019] In the present invention, "epithelial-mesenchymal transition of the salivary gland" occurs due to various causes such as wounds, inflammation, radiotherapy, and sialolithiasis, and refers to a state in which the healing process of a wound, such as an epithelial-mesenchymal transition back to a mesenchymal-epithelial transition, has not progressed. In other words, it refers to a state in which the epithelial-mesenchymal transition has not returned to an epithelial cell state, and is in the process of progressing to a fibrosis stage due to the deposition of extracellular matrix along with the differentiation of fibroblasts into myofibroblasts.
[0020] The culture medium used in step (a) of the method for producing an epithelial-mesenchymal transition and fibrosis model according to the present invention is provided for culturing salivary gland organoids from salivary gland tissue-derived epithelial cells, and essentially includes a TGF-β inhibitor, a Wnt activator, a BMP inhibitor, an FGF family member, a receptor tyrosine kinase ligand, and a ROCK inhibitor.
[0021] In the present invention, “culture solution” means a solution for maintaining a cell population or culturing a cell population, containing nutrients that maintain cell viability and support proliferation.
[0022] The culture medium used in the present invention includes a basic medium. The basic medium is any basic medium suitable for culturing animal or human cells.
[0023] The above-mentioned basic medium typically contains a number of components necessary to support the maintenance of cultured cells. Suitable combinations of these components can be readily formulated by skilled practitioners, taking into account the following. Furthermore, it includes a nutrient solution containing common standard cell culture components, such as amino acids, vitamins, lipid supplements, mineral salts, carbon energy sources, and buffers.
[0024] The above basal media are commercially available and include, but are not limited to, Dulbecco's Modified Eagles Media (DMEM), Minimum Essential Media (MEM), KnockOut-DMEM (KO-DMEM), Glasgow's Minimum Essential Media (G-MEM), Eagle's Minimum Essential Medium (EMEM), Basal Medium Eagle (BME), DMEM / Ham's F12, Advanced DMEM / Ham's F12, Iscove's Modified Dulbecco's Media and Minimum Essential Media (MEM), Ham's F-10, Ham's F-12, Medium 199, RPMI 1640 medium, and KnockOut Serum replacement XenoFree medium. For example, the basal media can be Advanced DMEM / F12 medium.
[0025] The above TGF-β inhibitor is any substance that inhibits the function of the TGF-β receptor, for example, a protein, a peptide, a small molecule, and may be any one selected from the group consisting of A83-01, SB-431542, SB-505124, SB-525334, SD-208, LY-36494, and SJN-2511. Preferably, it may be A83-01. More preferably, it may be 0.5 μM to 10 μM of A83-01.
[0026] The above Wnt activator may be at least one selected from the group consisting of Wnt3A, R-spondin 1, R-spondin 2, R-spondin 3, and R-spondin 4. Preferably, it may be R-spondin 3.
[0027] The BMP inhibitor is an agent that binds to a BMP molecule to form a complex, binds to a BMP receptor, and prevents the binding of a BMP ligand to the receptor, for example, an antibody that binds to the receptor. The BMP inhibitor may be a protein or a small molecule, and may be natural, modified, and / or partially or fully synthetic. In addition, the BMP inhibitor may be any one selected from the group consisting of Noggin, Dorsomorphin, DMH1, and LDN-193189. Noggin is preferred.
[0028] The FGF (fibroblast growth factor) family is a powerful factor that regulates cell proliferation and differentiation, and plays a very important role in the normal development of stem cells, tissue maintenance, wound healing, and angiogenesis. The FGF family may be at least one selected from the group consisting of FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, and FGF10. Preferably, it may be FGF2 and FGF10. More preferably, it may be FGF2 and FGF10 at 5 ng / ml to 20 ng / ml.
[0029] The above receptor tyrosine kinase ligand may be any one selected from the group consisting of NRG1 (Neuregulin β1), HRG1 (Heregulin β1), epidermal growth factor (EGF), transforming growth factor-α (TGF-α), basic fibroblast growth factor (bFGF), brain-derived neurotrophic factor (BDNF), hepatocyte growth factor (HGF), and keratinocyte growth factor (KGF). Preferably, it may be NRG1 (Neuregulin β1). More preferably, it may be 5 ng / ml to 10 ng / ml of NRG1 (Neuregulin β1).
[0030] The above ROCK (Rho-associated protein kinase) inhibitor inhibits the activity of serine / threonine kinase that acts as a target protein for Rho (Rho A, Rho B and Rho C), and may be any one selected from the group consisting of R-(+)-trans-4-(1-Aminoethyl)-N-(4-pyridyl)cyclohexane carboxamide dihydrochloride monohydrate (Y-27632), Fasudil and H-1152. Preferably, it may be Y-27632. More preferably, it may be 5 μM to 15 μM of Y-27632.
[0031] In addition to the essential components described above, the culture medium of the present invention may further include one or more additional components selected from the group consisting of Glutamax, HEPES, Primocin, Prostaglandin E2 (PGE2), N-acetylcysteine (NAC), B27, and Nicotinamide.
[0032] The above B27 may be replaced with a generic formulation containing one or more of the ingredients selected from the following list: biotin, cholesterol, linoleic acid, linolenic acid, progesterone, putrescine, retinyl acetate, sodium selenite, tri-iodothyronine (T3), DL-alpha tocopherol (vitamin E), albumin, insulin, and transferrin.
[0033] In addition, the culture medium of the present invention may contain, in addition to the essential components described above, antibiotics such as P / S (Penicillin-Streptomycin) and / or Primocin.
[0034] Each of these additional components can be appropriately adjusted in concentration within the general range commonly used in culture media.
[0035] More specifically, the culture medium used in step (a) of the method for producing an epithelial-mesenchymal transition and fibrosis model according to the present invention may include A83-01, R-spondin 3, Noggin, FGF2, FGF10, Neuregulin β1, and Y-27632.
[0036] Additionally, the step of culturing salivary gland organoids from the aforementioned epithelial cells may utilize other known methods for producing salivary gland organoids. For example, the culture medium used in step (a) may include A83-01, WNT3a, Noggin, FGF10, and Y-27632. As another example, the culture medium used in step (a) may include A83-01, R-spondin 3, Wnt3a, Noggin, FGF2, EGF, and Y-27632.
[0037] Preferably, the culture medium used in step (a) of the method for producing an epithelial-mesenchymal transition and fibrosis model according to the present invention may include A83-01, R-spondin 3, Noggin, FGF2, FGF10, Neuregulin β1, and Y-27632. A model produced by the step of culturing salivary gland organoids from epithelial cells according to the present invention can provide salivary gland organoids more suitable for producing an epithelial-mesenchymal transition and fibrosis model.
[0038] The culture medium used in step (b) of the method for producing an epithelial-mesenchymal transition and fibrosis model according to the present invention may be one from which a ROCK inhibitor is excluded.
[0039] The culture medium used in step (b) of the method for producing an epithelial-mesenchymal transition and fibrosis model according to the present invention may contain a smaller amount of a TGF-β inhibitor compared to the culture medium of step (a). The TGF-β inhibitor is any substance that inhibits the function of a TGF-β receptor, for example, a protein, a peptide, a small molecule, and may be any one selected from the group consisting of A83-01, SB-431542, SB-505124, SB-525334, SD-208, LY-36494, and SJN-2511. Preferably, it may be A83-01. More preferably, it may be 0.2 μM to 1 μM of A83-01.
[0040] In one embodiment of the present invention, Y-27632 can alleviate stress caused by Activin A treatment, etc., and thus Y-27632 was removed during the Activin A treatment step. In addition, by removing Y-27632, the polarity of organoid cells could be aligned similarly to that of tissue.
[0041] More specifically, the culture medium used in step (b) of the method for producing an epithelial-mesenchymal transition and fibrosis model according to the present invention may include A83-01, R-spondin 3, Noggin, FGF2, FGF10, NRG1 (Neuregulin β1), and Activin A. At this time, Activin A may preferably be included in an amount of 5 to 50 μg / ml.
[0042] In one embodiment of the present invention, "Activin A" is one of the TGF-β superfamily members and acts as a ligand for Acvr (Activin receptor). When Activin A binds to the receptor, phosphorylation occurs, activating downstream signaling. As p38, Stat, etc. are activated, epithelial-mesenchymal transition (EMT) occurs, which can induce fibrosis.
[0043] In addition, in one embodiment of the present invention, "A83-01" prevented unintended differentiation by suppressing TGF-β signaling in the organoid culture medium and played a role in increasing the expansion efficiency of the organoid. However, when fibrosis was induced through Activin A, A83-01 inhibited the activation of Acvr, thereby blocking the induction of fibrosis, so the administration of an appropriate dose of A83-01 was very important. Therefore, the composition of a suitable culture medium for the creation of an epithelial-mesenchymal transition and fibrosis model based on human salivary gland organoids was confirmed to include 20 μg / ml of Activin A and 1 μM of A83-01.
[0044] Accordingly, the present invention provides a medium composition for producing an epithelial-mesenchymal transition and fibrosis model comprising a TGF-β inhibitor, a Wnt activator, a BMP inhibitor, an FGF family member, a receptor tyrosine kinase ligand, and Activin A.
[0045] The method for producing an epithelial-mesenchymal transition and fibrosis model according to the present invention may perform three-dimensional culture in both the step of culturing salivary gland organoids and the step of treating the salivary gland organoids with a culture medium containing Activin A.
[0046] In most organs, including the salivary glands, cells tend to preferentially culture only progenitor cells or stem cells when cultured in two dimensions. In the case of the salivary glands, acinar and myoepithelial cells can only be maintained for a very short time after separation from the tissue. However, in three-dimensional culture, acinar and myoepithelial cells develop due to concentration gradients in the extracellular matrix and growth factors. This means that acinar and myoepithelial cell-dominated phenomena, which are not observed in two-dimensional cultures, are observed in three-dimensional cultures.
[0047] That is, when performing 3D culture, a superior level of development is observed compared to 2D culture in terms of the level of development related to salivary gland cells. More specifically, differences can be observed in the expression of AQP5, which is highly related to salivary gland function. In addition, differences can be observed in the expression of STATH, etc. In other words, the 3D culture method according to the present invention can configure salivary gland tissue more suitable for disease models.
[0048] This three-dimensional culture method can be performed by, for example, a method generally performed in the relevant technical field, without any particular limitation on the specific conditions for three-dimensional culture. For example, it can be performed by three-dimensionally culturing with a biocompatible scaffold in a medium. Here, the biocompatible scaffold is made of a material that has an affinity for cells and a so-called 'cell adhesive' surface, and means a support that can three-dimensionally attach and culture cells. Examples of naturally derived supports in the present invention include alginate, protein, collagen, fibrin, hyaluronic acid, cellulose, etc., and examples of synthetic polymer supports include, but are not limited to, poly(alpha-hydroxy acid) series, poly(vinyl alcohol), polyanhydride, etc. In addition, a culture body can be manufactured using a hanging drop culture method and three-dimensionally cultured.
[0049] The present invention provides a method for screening for epithelial-mesenchymal transition and fibrosis therapeutic agents.
[0050] Specifically, the present invention provides a method for screening an epithelial-mesenchymal transition and fibrosis treatment agent, comprising the step of treating a test substance in an epithelial-mesenchymal transition and fibrosis model manufactured according to the above manufacturing method.
[0051] More specifically, the above method for screening for an epithelial-mesenchymal transition and fibrosis treatment agent may further include a step of selecting the test agent as an epithelial-mesenchymal transition and fibrosis treatment agent when the expression level of any one or more selected from the group consisting of AQP5, BHLHA15, and BPIFA2 is increased compared to an epithelial-mesenchymal transition and fibrosis model group not treated with the test agent.
[0052] The above AQP5 and / or BHLHA15 are markers of salivary gland epithelial cells. According to one embodiment of the present invention, a decrease in the expression of the AQP5 and BHLHA15 genes was confirmed in the epithelial-mesenchymal transition and fibrosis model according to the present invention. A decrease in the expression level of the corresponding genes is an indicator that fibrosis and epithelial-mesenchymal transition have progressed.
[0053] Aquaporin 5 (AQP5) is a member of a family of membrane proteins related to major intrinsic proteins and plays a crucial role in the production of saliva, tears, and pulmonary secretions. AQP5 is known to be a marker associated with cells directly involved in salivary secretion in salivary glands.
[0054] BHLHA15 (Basic Helix-Loop-Helix Family Member A 15) acts as a key regulator of acinar cell function, stability, and identity.
[0055] BPIFA2 (BPI fold containing family A member 2, or parotid secretory protein) is one of the markers indicating developing serous acinar cells and acts as a surfactant to ensure smooth secretion of saliva within the ducts.
[0056] In addition, more specifically, the above-described epithelial-mesenchymal transition and fibrosis treatment screening method may further include a step of selecting the test substance as an epithelial-mesenchymal transition and fibrosis treatment when the expression level of any one or more selected from the group consisting of ACTA2, CDH2, ACVR1, and FN1 is reduced compared to an epithelial-mesenchymal transition and fibrosis model group not treated with the test substance.
[0057] The above ACTA2, CDH2, ACVR1 and FN1 are mesenchymal cell-related markers known to increase when fibrosis and epithelial-mesenchymal transition (EMT) occur. ACTA2 is a myoepithelial cell-related marker, CDH2 is a mesenchymal cell-related marker, ACVR1 is an Activin A receptor-related marker, and FN1 is a marker involved in cell adhesion. According to one embodiment of the present invention, an increase in the expression of ACTA2, CDH2, ACVR1 and FN1 genes was confirmed in the epithelial-mesenchymal transition and fibrosis model according to the present invention.
[0058] ACTA2 (actin alpha 2) is one of six actin isoforms and is involved in smooth muscle contraction. When the wound is severe or chronic, epithelial-mesenchymal transition (EMT) fails to revert to an epithelial state, and instead progresses to a fibrotic stage characterized by differentiation of fibroblasts into myofibroblasts and deposition of extracellular matrix. Thus, increased ACTA2 gene expression indicates the development of EMT and fibrosis.
[0059] CDH2 (cadherin-2) is a transmembrane protein expressed in various tissues and functions to mediate cell-cell adhesion. CDH2 is also known as a mesenchymal cell-associated marker, and increased expression of this gene indicates the occurrence of epithelial-mesenchymal transition.
[0060] ACVR1 (activin A receptor type Ⅰ) is a type Ⅰ receptor for bone morphogenic protein (BMP). Diseases associated with ACVR1 include fibrodysplasia and ossificans. Furthermore, ACVR1 inhibitors have been shown to be useful as therapeutic agents for myelofibrosis. Increased expression of the ACVR1 gene indicates the development of epithelial-mesenchymal transition (EMT) and fibrosis.
[0061] FN1 (fibronectin 1) is a high-molecular-weight glycoprotein of the extracellular matrix that binds to integrins. It plays a crucial role in cell adhesion, growth, migration, and differentiation, and is crucial for processes such as wound healing and embryonic development. FN1 is also known as a biomarker for fibrosis. Therefore, increased expression of the FN1 gene indicates the development of fibrosis.
[0062] The present invention provides an epithelial-mesenchymal transition and fibrosis model produced by culturing an organoid based on epithelial cells derived from human salivary gland tissue and treating the organoid with Activin A. Furthermore, the epithelial-mesenchymal transition and fibrosis model can be utilized to screen for novel therapeutic agents.
[0063] Figure 1 shows the results of observing organoids according to the concentration of A83-01 and Activin A using a bright-field microscope.
[0064] Figure 2 shows the results of confirming the difference in gene expression of progenitor cell markers in organoids according to the concentration of A83-01 and Activin A.
[0065] Figure 3 shows the results of confirming the difference in gene expression of mesenchymal cell markers in organoids according to the concentration of A83-01 and Activin A.
[0066] Figure 4 shows the results of confirming cell viability at the optimal concentrations of A83-01 and Activin A.
[0067] Figure 5 shows the results of confirming the morphological changes in organoids induced by epithelial-mesenchymal transition and fibrosis.
[0068] Figure 6 is a diagram showing the results of immunofluorescence staining of organoids in which epithelial-mesenchymal transition and fibrosis were induced.
[0069] Figure 7 shows the results of confirming the drug effect using an organoid platform in which epithelial-mesenchymal transition and fibrosis were induced.
[0070] Figure 8 shows the results of brightfield microscopy confirming that drug screening is possible using an organoid platform in which epithelial-mesenchymal transition and fibrosis are induced.
[0071] Figure 9 shows the results of H&E staining confirming that drug screening is possible using an organoid platform in which epithelial-mesenchymal transition and fibrosis are induced.
[0072] Hereinafter, preferred examples are presented to help understand the present invention.
[0073] However, the following examples are provided only to make the present invention easier to understand, and the contents of the present invention are not limited thereby.
[0074] Experimental Example 1. Production of an epithelial-mesenchymal transition and fibrosis model using human salivary gland-based organoids.
[0075] 1. Reagents used in the present invention
[0076] Collagenase, type II (Worthington, LS004176), Advanced DMEM / F12 (Gibco™, 12634010), Y-27632 dihydrochloride (Tocris, Cat. No. 1254), A83-01 (Tocris, Cat. No. 2939), PGE2 (Tocris, Cat. No. 2296), 48 well plate for suspension culture (Greiner Bio-one, 677102), Matrigel (Corning, 356231), Primocin® (Invivogen, ant-pm-2), HEPES (Gibco™, 15630080), GlutaMAX (Gibco™, 35050061), B-27™ supplement (50X), serum free (Gibco™, 17504001), N-Acetyl-L-cysteine (NAC; Sigma, A9165), Nicotinamide (Sigma, N0636), Recombinant RSPO3-Fc fusion protein conditioned medium (ImmunoPrecise Antibodies, R001), Noggin-Fc Fusion Protein conditioned medium (ImmunoPrecise Antibodies, N002), Recombinant Human Heregulinβ-1 (Peprotech, 100-03), Recombinant Human FGF-basic (154 a.a.) (Peprotech, 100-18B), Recombinant Human FGF-10 (Peprotech, 100-26), TrypLE express (Gibco™, 12604013), PBS (Gibco™, 14190144), CellBanker 1 (ZENOAQ), Activin A (Peprotech, 120-14P), TRIzol™ Reagent [Invitrogen™ 15596018 or 15596026], 1-Bromo-3-chloropropane for isolation of RNA [Sigma-Aldrich, B9673], 2-propanol for molecular biology [Sigma-Aldrich, I9516], GlycoBlue™ Coprecipitant [Invitrogen™ AM9516], Ethyl alcohol for molecular biology [Sigma-Aldrich, E7023], Nuclease free water, Tris Tris Buffer, 1.0 M, pH 8.0, Molecular Biology Grade [Sigma-Aldrich, 648314], EDTA for molecular biology [Sigma-Aldrich, E7889], PrimeScript™ RT Master Mix (Perfect Real Time) (Takara, RR036A), Sensifast SYBR Lo-ROX kit (MERIDIAN, BIO-94020), Hematoxylin (Abcam, ab63534), Eosin (Abcam, ab64044), 100% Ethanol (Sigma, 108543), Periodic Acid Schiff (PAS) stain kit (Abcam, ab150680), Fisher Chemical™ Permount™ Mounting Medium (Fisher scientific, SP15-100), Trypan Blue Solution, 0.4% (Gibco™, 15250061), CellTiter-Glo® Luminescent Cell Viability Assay (Promega, G9683).
[0077] 2. Processing and storage of human salivary gland stem cells
[0078] Human salivary gland samples were stored at 4°C in a solution containing 1X HEPES and 1X GlutaMAX in Advanced DMEM / F12. The samples were placed in Advanced DMEM / F12, and 5 mg / mL of Collagenase type II and 10 μM of Y-27632 were added at 1 mL per 50 mg of sample. The samples were minced with a blade and transferred to a new conical tube. The tubes were incubated in a 37°C shaker at 200 rpm for 1 h. The conical tubes were centrifuged at 300 × g for 5 min, the supernatant was removed, and 2 mL of TrypLE express and 10 μM of Y-27632 were added to the cells by pipetting, followed by incubation at 37°C for 10 min. Afterwards, the sample was filtered through a 100 μm strainer to remove undigested tissues, and 2 ml of Advanced DMEM / F12 was added. After centrifugation at 300 × g for 5 minutes, the supernatant was removed. After counting the cells, at least 2 × 10 cells were transferred to one cryovial (1 ml). 5 The cell pellet was dissolved in CellBanker 1 containing 10 μM Y-27632, calculated to contain 10 cells. 1 ml was dispensed into cryovials, stored at -80°C for 2-3 days, and then transferred to a nitrogen tank for long-term storage.
[0079] 3. 3D culture of human salivary gland stem cell-derived organoids
[0080] Fresh cells or cell stock immediately after isolation were taken out of the nitrogen tank and incubated at 37°C until half thawed, centrifuged at 300 × g for 5 minutes, and the supernatant was removed. 5.0 × 10 per well of a 48-well plate 3 The number of cells was calculated so that 10 cells could enter. The amount of Matrigel calculated per well of a 48-well plate was mixed with the cells. The mixture of the cells calculated above and 20 μl of Matrigel per well was embedded in a 48-well plate warmed in a 37°C incubator for more than 1 hour and solidified to form a dome shape. 250-300 μl of culture medium warmed in a 37°C bath was added and cultured. The culture medium was replaced with fresh medium every 2-3 days, and subculture was performed before 14 days.
[0081] The composition of the organoid culture medium is shown in Table 1 below.
[0082] ADF12Basal mediumGlutamax1 XHEPES1 XPrimocin0.2%B27 vit A+1 μM
[0083] (CM: Conditioned medium)
[0084] 4. Induction of epithelial-mesenchymal transition and fibrosis
[0085] During subculture, the cell number was adjusted to 1,000–2,000 cells / well, mixed with Matrigel, dispensed into a 48-well plate, and solidified. 275–300 μl of the culture medium with the composition of Table 1 was added. After 72 hours, the culture medium was replaced for the first time, and after another 72 hours, Y-27632 was removed, the concentration of A83-01 was reduced to 1 μM or removed, and 275–300 μl of the epithelial-mesenchymal transition and fibrosis-inducing culture medium containing 20 ng / ml or 50 ng / ml of Activin A was added. At this time, Y-27632 can alleviate stress caused by Activin A treatment, so Y-27632 was removed during the Activin A treatment step. Additionally, the polarity of organoid cells could be aligned similarly to the tissue by removing Y-27632.
[0086] After 48 hours, organoids were harvested and analyzed by RT-qPCR, special staining, IHC, IF, and other follow-up experiments.
[0087] The composition of the culture medium for inducing epithelial-mesenchymal transition and fibrosis is shown in Table 2 below.
[0088] ADF12Basal mediumGlutamax1 XHEPES1 XPrimocin0.2%B27 vit A+1 XNAC1 mMNicotinamide5 mMA83-01No additive or 1 μMPGE23 μMhRSPO3 CM1%hNoggin CM2%hNRG15 ng / ㎖hFGF25 ng / ㎖hFGF1010 ng / ㎖Activin ANo additive, 20 ng / ㎖ or 50 ng / ㎖
[0089] Example 1. Evaluation of fibrosis induction in epithelial-mesenchymal transition and fibrosis models according to the concentration of A83-01 and Activin A.
[0090] As a result of evaluating whether fibrosis was induced according to changes in the concentration of A83-01 and Activin A, as shown in Fig. 1, it was confirmed that the phenomenon of organoids sticking to the bottom in a concentration-dependent manner, i.e., fibrosis, increased as Activin A was treated, but it was difficult to confirm the change according to the concentration of A83-01.
[0091] Example 2. Evaluation of gene expression changes in epithelial-mesenchymal transition and fibrosis models according to A83-01 and Activin A concentrations.
[0092] 1. RNA extraction and gene expression analysis method
[0093] a. Real-time PCR
[0094] The organoids and other suspension cultures prepared in Example 1 were dissolved in 1 ml of TRIzol after removing ECM, etc., and transferred to a 1.5 ml tube. After slowly pipetting several times to confirm that the cells or organoids were completely dissolved in the TRIzol, they were left to stand at room temperature for 5 minutes. After adding 0.1 ml of 1-Bromo-3-chloropropane per 1 ml of TRIzol used, they were shaken vigorously by hand for 15 seconds and left to stand at room temperature for 2 to 15 minutes until the layers separated from the pink mixture. Centrifuged at 12,000 g at 2°C for 16 minutes, only the top layer was carefully transferred to a new tube.
[0095] Afterwards, 0.5 ml of 2-propanol and 2 μl of glycogen blue were added per 1 ml of TRIzol, mixed by pipetting or shaking, and allowed to stand at 4°C for 10 minutes. After centrifugation at 12,000 g for 11 minutes at 2°C, the liquid was discarded, being careful not to remove the blue pellet.
[0096] Afterwards, 1 ml of 75% EtOH was added and vortexed, centrifuged at 7,500 g for 5 minutes at 2°C, and the supernatant was discarded. Lightly centrifuged again to collect the remaining EtOH, remove it with a pipette, and dry it in the air for 5-10 minutes. Depending on the size of the pellet, 20-50 μl of TE buffer was added, pipetted several times, and heated in a 55°C heat block for 15 minutes. Then, it was stored at a temperature below -70°C or cDNA synthesis was performed.
[0097] B. cDNA synthesis
[0098] Total RNA extracted using the RR036a kit was synthesized into cDNA using the above method. The RNA concentration was then measured using a nano drop. The amount of distilled water (DW) was adjusted according to the RNA concentration, and cDNA was synthesized at 37°C for 15 minutes, 85°C for 5 seconds, and then at 16°C for the remainder.
[0099] D. qPCR
[0100] The cDNA synthesized according to the above method was diluted to 10 ng / 4 μl with TE buffer according to the purpose and stored. Then, Mastermix (Sensifast 5 μl + Forward primer 0.5 μl + Reverse primer 0.5 μl = 6 μl / well) was added to each gene to be evaluated, and PCR was performed for a total of 45 cycles, and the results were summarized using ddCT.
[0101] The primer base sequences for the target genes used at this time are shown in Table 3 below.
[0102] HumanAQP5ForwardTACGGTGTGGCACCGCTCAATG (SEQ ID NO: 1)ReverseAGTCAGTGGAGGCGAAGATGCA (SEQ ID NO: 2)HumanBHLHA15ForwardGCGGACAAGAAGCTCTCCAAGA (SEQ ID NO: 3)ReverseTGGTAGTGCTGGTAGAGCTTGG (SEQ ID NO: 4)HumanACTA2ForwardCTATGCCTCTGGACGCACAACT (SEQ ID NO: 5)ReverseCAGATCCAGACGCATGATGGCA (SEQ ID NO: 6)HumanCDH2ForwardCCTCCAGAGTTTACTGCCATGAC (SEQ ID NO: 7)ReverseGTAGGATCTCCGCCACTGATTC (SEQ ID NO: 8)HumanACVR1ForwardGACGTGGAGTATGGCACTATCG (SEQ ID NO: 9)ReverseCACTCCAACAGTGTAATCTGGCG (SEQ ID NO: 10) HumanFN1 ForwardACAACACCGAGGTGACTGAGAC (SEQ ID NO: 11) ReverseGGACACAACGATGCTTCCTGAG (SEQ ID NO: 12) HumanBPIFA2 ForwardCCTGGATGTCAAAGCTGAACCG (SEQ ID NO: 13) ReverseAGGTCCAAGGAGGCTTTCAGGT (SEQ ID NO: 14)
[0103] 2. Evaluation of changes in expression of genes related to progenitor cells
[0104] As shown in Fig. 2, it was confirmed that fibrosis was induced in the organoids through the decrease in AQP5 and BHLHA15, which are markers of salivary gland epithelial cells, by Activin A treatment. In addition, when A83-01 was removed, a non-tendency-dependent increase or decrease occurred rather than a concentration-dependent change due to Activin A. In particular, statistical significance was confirmed for AQP5, a marker of developing glandular epithelial cells.
[0105] The BPIFA2 gene, a developing serous gland cell-specific marker with the synonym parotid secretory protein (PSP), also showed statistical significance with the same pattern as AQP5.
[0106] Accordingly, it was determined that lowering the concentration of A83-01 to 1 μM rather than excluding it was more desirable for inducing fibrosis in organoids.
[0107] 3. Evaluation of changes in expression of mesenchymal cell-related genes
[0108] Additionally, we identified mesenchymal cell markers known to increase when fibrosis and epithelial-mesenchymal transition (EMT) occur. As shown in Fig. 3, when A83-01 was present at 1 μM, ACTA2, a myoepithelial cell marker, CDH2, a mesenchymal cell marker, ACVR1, a receptor for Activin A, and FN1, which is involved in cell adhesion, were all significantly increased. The increased expression of ACVR1 indicates that a positive feedback loop by Activin A is in operation, which means that the EMT and fibrosis induced by Activin A are stably maintained. In addition, the increase in FN1, a fibroblast-specific marker, indicates that the cells have undergone EMT. Through this, it was confirmed that fibrosis and EMT were induced in the organoids according to the present invention.
[0109] However, when the A83-01 concentration was 1 μM and the Activin A concentration was 50 ng / ㎖, the mesenchymal cell markers in the organoid tended to decrease compared to the 20 ng / ㎖ condition.
[0110] Accordingly, the optimal Activin A concentration that induces fibrosis and epithelial-mesenchymal transition in organoids was determined to be 20 ng / ml.
[0111] That is, the optimized composition of the culture medium for inducing epithelial-mesenchymal transition and fibrosis, which was confirmed by synthesizing the results of FIGS. 2 and 3, is shown in Table 4 below.
[0112] ADF12Basal mediumGlutamax1 XHEPES1 XPrimocin0.2%B27 vit A+1 ng / ml
[0113] 4. Evaluation of cell viability according to the optimal concentration of A83-01 and Activin A
[0114] The cell viability of organoids (epithelial-mesenchymal transition and fibrosis model) produced using the optimal composition of the epithelial-mesenchymal transition and fibrosis-inducing culture medium established above was measured.
[0115] As shown in Fig. 4, it was confirmed that there was no change in cell viability following treatment with the epithelial-mesenchymal transition and fibrosis-inducing culture medium (A83-01 1 μM, Activin A 20 ng / ㎖) according to the present invention. This confirmed that Activin A treatment changed the properties of cells from epithelial cells to mesenchymal cells, but did not affect cell survival.
[0116] Example 3. Evaluation of morphological changes in epithelial-mesenchymal transition and fibrosis models according to optimal concentrations of A83-01 and Activin A.
[0117] In this experiment, we performed staining to examine morphological changes in organoids under established fibrosis modeling conditions. HE staining was performed to determine cell morphology, and PAS staining was performed to confirm mucin secretion.
[0118] 1. Dyeing method
[0119] A. H&E staining
[0120] After hydrating paraffin block section slides, the slides were reacted with hematoxylin for 50 seconds and then washed in running water for 10 minutes. Afterwards, they were reacted with 100% ethanol for 1 minute and then with eosin for 2 minutes. After dehydration, 20 μl of permount mounting medium was pipetted onto the slides and covered with a cover glass to check the degree of staining.
[0121] B. PAS staining
[0122] Paraffin block section slides were hydrated and reacted with Periodic Acid Solution for 10 minutes. Afterwards, they were washed in DW, reacted with Schiff's solution for 30 minutes, washed with hot water, and reacted with Hematoxylin for 1 minute. Afterwards, they were washed in running water for 5 minutes and reacted with Bluing reagent for 30 seconds. After washing with DW and dehydration, 20 μl of Permount mounting medium was pipetted onto the slides and covered with a cover glass to check the degree of staining.
[0123] 2. Morphological change assessment
[0124] As shown in Fig. 5, in the group that was not treated with the epithelial-mesenchymal transition and fibrosis induction culture medium (A83-01 1 μM, Activin A 20 ng / ㎖) according to the present invention, the shape of normal salivary gland epithelial cells was maintained (upper left panel), and magenta-colored mucin was observed in the cells inside the organoid (lower left panel).
[0125] On the other hand, in the group treated with the epithelial-mesenchymal transition and fibrosis-inducing culture medium (A83-01 1 μM, Activin A 20 ng / ㎖) according to the present invention, an elongated cell shape, which is characteristic of mesenchymal cells, was observed, and it was confirmed that the epithelial cell morphology was lost (upper right panel), and the secretion of mucin was confirmed to have lost the polarity of the cells and to be present throughout the organoid (lower right panel).
[0126] Through this, it was confirmed that Activin A changed the morphology of the cells, and in particular, the central part of the organoids took on a squamous cell-like morphology rather than an epithelial cell morphology. These results imply that epithelial-mesenchymal transition and fibrosis progressed in the organoids through treatment with the culture medium according to the present invention.
[0127] 3. Immunofluorescence staining evaluation
[0128] The phenomenon of epithelial-mesenchymal transition and fibrosis progression in organoids was confirmed by attaching specific markers. As shown in Fig. 6, in the group not treated with the epithelial-mesenchymal transition and fibrosis inducing culture medium according to the present invention (A83-01 1 μM, Activin A 20 ng / ㎖), the myoepithelial cell marker ACTA2 was slightly expressed and the basal cell marker K14 was expressed mainly on the outside of the organoid. However, when treated with the epithelial-mesenchymal transition and fibrosis inducing culture medium according to the present invention (A83-01 1 μM, Activin A 20 ng / ㎖), the expression of ACTA2 was confirmed to be expressed more strongly toward the nucleus of the cell, and the expression of K14 was also expressed throughout the organoid.
[0129] When staining for AQP5, a marker of thyroid epithelial cells, and AMY1, a component of saliva, it was confirmed that the expression of AQP5 was reduced in the group treated with the culture solution according to the present invention.
[0130] As a result of staining for CDH2 and VIM, which are mesenchymal cell markers, and CDH1, which is an epithelial cell marker, it was confirmed that in the group treated with the culture medium according to the present invention, the expression of VIM slightly increased due to fibrosis, and that CDH1 decreased. However, no change in the expression of CDH2 could be confirmed.
[0131] When the immunofluorescence staining results were synthesized, it was finally confirmed that fibrosis occurred in the organoids following Activin A treatment, as evidenced by abnormal expression of ACTA2, decrease in AQP5 and CDH1, and increase in VIM.
[0132] Example 4. Evaluation of drug screening capabilities in epithelial-mesenchymal transition and fibrosis models.
[0133] The drug screening ability of the epithelial-mesenchymal transition and fibrosis model according to the present invention was evaluated using dexamethasone, which is used as a treatment for various salivary gland diseases.
[0134] As shown in Fig. 7, FN1 was confirmed to increase and decrease respectively in the model according to the present invention, but it was confirmed to return to normal levels by treatment with dexamethasone.
[0135] These results imply that the epithelial-mesenchymal transition and fibrosis model according to the present invention is suitable for exploring the mechanisms of existing drugs or the efficacy of new drugs.
[0136] Example 5. Confirmation of drug screening results using brightfield microscopy and H&E staining.
[0137] Dexamethasone, a drug known to reduce fibrosis and used as a treatment for various salivary gland diseases, was administered, and the reduction in fibrosis was confirmed through brightfield microscopy and HE staining, and the results are shown in Figs. 8 and 9.
[0138] As shown in Figures 8 and 9, the level of fibrosis significantly increased in the model manufactured according to the present invention, but this was clearly reduced following drug treatment. This confirms the high potential of the salivary gland organoid model according to the present invention as a drug screening model.
Claims
1. Method for producing an epithelial-mesenchymal transition and fibrosis model comprising the following steps: (a) culturing salivary gland organoids from salivary gland tissue-derived epithelial cells in a culture medium containing a TGF-β inhibitor, a Wnt activator, a BMP inhibitor, an FGF family member, a receptor tyrosine kinase ligand and a ROCK inhibitor; and (b) A step of treating the salivary gland organoid with a culture medium containing Activin A.
2. A method for producing an epithelial-mesenchymal transition and fibrosis model in the first paragraph, wherein the culture medium of step (b) excludes a ROCK inhibitor.
3. A method for producing an epithelial-mesenchymal transition and fibrosis model, wherein the culture medium of step (b) contains a smaller amount of a TGF-β inhibitor than the culture medium of step (a).
4. A method for producing an epithelial-mesenchymal transition and fibrosis model, wherein the TGF-β inhibitor in paragraph 1 is any one selected from the group consisting of A83-01, SB-431542, SB-505124, SB-525334, SD-208, LY-36494, and SJN-2511.
5. A method for producing an epithelial-mesenchymal transition and fibrosis model in claim 1, wherein the Wnt activator is any one selected from the group consisting of R-spondin 1, R-spondin 2, R-spondin 3, and R-spondin 4.
6. A method for producing an epithelial-mesenchymal transition and fibrosis model in claim 1, wherein the BMP inhibitor is any one selected from the group consisting of Noggin, Dorsomorphin, DMH1, and LDN-193189.
7. A method for producing an epithelial-mesenchymal transition and fibrosis model in claim 1, wherein the FGF family is at least one selected from the group consisting of FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, and FGF10.
8. A method for producing an epithelial-mesenchymal transition and fibrosis model in the first paragraph, wherein the receptor tyrosine kinase ligand is any one selected from the group consisting of NRG1 (Neuregulin β1), HRG1 (Heregulin β1), epidermal growth factor (EGF), transforming growth factor-α (TGF-α), basic fibroblast growth factor (bFGF), brain-derived neurotrophic factor (BDNF), hepatocyte growth factor (HGF), and keratinocyte growth factor (KGF).
9. A method for producing an epithelial-mesenchymal transition and fibrosis model in paragraph 1, wherein the ROCK inhibitor is any one selected from the group consisting of Y-27632, Fasudil, and H-1152.
10. A method for producing an epithelial-mesenchymal transition and fibrosis model, wherein the culturing of salivary gland organoids from salivary gland tissue-derived epithelial cells in step (a) is performed in a culture medium containing A83-01, R-spondin 3, Noggin, FGF2, FGF10, Neuregulin β1, and Y-27632.
11. A method for producing an epithelial-mesenchymal transition and fibrosis model, wherein the treatment of the culture medium to the salivary gland organoid in step (b) comprises treating the culture medium containing A83-01, R-spondin 3, Noggin, FGF2, FGF10, NRG1 (Neuregulin β1), and Activin A.
12. An epithelial-mesenchymal transition and fibrosis model obtained by any one of the methods selected from claims 1 to 11.
13. A medium composition for producing an epithelial-mesenchymal transition and fibrosis model comprising a TGF-β inhibitor, a Wnt activator, a BMP inhibitor, an FGF family member, a receptor tyrosine kinase ligand and Activin A.
14. A method for screening for an epithelial-mesenchymal transition and fibrosis treatment agent, comprising the step of treating a test substance in an epithelial-mesenchymal transition and fibrosis model according to Article 12.
15. A method for screening for an epithelial-mesenchymal transition and fibrosis treatment agent, further comprising: a step of selecting the test substance as an epithelial-mesenchymal transition and fibrosis treatment agent, when the expression level of any one or more selected from the group consisting of AQP5, BHLHA15, and BPIFA2 is increased compared to the epithelial-mesenchymal transition and fibrosis model group not treated with the test substance in paragraph 14.
16. A method for screening for an epithelial-mesenchymal transition and fibrosis treatment agent, further comprising: a step of selecting the test substance as an epithelial-mesenchymal transition and fibrosis treatment agent, when the expression level of any one or more selected from the group consisting of ACTA2, CDH2, ACVR1, and FN1 is reduced compared to the epithelial-mesenchymal transition and fibrosis model group not treated with the test substance in paragraph 14.
Citation Information
Patent Citations
Method and system of creating bundles for gig-worker
KR1020230151190A
Non-point pollution reduction drain pipe with easy cleaning and bridge maintenance method thereby
KR102701457B1
KR20190143703A
KR20230081737A