Wheat yellow mosaic disease resistance gene tarx-2d, and protein encoded by same and use thereof

By providing the TaRx-2D gene and its encoding protein related to wheat chrysanthesis resistance, the impact of wheat chrysanthesis on yield was solved and the regulation of wheat resistance was achieved.

WO2025118420A1PCT designated stage expired Publication Date: 2025-06-12NANJING AGRICULTURAL UNIVERSITY
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/079871
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-06
Filing Date
2024-03-04
Publication Date
2025-06-12

AI Technical Summary

Technical Problem

Wheat chalcoholism causes serious losses to wheat yields, and the prior art is difficult to effectively control the spread and occurrence of this disease.

Method used

It provides the application of the gene TaRx-2D, which is related to resistance to wheat chalcopenia, and its encoding protein, to change the resistance of wheat to viruses by regulating gene expression or knocking out the gene.

Benefits of technology

By reducing the expression of the TaRx-2D gene or knocking out the gene, the resistance of wheat to wheat chalvia disease is significantly reduced, thereby regulating plant yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024079871_12062025_PF_FP_ABST
    Figure CN2024079871_12062025_PF_FP_ABST
Patent Text Reader

Abstract

A wheat yellow mosaic disease resistance gene TaRx-2D, and a protein encoded by same and a use thereof. A cDNA sequence of a TaRx-2D gene from Yining wheat is as shown in SEQ ID NO: 1, and an amino acid sequence encoded by the TaRx-2D gene is as shown in SEQ ID NO: 3. In Yining wheat, EMS-induced mutants of the TaRx-2D gene, mutants caused by CRISPR / Cas9, and BSMV-induced TaRx-2D gene silencing result in reduced resistance to the wheat yellow mosaic disease, and therefore, the gene can be combined with an overexpression promoter in a plant, and then introduced into a suitable expression vector and transformed into a plant host, thereby altering the resistance of susceptible wheat to the wheat yellow mosaic disease, increasing the wheat yield.
Need to check novelty before this filing date? Find Prior Art

Description

A wheat yellow mosaic virus resistance gene TaRx-2D, its encoded protein, and its applications Technical Field

[0001] The invention belongs to the field of genetic engineering and relates to a wheat yellow mosaic disease-resistant gene TaRx-2D and its encoded protein and application. Background Art

[0002] Wheat yellow mosaic virus (WYMV) is transmitted and infected by the soil-borne fungus Polymyxa graminis. The disease develops optimally between 5°C and 15°C, with symptoms typically beginning in mid-to-late February and peaking in early to mid-March. Afterward, the disease stops and the plant becomes inactive. Infected wheat exhibits yellowing and curling leaves, stunting, and, in severe cases, death. Therefore, the disease significantly impacts wheat growth, development, yield, and its components.

[0003] The occurrence of viral diseases involves multiple factors, including host, vector, virus, and environment. Once wheat yellow mosaic virus, transmitted by Polymyx graminearum, enters a field, it is difficult to completely eradicate. This is because the dormant spores produced by Polymyx graminearum are extremely resistant to stress, surviving for years in the soil, even in adverse conditions such as drought and flooding, and are difficult to kill or inhibit with chemical agents. Furthermore, they can be spread over long distances through agricultural practices, diseased soil, diseased root debris, runoff from diseased fields, or through the mixing of vector-carrying soil with seeds. Although timely crop rotation, switching to crops that are not host to Polymyx graminearum, leaving land fallow, delaying sowing, increasing the application of organic fertilizers, and increasing nitrogen fertilizer application during the spring greening period can mitigate the disease to some extent, these traditional agronomic measures and chemical control methods are often ineffective.

[0004] Given the frequent occurrence of wheat yellow mosaic disease, which causes severe yield losses, numerous domestic research institutions have conducted large-scale identification of disease-resistant materials since the 1990s. After more than a decade of breeding practice, a number of highly resistant varieties have been developed, including Ningmai No. 9, Ningmai No. 13, Zhenmai No. 5, Sumai No. 5 and No. 6, Yangfumai No. 9311, and Yangfumai No. 4. These varieties have been widely adopted in production, particularly in areas where the disease is prevalent, effectively controlling the spread of the disease. Extensive experience has proven that breeding and planting disease-resistant varieties is currently the only way to control wheat yellow mosaic disease. Many domestic breeding institutions have included resistance to wheat yellow mosaic disease as a key trait in their breeding programs.

[0005] Summary of the Invention

[0006] The purpose of the present invention is to address the above-mentioned deficiencies in the prior art and provide a gene TaRx-2D related to wheat yellow mosaic disease resistance.

[0007] Another object of the present invention is to provide applications of the gene.

[0008] The purpose of the present invention can be achieved through the following technical solutions:

[0009] A gene TaRx-2D from Yining wheat related to wheat yellow mosaic disease resistance, the CDS nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0010] The genome sequence of the gene TaRx-2D is shown in SEQ ID NO: 2.

[0011] The amino acid sequence of the protein encoded by the gene TaRx-2D is shown in SEQ ID NO: 3.

[0012] The above-mentioned TaRx-2D can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0013] The above-defined DNA sequences have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology and encode DNA molecules with proteins having the same functions.

[0014] Genes encoding the above-mentioned similar domain proteins in other plants also fall within the protection scope of the present invention.

[0015] The gene TaRx-2D related to wheat yellow mosaic disease resistance, the expression cassette, recombinant vector or recombinant microorganism containing the gene TaRx-2D.

[0016] The application of the gene TaRx-2D is as follows (A1) or (A2): (A1) regulating the wheat yellow mosaic disease resistance of common wheat; (A2) enhancing or reducing the wheat yellow mosaic disease resistance of common wheat.

[0017] Specifically, by reducing the expression of the gene or knocking out the gene, the resistance of wheat to wheat yellow mosaic disease will be reduced or lost.

[0018] The plant is a monocotyledonous plant or a dicotyledonous plant; the monocotyledonous plant may be a grass plant.

[0019] The use of the expression cassette, recombinant vector or recombinant microorganism is characterized by the following (B1) or (B2): (B1) a transgenic plant with altered resistance to wheat yellow mosaic disease; (B2) a transgenic plant with increased or decreased resistance to wheat yellow mosaic disease.

[0020] The plant is a monocotyledonous plant or a dicotyledonous plant; the monocotyledonous plant may be a grass plant. Beneficial effects

[0021] The TaRx-2D gene of the present invention has the effect of significantly reducing wheat resistance in wheat by reducing expression levels and causing nonsense and missense mutations in the gene. Therefore, the gene of the present invention can be combined with an overexpression promoter in plants and then introduced into a suitable expression vector and transformed into a plant host, thereby changing wheat yellow mosaic disease resistance and regulating plant yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 shows the phenotypes of susceptible Yining wheat mutants induced by different EMS mutations after infection with wheat yellow mosaic virus and the TaRx-2D mutation sites identified in sequenced mutants. Panel A shows whole-plant, leaf, and virus molecular detection images of susceptible mutants and resistant controls after field infection. The horizontal axes represent the resistant Yining wheat, the susceptible Yangmai 158, and the Yining wheat EMS-susceptible mutants YN-Mut1, YN-Mut2, and YN-Mut3, respectively. Panel B shows the gDNA, cDNA, and protein mutation sites of the TaRx-2D gene in the three susceptible mutants, as well as the lengths of truncated proteins resulting from premature termination. "ATG" indicates the start codon, "TAA" indicates the stop codon, black boxes indicate exons, broken lines indicate introns, and gray areas indicate protein-encoding sequences. "g.", "c.", and "p." represent the gDNA, cDNA, and protein sequences, respectively.

[0023] Figure 2 shows the resistance phenotype and viral molecular identification of plants after TaRx-2D gene silencing induced by barley stripe mosaic virus (BSMV) in Yining wheat, as well as analysis of TaRx-2D gene expression efficiency in roots and plants. Panel A shows the analysis of TaRx-2D gene silencing efficiency. Real-time reverse transcription and quantitative PCR were used to measure TaRx-2D gene expression after BSMV-induced silencing. Panel B shows the resistance phenotype to wheat yellow mosaic virus in plants after BSMV-induced TaRx-2D gene silencing in Yining wheat. Panel C shows detection of wheat yellow mosaic virus and barley stripe mosaic virus. The horizontal axes in Figures A, B, and C represent wheat treated with different methods. Mock represents the phenotype of Yining wheat plants that were not smeared with barley stripe mosaic virus and naturally became ill in the diseased nursery. BSMV represents Yining wheat plants inoculated with barley stripe mosaic virus. Yangmai158 represents the susceptible control "Yangmai 158." I, II, III, and IV represent BSMV-TaRx-2D, respectively. CC BSMV-TaRx-2D CC BSMV-TaRx-2D LRR BSMV-TaRx-2DLRR Figure 2 represents the CC and LRR domains of silenced TaRx-2D. The vertical axis of Figure A represents the ratio of TaRx-2D expression in plants silenced by BSMV relative to control plants of Yining wheat that were not inoculated with BSMV. The internal reference gene is TaTubulin. Letters indicate significant differences; a indicates no significant difference, and b indicates a significant difference.

[0024] Figure 3 shows the wheat yellow mosaic virus resistance phenotype, gene sequence editing, and resulting protein sequence mutations in the T1 generation mutant line of the transgenic recipient material Fielder, which was generated by CRISPR / Cas9 knockout of the TaRx-2D gene. Panel A shows the designed TaRx-2D target site and the location of the edited gDNA gene sequence, cDNA sequence mutation site, amino acid mutation site, and final truncated protein size in the gene-edited T1 generation line. "g.", "c.", and "p." above Panel A represent the mutation information in the gDNA, cDNA, and protein sequences, respectively. "del" represents a base deletion, "fs" represents a protein frameshift mutation, and "★" and the following number represent the number of residues between the start and end of the frameshift frame of the mutant protein. "ATG" below Panel A indicates the start codon, "TAA" indicates the stop codon, black boxes indicate exons, broken lines indicate introns, and gray areas indicate protein domain-encoding sequences. Panel B shows the target sequence after editing in the T1 generation of the gene-edited mutant. The red sequence represents the target PAM sequence, the blue sequence represents the designed sgRNA editing target, and WT represents wild type. Panel C shows the WYMV-resistant phenotype (top) and semi-quantitative RT-PCR analysis of VPg (bottom) in leaves of T1-generation mutant plants after TaRx-2D gene editing using the CRISPR / Cas9 system in Fielder. TaTubulin was used as an internal control. Fielder serves as both the receptor and the disease resistance control. Y158 is the susceptible wheat variety "Yangmai 158," and T1-CR TaRx-2D-1-1, T1-CR TaRx-2D-4-2, T1-CR TaRx-2D-6, and T1-CR TaRx-2D-8 are the four CRISPR mutation lines. DETAILED DESCRIPTION

[0025] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The experimental materials and reagents used in the examples, unless otherwise specified, are commercially available.

[0026] The materials used were wheat varieties Yining wheat and Fielder, and the transgenic materials T1-CR TaRx-2D-1-1, T1-CR TaRx-2D-4-2, T1-CR TaRx-2D-6, and T1-CR TaRx-2D-8 with a Fielder background were obtained by Agrobacterium-mediated genetic transformation.

[0027] Example 1: Verification of the wheat yellow mosaic disease resistance effect of the TaRx-2D gene using the Yining wheat EMS susceptible mutant

[0028] Full-grained dry seeds of Yining wheat were selected and soaked in 0.05 mol / L phosphate buffer (pH = 7.0) at room temperature for 8 hours. Ethyl methane sulfonate (EMS) was added to a final concentration of 0.6%, and the seeds were shaded and soaked for 16 hours. After rinsing with running water for 2 hours, the seeds were placed in a 25°C constant temperature incubator and cultured until germination. M1 generation seedlings were transplanted to the field and harvested as single ears per plant. M2 generation seedlings were planted in rows in the WYMV disease nursery in Zhumadian, Henan Province. After screening mutant populations after the onset of wheat yellow mosaic disease, the full-length TaRx-2D gene of three susceptible mutants, YN-Mut1, YN-Mut2, and YN-Mut3 (Figure 1A), was cloned and sequenced.

[0029] In the YN-Mut1 mutant line, a cytosine at position 2,961 of the TaRx-2D gene was mutated to a thymine, resulting in a change from threonine (Thr) to isoleucine (Ile) at position 306 in the NBS domain of the encoded protein. In YN-Mut2, a base mutation at position 3,190 of the TaRx-2D gene was observed, converting cytosine to thymine, causing a nonsense mutation that prematurely terminated translation and produced a 382-aa truncated protein. In YN-Mut3, full-length cloning revealed that a cytosine at position 3,872 of the TaRx-2D gene was mutated to a thymine, resulting in a mutation from proline (Pro) to serine (Ser) at position 610. Sequence analysis of the TaRx-2D residues in susceptible mutants revealed that the missense mutation or premature translation termination caused by the base mutation led to the loss of resistance to WYMV in Yining wheat (Figure 1, panel B).

[0030] The primers used for full-length PCR amplification of TaRx-2D gene gDNA are shown in Table 1:

[0031] Table 1. Primers used for full-length PCR amplification of TaRx-2D gene gDNA

[0032] Example 2: Verification of the resistance function of the TaRx-2D gene to wheat yellow mosaic disease using virus-induced gene silencing A VIGS infection system based on barley stripe mosaic virus (BSMV) was used with Nicotiana benthamiana as the transitional host. Gene silencing target primers were designed based on the reverse sequence of the TaRx-2D gene located at 228-398 bp encoding the CC domain sequence and the reverse sequence of 2,034-2,218 bp encoding the LRR domain sequence. The sequences were RxCC-rcseq: 5'-TTCACTTTCCTAACTTGGATCTCGATGTCTTTGATGTCATTGGATATTCTATGGTGAACCTTGAGCTTGGTGAGCTTGCCGCGGGTCTTCTTCATGAATCCCTTGATGGTGCTTGACCTGTTTGGCTCAA GACCATCTATGCGCACCATGGAGGAGTCGAGATTATCTTCG-3', RxLRR-rcseq: 5'-AAGGGGGCGCACAATCTTCCCAGATACCAAAGGGAACTATCCGATTCTCTTTGCACGAGATCTCCAGAGTTTGGATTTTACCCAGGTTACGGAGCGAATCCAGCAGAGCTGTCTCTGTGCTCTTGTCCATTTCATCAAAATGGATTTCAAGCACCCTTATCTCTGTCATCTTACCTAGTTCGGAG-3'. The homology arm sequences of the multiple cloning site on the pCaBS-γb vector were added at both ends of the target site and submitted to Qingke Biotechnology Co., Ltd. for synthetic vector construction. Primers BSMV-r-RxCC-rcseq1-F / R and BSMV-r-RxLRR-rcseq1-F / R were used to amplify the silencing target sequence and purify and recover it. The pCaBS-γb vector was linearized using restriction endonuclease MseI at 37°C for 6 h. 1 μl of the reaction solution and a control were run on a 1.0% agarose gel to check for complete cleavage. The complete cleavage product was recovered and purified. The cleavage system is shown in Table 2:

[0033] Table 2. Enzyme digestion system

[0034] The primer sequences for constructing the virus-induced gene silencing vector are shown in Table 3:

[0035] Table 3. Primer sequences for constructing virus-induced gene silencing vectors

[0036] The VIGS vector was constructed by homologous recombination, following the instructions for the ClonExpress II One Step Cloning Kit from Nanjing Novezan Biotechnology Co., Ltd. EHA105 competent cells were thawed on ice, 10 μl of the recombinant product was added to 100 μl of competent cells, and the mixture was allowed to stand on ice for 10 min, frozen in liquid nitrogen for 5 min, and incubated in a 37°C water bath for 5 min. 900 μl of LB medium (without antibiotics) was added and cultured at 28°C for 4 h (120 rpm). The mixture was centrifuged at 5,000 rpm for 3 min, the supernatant discarded, and the cells resuspended and evenly spread on a plate containing Kan and Rif resistance. The cells were incubated in an incubator at 28°C for 48–72 h, and then single clones were selected for PCR identification.

[0037] The constructed BSMV-γ chain recombinant plasmids pCaBS-γb:TaPDS, pCaBS-γb:TaRx-2D CC , pCaBS-γb:TaRx-2D LRR , BSMV-α, BSMV-β, BSMV-γ chain plasmids pCaBS-α, pCaBS-β, pCaBS-γb, and BSMV-γ chain recombinant plasmid pCaBS-γb:TaPDS with wheat lycopene desaturase (PDS) gene constructed were transformed into Agrobacterium EHA105 competent cells. After positive transformation of Agrobacterium strains by bacterial liquid PCR using vector identification primers, 500 μl was inoculated into 15 ml LB liquid medium (containing 25 mg / L rifampicin and 100 mg / L kanamycin) and cultured in a shaking incubator at 28°C for 8 to 12 hours for expansion culture. When the bacterial liquid OD 600 When the value reaches 0.6-1.0, centrifuge at 4,000 rpm for 10 minutes to collect the bacterial solution. After pouring off the supernatant, resuspend the bottom bacteria in tobacco injection buffer to OD 600 = 0.6 (200 μl of 0.5 M 2-morpholinoethanesulfonic acid (MES), 100 μl of 1 M MgCl2) and pCaBS-γb, pCaBS-γb: TaPDS, pCaBS-γb: TaRx-2D CC , pCaBS-γb:TaRx-2D LRR The BSMV-γ chain recombinant vector bacterial solution was mixed with the bacterial solution containing pCaBS-α and pCaBS-β plasmids in equal volumes, placed in the dark at room temperature for 4 hours, and injected into the back of tobacco leaves with a sterile syringe to co-express in tobacco leaves to produce four viral recombinant particles BSMV, BSMV-TaPDS, and BSMV-TaRx-2D. CC BSMV-TaRx-2D LRR .

[0038] Seven days after injection, when tobacco leaves showed obvious virus symptoms, the injected leaves were removed. 3 ml of friction inoculation buffer was added per gram of leaf, and the mixture was thoroughly ground. The resulting mixture was then rubbed onto wheat leaves and protected from light for 24 hours. Ten days after inoculation, distinct BSMV streaking mosaic symptoms were observed on upper wheat leaves. A distinct bleaching phenotype was observed on upper wheat leaves inoculated with BSMV-TaPDS, demonstrating successful inoculation and the effective knockdown of wheat genes using this system.

[0039] After the susceptible control Yangmai 158 showed a susceptible phenotype, the WYMV resistance of the Yining wheat plants inoculated with VIGS was identified. Compared with the Yining wheat that was not inoculated with VIGS, the whole plant and leaves of the Yining wheat inoculated with VIGS showed obvious WYMV susceptible phenotypes (Figure B in Figure 2), including reduced plant tillering and leaf chlorosis. The WYMV-specific primers WYMV-Vpg and the identification primers of the BSMV-γ chain were used to detect wheat yellow mosaic virus and barley stripe mosaic virus in the leaves of the Yining wheat inoculated with VIGS (Figure C in Figure 2). After inoculation with the virus recombinant particles BSMV-TaRx-2D CC BSMV-TaRx-2D LRR Specific bands of WYMV were detected in the leaves of individual plants, indicating that Yining wheat inoculated with VIGS was susceptible to WYMV.

[0040] The silencing efficiency of Yining wheat root tissue inoculated with VIGS was analyzed. CC BSMV-TaRx-2D LRR RNA from the roots of Yining wheat plants that had been inoculated with BSMV and those that had not was synthesized. The TaRx-2D gene expression level was detected by first-strand cDNA synthesis and quantitative analysis of TaRx-2D expression in root tissues. The TaRx-2D gene expression level in Yining wheat was significantly reduced after BSMV inoculation (Figure 2, Panel A), indicating that TaRx-2D expression was significantly silenced. Therefore, it was concluded that silencing the TaRx-2D gene caused Yining wheat to lose its resistance to WYMV.

[0041] The wheat yellow mosaic virus specific primers WYMV-VPg-F / R, the BSMV-γ chain identification primers BSMV-γ-F / R, and the primers used for the TaRx-2D gene fluorescence quantitative analysis are shown in Table 4:

[0042] Table 4. Wheat yellow mosaic virus specific primers WYMV-VPg-F / R, BSMV-γ chain identification primers BSMV-γ-F / R, and primers used for TaRx-2D gene fluorescence quantitative analysis

[0043] Tobacco injection buffer formula: 2ml 0.5M MES + 1ml 1M MgCl2 + 100μl 0.1M acetosyringone (As), dilute to 100ml with ddH2O; friction inoculation buffer: 2.8ml 0.2M H2NaPO4 + 7.2ml 0.2M HNa2PO4 + 1g volcanic ash, dilute to 100ml.

[0044] The extraction of RNA from the above plant tissues and the identification of relative expression levels are as follows:

[0045] 1. Total RNA extraction using the TRIpure kit: Wheat total RNA extraction was performed according to the instructions for TRIpure Reagent (RN0102) from Beijing Aidlab. To reduce the effects of nucleases and other substances on RNA, the pipette tips and centrifuge tubes were treated with 0.1% DEPC (1 mL of DEPC per 1 L of water). The mortar, pestle, and spoon were wrapped in tin foil and baked in an oven at 180°C for at least 6 hours. The specific steps are as follows:

[0046] (1) Place the quick-frozen wheat tissue (leaves or roots) in a strictly sterilized mortar (or grinder), add liquid nitrogen and grind thoroughly into a powder. Transfer the sample to a 2.0 mL centrifuge tube using a pre-treated spatula and add 1 mL of TRIpure per 100 mg of sample.

[0047] (2) The homogenized sample was shaken vigorously for 20 seconds using a vortexer and then placed at room temperature for 5 minutes to allow complete dissociation of the nuclear protein;

[0048] (3) Centrifuge at 12,000 rpm for 10 min in a refrigerated centrifuge set at 4°C. Transfer the supernatant to a 1.5 ml centrifuge tube treated with DEPC water. Add 200 μL of chloroform per 1 ml of TRIpure. Cap the tube tightly, shake vigorously for 15 seconds, and then place it at room temperature for 3 min.

[0049] (4) Centrifuge at 12,000 rpm at 4°C for 15 min. Transfer the upper aqueous layer to another clean centrifuge tube, add an equal volume of isopropanol, mix thoroughly by inversion, and then place at room temperature for 10 min.

[0050] (5) Centrifuge at 12,000 rpm for 10 min, discard the supernatant, and wash the precipitate with 75% ethanol. For every 1 ml of TRIpure used, wash the precipitate with 1 ml of 75% ethanol.

[0051] (6) Centrifuge at 12,000 rpm for 3 min, discard the supernatant, and aspirate the solution with a pipette after a brief centrifugation.

[0052] (7) After standing at room temperature for 3 minutes to dry, add 100 μl of RNase-free water to fully dissolve the RNA;

[0053] (8) 1 μl of dissolved RNA was aspirated and subjected to 1% agarose gel electrophoresis. The undegraded RNA showed three clear bands after electrophoresis, of which the brightness of the 28S rRNA band was approximately twice that of the 18S rRNA band, and there was no obvious smearing of the rRNA.

[0054] The quality of RNA is measured by calculating the RNA concentration by measuring the absorbance at 260nm and 280nm using a UV spectrophotometer: when the absorbance at 260nm is 1, the RNA concentration is equal to 40μg / ml. The concentration of the corresponding RNA stock solution is calculated based on the dilution factor; the A260 / A280 of a high-purity RNA sample should be close to 2.0.

[0055] 2. Use reverse transcription kit to synthesize first-strand cDNA sequence. The first-strand cDNA synthesis, reverse transcription reaction system and amplification procedure refer to the II 1st Strand cDNA Synthesis Kit (+gDNA wiper) reagent instructions, to obtain cDNA for subsequent RT-PCR amplification of viral gene molecular markers and qRT-PCR detection of gene expression levels. The specific process is as follows: (1) Add dNTP Mixture, Oligo dT Primer and template RNA to a clean tube without RNase; (2) Gently mix, incubate at 65℃ for 5 minutes, quickly cool in an ice box and add 5× PrimeScript II Buffer, RNase Inhibitor, PrimeScript II RTase and RNase-free ddH2O; (3) Gently mix, incubate at 42℃ for 60 minutes. (4) Terminate the reaction at 95℃ for 5 minutes to inactivate the enzyme. Store the reverse transcribed sample in a refrigerator at -80℃ until use.

[0056] 3. Real-time fluorescence quantitative PCR (qRT-PCR) procedure. The qRT-PCR reaction system and procedure refer to AceQ qPCR SYBR Green MasterMix (Vazyme). The specific steps are as follows:

[0057] (1) qRT-PCR quantitative analysis was performed using the first-strand cDNA synthesized by reverse transcription as a template and the TaRx-2D gene expression primers TaRx-2D-qPCR-F / R. The wheat TaTubulin gene was used as an internal reference. Three technical replicates were set up for each parallel experiment. The primer sequences are shown in Appendix G.

[0058] (2) The qRT-PCR reaction system is shown in Table 5:

[0059] Table 5. qRT-PCR reaction system

[0060] (3) The qRT-PCR reaction procedure is shown in Table 6:

[0061] Table 6. qRT-PCR reaction procedure

[0062] (4) Calculation of relative gene expression: After completing qRT-PCR, the relative expression of TaRx-2D before and after BSMV treatment was calculated based on the obtained CT value, i.e., 2 -ΔΔCT . ΔΔCT=(CT TaRx-2D -CT TaTubulin )BSMV inoculated single strain-(CT TaRx-2D -CT TaTubulin ) The target gene expression of uninoculated BSMV plants and uninoculated Yining wheat was doubled after TaTubulin correction, and the significant differences were analyzed by multiple comparison using the least significant difference (LSD) in the R language function package agricolae.

[0063] Example 3: Verification of the disease resistance of the TaRx-2D gene against wheat yellow mosaic disease using CRISPR / Cas9 gene editing Based on the CDS sequence of the TaRx-2D gene, the wheatCrispr website (https: / / crispr.bioinfo.nrc.ca / WheatCrispr / ) was used to predict CRISPR editing targets for the full-length gDNA sequence of the TaRx-2D gene. Based on two targets with high prediction scores (452-473 bp and 4,068-4,086 bp) located in the exon region of the antisense chain of the CC domain and the LRR domain, CRISPR vector construction primers TaRx-MT1T2-F, TaRx-MT1T2-R, TaRx-MT1T2-F0, and TaRx-MT1T2-R0 were designed, respectively. The target sequence one is: 5'-GATTCATGAAGAAGACCCGCGG-3', and the target sequence two is: 5'-CAAACTTCGCCTCCGAACTAGG-3'.

[0064] Using plasmid pCBC-MT1T2 as a template, TaRx-MT1T2-F, TaRx-MT1T2-R, TaRx-MT1T2-F0, and TaRx-MT1T2-R0 were used as primer combinations to amplify a DNA fragment containing the target sgRNA, wherein the concentrations of TaRx-MT1T2-F and TaRx-MT1T2-R primers were 10 μM, and the concentrations of TaRx-MT1T2-F0 and TaRx-MT1T2-R0 primers were 0.5 μM. The DNA fragments were purified and recovered. The PCR amplification system, reaction procedure, and DNA fragment purification and recovery were as described in Example 2.

[0065] The PCR reaction system was prepared as shown in Table 7:

[0066] Table 7. PCR reaction system

[0067] The PCR reaction program is shown in Table 8:

[0068] Table 8. PCR reaction program

[0069] The purified target fragments were used to construct vectors according to the enzyme digestion-ligation reaction system shown in Table 9:

[0070] Table 9. Enzyme digestion-ligation reaction system

[0071] The primers used for vector construction are shown in Table 10:

[0072] Table 10. Primers used for vector construction

[0073] Using Agrobacterium-mediated transgenic technology, specifically referring to the method described in patent CN104745621B, TaRx-2D was knocked out in the wheat variety Fielder. DNA extracted from T0 generation leaves was amplified and sequenced using the TaRx-2D gene, revealing that T0-CR TaRx-2D-1-1, T0-CR TaRx-2D-4-2, T0-CR TaRx-2D-6, and T0-CR TaRx-2D-8 were transgenic-positive plants. T1 generation strains of transgenic plants were obtained through greenhouse cultivation. The derived T1 generation strains were planted in pots containing WYMV-infected soil under laboratory conditions to identify their WYMV-resistant and susceptible phenotypes.

[0074] Sixteen WYMV-susceptible individuals were screened from the T1 generation of gene-edited plants, including four T1-CR TaRx-2D-1-1 lines, three T1-CR TaRx-2D-4-2 lines, three T1-CR TaRx-2D-6 lines, and six T1-CR TaRx-2D-8 lines. Full-length TaRx-2D genes cloned from susceptible plants and compared with the wild-type TaRx-2D sequence revealed that the TaRx-2D gene was edited in all 16 susceptible plants. The editing site in the T1-CR TaRx-2D-1 line resulted in an 8-bp deletion at the first target site within the CC domain of the gene, while no editing occurred at the second target site. This resulted in a frameshift mutation in the TaRx-2D gene, producing a 112-aa truncated protein. Susceptible plants in the T1-CR TaRx-2D-4-2 line developed a large 3,623-bp deletion between target site 1 in the CC domain and target site 2 in the LRR domain, resulting in a frameshift mutation in the target gene and a 103-aa truncated protein. Susceptible plants in the T1-CR TaRx-2D-6 line also developed a large 3,615-bp deletion between target sites 1 and 2, causing a frameshift mutation and a 107-aa truncated protein. Susceptible plants in the T1-CR TaRx-2D-8 line developed a 2-bp deletion at target site 2 in the LRR domain, leading to a frameshift mutation and a 681-aa truncated protein (Figure 3, Panel A). The phenotypes and genotypes of the above CRISPR transgenic plants showed that knocking out the TaRx-2D gene in Fielder caused the plants to lose WYMV resistance, further confirming that the TaRx-2D gene is the WYMV resistance gene at the QYm.nau-2D locus.

Claims

1. A gene TaRx-2D associated with wheat yellow mosaic disease resistance, characterized in that: The CDS sequence of the gene TaRx-2D is shown in SEQ ID NO:

1.

2. The gene TaRx-2D related to wheat yellow mosaic disease resistance according to claim 1, characterized in that: The genome sequence of the gene TaRx-2D is shown in SEQ ID NO:

2.

3. The protein encoded by the gene TaRx-2D related to wheat yellow mosaic disease resistance according to claim 1, characterized in that: The amino acid sequence is shown in SEQ ID NO:

3.

4. An expression cassette, recombinant vector or recombinant microorganism containing the gene TaRx-2D according to claim 1 or 2.

5. The use of the gene TaRx-2D according to claim 1 or 2, characterized in that: As follows (A1) or (A2): (A1) regulating wheat yellow mosaic virus resistance in common wheat; (A2) Enhance or reduce the resistance of common wheat to wheat yellow mosaic virus.

6. Use of the expression cassette, recombinant vector or recombinant microorganism according to claim 4, characterized in that: As follows (B1) or (B2): (B1) Transgenic plants with altered resistance to wheat yellow mosaic virus; (B2) Transgenic plants with increased or decreased resistance to wheat yellow mosaic virus.

7. The use according to claim 6, characterized in that: The plant is a monocotyledon or a dicotyledon.

8. The use according to claim 7, characterized in that: The monocotyledonous plant is a plant of the family Poaceae.

Citation Information

Patent Citations

  • Application of yellow mosaic virus P2 protein and gene thereof in cultivation of wheat resistant to yellow mosaic disease

    CN103725708A

  • Marking composition prepared from wheat yellow mosaic disease-resistant material

    CN114292852A

  • Wheat yellow mosaic disease susceptible gene TaEIF4E and application thereof

    CN116536327A

  • Wheat yellow mosaic disease-resistant gene TaRx-2D as well as protein coded by wheat yellow mosaic disease-resistant gene TaRx-2D and application thereof

    CN117431256A

  • Wheat stripe rust resistance genes and methods of use

    WO2017079286A1