Method for improvement of pstvd resistance of potatoes based on crispr-rfxcas13d system, and product and use thereof
By introducing the CRISPR-RfxCas13d system into potatoes, targeting PSTVd RNA, the problem of insufficient resistance to PSTVd to potatoes is solved, and the effect of significantly reducing the pathogenicity of PSTVd is achieved, and the disease resistance of potatoes is improved.
Patent Information
- Application Number
- PCT/CN2024/100897
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-04
- Filing Date
- 2024-06-24
- Publication Date
- 2025-06-12
AI Technical Summary
Potato spindle tuber virus (PSTVd) is one of the important diseases of potatoes. The existing technology cannot effectively prevent and treat it, resulting in serious economic losses and reduced yields.
The CRISPR-RfxCas13d system targeting PSTVd was designed, and the CRISPR-RfxCas13d vector containing single-target or multi-target crRNA targeting PSTVd was constructed, and potatoes were transformed under Agrobacterium mediated, and transgenic plants with improved PSTVd resistance were screened to obtain.
The CRISPR-Cas13d system is used to directionally shear PSTVd RNA in the potato body, reducing the pathogenicity of PSTVd, reducing the symptoms, and improving the resistance of potatoes to PSTVd.
Smart Images

Figure CN2024100897_12062025_PF_FP_ABST
Abstract
Description
Method for improving potato PSTVd resistance based on CRISPR-RfxCas13d system, and its products and applications Technical Field
[0001] The present invention relates to the field of plant biotechnology, and in particular to a method for improving potato PSTVd resistance based on the CRISPR-RfxCas13d system, and a product and application thereof. Background Art
[0002] Potatoes, a dicotyledonous plant in the Solanaceae family, are my country's fourth-largest food crop after rice, wheat, and corn. The potato industry is also a key industry for poverty alleviation in ethnic minority, border, and mountainous areas, playing a key role in ensuring my country's food security and increasing agricultural productivity and income for farmers. Potato spindle tuber viroid (PSTVd) is a major potato disease that severely impacts its growth and development, leading to significant yield and quality losses. Strong strains of PSTVd have been reported to cause yield reductions of up to 60%, while weak strains can cause yield reductions of approximately 20% to 35%, resulting in significant economic losses.
[0003] Since PSTVd cannot be eliminated through stem apex detoxification and tissue culture, as well as the lack of disease-resistant varieties, it is currently impossible to effectively prevent and control the occurrence of PSTVd diseases. Gene editing technology is currently developing rapidly and is widely used in gene editing, diagnosis, and expression regulation. The development of plant gene editing technology has greatly shortened the breeding period and accelerated the breeding process. Currently, gene editing technology has been used to create virus-resistant germplasm resources for a variety of crops. However, this technology is rarely used in potatoes. Therefore, the present invention intends to use gene editing technology to design crRNA targets targeting PSTVd, and use the CRISPR-Cas13d system to carry crRNA targeting PSTVd, thereby reducing the pathogenicity of PSTVd and improving potato resistance to PSTVd. Technical issues
[0004] In view of this, one of the objects of the present invention is to provide a method for improving potato PSTVd resistance based on the CRISPR-RfxCas13d system; a second object of the present invention is to provide a CRISPR-RfxCas13d editing system constructed by the method described; a third object of the present invention is to provide a crRNA sequence; a fourth object of the present invention is to provide the CRISPR-Cas13d editing system and the crRNA sequence in the preparation of a kit for preventing and controlling potato spindle tuber viroid PSTVd. Technical Solutions
[0005] In order to achieve the above object, the present invention provides the following technical solutions:
[0006] 1. A method for improving potato PSTVd resistance based on the CRISPR-RfxCas13d system, comprising the following steps:
[0007] 1) Designing a single-target or multi-target crRNA of the CRISPR-RfxCas13d system targeting potato spindle tuber viroid PSTVd, wherein the sequence of the single-target crRNA targets the PSTVd sequence shown in SEQ ID No. 2 or SEQ ID No. 5, and the multi-target crRNA simultaneously targets the PSTVd sequences shown in SEQ ID Nos. 6 to 9;
[0008] 2) Construction of CRISPR-RfxCas13d vectors containing single-target and multi-target crRNAs targeting PSTVd;
[0009] 3) The CRISPR-RfxCas13d vector was transformed into potatoes under Agrobacterium-mediated transformation, and transgenic plants with improved resistance to PSTVd were screened.
[0010] Preferably, in step 1, the nucleotide sequence of potato spindle tuber viroid PSTVd is shown as SEQ ID No. 1.
[0011] Preferably, in step 2, the CRISPR-RfxCas13d vector comprises a RfxCas13d gene expression cassette and a gRNA expression cassette, wherein the RfxCas13d gene expression cassette is composed of a CaMV35S promoter, a RfxCas13d gene, an SV40 NLS, and a Nos-T element connected in sequence, and the gRNA expression cassette is composed of a sequentially connected AtU6 promoter, a DR sequence, and a single target or multi-target crRNA sequence targeting PSTVd.
[0012] Preferably, in step 3, the Agrobacterium is a GV3101::pMP90 strain.
[0013] 2. The CRISPR-RfxCas13d editing system was constructed using the described method.
[0014] 3. A crRNA sequence
[0015] The CRISPR-RfxCas13d editing system can be used to directionally cleave the RNA of potato spindle tuber viroid PSTVd and knock down its expression in plants through crRNA mediation, and the sequence of the crRNA is the reverse complementary sequence of the sequence shown in SEQ ID No. 2, SEQ ID No. 5 or SEQ ID No. 6~9.
[0016] 4. Use of the CRISPR-Cas13d editing system and the crRNA sequence in the preparation of a kit for preventing and controlling potato spindle tuber viroid PSTVd. Beneficial effects
[0017] The present invention designs crRNA targeting the potato spindle tuber viroid PSTVd, and uses CRISPR-Cas13d to carry single or four crRNAs to successfully target PSTVd in potatoes, reducing the accumulation of mature PSTVd and vd-sRNA, thereby reducing the pathogenicity of PSTVd, alleviating the symptoms of potatoes caused by PSTVd, and improving potato resistance to PSTVd. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention provides the following drawings for illustration:
[0019] Figure 1 is a schematic diagram of the single-target pCAMBIA1300-35S::RfxCas13d-AtU6::crRNA vector;
[0020] Figure 2 is a schematic diagram of the multi-target pCAMBIA1300-35S::RfxCas13d-AtU6::crRNA1234 vector;
[0021] Figure 3 shows PCR detection of a single-target CRISPR-RfxCas13d transgenic line targeting PSTVd;
[0022] Figure 4 shows PCR detection of multi-target CRISPR-RfxCas13d transgenic lines targeting PSTVd;
[0023] Figure 5 shows the symptom manifestations, plant height statistics, and Northern blot analysis of the single-target transgenic strain targeting PSTVd 14 days after virus inoculation;
[0024] Figure 6 shows the symptom manifestations, plant height statistics and Northern blot analysis of the multi-target transgenic strain targeting PSTVd 21 days after virus inoculation. Best Mode for Carrying Out the Invention
[0025] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.
[0026] The CRISPR-Cas13d crRNA targeting PSTVd was designed using the online search website (https: / / cas13design.nygenome.org / ). PSTVd contains five functional regions: the left terminal region (TL, 1-46 / 315-359), the pathogenic region (P, 47-73 / 286-314), the central conserved region (CCR, 74-120 / 240-285), the variable region (V, 121-148 / 212-239), and the right terminal region (TR, 149-211). The structural features of different regions of PSTVd contribute to their corresponding functions, so the present invention designed targets for different regions of PSTVd.
[0027] In the present invention, bases 11 to 32 (22 nt), bases 34 to 55 (22 nt), bases 239 to 260 (22 nt), and bases 287 to 308 (22 nt) of the PSTVd sequence (SEQ ID No. 1) were selected as single target sequences for the TL region, TL region and P region, CCR region and V region, and P region of PSTVd, respectively (Table 1).
[0028] Table 1 Single target sequences
[0029] Target name Location Functional region Target sequence (5'→3') crRNA1287-308PGAGAACCGCTTTTTCTCTATCT (SEQ ID No.2) crRNA2239-260CCR, VTTGCGCTGTCGCTTCGGCTACT (SEQ ID No.3) crRNA334-55TL, PCTGACCTCCTGACAAGAAAAGA (SEQ ID No.4) crRNA411-32TLCTCGTGGTTCCTGTGGTTCACA (SEQ ID No.5)
[0030] Studies have reported that the CRISPR-Cas13d system has the best targeting effect when carrying multiple targets with a target sequence of 30 bp. Therefore, the present invention selected bases 3 to 32 (30 bp), bases 26 to 55 (30 bp), bases 231 to 260 (30 bp), and bases 279 to 308 (30 bp) of the PSTVd sequence as target sequences for the TL region, TL region and P region, CCR region and V region, and CCR region and P region of PSTVd, respectively, to construct a CRISPR-Cas13d multi-target vector. The multi-target sequences are shown in Table 2.
[0031] Table 2 Multi-target sequences
[0032] Target name Location Functional region Target sequence (5'→3') crRNA4'3-32TLGAACTAAACTCGTGGTTCCTGTGGTTCACA (SEQ ID No.6) crRNA3'26-55TL, PGTTCACACCTGACCTCCTGACAAGAAAAGA (SEQ ID No.7) crRNA2'231-260CCR, VCGCCCCCTTTGCGCTGTCGCTTCGGCTACT (SEQ ID No.8) crRNA1'279-308CCR, PAAGCTCCCGAGAACCGCTTTTTCTCTATCT (SEQ ID No.9) Modes for Carrying Out the Invention
[0033] Example 2: Construction of single-target and multi-target vectors containing crRNA targeting PSTVd
[0034] The specific process for vector construction is as follows: First, a pair of primers containing reverse complements of the target site sequences shown in Tables 1 and 2 are synthesized and annealed to unwind the double helix to form single-stranded DNA. Simultaneously, a variable temperature cycle enzyme digestion and ligation reaction is performed with the vector on a PCR instrument. After the vector is digested with Aar I, specific sticky ends are formed. Under the action of T4 DNA Ligase, they can be ligated into the binary vector CRISPR-RfxCas13d (the full name of this recombinant vector in the present invention is pCAMBIA1300-35S::RfxCas13d-AtU6::crRNA, which is the pCambia1300-RfxCas13d-crRNA vector mentioned in the Chinese invention patent entitled "CRISPR_RfxCas13d Anti-Plant RNA Virus Vector and Its Construction Method and Application"). Expression of the constructed plasmid Cas13d is controlled by the 35S promoter, and the sgRNA is regulated by the Arabidopsis U6 promoter (Figures 1 and 2).
[0035] The AarI digestion system for 15 μL is shown in Table 1. First, digest at 37°C for 15 minutes, then perform a temperature-controlled cycle of digestion and ligation on a PCR instrument. The PCR reaction conditions are: 37°C, 5 minutes, 10°C, 5 minutes, 20°C, 5 minutes, 15 cycles, and 4°C. Digest with AarI, using the digestion system shown in Table 3:
[0036] Table 3 Enzyme digestion system
[0037] Table Ara I Digest reaction
[0038] Prime mix 8 μL pCAMBIA1300-35S::RfxCas13d-AtU6::crRNAx (200 ng) 1.5 μL T4 buffer 1 μL Raa I buffer 1.5 μL Raa I 1 μL H2O To 15 (15-x)
[0039] The vector DNA was purified using a purification kit. 10 μL of the ligation product was used to transform E. coli DH5α cells. The cells were plated in LB medium and cultured overnight at 37°C. Single colonies were selected for PCR verification using specific primers. The expected product size was initially verified by agarose gel electrophoresis. If consistent with the expected size, the product was sent for sequencing. The sequence of AtU6::crRNA1234, containing four multi-target sites, was obtained as shown in SEQ ID No. 10. After correct sequencing, the cells were transformed into Agrobacterium tumefaciens GV3101::pMP90, generating Agrobacterium strains harboring single-target or multi-target plasmids containing crRNAs targeting PSTVd.
[0040] Agrobacterium containing a single-target or multi-target plasmid containing crRNA targeting PSTVd prepared in Example 2 was used to genetically transform potatoes. The recipient material was potato K18. The specific method was as follows:
[0041] Potato test tube seedlings K18 that had been grown normally for 25 days on 3% MS solid medium (22°C, 16 h light / 8 h dark) were propagated on 8% MS solid medium (containing activated carbon, 1.5 g / L) and placed in a tuber culture room (22°C, 8 h light / 16 h dark) for cultivation. Test tube potatoes that had grown for 2 months were ready for genetic transformation. Agrobacterium containing the target plasmid was streaked on LB solid medium (containing the corresponding antibiotics) for activation, and a single colony was picked and incubated in 20 mL YEB liquid medium (containing the corresponding antibiotics) at 28°C, 250 rpm / min for 24 h. 1 mL of the bacterial solution was taken and subcultured in 50 mL YEB liquid medium (containing the corresponding antibiotics) at 28°C, 250 rpm / min until the OD 600 About 0.5 (about 5-6 h), 5000 rpm / min, centrifuge for 10 min, remove the supernatant, and resuspend in an equal amount of 3% MS liquid culture medium.
[0042] Add a small amount of 3% MS liquid medium to a glass dish and slice the tube potato slices horizontally to a thickness of approximately 1-2 mm. Place the slices in a suspension of Agrobacterium containing the target plasmid and infect for 10 minutes. During this time, shake the cells and discard the inoculum. Place the slices on filter paper and air dry for 15 minutes. After absorbing the inoculum, transfer the slices to P1 co-culture medium (4.43 g / L MS, 30 g / L sucrose, 0.2 mg / L GA3, 0.2 mg / L IAA, 0.5 mg / L 6-BA, 2 mg / L zeatin, 8 g / L agar, pH 5.8) and incubate at 26°C in the dark for 48 hours. After dark culture, the tubers were transferred to P2 differentiation medium (4.43 g / L MS, 30 g / L sucrose, 0.2 mg / L GA3, 0.2 mg / L IAA, 0.5 mg / L 6-BA, 2 mg / L zeatin, 50 mg / L kanamycin, 400 mg / L cefotaxime, 8 g / L agar, pH 5.8), and cultured at 26°C (16 h light / 8 h dark). Resistant buds grew at the incision, and the differentiation medium was replaced every 15 days (the medium can be replaced in time according to the contamination situation). After the lateral buds grow to 0.5 cm-0.8 cm (about 1 week), the lateral buds of the tuber are cut off, and the resistant buds grown on the cut surface of the potato slices (1-2 months, the time is uncertain) are inoculated into P3 rooting medium (4.43 g / L MS, 30 g / L sucrose, 50 mg / L kanamycin, 400 mg / L cefotaxime, 8 g / L agar, pH 5.8). When the resistant buds grow to 1 cm, secondary rooting can be carried out, and then a positive test is performed.
[0043] To improve transformation efficiency, potato K18 was transformed with equal amounts of Agrobacterium harboring the four single-target CRISPR-RfxCas13d vectors targeting PSTVd. Rooting lines were then analyzed by PCR using RfxCas13d-specific primers. Cas13d-specific bands were detected in 9 of the 12 RfxCas13d-PSTVd lines, whereas no corresponding bands were detected in non-transgenic K18 samples (Figure 3). Potato K18 was then transformed with Agrobacterium harboring the multi-target CRISPR-RfxCas13d vectors targeting PSTVd. Rooting lines were then analyzed by PCR using RfxCas13d-specific primers. Preliminary identification revealed that Cas13d-specific bands were detected in 5 of the 6 lines (Figure 4). Positive lines were then sequenced using single clones to verify the presence of the target sites in each line.
[0044] In order to identify the resistance of CRISPR-Cas13d single-target transgenic lines, K18 at the three-leaf stage and potato transgenic plants transformed with a single-target vector were infected with PSTVd, and the phenotypes were observed for 14 days.
[0045] Single-base mutations in PSTVd may significantly impact its infection cycle and pathogenicity. To avoid mutations caused by multiple generations of PSTVd, this study used infectious clones for inoculation. Agrobacterium GV3101 containing the pCAMBIA1300::35S-PSTVd-S plasmid (the PSTVd sequence shown in SEQ ID No. 1 inserted between XbaI and SacI in the multiple cloning site downstream of the 35S promoter in the pCambia1300-35S-EGFP vector) was activated by streaking onto YEB solid medium plates and incubated at 28°C for 2 days. A single colony was selected and inoculated into 5 mL of YEB liquid medium (containing Kan and Rif) and cultured overnight at 28°C at 200 rpm / min. An appropriate amount of the bacterial suspension was then added to 50 mL of YEB liquid medium (containing Kan and Rif) and incubated at 28°C at 250 rpm / min for approximately 6 hours until the OD reached 0. 600 The Agrobacterium pellet was approximately 0.5. The pellet was centrifuged at 8000 rpm for 10 minutes, and an equal volume of MMA solution (10 mM MgCl2, 10 mM MES, 100 μM AS, pH 5.6) was collected and resuspended in the dark at 28°C for 3 hours. Potato leaves were injected using a 1 ml needleless syringe, with two leaves per plant injected (approximately 1 / 5 to 1 / 4 of the leaf area). Plants were placed in darkness at 23°C for 48 hours and then incubated at 25°C under 16 h light / 8 h dark conditions. Disease symptoms began to appear after 14 days, and were evident after 21 days. Total RNA was extracted from top systemic leaves of the plants for Northern blot analysis of PSTVd.
[0046] The results showed that the control (K18) plants inoculated with PSTVd showed obvious symptoms of dwarfing and bunchy top, but none of the three single-target transgenic lines showed obvious symptoms (Figure 5, A, B). Further RNA extraction from plant leaves and Northern blotting revealed that the accumulation of mature PSTVd and vd-sRNA was significantly reduced in the transgenic lines. Lines 7 (35S::Cas13d-crRNA4-1) and 11 (35S::Cas13d-crRNA4-2) showed less accumulation of mature PSTVd and vd-sRNA than line 2 (35S::Cas13d-crRNA1) (Figure 5, C). This indicates that transgenic lines expressing the single CRISPR-Cas13d targets crRNA4 and crRNA1 have strong resistance to PSTVd, with target crRNA4 operating more efficiently than target crRNA1.
[0047] To characterize the resistance of CRISPR-RfxCas13d multi-target transgenic lines, three-leaf-stage K18 plants and potato transgenic plants harboring the multi-target vector were inoculated with PSTVd-S using the same infection method as described for single-target transgenic lines. After 21 days, the control group (K18) inoculated with PSTVd-S showed significant signs of dwarfing and bunchy top in most transgenic lines (Figure 6, A). Statistical analysis of plant height data revealed that only the control group (K18) showed a highly significant difference in plant height before and after PSTVd inoculation (Figure 6, B), indicating that the multi-target transgenic lines showed no obvious signs of dwarfing and demonstrated good resistance to PSTVd.
[0048] Viroid assays of systemic leaves from plant apex revealed significantly reduced accumulation of mature PSTVd-S and vd-sRNA in transgenic lines. Accumulation of mature PSTVd-S and vd-sRNA was extremely low, almost to zero, in the multi-target lines M1 (35S::Cas13d-crRNA1234-1) and M2 (35S::Cas13d-crRNA1234-2) (Figure 6, C), indicating high resistance to PSTVd. Accumulation of mature PSTVd-S and vd-sRNA was also reduced by 50% in the multi-target lines M3 (35S::Cas13d-crRNA1234-3) and M5 (35S::Cas13d-crRNA1234-5) (Figure 6, C), demonstrating the overall superior editing efficiency of the CRISPR-RfxCas13d multi-target system.
[0049] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.
Claims
1. A method for improving potato PSTVd resistance based on the CRISPR-RfxCas13d system, characterized in that: The following steps are included: Design a single-target or multi-target crRNA of the CRISPR-RfxCas13d system targeting potato spindle tuber viroid PSTVd, wherein the sequence of the single-target crRNA targets the PSTVd sequence shown in SEQ ID No.2 or SEQ ID No.5, and the multi-target crRNA simultaneously targets the PSTVd sequences shown in SEQ ID No.6-9; Construction of CRISPR-RfxCas13d vectors containing single-target and multi-target crRNA targeting PSTVd; The CRISPR-RfxCas13d vector was transformed into potatoes under the mediation of Agrobacterium, and transgenic plants with improved potato PSTVd resistance were screened.
2. The method according to claim 1, characterized in that In step 1, the nucleotide sequence of potato spindle tuber viroid PSTVd is shown as SEQ ID No.
1.
3. The method according to claim 1, characterized in that In step 2, the CRISPR-RfxCas13d vector comprises a RfxCas13d gene expression cassette and a gRNA expression cassette, wherein the RfxCas13d gene expression cassette is composed of a CaMV35S promoter, a RfxCas13d gene, a SV40 NLS, and a Nos-T element connected in sequence, and the gRNA expression cassette is composed of a sequentially connected AtU6 promoter, a DR sequence, and a single target or multi-target crRNA sequence targeting PSTVd.
4. The method according to claim 1, characterized in that: In step 3, the Agrobacterium is a GV3101::pMP90 strain.
5. The CRISPR-RfxCas13d editing system constructed by the method described in any one of claims 1 to 3.
6. A crRNA sequence, characterized in that The CRISPR‑RfxCas13d editing system described in claim 5 can be used to directionally shear the RNA of potato spindle tuber viroid PSTVd and knock down its expression in plants under the mediation of crRNA, and the sequence of the crRNA is the reverse complementary sequence of the sequence shown in SEQ ID No. 2 or SEQ ID No. 5 or SEQ ID No. 6 to 9.
7. Use of the CRISPR-Cas13d editing system according to claim 5 and the crRNA sequence according to claim 6 in the preparation of a kit for preventing and controlling potato spindle tuber viroid PSTVd.
Citation Information
Patent Citations
amiRNA capable of improving PSTVd resistance of potatoes and application thereof
CN110684766A
CRISPR / RfxCas13d anti-plant RNA virus vector and construction method and application of CRISPR / RfxCas13d anti-plant RNA virus vector
CN111549054A
Breeding method of sweet potatoes with SPVD resistance
CN113249403A
Virus-derived polynucleotides for modifying plants
CN116964208A
Method for improving potato PSTVd resistance based on CRISPR-RfxCas13d system and product and application thereof
CN117625682A