Barcode-based method for screening neoantigen immunogenicity

The novel barcode-based method for neoantigen screening addresses the complexity and cost issues of existing methods by using dual barcode sequences to efficiently identify immunogenic neoantigens, improving accuracy and simplifying the process.

WO2025116698A1PCT designated stage expired Publication Date: 2025-06-05THERAGEN BIO CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/096516
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-20
Filing Date
2024-11-13
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

Current neoantigen screening methods are complex, time-consuming, and costly, with low accuracy in predicting immunogenicity, and often require expensive peptide synthesis and complex PCR processes.

Method used

A novel method using a combination of two barcode sequences per neoantigen coding sequence for efficient selection of immunogenic neoantigens, involving amplification, transcription, and expression of DNA templates specific to each barcode sequence, to identify neoantigens exhibiting immunogenicity.

Benefits of technology

This method allows for the efficient screening of multiple neoantigen candidates, simplifying the process and improving accuracy, enabling the identification of immunogenic neoantigens with enhanced specificity and sensitivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024096516_05062025_PF_FP_ABST
    Figure KR2024096516_05062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a method for screening neoantigens having immunogenicity and, more specifically, to a method for screening neoantigens, comprising the steps of: screening an effective DNA template group exhibiting immunogenicity, by first-barcode-sequence-specific amplification, transcription, and expression of a plurality of DNA templates each including a first barcode sequence, a second barcode sequence, and a neoantigen-coding sequence; and screening neoantigens exhibiting immunogenicity, by second-barcode-sequence-specific amplification, transcription, and expression of the effective DNA template group, and thus the method enables more efficient screening of neoantigens.
Need to check novelty before this filing date? Find Prior Art

Description

Barcode-based neoantigen immunogenicity screening method

[0001] The present invention relates to a novel method for screening for a new antigen having immunogenicity.

[0002]

[0003] Cancer is a disease that occurs when cells lose their normal regulatory mechanisms, leading to abnormal growth and excessive proliferation. Currently, the most common cancer treatments include surgery, radiation therapy, and chemotherapy. Combinations of these methods are sometimes used to improve efficacy and minimize side effects. Chemotherapy, for example, involves administering anticancer drugs systemically to destroy and inhibit rapidly proliferating cancer cells. Systemic administration of anticancer drugs can affect both cancer cells and normal cells, leading to various side effects such as nausea, vomiting, diarrhea, neuralgia, hair loss, bone marrow suppression, muscle pain, neuropathy, nephrotoxicity, and neurasthenia.

[0004] To improve the side effects of existing anticancer drugs and enhance the effectiveness of cancer treatment, research is ongoing to develop targeted therapies. Targeted therapies are drugs designed to attack cancer cells while sparing normal cells. They are characterized by targeting cancer-specific proteins that are absent in normal cells. Numerous new targeted therapies are currently being developed and are being applied in clinical practice. These targeted therapies enable personalized treatment based on an individual's cancer cell targets. To achieve personalized treatment using targeted therapies, it is necessary to first identify the specific cancer cell targets of each patient.

[0005] Meanwhile, "neoantigens" refer to new proteins or peptides formed in cancer cells when mutations occur in their DNA. These neoantigens are mutant proteins not found in normal cells, making them cancer-specific antigens and thus potential targets for targeted therapies. However, cancer cell DNA can harbor hundreds of mutations, some of which are expressed as mutant proteins. Of these, only a very small number are recognized as antigens by immune cells.

[0006] Targeted therapy using neoantigens requires first identifying the target neoantigen. Currently, strategies for selecting neoantigens utilize various algorithms to predict peptide sequences that will be presented on the surface of antigen-presenting cells based on mutations. However, these algorithms have low accuracy compared to actual biological outcomes, and the probability that predicted peptide sequences will actually induce immunogenicity is very low. Various approaches have been reported to screen antigens or neoantigens for immunogenicity, including screening the entire coding region using cDNA libraries or using HLA multimer assays that match each peptide. However, these methods still have technical and cost limitations.

[0007] Specifically, the existing neoantigen screening method requires expensive peptide synthesis, and problems such as the exclusion of candidate neoantigens to be screened due to failure of peptide synthesis can occur, and the production of minigenes requires a complex three-step PCR. Furthermore, when screening in a tandem minigene format where 10 minigenes are arranged per barcode, samples that result in a positive screening result must be individually screened again using peptides, etc. for the 10 epitopes contained in the sample. As such, the existing neoantigen screening process is complex and time-consuming, and therefore, the development of new technologies that can perform the neoantigen screening process more accurately and efficiently is necessary.

[0008] Accordingly, the inventors of the present invention completed the present invention by confirming that efficient selection of immunogenic neoantigens is possible by utilizing a combination of two barcode sequences per neoantigen coding sequence while studying a technique for selecting immunogenic neoantigens.

[0009]

[0010] The present invention aims to provide a novel method for screening for a new antigen having immunogenicity.

[0011]

[0012] 1. A method for screening a neoantigen, comprising: a step of selecting a group of effective DNA templates exhibiting immunogenicity by amplifying, transcribing, and expressing a plurality of DNA templates each including a first barcode sequence, a second barcode sequence, and a neoantigen coding sequence in a manner specific to the first barcode sequence; and a step of specifying a neoantigen exhibiting immunogenicity by amplifying, transcribing, and expressing the group of effective DNA templates in a manner specific to the second barcode sequence.

[0013] 2. A method for screening a new antigen, wherein in the above 1, the first barcode sequence is any one sequence selected from a group consisting of n oligonucleotides that specifically bind to n different primers (n is an integer of 2 or more).

[0014] 3. A method for screening a new antigen, wherein in the above 1, the second barcode sequence is different from the first barcode sequence and is any one sequence selected from a group consisting of m oligonucleotides that specifically bind to m different primers (m is an integer of 2 or more).

[0015] 4. A method for screening a new antigen in the above 1, wherein the first barcode sequence or the second barcode sequence comprises 5 to 50 nucleotides.

[0016] 5. A method for screening a new antigen, wherein the step of selecting the effective DNA template group in the above 1 comprises: a first step of amplifying the plurality of DNA templates with primers specific to the first barcode sequence to produce a first barcode-based DNA pool; a second step of transcribing the DNAs to produce a first barcode-based mRNA pool; and a third step of expressing the mRNAs to derive the effective DNA template group exhibiting immune cell-specific immunogenicity.

[0017] 6. A method for screening a new antigen, wherein the step of specifying the new antigen in the above 1 comprises: step A of amplifying each of the valid DNA template groups with primers specific to the second barcode sequence to produce a second barcode-based DNA pool; step B of transcribing each of the DNAs to produce a second barcode-based mRNA pool; and step C of expressing each of the mRNAs to derive a new antigen exhibiting immune cell-specific immunogenicity.

[0018] 7. A method for screening a new antigen, wherein in the above 1, the amplification is performed through one or more methods selected from the group consisting of PCR (polymerase chain reaction), nested PCR, multiplex PCR, micro PCR, and real-time PCR.

[0019] 8. A method for screening a new antigen, wherein the transcription in the above 1 is performed through IVT (in vitro transcription).

[0020] 9. A method for screening a new antigen, wherein in the above 1, the selection of a group of effective DNA templates exhibiting immunogenicity or the identification of a new antigen exhibiting immunogenicity is performed through one or more methods selected from the group consisting of Enzyme-Linked ImmunoSpot (ELISpot) Assay, Intracellular Cytokine Staining (ICS) Assay, Cytokine Bead Array (CBA), and T cell receptor sequencing (TCRseq).

[0021] 10. A method for screening a new antigen, wherein in the above 1, the plurality of DNA templates have the second barcode sequence linked to the 3' end of the first barcode sequence, and the new antigen coding sequence is linked so as to be amplifiable by a primer linked to the first barcode sequence or the second barcode sequence.

[0022] 11. A DNA template set for screening a neoantigen, comprising a plurality of DNA templates each including a first barcode sequence, a second barcode sequence, and a neoantigen coding sequence, wherein the first barcode sequence is any one sequence selected from a group consisting of n oligonucleotides that specifically bind to n different primers (n is an integer of 2 or more), and the second barcode sequence is any one sequence selected from a group consisting of m oligonucleotides that are different from the first barcode sequence and that specifically bind to m different primers (m is an integer of 2 or more).

[0023] 12. A DNA template set for screening a new antigen, wherein the first barcode sequence or the second barcode sequence comprises 5 to 50 nucleotides in the above 11.

[0024] 13. In the above 11, the plurality of DNA templates are connected to the 3' end of the first barcode sequence with the second barcode sequence, and the new antigen coding sequence is connected so as to be amplifiable by a primer bound to the first barcode sequence or the second barcode sequence, a DNA template set for screening a new antigen.

[0025]

[0026] The present invention provides a novel neoantigen screening method for selecting neoantigens having immunogenicity.

[0027] The present invention provides a novel set of DNA templates used in screening for new antigens having immunogenicity.

[0028] The novel antigen screening method of the present invention can efficiently select a novel antigen having immunogenicity.

[0029] The novel antigen screening method of the present invention can screen more than 100 novel antigen candidates at once in a simplified procedure by linking two types of barcodes to one candidate novel antigen.

[0030]

[0031] Figures 1a and 1b are schematic diagrams showing the new antigen screening process of the present invention.

[0032] Figure 2 schematically illustrates a DNA template design consisting of two barcode sequences, a T7 promoter, a 5' untranslated region (UTR), a Kozak sequence, an open reading frame (ORF) containing one neoantigen coding sequence, and a 3' UTR, sequentially.

[0033] Figures 3a and 3b are schematic diagrams showing the PCR method used to produce an IVT template in the present invention.

[0034] Figure 4 is an example of designing 100 candidate new antigens using DNA template design, showing a total of 100 minigenes produced by combining alphabetic naming barcodes A to J and numeric naming barcodes 1 to 10.

[0035] Figure 5 is a table showing the selection of positive neoantigens through primary selection screening and secondary specific (confirmatory) screening using the screening method of the present invention. Specifically, it shows that the primary selection screening is performed using alphabetically named barcode sequences to select immunogenic barcode groups A, D, and H as valid DNA template groups, and the selected groups are subjected to secondary screening using numerically named barcode sequences to ultimately confirm neoantigens linked to barcodes A1 and D5, which are single antigens with immunogenicity.

[0036] Figures 6a to 6c illustrate the process of confirming the production of a barcode sequence-specific minigene pool through PCR. Figure 6a is a simplified schematic diagram of the PCR process using a primer binding to barcode A and a common primer, and Figures 6b and 6c illustrate the results of performing nested PCR on a PCR product amplified with barcode A using barcodes 1 to 10, followed by confirmation by agarose gel electrophoresis.

[0037] Figures 7a and 7b show the results of the primary screening, in which HLA-A*02:01-overexpressing K562 cell lines or autologous CD40 act B cells were co-cultured on ELISpots coated with INF-gamma to confirm the immunogenicity against HLA-A*02:01-specific antigens targeting activated T cells.

[0038] Figures 8a to 8e show the results of the second screening, in which the immunogenicity for the HLA-A*02:01-specific antigen was finally confirmed by co-culturing the K562 cell line overexpressing HLA-A*02:01 with the group selected in the first screening on an ELISpot coated with INF-gamma.

[0039] Figures 9a and 9b show the ELISpot results verifying the new antigen produced through CTL induction based on a single minigene to confirm the specificity of the screening method of the present invention.

[0040] Figures 10a and 10b show the results of the CTL induction step to improve the sensitivity of the screening method of the present invention, comparing the group treated with anti-CTLA-4 antibody in the culture medium and the group not treated with Naive CD8. + T cells and Total CD8 + This shows the ELISpot results comparing the degree of response of T cell groups.

[0041] Figures 11a and 11b show the results of co-culturing K562 cell lines overexpressing HLA-A*02:01 or HLA-A*11:01 on ELISpots coated with INF-gamma under conditions that improve the sensitivity of the screening method of the present invention, thereby producing D1, a single antigen having immunogenicity against an antigen specific to HLA-A*02:01, and I7, a single antigen having immunogenicity against an antigen specific to HLA-A*11:01.

[0042]

[0043] The present invention provides a novel method for screening for new antigens having immunogenicity.

[0044] The present invention provides a method for screening a neoantigen, which can more efficiently screen a neoantigen, by including a step of selecting a group of effective DNA templates exhibiting immunogenicity by amplifying, transcribing, and expressing a plurality of DNA templates each including a first barcode sequence, a second barcode sequence, and a neoantigen coding sequence in a first barcode sequence-specific manner; and a step of specifying a group of effective DNA templates exhibiting immunogenicity by amplifying, transcribing, and expressing a second barcode sequence-specific manner, respectively.

[0045] The screening method of the present invention provides a method for efficiently screening several tens to several hundred candidate neoantigens predicted by an algorithm in the screening of neoantigens with immunogenicity, which is the biggest challenge in the process of developing a neoantigen-based therapeutic agent.

[0046] The novel antigen screening method of the present invention can select novel antigens through a simplified procedure by linking two types of barcodes to one candidate novel antigen.

[0047] The screening method of the present invention is largely divided into two parts (see Figs. 1a and 1b). Part 1 includes the steps of designing a DNA template to include two barcode sequences for each candidate neoantigen, amplifying the DNA template using the PCR method of the present invention to produce a DNA pool, and producing an mRNA pool from the DNA pool. Part 2 includes the steps of isolating T cells and B cells from donated blood to confirm whether the candidate neoantigen has actual immunogenicity, injecting mRNA and co-stimulatory factors into B cells after a 5-day maturation process to produce antigen-presenting cells, co-culturing the antigen-presenting cells and T cells, and then confirming the degree of interferon-gamma detection by the T cells. The screening method of the present invention includes the steps of performing the first barcode and the second barcode respectively in Part 1, and performing screening using each barcode once to select a single neoantigen in Part 2.

[0048] A "neoantigen" is a new peptide formed in cancer cells when a mutation occurs in tumor DNA. It is a mutant protein not found in normal cells and can become a cancer-specific antigen. Neoantigen peptides are presented on the surface of antigen-presenting cells in a form bound to MHC molecules (pMHC), and T cells recognize them, inducing immunogenicity. To discover neoantigens that can serve as therapeutic targets, it is necessary to predict the peptide sequence (epitope) that will be presented on the surface of antigen-presenting cells upon binding to MHC, and to verify whether the predicted epitope is immunogenic.

[0049] In the present invention, “new antigen coding sequence” means a base sequence encoding a new antigen.

[0050] The term "minigene" refers to a small-sized gene that contains the coding region and control region essential for gene expression in the same manner as a wild-type gene. In one embodiment of the present invention, a minigene may be a sequence encoding a neoantigen.

[0051] In the present invention, “DNA template” means a single-stranded antisense DNA each including a first barcode sequence, a second barcode sequence, and a new antigen coding sequence, and is used as a template when producing a DNA pool through PCR.

[0052] Antigen-presenting cells (APCs) are a type of immune cell that enhances the immune response by presenting antigens on their surface. Representative examples of APCs include dendritic cells, macrophages, and B cells. APCs can present antigenic peptides via major histocompatibility complex (MHC) molecules, and T cells recognize these presented peptides and become activated, initiating an adaptive immune response.

[0053] Cytotoxic T lymphocytes (CTLs) are a type of lymphocyte and an important component of the adaptive immune system, and are CD8 + Also referred to as T cells, cytotoxic T lymphocytes play a crucial role in the immune response by killing intracellular pathogens such as viruses or bacteria, as well as cancer cells. CTL induction refers to the activation and proliferation of CTLs by recognizing peptides presented by MHC molecules.

[0054] "Immunogenicity" refers to the property of causing an immune response when a foreign substance such as an antigen is introduced into the body of a human or animal. Methods for measuring immunogenicity include Enzyme-Linked ImmunoSpot (ELISpot) Assay, Intracellular Cytokine Staining (ICS) Assay, Cytokine Bead Array (CBA), etc. In one embodiment of the present invention, immunogenicity was confirmed by performing ELISpot, but the present invention is not limited thereto.

[0055] "ELISpot" is a test method for assessing cellular immunogenicity. It is a highly sensitive immunoassay that can measure cytokine-secreting immune cells in response to a specific antigen at the cellular level. ELISpot is used in research on immune responses in cancer, allergies, and autoimmune diseases, as well as in the discovery of new vaccine candidates. In particular, CD8 + When trying to confirm the cytotoxicity of T cells, ELISpot measurement using a type of cytokine, interferon-γ (IFNγ) or tumor necrosis factor (TNF-a), or both cytokines simultaneously can be used.

[0056] The screening method of the present invention can select a new antigen by confirming immunogenicity targeting all types of human leukocyte antigens (HLA).

[0057] In one embodiment, the immunogenicity of the neoantigen is confirmed using a cell line obtained using donated blood corresponding to HLA-A*02:01 or HLA-A*11:01, but is not limited thereto.

[0058] The term "barcode" refers to an oligonucleotide having a nucleotide sequence to which a primer can complementarily bind, which specifies a candidate for a new antigen, and is used to distinguish DNA templates from each other in the method for screening new antigens of the present invention.

[0059] The barcode can be produced using known techniques, and the specific base sequence and length of the barcode of the present invention are not particularly limited.

[0060] In one embodiment, the sequence of the barcode was selected from among the barcodes generated using a barcode generator, which had a Tm (melting temperature) value of 54°C or higher and 56°C or lower, did not have three consecutive nucleotides in the barcode sequence, and did not have a predicted hairpin structure in the barcode. Finally, a barcode set was formed using multiple barcodes having the same length and Tm value, but the present invention is not limited thereto.

[0061] The term "barcode set" refers to a group of multiple barcodes. In one embodiment, two barcode sets, each containing 10 barcodes, were used to screen 100 candidate neoantigens, but this is not a limitation.

[0062] In one embodiment, two types of barcode sets may be used to screen for new antigens, and the two types of barcode sets may be composed of different pluralities of oligonucleotides.

[0063] In one embodiment, the two types of barcode sets may be named alphabetic naming barcodes and numeric naming barcodes, respectively.

[0064] In one embodiment, the two types of barcode sets may be named a first barcode sequence and a second barcode sequence, respectively.

[0065] In one embodiment, a barcode set having the sequence shown in Table 1 below is constructed, but is not limited thereto.

[0066] No. Classification Barcode Name Sequence Tm Value Length 1 Alphabet Naming Barcode Barcode-AGAGAAGCGCACGTACCACTA (SEQ ID NO: 1) 55℃20 mer2 Barcode-BAGGACCAACAAGCGCGTAAC (SEQ ID NO: 2) 55℃20 mer3 Barcode-CTGGCACGAATGGTTAGGCAG (SEQ ID NO: 3) 55℃20 mer4 Barcode-DGTCCTGACGAACGCATGACC (SEQ ID NO: 4) 55℃20 mer5 Barcode-ETGTCCTGCAGCCTCGATCTT (SEQ ID NO: 5) 55℃20 mer6 Barcode-FCGAACTGGACGCCTCGGATA (SEQ ID NO: 6) 55℃20 mer7 Barcode-GGCCGAGTAGCCAGCATTCTT (SEQ ID NO: 7) 55℃20 mer8 Barcode-HCCACCTCGTTCCAGACTTCG (SEQ ID NO: 8) 55℃20 mer9 Barcode-IGTGATGCGGCGACACTAAGT (SEQ ID NO: 9) 55℃20 mer10 Barcode-JATAACCGGCGCATTACCACG (SEQ ID NO: 10) 55℃20 mer11 Number naming barcode Barcode-1TCGAGTCTGCCAGGTTACGA (SEQ ID NO: 11) 55℃20 mer12 Barcode-2ACGAGAGATCCTGCGGCTTA (SEQ ID NO: 12) 55℃20 mer13 Barcode-3TGTGGCTTGTACCGTGTTCA (SEQ ID NO: 13) 55℃20 mer14 Barcode-4CATAGACTGCAGACTCCGCG (SEQ ID NO: 14) 55℃20 mer15 Barcode-5GTACCGCCAGCCATCTAACG (SEQ ID NO: 15) 55℃20 mer16 Barcode-6TCAGGAGAAGGCGCTAACCA (SEQ ID NO: 16)55℃20 mer17Barcode-7GCCATCGGACTTGCCTAGAA (SEQ ID NO: 17)55℃20 mer18Barcode-8CGTCTGAGCAAGGCACGTAG (SEQ ID NO: 18)55℃20 mer19Barcode-9GCCGGCAATGTGAGCTCTAT (SEQ ID NO: 19)55℃20mer20Barcode-10GTGTCTATTGGTGCGTGGCC (SEQ ID NO: 20)55℃20 mer

[0067]

[0068] The present invention provides a method for screening a new antigen, wherein the first barcode sequence is any one sequence selected from a group consisting of n oligonucleotides that specifically bind to n different primers (n is an integer of 2 or more).

[0069] The present invention provides a method for screening a new antigen, wherein the second barcode sequence is different from the first barcode sequence and is any one sequence selected from a group consisting of m oligonucleotides that specifically bind to m different primers (m is an integer of 2 or more).

[0070] “The second barcode sequence is different from the first barcode sequence” means that the n oligonucleotides included in the first barcode sequence and the m oligonucleotides included in the second barcode sequence are different from each other.

[0071] The numbers n and m may vary depending on the number of candidate neoantigens being screened.

[0072] The present invention provides a method for screening a new antigen, wherein the first barcode sequence or the second barcode sequence comprises 5 to 50 nucleotides.

[0073] The length of the barcode sequence may vary depending on several factors, including the number of neoantigen candidates to be screened, the length of the DNA that serves as a template for amplification, and PCR conditions.

[0074] For example, the barcode of the present invention may have 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more, 34 or more, 35 or more, 36 or more, 37 or more, 38 or more, 39 or more, 40 or more, 41 It may be composed of 42 or more, 43 or more, 44 or more, or 45 or more nucleotides.

[0075] For example, the barcode of the present invention may have 50 or less, 49 or less, 48 ​​or less, 47 or less, 46 or less, 45 or less, 44 or less, 43 or less, 42 or less, 41 or less, 40 or less, 39 or less, 38 or less, 37 or less, 36 or less, 35 or less, 34 or less, 33 or less, 32 or less, 31 or less, 30 or less, 29 or less, 28 or less, 27 or less, 26 or less, 25 or less, 24 or less, 23 or less, 22 or less, 21 or less, 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less, 14 or less, 13 or less, 12 or less, It may consist of 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, or 5 or fewer nucleotides.

[0076] In one embodiment, the barcode is comprised of, but is not limited to, 10 to 20 nucleotides.

[0077] The present invention provides a method for screening for a new antigen, wherein the step of selecting a group of effective DNA templates comprises a first step of amplifying a plurality of DNA templates with primers specific to a first barcode sequence to produce a first barcode-based DNA pool; a second step of transcribing the DNAs to produce a first barcode-based mRNA pool; and a third step of expressing the mRNAs to derive a group of effective DNA templates exhibiting immune cell-specific immunogenicity.

[0078] “First barcode-based DNA pool” means a pool created by amplifying a DNA template using a primer that binds complementarily to the first barcode sequence.

[0079] “First barcode-based mRNA pool” means an mRNA pool created by transcribing DNA of the first barcode-based DNA pool.

[0080] “Valid DNA template group” means a group that has been confirmed to have immunogenicity as a result of confirming immunogenicity by expressing the first barcode-based mRNA pool in antigen-presenting cells.

[0081] In one embodiment, the “third step” may be a step of injecting mRNA into antigen-presenting cells to express the mRNA, co-culturing the antigen-presenting cells with the peptides presented on the cell surface and T cells, and then determining the degree of interferon-gamma detection in the activated T cells to derive a group of effective DNA templates that exhibit immunogenicity.

[0082] The present invention provides a method for screening for a new antigen, wherein the step of specifying a new antigen comprises: step A of amplifying a group of valid DNA templates with primers specific to a second barcode sequence to produce a second barcode-based DNA pool; step B of transcribing the DNAs to produce a second barcode-based mRNA pool; and step C of expressing the mRNAs to derive a new antigen exhibiting immune cell-specific immunogenicity.

[0083] “Second barcode-based DNA pool” means a pool created by amplifying a DNA template using a primer that binds complementarily to the second barcode sequence.

[0084] “Second barcode-based mRNA pool” means an mRNA pool created by transcribing DNA of a second barcode-based DNA pool.

[0085] “A new antigen exhibiting immune cell-specific immunogenicity” refers to a single new antigen exhibiting immunogenicity that is finally selected through a secondary screening targeting a group of effective DNA templates selected in the step of selecting the above-mentioned group of effective DNA templates.

[0086] In one embodiment, the "C step" may be a step of injecting mRNA into antigen-presenting cells to express it, co-culturing the antigen-presenting cells with peptides presented on the cell surface and T cells, and then determining the degree of interferon-gamma detection in the activated T cells to derive a new antigen that exhibits immunogenicity.

[0087] The present invention provides a method for screening a new antigen, wherein the amplification is performed through one or more methods selected from the group consisting of PCR (polymerase chain reaction), nested PCR, multiplex PCR, micro PCR, and real-time PCR.

[0088] The present invention provides a method for screening a new antigen, wherein the transcription is performed through IVT (in vitro transcription).

[0089] The present invention provides a method for screening a neoantigen, wherein the selection of a group of effective DNA templates exhibiting immunogenicity or the identification of a neoantigen exhibiting immunogenicity is performed through one or more methods selected from the group consisting of a cytokine detection method exhibiting a T cell response, such as an Enzyme-Linked ImmunoSpot (ELISpot) Assay, an Intracellular Cytokine Staining (ICS) Assay, and a Cytokine Bead Array (CBA), and T cell receptor sequencing (TCRseq).

[0090] "Amplification" refers to creating copies of a DNA fragment in a laboratory using a method such as polymerase chain reaction (PCR). In one embodiment, amplification is performed via PCR, but is not limited thereto. PCR reaction conditions may be standard or appropriately modified, depending on the type of PCR, the type of PCR instrument, and the type of primers.

[0091] "Transcription" refers to the process by which mRNA is synthesized from template DNA. In one embodiment, transcription is performed via, but not limited to, in vitro transcription (IVT). IVT refers to a method of synthesizing mRNA in vitro using RNA polymerase, its cofactors, NTPs, and template DNA.

[0092] "Expression" refers to the process of synthesizing protein from mRNA. In one embodiment, expression is achieved intracellularly by injecting mRNA into an antigen-presenting cell, but is not limited thereto.

[0093] The present invention provides a method for screening a new antigen, wherein a plurality of DNA templates have a second barcode sequence linked to the 3' end of a first barcode sequence, and a new antigen coding sequence is linked so as to be amplifiable by a primer linked to the first barcode sequence or the second barcode sequence.

[0094] "Amplifiable linkage" means that the neoantigen coding sequence is functionally linked so that it can be replicated during amplification of the DNA template. Specifically, the first barcode sequence or the second barcode sequence and the neoantigen coding sequence are linked such that a strand complementary to the neoantigen coding sequence can be synthesized starting from a primer that complementarily binds to the barcode sequence, and any additional sequence may be included to achieve this purpose.

[0095] For example, the plurality of DNA templates of the present invention may be a plurality of DNA templates to which a T7 promoter and a Kozak sequence are operably linked for subsequent transcription and expression.

[0096] The present invention provides a set of DNA templates for screening a neoantigen, comprising a plurality of DNA templates each including a first barcode sequence, a second barcode sequence, and a neoantigen coding sequence, wherein the first barcode sequence is any one sequence selected from a group consisting of n oligonucleotides that specifically bind to n different primers (n is an integer of 2 or more), and the second barcode sequence is any one sequence selected from a group consisting of m oligonucleotides that are different from the first barcode sequence and that specifically bind to m different primers (m is an integer of 2 or more).

[0097] “DNA template set for screening new antigens” refers to a configuration of multiple DNA templates that can be used to screen new antigens.

[0098] The present invention provides a set of DNA templates for screening new antigens, wherein the first barcode sequence or the second barcode sequence comprises 5 to 50 nucleotides.

[0099] The present invention provides a set of DNA templates for screening a new antigen, wherein a plurality of DNA templates have a second barcode sequence linked to the 3' end of a first barcode sequence, and a new antigen coding sequence is linked so as to be amplifiable by a primer bound to the first barcode sequence or the second barcode sequence.

[0100] In the DNA template set for screening new antigens of the present invention, the same applies as long as it does not contradict the matters mentioned in the method for screening new antigens of the present invention.

[0101]

[0102] Hereinafter, the present invention will be described in detail by way of examples to specifically explain the present invention.

[0103]

[0104] Example

[0105] Example 1. Design of DNA template

[0106] The DNA template was designed to be a structure capable of in vitro transcription (IVT), sequentially consisting of two barcode sequences, a T7 promoter, a 5' untranslated region (UTR), an open reading frame (ORF) containing a Kozak sequence and an initiation codon, a neoantigen candidate, a stop codon, and a 3' UTR (Fig. 2).

[0107] The two barcode sequences used in the experiment are shown in Table 1, and the specific T7 promoter, 5' UTR, Kozak sequence and start codon, stop codon and 3' UTR used in the experiment are shown in Table 2 below.

[0108] T7 promoter (including capping binding (AG) sequence)GCGAGGTAATACGACTCACTATAAG (SEQ ID NO: 21) 5' UTRGGCCAGTCACCATGGGG (SEQ ID NO: 22) Kozak + start codonGCCACCATGStop 3' UTRTAAgctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaagtccaactactaaactgggggatattatgaagggccttgagcatctggattctgcctaataaaaaacatttattttcattgc (SEQ ID NO: 23)

[0109]

[0110] The fabricated DNA template is single-stranded and corresponds to the antisense strand. The barcode is a site where the forward primer can bind during PCR, and refers to a primer binding site arbitrarily synthesized in the present invention for the purpose of selecting a new antigen.

[0111]

[0112] Example 2. PCR method using multiple oligonucleotides

[0113] To produce templates for performing in vitro transcription (IVT), an efficient PCR method was devised using multiple DNA templates having the design of Example 1 described above as templates. The forward primer used in the PCR of the present invention is a pool-specific primer that can specifically bind to each minigene pool and is a primer that binds to one of two barcode sequences. The reverse primer is a common primer that can bind to all sense strands regardless of the minigene pool. The sequences of the common reverse primers used in the experiments are shown in Table 3 below.

[0114] Common primer (5'->3')tttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt tttttttttttttttttttttttttttttttttttttttttttttttttttttgcaatgaaaataaatgttttttattaggcag (SEQ ID NO: 24)

[0115] Since the DNA template produced in Example 1 is in an antisense form, only the forward primer can bind to the DNA template in the first cycle, and through the first cycle, the complementary strand of the single-stranded DNA template is synthesized, generating a double-stranded PCR product (Fig. 3a). From the subsequent cycles, the double-stranded PCR product is separated into single strands in a high-temperature denaturation step, the forward primer binds to the antisense strand, and the reverse primer containing a poly A tail binds to the sense strand. When the reverse primer binds to the sense strand and the complementary strand is synthesized, a portion complementary to the poly A tail is also synthesized according to the principle of assembly PCR. Therefore, the final obtained PCR product becomes a double-stranded IVT-capable template containing a poly A tail (Fig. 3b).

[0116] This PCR method is simpler than conventional sewing PCR and assembly PCR, and is therefore highly useful in producing IVT templates containing poly A tails.

[0117]

[0118] Example 3. Design of 100 candidate neoantigens using DNA template design.

[0119] In the embodiment of the present invention, the method of assigning barcodes was such that when screening a total of 100 antigens, 10 types of barcodes were used as one set, and a total of two sets of barcodes were randomly synthesized and used for screening.

[0120] The barcode sequence was generated using the existing publicly available barcode generator (https: / github.com / audy / barcode-generator) Python program to generate barcodes of 10 to 20 bp in length. Among the generated barcodes, those with a Tm (melting temperature) value of 54 ° C. or higher and 56 ° C. or lower, without three consecutive nucleotides, and without the predicted hairpin structure in the barcode were selected. Finally, a barcode set was constructed with sequences with the same barcode length and Tm value.

[0121] Individual barcodes included in one set were named with the letters A to J (alphabet-named barcode sequence), and individual barcodes included in another set were named with the numbers 1 to 10 (numeric-named barcode sequence). The specific sequences of each barcode are shown in Table 1.

[0122] According to the aforementioned Example 1, a total of 100 DNA templates were produced by including a combination of one alphabetic naming barcode sequence, one numeric naming barcode sequence, and one neoantigen sequence in each DNA template (Fig. 4). The 100 produced DNA templates are shown in Table 4 below. N represents any nucleotide among A, U, T, and G.

[0123]

[0124]

[0125] Each of the 100 assigned minigenes was custom-made as a library, and the DNA templates were designed to amplify and produce a minigene pool of a defined combination through PCR.

[0126]

[0127] Example 4. Selection process for a single immunogenic neoantigen targeting a neoantigen sequence linked to a barcode.

[0128] In the novel antigen screening method of the present invention, a single novel antigen having immunogenicity can be selected through a total of two screenings.

[0129] First, a primary screening was performed using the alphabet-named barcode sequence (barcodes A to J). Using a forward primer complementary to the alphabet-named barcode sequence, the PCR method of Example 2 was performed to produce a DNA pool, from which an RNA pool was produced by performing IVT, and after activating and expanding antigen-specific T cells to secure target cells, a group with immunogenicity was selected (Fig. 5).

[0130] Afterwards, a secondary screening is performed on the group selected through the primary screening using a number-naming barcode sequence (barcode 1 to 10). Using a forward primer that complementarily binds to the number-naming barcode sequence, the PCR method of Example 2 is performed to produce a DNA pool, and an RNA pool is produced from this by performing IVT, and antigen-specific T cells are activated and expanded to secure target cells, and a single neoantigen with immunogenicity is finally selected (Fig. 5).

[0131]

[0132] Example 5. Confirmation of a DNA pool created through PCR targeting a new antigen sequence linked to a barcode.

[0133] Example 5-1. PCR amplification

[0134] Minigenes containing actual barcode sequences were amplified for each barcode combination from the 100 DNA template composites produced in Example 3. As previously described, the DNA templates consist of an antisense strand, allowing the forward primer to bind complementarily to each barcode sequence, while the reverse primer can bind only to the sense strand of the newly synthesized DNA.

[0135] PCR was performed using a PCR reaction solution containing a single-stranded DNA template in antisense form, a forward primer complementary to the barcode sequence, and a common reverse primer capable of binding to all sense strands regardless of the minigene pool and containing a poly A tail.

[0136] The final PCR product obtained by performing PCR consists of two barcode sequences, a T7 promoter, a 5' UTR, an open reading frame (ORF) containing a neoantigen epitope sequence, a 3' UTR, and a poly A tail, and has a size of approximately 380 bp, although the size may vary depending on the length of the epitope sequence (Fig. 6a).

[0137] Example 5-2. Confirmation of the production of a barcode sequence-specific minigene pool.

[0138] To confirm whether the barcode sequence-specific minigene pool was successfully produced, PCR was performed using the method of Example 2 using a forward primer binding to the sequence corresponding to Barcode-A among the alphabet-named barcode sequences and the common reverse primer (Fig. 6b).

[0139] Nested PCR was performed on the amplified PCR products using forward primers and a common reverse primer that bind to the numerical naming barcodes Barcode-1 to 10. The final PCR products were subjected to agarose gel electrophoresis to confirm each single type of minigene amplicon, thereby confirming the presence of 10 types of minigenes that share Barcode-A and each include Barcode-1 to 10 (Fig. 6c).

[0140]

[0141] Example 6. Confirmation of immunogenicity of pooled minigenes through primary screening and primary selection of positive neoantigens.

[0142] Example 6-1. CTL induction

[0143] MACS isolation of donated blood corresponding to HLA-A*02:01 and CD8 + T cells and CD19 + Cells were secured. The secured CD19 + CD40-CD40L activated B cells (hereinafter referred to as CD40 act B cells) were produced through a culture period of approximately one week under culture conditions in which CD40L recombinant protein, IL-4, and IL-21 were added to the cells.

[0144] The minigene in mRNA form, produced through IVT, and the co-stimulatory factors OX40L-T2A-41BBL and IL12A-T2A-IL12B were co-transfected (electroporated) into the produced CD40 act B cells. When mRNA and co-stimulatory factors are injected into CD40 act B cells, the mRNA is expressed within the cells, and the expressed peptide or protein is presented on the surface through the antigen presentation pathway, enabling the production of antigen-presenting cells.

[0145] Secured CD8 + T cells and manufactured antigen-presenting cells were co-cultured to obtain cell lines for neoantigen detection by targeting minigenes with each alphabetically designated barcode sequence for neoantigen-specific activation and expansion. Co-culture was performed twice at 10-day intervals.

[0146] Example 6-2. Confirmation of immunogenicity of pooled minigenes through primary screening and primary selection

[0147] The activated T cells obtained through the process of Example 6-1 were co-cultured with K562 cell lines overexpressing HLA-A*02:01 or autologous CD40 act B cells on ELISpots coated with INF-gamma. The immunogenicity against HLA-A*02:01-specific antigens was confirmed through the detection level of INF-gamma, thereby selecting a group of effective DNA templates to be the target of secondary screening (Figs. 7a and 7b).

[0148]

[0149] Example 7. Selection of a single antigen with immunogenicity through secondary screening

[0150] The second screening was conducted on a group of valid DNA templates selected in the first screening.

[0151] CD8 immunogenicity confirmed through the primary screening performed in Example 6 + After secondary screening using minigenes containing a combination of numerically named barcodes that each shared one antigen, targeting T cells, single antigen results were generated.

[0152] The second screening was performed in the same manner as the first screening of Example 6, but using a K562 cell line overexpressing HLA-A*02:01 or autologous CD40 act B cells, co-cultured on an ELISpot coated with INF-gamma.

[0153] As a result of confirming the immunogenicity for the HLA-A*02:01-specific antigen through the detection level of INF-gamma, the result of Barcode-7 confirmed in the secondary screening was finally derived as a single antigen with immunogenicity, "A7" (Figs. 8a to 8e). When a minigene indicated by the barcode sequence of the combination of Barcode-A and Barcode-7 is presented on the surface of an antigen-presenting cell, it becomes a neoantigen that can be targeted as it has immunogenicity.

[0154]

[0155] Example 8. Confirmation of the immunogenicity of a new antigen produced through CTL induction based on a single minigene.

[0156] In order to verify the response of the A7 antigen produced in Example 7, minigenes for each antigen were individually produced, and B cells and T cells were isolated from blood having the same HLA-A*02:01, and independently performed in the same manner as the CTL induction method of Example 6-1. As in Example 6-1, co-culture was performed twice, and finally, K562 cell lines overexpressing HLA-A*02:01 or autologous CD40 act B cells were co-cultured on ELISpots coated with INF-gamma. The immunogenicity for the HLA-A*02:01-specific antigen was confirmed through the degree of detection of INF-gamma.

[0157] As a result, Neo #4 produced the same results as the pooled minigene-based immunogenicity confirmation method even when independently performed with A7 produced in Example 7 (Figures 9a and 9b).

[0158]

[0159] Example 9. Example of improved sensitivity of the present invention.

[0160] As a strategy to further enhance the reaction specificity of the pooled minigene-based screening method of the present invention, 20 μg / mL of anti-CTLA-4 antibody was additionally treated to the culture medium in the CTL induction step of Example 6-1.

[0161] The experimental subjects were CD8 derived from the same donated blood as in Example 6. + T cell, and the target for evaluation is Naive CD8 + This is an experimental group conducted on T cells.

[0162] As a result, Total CD8 + T cell-based screening methods include Naive CD8 + It was difficult to distinguish the difference in the degree of response for each antigen due to the weak degree of response compared to T cells, but a clear difference in immunogenicity was confirmed under conditions treated with anti-CTLA-4 antibody, and Naive CD8 + It was confirmed that the same pattern as the experimental group conducted in T cells was observed, but the specificity of the reaction was enhanced (Figures 10a and 10b).

[0163]

[0164] Example 10. Screening of antigen targets including HLA-A*02:01 or HLA-A*11:01 and selection of a single antigen with immunogenicity

[0165] Using the screening method of the present invention, screening was conducted on 100 predicted antigens including HLA-A*02:01 or HLA-A*11:01.

[0166] Screening was conducted under experimental conditions (sensitivity enhancement conditions) in which 20 μg / mL of anti-CTLA-4 antibody was additionally treated in the culture medium during the CTL induction step of Example 6-1, as in Example 9. The experimental subjects were blood-derived CD8+ T cells with HLA-A*02:01 or HLA-A*11:01, which were co-cultured twice, and finally co-cultured on an ELISpot coated with INF-gamma in a K562 cell line overexpressing HLA-A*02:01 or HLA-A*11:01.

[0167] By confirming the degree of detection of INF-gamma, a single antigen "D1" with immunogenicity against HLA-A*02:01-specific antigens (Fig. 11a) and a single antigen "I7" with immunogenicity against HLA-A*11:01-specific antigens (Fig. 11b) were finally produced.

Claims

1. A step of selecting a group of effective DNA templates exhibiting immunogenicity by amplifying, transcribing and expressing a plurality of DNA templates each including a first barcode sequence, a second barcode sequence and a new antigen coding sequence, specifically for the first barcode sequence; and A step of amplifying, transcribing and expressing the above valid DNA template group specifically for the second barcode sequence to identify a new antigen exhibiting immunogenicity; A method for screening a new antigen comprising:

2. A method for screening a new antigen according to claim 1, wherein the first barcode sequence is any one sequence selected from a group consisting of n oligonucleotides that specifically bind to n different primers (n is an integer of 2 or more).

3. A method for screening a new antigen according to claim 1, wherein the second barcode sequence is different from the first barcode sequence and is any one sequence selected from a group consisting of m oligonucleotides that specifically bind to m different primers (m is an integer of 2 or more).

4. A method for screening a new antigen according to claim 1, wherein the first barcode sequence or the second barcode sequence comprises 5 to 50 nucleotides.

5. A method for screening for a new antigen according to claim 1, wherein the step of selecting the group of valid DNA templates comprises: a first step of amplifying each of the plurality of DNA templates with primers specific for the first barcode sequence to produce a first barcode-based DNA pool; a second step of transcribing each of the DNAs to produce a first barcode-based mRNA pool; and a third step of expressing each of the mRNAs to derive the group of valid DNA templates exhibiting immune cell-specific immunogenicity.

6. A method for screening a new antigen according to claim 1, wherein the step of specifying the new antigen comprises: step A of amplifying each of the valid DNA template groups with primers specific for the second barcode sequence to produce a second barcode-based DNA pool; step B of transcribing each of the DNAs to produce a second barcode-based mRNA pool; and step C of expressing each of the mRNAs to derive a new antigen exhibiting immune cell-specific immunogenicity.

7. A method for screening a new antigen according to claim 1, wherein the amplification is performed by at least one method selected from the group consisting of PCR (polymerase chain reaction), nested PCR, multiplex PCR, micro PCR, and real-time PCR.

8. A method for screening a new antigen according to claim 1, wherein the transcription is performed through IVT (in vitro transcription).

9. A method for screening a neoantigen according to claim 1, wherein the selection of a group of effective DNA templates exhibiting immunogenicity or the identification of a neoantigen exhibiting immunogenicity is performed by at least one method selected from the group consisting of Enzyme-Linked ImmunoSpot (ELISpot) Assay, Intracellular Cytokine Staining (ICS) Assay, and Cytokine Bead Array (CBA) and T cell receptor sequencing (TCRseq).

10. A method for screening a novel antigen according to claim 1, wherein the plurality of DNA templates have the second barcode sequence linked to the 3' end of the first barcode sequence, and the novel antigen coding sequence is linked so as to be amplifiable by a primer linked to the first barcode sequence or the second barcode sequence.

11. Containing a plurality of DNA templates, each of which includes a first barcode sequence, a second barcode sequence, and a new antigen coding sequence; The above first barcode sequence is any one sequence selected from a group consisting of n oligonucleotides that specifically bind to n different primers (n is an integer greater than or equal to 2), A set of DNA templates for screening new antigens, wherein the second barcode sequence is different from the first barcode sequence and is any one sequence selected from a group consisting of m oligonucleotides that each specifically bind to m different primers (m is an integer greater than or equal to 2).

12. A DNA template set for screening a new antigen according to claim 11, wherein the first barcode sequence or the second barcode sequence comprises 5 to 50 nucleotides.

13. A DNA template set for screening a novel antigen according to claim 11, wherein the plurality of DNA templates have the second barcode sequence linked to the 3' end of the first barcode sequence, and the novel antigen coding sequence is linked so as to be amplifiable by a primer bound to the first barcode sequence or the second barcode sequence.

Citation Information

Patent Citations

  • Immunogenicity prediction device, immunogenicity prediction method and computer program for synthetic long peptide

    KR102475794B1