Microorganism of genus corynebacterium producing l-threonine or l-homoserine, and method for producing l-threonine or l-homoserine using same

By employing Corynebacterium microorganisms with reduced citrate synthase activity, specifically through genetic modifications to the gltA gene, the production of L-threonine or L-homoserine is significantly enhanced, overcoming previous yield limitations and growth rate concerns.

WO2025116468A1PCT designated stage expired Publication Date: 2025-06-05CJ CHEILJEDANG CORP
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/018810
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-26
Filing Date
2024-11-26
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

Current methods for producing L-threonine or L-homoserine using Corynebacterium microorganisms are limited by low yields and potential delays in growth rate.

Method used

Utilizing a microorganism of the genus Corynebacterium with reduced citrate synthase activity, which allows for higher yields of L-threonine or L-homoserine without compromising growth rate, achieved through genetic modification such as substituting the initiation codon of the gltA gene from ATG to GTG.

Benefits of technology

The approach results in increased productivity of L-threonine or L-homoserine, with strains showing up to a 124% improvement in L-threonine production compared to parent strains, without affecting the growth rate.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention relates: to a microorganism of the genus Corynebacterium that produces L-threonine or L-homoserine and has reduced citrate synthase activity; and a method for producing L-threonine or L-homoserine using same.
Need to check novelty before this filing date? Find Prior Art

Description

Microorganisms of the genus Corynebacterium producing L-threonine or L-homoserine and methods for producing L-threonine or L-homoserine using the same

[0001] The present application relates to a Corynebacterium genus microorganism producing L-threonine or L-homoserine, having reduced citrate synthase activity; a method for producing L-threonine or L-homoserine, comprising a step of culturing the microorganism in a medium; and a composition for producing L-threonine or L-homoserine, comprising the microorganism or a culture of the microorganism.

[0002]

[0003] Microorganisms of the genus Corynebacterium, particularly Corynebacterium glutamicum, are Gram-positive microorganisms widely used to produce L-amino acids and other useful substances. To produce the aforementioned L-amino acids and other useful substances, various studies are being conducted to develop highly efficient production microorganisms and fermentation process technologies. In particular, L-threonine is an essential amino acid that cannot be synthesized in the body and must be supplied through ingestion. Therefore, research and development for highly efficient production of L-threonine is necessary.

[0004]

[0005] The present inventors have completed the present invention by confirming that L-threonine or L-homoserine can be produced at a higher yield without delaying the growth rate when using a microorganism with reduced citrate synthase activity.

[0006]

[0007] One object of the present application is to provide a microorganism of the genus Corynebacterium that produces L-threonine or L-homoserine and has reduced citrate synthase activity.

[0008] Another object of the present application is to provide a method for producing L-threonine or L-homoserine, comprising a step of culturing the microorganism in a medium.

[0009] Another object of the present application is to provide a composition for producing L-threonine or L-homoserine comprising the microorganism or a culture of the microorganism.

[0010]

[0011] When using the microorganism with reduced citrate synthase activity of the present application, L-threonine or L-homoserine can be produced at a higher yield without delaying the growth rate.

[0012]

[0013] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated into this specification in their entirety by reference to more clearly explain the level of the technical field to which this application belongs and the contents of this application.

[0014]

[0015] One aspect of the present application provides a microorganism of the genus Corynebacterium that produces L-threonine or L-homoserine and has reduced citrate synthase activity.

[0016] The "citrate synthase" of the present application is an enzyme that produces citrate by polymerizing acetyl CoA and oxaloacetate, which are produced during the glycolysis process of microorganisms. In addition, the enzyme can catalyze the condensation reaction of a 2-carbon acetate residue from a molecule of acetyl CoA and 4-carbon oxaloacetate to form 6-carbon citrate. The term "citrate synthase" of the present application may be used interchangeably with citrate synthase, CS, GltA protein, or GltA. The sequence of GltA in the present application can be obtained from the known database NCBI's GenBank. In addition, GltA may be a polypeptide having citrate synthase activity encoded by the gltA gene, but is not limited thereto.

[0017] The "citrate synthase" of the present application may include any protein that exhibits the activity of producing citrate by polymerizing acetyl CoA and oxaloacetate, and in one embodiment, may include, have, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 1.

[0018] In the above, an embodiment of the citrate synthase of the present application is described as a protein comprising or consisting of the amino acid sequence of SEQ ID NO: 1. However, this does not exclude meaningless sequence additions before and after the amino acid sequence of SEQ ID NO: 1, mutations that may occur naturally, or silent mutations thereof, and if it has the same or corresponding activity as the protein comprising the amino acid sequence, it may correspond to the citrate synthase of the present application.

[0019] For example, the citrate synthase of the present application may comprise, have, consist of, or consist essentially of an amino acid sequence having at least 60%, 62%, 63%, 64%, 65%, 70%, 75%, 76%, 77%, 78%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology or identity with the amino acid sequence of SEQ ID NO: 1. In addition, it is obvious that a protein that has the above homology or identity and exhibits an activity corresponding to the protein of the sequence described in the above sequence number 1 is included in the citrate synthase of the present application even if it has an amino acid sequence in which some of the sequences are deleted, modified, substituted or added.

[0020] In one embodiment of the present application, the citrate synthase may be encoded by a polynucleotide capable of encoding a protein comprising an amino acid sequence having at least 60% homology or identity with SEQ ID NO: 1; or a polynucleotide comprising a base sequence of SEQ ID NO: 2, or a base sequence having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the base sequence of SEQ ID NO: 2.

[0021] In one embodiment of the present application, the citrate synthase may be derived from a strain of the genus Corynebacterium, and specifically, may be derived from a strain of Corynebacterium glutamicum.

[0022] The term "reduction" of protein (polypeptide) activity in the present application includes both a decrease in the activity of the protein (polypeptide) compared to the intrinsic activity or inactivation within the host cell (microorganism). That is, the decrease in protein (polypeptide) activity may include a decrease in the activity of the protein (polypeptide) compared to the intrinsic activity or the activity before modification, without the protein (polypeptide) being completely inactivated within the host cell (microorganism); or a complete inactivation of the activity of the protein (polypeptide).

[0023]

[0024] For example, the reduction may include cases where the activity of the protein (polypeptide) is lower or absent compared to the protein (polypeptide) before transformation or in a non-transformed host cell (microorganism) due to mutation of the polynucleotide encoding the protein (polypeptide), cases where the overall level of protein (polypeptide) expression in the cell is lower than that before transformation or in a non-transformed host cell (microorganism) due to inhibition of expression of the polynucleotide or protein (polypeptide), cases where the expression of the polynucleotide or protein (polypeptide) does not occur at all, and cases where the activity of the protein (polypeptide) is low or absent even when protein (polypeptide) expression occurs normally.

[0025] The above "intrinsic activity" refers to the activity of a specific protein (polypeptide) originally possessed by a host cell (microorganism) or an untransformed host cell (microorganism) before transformation, when the trait changes due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before transformation."

[0026] The above host cell (microorganism) may be a prokaryotic or eukaryotic microorganism.

[0027] A decrease in the activity of a protein (polypeptide) compared to the intrinsic activity means that the activity and / or concentration (expression amount) of the protein (polypeptide) of the host cell (microorganism) is lower than the activity and / or concentration (expression amount) of the protein (polypeptide) originally present in the host cell (microorganism) before transformation or in the non-transformed host cell (microorganism).

[0028] Whether the activity of the above protein (polypeptide) is reduced can be confirmed by the degree of activity of the protein (polypeptide), the amount of expression, or the increase in the amount of a product resulting from the activity of the protein (polypeptide). For example, when the L-threonine or L-homoserine production ability of the microorganism of the present application is increased compared to the L-threonine or L-homoserine production ability of a natural wild-type microorganism or an unmodified microorganism, the reduced citrate synthase activity can be measured by measuring the increased L-threonine or L-homoserine production ability, but is not limited thereto.

[0029]

[0030] For example, the reduction may be, but is not limited to, a decrease in the activity or concentration of the corresponding protein (polypeptide) by generally less than about 100%, less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, less than about 10%, less than about 5%, or 0%, relative to the activity or concentration in the host cell (microorganism) before transformation or in the untransformed host cell (microorganism).

[0031] The reduction in the activity of the above protein (polypeptide) can be achieved by various methods well known in the art, and is not limited thereto, as long as the activity of the target protein (polypeptide) can be reduced compared to that of the host cell (microorganism) before transformation. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

[0032] Specifically, the decrease in the activity of the protein (polypeptide) of the present application is

[0033] 1) Deletion of all or part of a gene encoding a protein (polypeptide);

[0034] 2) Modification of the gene expression control region on the chromosome that codes for a protein (polypeptide) (e.g., introduction of a mutation in the expression control region, replacement with a sequence having expression suppression activity, or insertion of a sequence having expression suppression activity);

[0035] 3) Modification of the amino acid sequence of the protein (polypeptide) so as to reduce the activity of the protein (polypeptide) (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence);

[0036] 4) Modification of a polynucleotide sequence encoding a protein (polypeptide) such that the activity of the protein (polypeptide) is reduced (e.g., modification of a polynucleotide sequence of a gene encoding a protein (polypeptide) such that the activity of the protein (polypeptide) is reduced);

[0037] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR of a gene encoding a protein (polypeptide);

[0038] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to a transcript of the gene encoding a protein (polypeptide);

[0039] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a protein (polypeptide) to form a secondary structure that prevents ribosome attachment;

[0040] 8) Addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of a polynucleotide sequence encoding a protein (polypeptide) (Reverse transcription engineering, RTE);

[0041] 9) Regulation of cellular localization of proteins (polypeptides);

[0042] or

[0043] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.

[0044] for example,

[0045] The above 1) deletion of all or part of a gene encoding a protein (polypeptide) can be performed using a method of homologous recombination through a vector for chromosome insertion in a microorganism, or using electromagnetic waves such as ultraviolet rays, X-rays, gamma rays, or chemicals, but is not limited thereto.

[0046] In addition, the replacement of the gene expression control region on the chromosome encoding the above 2) protein (polypeptide) with a sequence having expression suppression activity may be, for example, introduction of a mutation in the expression control region by deletion, insertion, substitution, or a combination thereof so as to reduce the expression inducing activity of the expression control region, or replacement with a sequence having further expression suppression activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0047] In addition, the modification of the amino acid sequence or polynucleotide sequence of the protein (polypeptide) of 3) and 4) above may be, but is not limited to, introducing a sequence mutation such as deletion, insertion, substitution, or a combination thereof into the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence encoding the protein (polypeptide) so as to reduce the activity of the protein (polypeptide), or replacing it with an amino acid sequence or polynucleotide sequence modified to reduce the activity. The modification of the sequence may be performed, for example, by inserting a polynucleotide of the modified sequence into a chromosome by homologous recombination, but is not limited thereto. In one specific example, the protein (polypeptide) may be inactivated by introducing a mutation in the polynucleotide sequence encoding the protein (polypeptide) to form a stop codon, but is not limited thereto.

[0048] In addition, the modification of the base sequence encoding the initiation codon or 5'-UTR of the gene encoding the protein (polypeptide) mentioned above 5) may be, for example, a substitution with another initiation codon having a lower protein (polypeptide) expression rate compared to the endogenous initiation codon, or a modification encoding an RBS sequence having a lower protein (polypeptide) expression rate compared to the endogenous RBS (ribosome binding site) sequence, but is not limited thereto.

[0049] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the protein (polypeptide) described above 6) can be performed, for example, with reference to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986], but is not limited thereto.

[0050] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a protein (polypeptide) to form a secondary structure to prevent attachment of ribosomes may, but is not limited to, making mRNA translation impossible or slowing down the translation speed.

[0051] 8) The addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the polynucleotide sequence encoding the protein (polypeptide) above (Reverse transcription engineering, RTE) may reduce activity by suppressing translation of the protein (polypeptide) by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.

[0052] The above 9) regulation of the intracellular location of a protein (polypeptide) may target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the protein (polypeptide), but is not limited thereto.

[0053] Such a decrease in protein (polypeptide) activity may be, but is not limited to, a decrease in the activity or concentration of the corresponding protein (polypeptide) relative to the activity or concentration of the protein (polypeptide) expressed in the wild type or pre-transformed host cell (microorganism).

[0054]

[0055] The decrease in the activity of the citrate synthase in the microorganism of the present application may be due to the substitution of the initiation codon of the gene (polynucleotide) encoding the endogenous citrate synthase with GTG (ATG→GTG).

[0056] The polynucleotide sequence before substitution encoding the citrate synthase may be encoded by a polynucleotide capable of encoding a protein including an amino acid sequence having at least 60% homology or identity with the amino acid sequence of SEQ ID NO: 1, and in one embodiment of the present application, the polynucleotide sequence before substitution encoding the citrate synthase may be composed of or include the base sequence of SEQ ID NO: 2. In addition, the polynucleotide sequence after substitution encoding the citrate synthase may be composed of or include the base sequence of SEQ ID NO: 3.

[0057] Modification (substitution, addition or deletion) of part or all of the polynucleotide in the microorganism of the present application may be induced by (a) homologous recombination using a vector for chromosomal insertion or genome editing using engineered nuclease (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation, but is not limited thereto, and may be performed using a method known in the art.

[0058]

[0059] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and microorganisms that have undergone genetic modification naturally or artificially, and may be a microorganism that has a specific mechanism weakened or strengthened due to causes such as insertion of an external gene or enhanced or inactivated activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein or product.

[0060] The microorganism of the present application may be a microorganism with reduced citrate synthase activity for the purpose of the present application.

[0061] The microorganism of the present application may be, but is not limited to, a microorganism comprising at least one of a polynucleotide encoding a citrate synthase of the present application and a vector comprising the polynucleotide; a microorganism modified to express a polynucleotide encoding a citrate synthase of the present application; a microorganism (e.g., a recombinant strain) expressing a polynucleotide encoding a citrate synthase of the present application; or a microorganism (e.g., a recombinant strain) having reduced citrate synthase activity of the present application.

[0062] The microorganism of the present application may be a strain having the ability to produce L-threonine or L-homoserine.

[0063] "L-threonine" and "L-homoserine" in the present application both correspond to L-aspartate series amino acids and their precursors. L-homoserine is a precursor of L-threonine and is converted into L-threonine by homoserine kinase and threonine synthase.

[0064] The microorganism of the present application is a cell or microorganism that expresses the citrate synthase of the present application by replacing a polynucleotide encoding an endogenous citrate synthase with a polynucleotide encoding the citrate synthase of the present application. For the purpose of the present application, the microorganism of the present application may include all microorganisms capable of producing L-threonine or L-homoserine, including the citrate synthase of the present application. For example, the microorganism of the present application may be a recombinant strain in which the polynucleotide encoding an endogenous citrate synthase on the chromosome of a natural wild-type microorganism or a microorganism producing L-threonine or L-homoserine is replaced with a polynucleotide encoding the citrate synthase of the present application, thereby increasing the ability to produce L-threonine or L-homoserine. The recombinant strain having increased L-threonine or L-homoserine production ability may be a microorganism having increased L-threonine or L-homoserine production ability compared to a natural wild-type microorganism or an unmodified microorganism, but is not limited thereto. The wild-type microorganism or unmodified microorganism may be, but is not limited to, the ATCC13032 strain or the KCCM12120P strain.

[0065] For example, the recombinant strain with increased productivity may have an L-threonine or L-homoserine productivity increased by about 1% or more, 5% or more, 7% or more, about 10% or more, about 20% or more, or about 30% or more (the upper limit is not particularly limited, and may be, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, about 40% or less, or about 30% or less) compared to the parent strain or the non-modified microorganism before mutation, but is not limited thereto as long as it has a positive increase compared to the productivity of the parent strain or the non-modified microorganism before mutation. In another example, the recombinant strain with increased productivity may have an increased L-threonine or L-homoserine productivity of about 1.01 times or more, about 1.05 times or more, about 1.07 times or more, about 1.1 times or more, about 1.2 times or more, or about 1.3 times or more (the upper limit is not particularly limited and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less) compared to the parent strain before mutation or the unmodified microorganism.

[0066] The term “about” above includes all ranges including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all ranges of values ​​equal to or similar to the value following the term “about,” but is not limited thereto.

[0067] The term "unmodified microorganism" in this application does not exclude strains that contain mutations that can occur naturally in microorganisms, and may refer to wild-type strains or natural strains themselves, or strains before their characteristics are changed by genetic mutations caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain that has not been introduced or before the protein variant described herein is introduced. The "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmutated strain," "unmodified microorganism," or "reference microorganism."

[0068] As another example of the present application, the microorganism of the present application may be a microorganism of the genus Corynebacterium, and specifically, Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes ammoniagenes), Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens, and more specifically, but not limited to, Corynebacterium glutamicum.

[0069]

[0070] Another aspect of the present application provides a method for producing L-threonine or L-homoserine, comprising a step of culturing the microorganism of the present application in a medium.

[0071] In this application, the term "cultivation" refers to growing a Corynebacterium microorganism of this application under appropriately controlled environmental conditions. The culturing process of this application can be performed using any suitable medium and culture conditions known in the art. Such culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0072] In this application, the term "medium" means a material containing nutrients as a main component necessary for culturing the Corynebacterium microorganism of this application, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the Corynebacterium microorganism of this application may be any medium used for culturing general microorganisms without particular limitation, but the Corynebacterium microorganism of this application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0073] Specifically, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0074] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0075] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0076] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0077] In addition, during the cultivation of the Corynebacterium glutamicum strain of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0078] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0079] L-threonine or L-homoserine produced by the culture of the present invention may be secreted into the medium or remain within the cells.

[0080] The method for producing L-threonine or L-homoserine of the present application may additionally include a step of recovering L-threonine or L-homoserine from the cultured microorganism, a culture of the microorganism, a fermented product of the microorganism, or the culture medium.

[0081] The above recovery may be performed by collecting the target L-threonine or L-homoserine using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallizing protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target L-threonine or L-homoserine may be recovered from the medium or microorganism using a suitable method known in the art.

[0082] In the method of the present application, microorganisms, etc. are as described in the other aspects above.

[0083]

[0084] Another aspect of the present application provides a composition for producing L-threonine or L-homoserine, comprising the microorganism of the present application or a culture of the microorganism.

[0085] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing amino acids, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0086] In the composition of the present application, microorganisms, etc. are as described in the other aspects above.

[0087]

[0088] Another aspect of the present application provides a use of the microorganism of the present application for producing L-threonine or L-homoserine.

[0089]

[0090] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.

[0091]

[0092] Example 1: Construction of a recombinant vector for introducing a mutation that reduces the activity of citrate synthase in a microorganism.

[0093] To introduce a mutation that reduces citrate synthase activity in microorganisms, a vector was constructed in which the start codon of the gltA gene encoding citrate synthase was substituted from ATG to GTG.

[0094] Specifically, based on information about the gltA gene and surrounding base sequence of Corynebacterium glutamicum ATCC13032 strain, PCR was performed using the ATCC13032 strain genomic DNA as a template using the primer pair of SEQ ID NO: 4 and SEQ ID NO: 5.

[0095] PfuUltraTM high-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and denaturation, annealing, and polymerization under these conditions were repeated 28 times. As a result, a 1714 bp DNA fragment was obtained. The obtained DNA product was purified using a PCR purification kit (PCR Purification kit, QUIAGEN), and the purified amplified product was treated with the restriction enzyme smaI, and then heat-treated at 65°C for 20 minutes. The pDC24 vector (SEQ ID NO: 6) was cloned according to the provided manual using an Infusion Cloning Kit (TaKaRa) to construct a vector for target gene replacement, pDC24△gltA::gltA(a1g).

[0096] The primer sequences used to perform each of the above PCRs are as shown in Table 1 below.

[0097]

[0098] Sequence number Primer sequence 4 Primer 1 TTCGAGCTCGGTACCCGTTTTTTTCCGAACAAATGTGTTTGAAAGGGATATC5 Primer 2 GTCGACTCTAGAGGATCCCCCTCTTGCCAACCTGCAATGA

[0099]

[0100] Example 2: Production of microorganisms with reduced citrate synthase activity and evaluation of L-threonine production ability

[0101] Example 2-1. Production of microorganisms introducing mutations with reduced citrate synthase activity

[0102] The vector produced in Example 1 was transformed into Corynebacterium glutamicum KCCM12120P (US 11236374 B2), a threonine-producing strain, by electroporation, and a strain in which the start codon of gltA was substituted from ATG to GTG as desired was selected and named CJP1-gltA(a1g).

[0103]

[0104] Example 2-2. Evaluation of L-threonine production by microorganisms with reduced citrate synthase activity.

[0105] To confirm the L-threonine production ability of the strain produced above, it was cultured using the following method.

[0106]

[0107] First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 32°C for 24 hours with shaking at 200 rpm.

[0108]

[0109] <Seed medium (pH 7.0)>

[0110] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 2000 μg (based on 1 liter of distilled water)

[0111]

[0112] <Production medium (pH 7.2)>

[0113] Glucose 30g, KH2PO42g, Urea 3g, (NH4)2SO440g, Peptone 2.5g, CSL(Sigma) 5g(10 ml), MgSO4.7H2O 0.5g, Leucine 400mg, CaCO320g (based on 1 liter of distilled water)

[0114]

[0115] After the culture was completed, the amount of L-threonine produced was measured using high-performance liquid chromatography (HPLC), and the concentration is shown in Table 2 below.

[0116]

[0117] Strain name OD 562 Threonine concentration (g / L) Yield improvement compared to parent strain (%) KCCM12120P78.41.35100CJP1-gltA(a1g)[KCCM12120P△gltA::gltA(a1g)]70.21.68124

[0118] As shown in Table 2 above, the parent strain, Corynebacterium glutamicum KCCM12120P, was confirmed to produce approximately 1.35 g / L of threonine. CJP1-gltA(a1g) was confirmed to produce approximately 1.68 g / L of threonine, showing an approximately 24% increase in productivity compared to the parent strain.

[0119] The above results confirmed that the strain with reduced expression of citrate synthase could produce L-threonine more efficiently than the parent strain.

[0120]

[0121] Example 3: Evaluation of L-homoserine production by microorganisms with reduced citrate synthase activity

[0122] In order to confirm the L-homoserine production ability of strain CJP1-gltA (a1g) produced in Example 2 above, it was cultured using the following method.

[0123]

[0124] After inoculating the parent strain and the mutant strain into a 250 ml corner-bottom flask containing 25 ml of production medium, the culture was shaken at 200 rpm for 24 hours at 32°C.

[0125]

[0126] <Production medium>

[0127] (pH 7.2) Glucose 30g, (NH4)2SO4 20g, MgSO4·7H2O 1.2g, KH2PO4 1.1g, Biotin 900㎍, Thiamine Hydrochloride 4500㎍, Calcium-Pantothenic Acid 4500㎍, CaCO3 30g (based on 1 liter of distilled water)

[0128]

[0129] After the culture was completed, the amount of L-homoserine produced was measured using high-performance liquid chromatography (HPLC), and the concentration is shown in Table 3 below.

[0130]

[0131] Strain name OD 562 Homoserine concentration (g / L) Yield improvement compared to parent strain (%) KCCM12120P80.50.37100CJP1-gltA(a1g)[KCCM12120P△gltA::gltA(a1g)]76.30.42114

[0132] As a result, as shown in Table 3 above, it was confirmed that the parent strain, Corynebacterium glutamicum KCCM12120P, produced approximately 0.37 g / L of L-homoserine. CJP1-gltA(a1g) produced approximately 0.42 g / L of L-homoserine, showing an increase in productivity of approximately 14% compared to the parent strain.

[0133] The above results confirmed that the strain with reduced expression of citrate synthase could produce L-homoserine more efficiently than the parent strain.

[0134]

[0135] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A microorganism of the genus Corynebacterium that produces L-threonine or L-homoserine and has reduced citrate synthase activity.

2. A microorganism of the genus Corynebacterium, wherein the initiation codon of a polynucleotide encoding citrate synthase in the microorganism is substituted with GTG.

3. A microorganism of the genus Corynebacterium, wherein the polynucleotide encoding the citrate synthase before substitution comprises a base sequence of sequence number 2.

4. In the first paragraph, the microorganism is a Corynebacterium microorganism having increased L-threonine or L-homoserine production ability compared to a Corynebacterium microorganism having no decreased citrate synthase activity.

5. In paragraph 1, the microorganism is a microorganism of the genus Corynebacterium, which is Corynebacterium glutamicum.

6. A method for producing L-threonine or L-homoserine, comprising a step of culturing a microorganism according to any one of claims 1 to 5 in a medium.

7. A production method according to claim 6, further comprising a step of recovering L-threonine or L-homoserine from the cultured microorganism, a culture of the microorganism, a fermented product of the microorganism, or the culture medium.

8. A composition for producing L-threonine or L-homoserine, comprising a microorganism according to any one of claims 1 to 5, or a culture of the microorganism.

9. Use of a microorganism according to any one of claims 1 to 5 for producing L-threonine or L-homoserine.

Citation Information

Patent Citations

  • Modified polypeptide with attenuated activity of citrate synthase and a method for producing L-amino acid using the same

    KR101915433B1

  • Corynebacterium glutamicum variant having improved l-lysine production ability, and method for producing l-lysine using same

    WO2022050524A1