Therapeutic oligonucleotide-containing pharmaceutical compositions and dosing regimens using the same
The use of therapeutic oligonucleotides, specifically ds RNAi agents, in formulations for intravenous or subcutaneous administration effectively modulates ANGPTL3 expression, addressing the need to treat diseases associated with ANGPTL3 while maintaining a favorable benefit-to-risk profile.
Patent Information
- Application Number
- PCT/US2024/058875
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-08
- Filing Date
- 2024-12-06
- Publication Date
- 2025-06-12
AI Technical Summary
There is a need for safe and effective formulations containing therapeutic oligonucleotides that modulate ANGPTL3 expression to attenuate, prevent, or treat diseases associated with ANGPTL3 expression, while maintaining an acceptable benefit-to-risk profile.
The disclosure describes doses of a therapeutic oligonucleotide, specifically a ds RNAi agent, that modulates ANGPTL3 expression, ranging from about 24 mg to about 960 mg, and pharmaceutical compositions including the ds RNAi agent for intravenous or subcutaneous administration.
The described doses and formulations effectively reduce ANGPTL3 expression, leading to decreased levels of triglycerides, LDL-C, non-HDL-C, and ApoB for up to 6 months, thereby reducing the risk of major adverse cardiovascular events.
Smart Images

Figure IMGF000041_0001 
Figure IMGF000042_0001 
Figure IMGF000042_0002
Abstract
Description
THERAPEUTIC OLIGONUCLEOTIDE-CONTAINING PHARMACEUTICAL COMPOSITIONS AND DOSING REGIMENS USING THE SAMEREFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0001] The disclosure is being filed along with a Sequence Listing in ST.26 XML format. The Sequence Listing is provided as a file titled “30764_US_PRI_SeqList” created 11 November 2023 and is 6 kilobytes (kb) in size. The Sequence Listing information in the ST.26 XML format is incorporated herein by reference in its entirety.TECHNICAL FIELD
[0002] This disclosure generally relates to biology and medicine, and more specifically it relates to pharmaceutical compositions such as formulations having therapeutic oligonucleotides (e.g., ds RNAi agents) that modulate angiopoi etin-like 3 gene (ANGPTL3) expression and relates to dosing regimens using the same for attenuating, preventing and / or treating diseases, disorders and / or conditions associated with ANGPTL3 expression.BACKGROUND
[0003] Angiopoietin-like 3 protein (ANGPTL3) is a member of the angiopoi etin-like family of secreted proteins that regulates lipid metabolism and that is primarily expressed in the liver (Koishi et al. (2002) Nat. Genet. 30: 151-157). ANGPTL3 inhibits lipoprotein lipase (LPL), which catalyzes the hydrolysis of triglycerides (TGs), as well as inhibits endothelial lipase (EL), which hydrolyzes high-density lipoprotein (HDL) phospholipids.
[0004] Hypertriglyceridemia is a lipid metabolism disorder characterized by an abnormally elevated concentration of TGs in the blood (e.g., > 150 mg / dL). Hypertriglyceridemia has been associated with the development of cardiovascular diseases (e.g., arteriosclerosis). Severe hypertriglyceridemia (e.g., >500 mg / dL) may cause pancreatitis, eruptive xanthomas or lipemia retinalis. In some cases, extremely high levels of chylomicrons can cause chylomicronemia syndrome, which is characterized by recurrent abdominal pain, nausea, vomiting and pancreatitis (Pejic & Lee (2006) J. Am. Board. Fam. Med. 19:310-316). Hyperlipidemia is another lipid metabolism disorder that is characterized by elevated levels of any one or all lipids and / or lipoproteins in the blood.
[0005] Biochemical, clinical and genetic studies have shown that loss of function, inactivating or downregulating expression of ANGPTL3 is associated with reduced plasma levels of TGs, low-density lipoprotein-cholesterol (LDL-C) and non-high-density lipoproteincholesterol (non-HDL-C), which consequently can lead to reduced atherosclerotic lesions and risk of cardiovascular events.
[0006] In view thereof, there is a need for safe and effective formulations including therapeutic oligonucleotides that modulate ANGPTL3 expression and for dosing regimens using the same for attenuating, preventing and / or treating diseases, disorders and / or conditions associated with ANGPTL3 expression, while also preserving an overall acceptable benefit / risk profile to the individual.BRIEF SUMMARY
[0007] To address this need, the disclosure describes doses of a therapeutic oligonucleotide that modulates ANGPTL3 expression, where a dose thereof can be from about 24 mg to about 960 mg. In some instances, the therapeutic oligonucleotide is a RNAi agent, especially a double-stranded (ds) RNAi agent. In certain instances, the ds RNAi agent has a sense strand and an antisense strand, where the sense strand includes a nucleotide sequence of SEQ ID NO: 1 or 3 and where the antisense strand includes a nucleotide sequence of SEQ ID NO:2 or 4. Such doses can be used in attenuating, preventing and / or treating diseases, disorders and / or conditions associated with ANGPTL3 expression.
[0008] In some instances, the dose can be from about 24 mg to about 960 mg. In other instances, the dose can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg.
[0009] In addition, and to facilitate administering the doses herein to an individual in need thereof, the disclosure describes pharmaceutical compositions such as formulations that include at least the ds RNAi agent herein, or a pharmaceutically acceptable salt thereof, that modulates ANGPTL3 expression. Such formulations can be used in attenuating, preventing and / or treating diseases, disorders and / or conditions associated with ANGPTL3 expression. For example, the formulations can be used to reduce the risk of major adverse cardiovascular events (MACE) inindividuals with or at high risk of atherosclerotic cardiovascular disease (ASCVD) and high apolipoprotein B (ApoB)-containing lipoprotein levels. Moreover, such formulations can be packaged for intravenous (IV) or subcutaneous (SC) administration as described herein with maintenance of, for example, product stability and other desirable attributes.
[0010] In particular, pharmaceutical compositions are described that include the ds RNAi agent herein or a pharmaceutically acceptable salt thereof in water (H2O).
[0011] In some instances, the ds RNAi agent can be at a concentration from about 100 mg / mL to about 300 mg / mL. In other instances, the ds RNAi agent can be at a concentration from about 150 mg / mL to about 170 mg / mL, especially about 160 mg / mL, or from about 190 mg / mL to about 210 mg / mL, especially about 200 mg / mL.
[0012] In some instances, the formulations can be at a pH from about 6.0 to about 8.0. In other instances, the formulations can be at a pH of about 7.0.
[0013] In some instances, the pharmaceutical compositions herein can be preservative free.
[0014] In some instances, the pharmaceutical compositions herein can be diluted with about 0.9% NaCl injection for lower doses.
[0015] In one particular instance, a pharmaceutical composition includes a ds RNAi agent that modulates ANGPTL3 expression, where the ds RNAi agent has a sense strand having a nucleotide sequence of SEQ ID NO: 1 and an antisense strand having a nucleotide sequence of SEQ ID NO:2 in H2O at a concentration from about 150 mg / mL to about 170 mg / mL, especially about 160 mg / mL, at pH 7.0, and where the pharmaceutical composition is preservative free.
[0016] In another instance, a pharmaceutical composition includes a ds RNAi agent that modulates ANGPTL3 expression, where the ds RNAi agent has a sense strand having a nucleotide sequence of SEQ ID NO: 1 and an antisense strand having a nucleotide sequence of SEQ ID NO:2 in H2O at a concentration from about 190 mg / mL to about 210 mg / mL, especially about 200 mg / mL, at pH 7.0, and where the pharmaceutical composition is preservative free.
[0017] In one particular instance, a pharmaceutical composition includes a ds RNAi agent that modulates ANGPTL3 expression, where the ds RNAi agent has a sense strand having a nucleotide sequence of SEQ ID NO:3 and an antisense strand having a nucleotide sequence of SEQ ID NO:4 in H2O at a concentration from about 150 mg / mL to about 170 mg / mL,especially about 160 mg / mL, at pH 7.0, and where the pharmaceutical composition is preservative free.
[0018] In another instance, a pharmaceutical composition includes a ds RNAi agent that modulates ANGPTL3 expression, where the ds RNAi agent has a sense strand having a nucleotide sequence of SEQ ID NO:3 and an antisense strand having a nucleotide sequence of SEQ ID NO:4 in H2O at a concentration from about 190 mg / mL to about 210 mg / mL, especially about 200 mg / mL, at pH 7.0, and where the pharmaceutical composition is preservative free.
[0019] The disclosure also describes dosing regimens for and methods of attenuating, preventing and / or treating diseases, disorders and / or conditions associated with ANGPTL3 expression, where such methods include a step of administering to an individual in need thereof a first dose of a ds RNAi agent that modulates ANGPTL3 expression or a pharmaceutical composition thereof such as a formulation herein, where the dose can be from about 24 mg to about 908 mg.
[0020] In some instances, the ds RNAi agent includes a sense strand having a nucleotide sequence of SEQ ID NO: 1 and an antisense strand having a nucleotide sequence of SEQ ID NO:2. In other instances, the ds RNAi agent includes a sense strand having a nucleotide sequence of SEQ ID NO:3 and an antisense strand having a nucleotide sequence of SEQ ID NO:4.
[0021] In some instances, the first dose can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg.
[0022] In some instances, the methods include a step of administering one or more subsequent doses (ie., second, third, fourth, fifth, et seq. dose) about every month (Q1M), about every three months (Q3M), about every six months (Q6M) or about every nine months (Q9M) from the first dose (or from a previous dose for any other subsequent dose), where the one or more subsequent doses can be from about 24 mg to about 960 mg.
[0023] In some instances, the one or more subsequent doses can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg.
[0024] In some instances, the one or more subsequent doses can be the same as the first dose. In other instances, the one or more subsequent doses can be different from the first dose. In yet other instances, a second dose can be the same as the other subsequent doses (but all different from the first dose). In yet other instances, the second dose can be different from the other subsequent doses (but not all are necessarily different from the first dose).
[0025] In one particular instance, the second dose can be administered about 1 month, about 3 months, about 6 months or about 9 months after the first dose, and any other subsequent doses (z.e., third, fourth, fifth, et seq. dose) can be administered about Q1M, about Q3M, about Q6M or about Q9M from the second dose or from a previous dose thereafter. In another particular instance, the second dose can be administered about 3 months after the first dose, and any other subsequent doses (z.e., third, fourth, fifth, et seq. dose) can be administered about Q3M from the second dose or from a previous dose thereafter. In another particular instance, the second dose can be administered about 6 months after the first dose, and any other subsequent doses (z.e., third, fourth, fifth, et seq. dose) can be administered about Q6M from the second dose or from a previous dose thereafter. In another particular instance, the second dose can be administered about 9 months after the first dose, and any other subsequent doses (z.e., third, fourth, fifth, et seq. dose) can be administered about Q9M from the second dose or from a previous dose thereafter.
[0026] Alternatively, the disclosure describes methods of reducing ANGPTL3 expression, where such methods include a step of administering to an individual in need thereof a first dose of a ds RNAi agent that modulates ANGPTL3 expression or a pharmaceutical composition thereof such as a formulation herein, where the dose can be from about 24 mg to about 960 mg.
[0027] In some instances, the ds RNAi agent includes a sense strand having a nucleotide sequence of SEQ ID NO: 1 and an antisense strand having a nucleotide sequence of SEQ ID NO:2. In other instances, the ds RNAi agent includes a sense strand having a nucleotide sequence of SEQ ID NO:3 and an antisense strand having a nucleotide sequence of SEQ ID NO:4.
[0028] In some instances, the first dose can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg,about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg.
[0029] In some instances, the methods include a step of administering one or more subsequent doses (z.e., second, third, fourth, fifth, et seq. dose) about every Q1M, about every Q3M, about every Q6M or about every Q9M following the first dose (or from a previous dose in the case of a third, fourth, fifth, et seq. dose), where the one or more subsequent doses can be from about 24 mg to about 960 mg.
[0030] In some instances, the one or more subsequent doses can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg.
[0031] In some instances, the one or more subsequent doses can be the same as the first dose. In other instances, the one or more subsequent doses can be different from the first dose. In yet other instances, a second dose can be the same as the other subsequent doses (but all different from the first dose). In yet other instances, the second dose can be different from the other subsequent doses (but not all are necessarily different from the first dose).
[0032] In one particular instance, the second dose can be administered about 1 month, about 3 months, about 6 months or about 9 months after the first dose, and any other subsequent doses (z.e., third, fourth, fifth, et seq. dose) can be administered about Q1M, about Q3M, about Q6M or about Q9M from the second dose or from a previous dose thereafter. In another particular instance, the second dose can be administered about 3 months after the first dose, and any other subsequent doses (z.e., third, fourth, fifth, et seq. dose) can be administered about Q3M from the second dose or from a previous dose thereafter. In another particular instance, the second dose can be administered about 6 months after the first dose, and any other subsequent doses (z.e., third, fourth, fifth, et seq. dose) can be administered about Q6M from the second dose or from a previous dose thereafter. In another particular instance, the second dose can be administered about 9 months after the first dose, and any other subsequent doses (z.e., third, fourth, fifth, et seq. dose) can be administered about Q9M from the second dose or from a previous dose thereafter.
[0033] In any of the above methods, the administering of a dose can be by IV administration or by SC administration.
[0034] In any of the above methods, the individual can have a confirmed disease, disorder and / or condition associated with ANGPTL3 expression. In some instances, the individual can be at risk for a disease, disorder and / or condition associated with ANGPTL3 expression, especially abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, homozygous and heterozygous familial hypercholesterolemia, hyperlipidemia, hypertriglyceridemia, obesity, type II diabetes mellitus, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), peripheral artery disease (PAD) and statin-resistant hypercholesterolemia. In other instances, the individual can be an adult with mixed dyslipidemia and established CV disease.
[0035] In any of the above methods, the diseases, disorders and / or conditions associated with ANGPTL3 expression include abnormal lipid and / or cholesterol metabolism, acute pancreatitis, atherosclerosis, cardiovascular disease, coronary artery disease, diabetic nephropathy, homozygous and heterozygous familial hypercholesterolemia, hyperlipidemia, hypertriglyceridemia, obesity, NAFLD, NASH, nephrotic syndrome, PAD, severe hypertriglyceridemia, statin-resistant hypercholesterolemia and type II diabetes mellitus.
[0036] In some instances of any of the above methods, the individual can have an ApoB level of > about 80 mg mg / dL prior to administering a first dose. In other instances, the individual can have a LDL-C level of > about 70 mg / dL prior to administering the first dose. In yet other instances, the individual can have a non-HDL-C of > about 130 mg / dL prior to administering the first dose. In yet other instances, the individual can have a total cholesterol (TC) level of > 180 mg / dL prior to administering the first dose. In yet other instances, the individual can have a TG level of > about 150 mg / dL to < about 500 mg / dL prior to administering the first dose. In certain instances, the individual can have an ApoB level of > about 80 mg / dL, a LDL-C level of > about 70 mg / dL, a non-HDL-C level of > about 130 mg / dL, a TC level of > about 180 mg / dL and / or a TG level of > about 150 mg / dL to < about 500 mg / dL prior to administering the first dose.
[0037] In some instances of any of the above methods, the individual can have an ApoB level of < about 80 mg / dL following one or more doses. In other instances, the individual can have a LDL-C level of < about 70 mg / dL following one or more doses. In yet other instances, the individual can have a non-HDL-C level of < about 130 mg / dL following one or more doses. In yet other instances, the individual can have a TC level of < 180 mg / dL following one or more doses. In yet other instances, the individual can have a TG level of < about 150 mg / dL followingone or more doses. In certain instances, the individual can have an ApoB level of < about 80 mg / dL, a LDL-C level of < about 70 mg / dL, a non-HDL-C level of < about 130 mg / dL, a TC level of < 180 mg / dL and / or a TG level of < about 150 mg / dL following one or more doses.
[0038] The disclosure further describes a composition herein for use as a medicament.
[0039] The disclosure further describes a composition herein for use in the treatment of diseases, disorders and / or conditions associated with ANGPTL3 expression.
[0040] The disclosure further describes an article of manufacture including a formulation herein. In some instances, the article of manufacture is a single-use vial or a multi-use vial. In some instances, the article of manufacture is a pre-filled syringe. In some instances, the article of manufacture is an automatic injection apparatus. In some instances, the article of manufacture is a pump for continuous perfusion, especially a pump for subcutaneous infusion.
[0041] An advantage of the doses, regimens, methods and uses herein is that they provide a limited duration of exposure, durable treatment effects and fewer adverse events (AEs). Likewise, such doses, regimens, methods and uses have a potential to improve acceptance and compliance in view of their infrequent administration that is required.DETAILED DESCRIPTION
[0042] Overview
[0043] Individuals with elevated TGs remain at risk of ASCVD despite use of existing lipid- lowering treatments. Lowering levels of ANGPTL3 can lower levels of TGs and atherogenic ApoB -containing lipoproteins.
[0044] Inti. Patent Application Publication No. WO 2021 / 188795 describes a ds RNAi agent (e.g., ANGPTL3-1412-M1; see also, DP15091P:DP15090G) that can be used for attenuating, preventing and / or treating diseases, disorders and / or conditions associated with ANGPTL3 expression (i.e., reduce the levels of ANGPTL3 mRNA to thereby decrease ANGPTL3 activity / level, as well as to subsequently reduce LPL activity and / or EL activity).
[0045] It is surprisingly shown herein that doses of the ds RNAi agent and formulations including the same rapidly decrease ANGPTL3 (e.g., within about 4 days to about 8 days depending upon dose) after a single dose, can statistically significantly decrease ApoB, LDL- C, non-HDL-C and TG for up to 6 months.
[0046] Abbreviations and Definitions
[0047] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art to which the disclosure pertains. Although any methods and materials similar to or equivalent to those described herein can be used in the practice or testing of the methods herein, the preferred methods and materials are described herein.
[0048] Additionally, reference to an element by the indefinite article “a” or “an” does not exclude the possibility that more than one element is present, unless the context clearly requires that there be one and only one element. The indefinite article “a” or “an” thus usually means “at least one.”
[0049] Moreover, use of “including,” as well as other forms, such as “including but not limited, “include,” “includes” and “included,” is not limiting.
[0050] Certain abbreviations used herein are as follows:
[0051] “AE” refers to adverse event(s); “Apo(a)” refers to apolipoprotein A; “ApoB” refers to apolipoprotein B-100; “ANGPTL3” refers to angiopoi etin-like 3 gene; “ANGPTL3” refers to angiopoietin-like 3 protein; “ASCVD” refers to atherosclerotic cardiovascular disease; “AUC” refers to area under the plasma concentration versus time curve; “AUCT” refers to area under the concentration versus time curve during the dosing interval (T = 28 days); “AUC(o-«>)” refers to area under the concentration versus time curve from time zero to infinity; “AUC(o- tiast)” = area under the concentration versus time curve from time zero to time t, where t is the last time point with a measurable concentration; “bp” refers to base pair(s); “CL / F” refers to apparent total body clearance of drug calculated after extra-vascular administration; “Cmax” refers to maximum observed drug concentration; “CVD” refers to cardiovascular disease; “dL” refers to deciliter(s); “ds” refers to double-stranded; “ECG” refers to electrocardiogram; “EL” refers to endothelial lipase; “HQ” refers to hydrochloric acid; “HDL” refers to high-density lipoprotein(s); “HDL-C” refers to high-density lipoprotein-cholesterol; “H2O” refers to water; “IDL” refers to intermediate-density lipoprotein(s); “IV” refers to intravenous or intravenously; “LDL” refers to low-density lipoprotein(s); “LDL-C” refers to low-density lipoprotein-cholesterol; “Lp(a)” refers to lipoprotein(a) “LPL” refers to lipoprotein lipase; “MACE” refers to major adverse cardiovascular event(s); “mg” refers to milligram(s); “MI” refers to myocardial infarction; “mL” refers to milliliter(s); “mRNA” refers to messenger ribonucleic acid; “NAFLD” refers to nonalcoholic fatty liver disease; “NASH” refers to nonalcoholic steatohepatitis, “NaOH” refers to sodium hydroxide; “NOAEL” refers to no-observed-adverse-effect level; “NOEL” refers to no-observed-effect level; “non-HDL-C” refers to non-high-density lipoprotein-cholesterol; “nt” refers to nucleotide(s); “PAD” refers to peripheral artery disease; “PD” refers to pharmacodynamics; “PK” refers to pharmacokinetics; “PO” refers to phosphodiester; “PS” refers to phosphorothioate; “RISC” refers to RNA- induced silencing complex; “SAE” refers to serious adverse event; “SC” refers to subcutaneous or subcutaneously; “ss” refers to single-stranded; “t’A” refers to half-life associated with the terminal rate constant in non-compartmental analysis; “tmax” refers to time of maximum observed drug concentration; “TC” refers to total cholesterol; “TEAE” refers to treatment- emergent adverse event; “TG” refers to triglyceride(s); “VLDL” refers to very low-density lipoprotein(s); and “WFI” refers to water-for-inj ection.
[0052] Certain definitions used herein are defined as follows:
[0053] As used herein, “about” means within a statistically meaningful range of a value or values such as, for example, a stated concentration, length, molecular weight, pH, sequence similarity, time frame, temperature, volume, etc. Such a value or range can be within an order of magnitude typically within 20%, more typically within 10%, and even more typically within 5% of a given value or range. The allowable variation encompassed by “about” will depend upon the particular system under study, and can be readily appreciated by one of skill in the art.
[0054] As used herein, “administer,” “administering,” “administration” and the like mean providing a substance (e.g., a ds RNAi agent herein or a pharmaceutical composition herein) to an individual in a manner that is pharmacologically useful (e.g., to attenuate, prevent and / or treat a disease, disorder and / or condition in the individual).
[0055] As used herein, “apolipoprotein B-containing lipoprotein” or “ApoB-containing lipoprotein” mean very low-density lipoprotein (VLDL), intermediate-density lipoprotein (IDL), chylomicrons, remnants of such TG-rich lipoproteins, low-density lipoprotein (LDL) and lipoprotein(a) (Lp(a)).
[0056] As used herein, “attenuate,” “attenuating,” “attenuation” and the like mean that a qualitative or quantitative measure of signs and / or symptoms and / or biomarkers of a given disease, disorder and / or condition can be decreased in an individual by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% when administered a substance (when compared to an appropriate control). Although there can be overlap between “attenuating” and “preventing,” it is intended that the latter is amore drastic (z.e., less subtle) decrease in the signs and / or symptoms and / or biomarkers. For example, a disease, disorder and / or condition is “attenuated” if existing signs and / or symptoms and / or biomarkers are reduced in intensity and / or frequency but may not completely disappear.
[0057] As used herein, “chemical stability” means an ability of a substance (e.g., a ds RNAi agent herein or a pharmaceutical composition herein) to resist potential changes in composition in the product due to chemical reactions that may occur, such as aggregation, fragmentation, hydrolysis, isomerization, oxidation and polymerization.
[0058] As used herein, “disease, disorder and / or condition associated with ANGPTL3 expression” and the like mean abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, homozygous and heterozygous familial hypercholesterolemia, hyperlipidemia, hypertriglyceridemia, obesity, type II diabetes mellitus, NAFLD, NASH and statin-resistant hypercholesterolemia.
[0059] As used herein, “dose” or “doses” means a quantity of a substance (e.g., a ds RNAi agent herein or a pharmaceutical composition herein) that is administered to an individual in a discrete amount at a particular point in time. When used in connection with the terms dose, doses, dosing and the like, “adjustment” or “adjusting” mean a quantity of any decrease or increase to the prior-administered dose. When used in connection with the terms dose, doses, dosing and the like, “regimen” means a set of guidelines for determining and administering one or more doses and / or adjustments thereto.
[0060] As used herein, “dosing regimen” or “therapeutic regimen” mean a set of unit doses (typically more than one) that are administered individually to an individual, typically separated by periods of time. A given therapeutic agent can have a recommended dosing regimen, which may involve one or more doses. For example, the dosing regimen can include a plurality of doses, each of which are separated from one another by a predetermined time period. Alternatively, the dosing regimen can include a plurality of doses, each of which are separated from one another by at least two different time periods separating individual doses.
[0061] As used herein, “effective amount” means an amount, concentration or dose of one or more substances (e.g., a ds RNAi agent herein or a pharmaceutical composition herein) that, upon single or multiple dose administration to an individual in need thereof, provides a desired effect in such an individual under diagnosis or treatment (z.e., may produce a clinically measurable difference in a status of the individual). An effective amount can be readily determined by one of skill in the art by using known techniques and by observing resultsobtained under analogous circumstances. In determining the effective amount for an individual, a number of factors are considered, including, but not limited to, the species of the individual, its size, age and general health, the specific disease, disorder and / or condition involved, the degree of or involvement or the severity of the disease, disorder and / or condition, the response of the individual, the particular active ingredient administered, the mode of administration, the bioavailability characteristics of the preparation administered, the dose regimen selected, the use of concomitant therapeutic agent(s), and other relevant circumstances.
[0062] As used herein, “individual” means any mammal, including cats, dogs, mice, rats, and primates (human and non-human), especially humans. Moreover, “participant,” patient” or “subject” may be used interchangeably with “individual.”
[0063] As used herein, “individual in need thereof’ means a mammal, such as a human, with a disease, disorder and / or condition requiring treatment or therapy, including for example, those listed herein. In particular, the preferred individual to be treated is a human, especially an individual having or suspected of having a disease, disorder and / or condition associated with ANGPTL3 expression.
[0064] As used herein, “medicament” means an active ingredient (e.g., a ds RNAi agent herein) to treat a disease, disorder and / or condition associated with ANGPTL3 expression.
[0065] As used herein, “microbiological stability” means an ability of an active ingredient, substance or product to maintain its sterility when exposed to environmental or other microorganisms.
[0066] As used herein, “mixed dyslipidemia” means elevated levels of LDL-C and TG.
[0067] As used herein, “modulate,” “modulating,” “modulation” and the like means to change, affect or interfere with the functioning of the components of systems. For example, the ds RNAi agent herein modulates ANGPTL3 expression by mediating degradation of ANGPTL3 mRNA thereby causing reduced ANGPTL mRNA, reduced ANGPTL3 (level / activity) and / or reduced EL and / or LPL (level / activity).
[0068] As used herein, “nucleotide” means an organic compound having a nucleoside (a nucleobase such as, for example, adenine, cytosine, guanine, thymine, or uracil; and a pentose sugar such as, for example, ribose or 2'-deoxyribose) and a phosphate group. A “nucleotide” can serve as a monomeric unit of nucleic acids such as deoxyribonucleic acid (DNA) oligonucleotides and ribonucleic acid (RNA) oligonucleotides.
[0069] As used herein, “oligonucleotide” means a short nucleic acid molecule (e.g. , less than about 100 nucleotides in length), which may be single-stranded (ss) or ds.
[0070] As used herein, “pharmaceutical formulation” or “formulation” means a preparation that is in such form as to permit the biological activity of the active ingredient (e.g., a ds RNAi agent herein) to be effective and that contains no additional components having unacceptable toxicity to an individual to which the formulation would be administered. Such formulations are sterile. “Pharmaceutically acceptable” excipients (e.g., additives, vehicles, etc.) mean those that reasonably can be administered to an individual to provide an effective dose of the active ingredient employed.
[0071] As used herein, “preservative” means a compound that can be included in a formulation to essentially reduce bacterial action therein, thus facilitating the production of a multi-use formulation. Examples of preservatives include, but are not limited to, octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride (a mixture of alkylbenzyldimethylammonium chlorides in which the alkyl groups are long-chain compounds), and benzethonium chloride. Other preservatives include aromatic alcohols such as phenol, butyl and benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3 -pentanol and m-cresol.
[0072] As used herein, “preservative-free” or “preservative free” means a composition, such as a pharmaceutical composition (i.e., a formulation), that does not contain a preservative.
[0073] As used herein, “prevent,” “preventing,” “prevention” and the like mean that a qualitative or quantitative measure of signs and / or symptoms and / or biomarkers, of a given disease, disorder and / or condition can be decreased in an individual by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% when administered a substance (when compared to an appropriate control). Although there can be overlap between “attenuating” and “preventing,” it is intended that the latter is a more drastic (i.e., less subtle) decrease in the signs and / or symptoms and / or biomarkers. For example, a disease, disorder and / or condition is “prevented” if it does not appear. In this manner, some individuals can be considered (for diverse reasons, including genetics) as likely to develop a disease, disorder and / or condition, and can undergo a preventing regimen (i.e., prophylactic) according to avoid the disease, disorder and / or condition.
[0074] As used herein, “reduced expression,” and with respect to a gene (e.g., ANGPTL3) means a decrease in an amount or level of a RNA transcript (e.g. , ANGPTL3 mRNA) or protein(e.g., ANGPTL3 encoded by the gene and / or a decrease in the amount or level of activity of the gene or its protein in a cell, a population of cells, a sample, an organ, a tissue, a system or an individual, when compared to an appropriate reference (e.g., a reference cell, population of cells, sample, organ, tissue, system or individual). For example, the act of contacting a cell with a substance (e.g., a ds RNAi agent herein or a pharmaceutical composition herein) may result in a decrease in the amount or level of mRNA, protein, and / or activity (e.g., via degradation of ANGPTL3 mRNA by the RNAi pathway) when compared to a cell that is not treated with the substance. Similarly, and as used herein, “reducing expression” means an act that results in reduced expression of a gene (e.g., ANGPTL3). Specifically, and as used herein, “reduction of ANGPTL3 expression” means a decrease in the amount or level of ANGPTL3 mRNA, ANGPTL3, EL and / or LPL concentration and / or activity in a cell, a population of cells, a sample, or an individual when compared to an appropriate reference (e.g., a reference cell, population of cells, tissue, organ, system or individual).
[0075] As used herein, “iRNA,” “iRNA agent,” “RNAi,” “RNAi agent” and “RNA interference agent” means an oligonucleotide that contains RNA and that mediates the targeted cleavage of a RNA transcript via RNA interference, e.g., through a RNA-induced silencing complex (RISC) pathway. The RNAi agent can have a sense strand and an antisense strand, where the sense strand and the antisense strand form a duplex. In some instances, the sense and antisense strands of RNAi agent can be 21-23 nucleotides in length. Alternatively, the sense and antisense strands can be longer, for example, 25-36 nucleotides in length, in which case the longer nucleotide sequences are first processed by the Dicer enzyme. The RNAi agent directs sequence-specific degradation of mRNA via RNA interference. The RNAi agent attenuates, inhibits, modulates or reduces gene expression in a cell, tissue, organ, system or individual (e.g., ANGPTL3 expression).
[0076] As used herein, “stable,” with regard to a formulation, means one in which the active ingredient therein (e.g. , a ds RNAi agent herein) essentially retains its biological activity and / or chemical stability and / or physical stability upon storage. In this manner, the formulation essentially retains its chemical and physical stability, as well as retain its biological activity upon storage. The storage period generally can be based on an intended shelf-life of the formulation.
[0077] As used herein, “sterile,” with regard to a composition, such as a pharmaceutical composition or formulation, means aseptic or free or essentially free from all living microorganisms and spores.
[0078] As used herein, “strand” refers to a single, contiguous sequence of nucleotides linked together through internucleotide linkages (e.g., PO bonds / linkages or PS bond / linkages). A strand can have two free ends (e.g., a 5' end and a 3' end).
[0079] As used herein, “treat,” “treatment” or “treating” mean a process where there may be a slowing, controlling, delaying or stopping of the progression of the diseases, disorders or conditions disclosed herein, or ameliorating disease, disorder or condition symptoms, but does not necessarily indicate a total elimination of all disease, disorder or condition symptoms. Treatment and the like includes administration of a compound, composition or formulation as described herein for treatment of a disease, disorder and / or condition in an individual, particularly in a human.
[0080] Doses and Pharmaceutical Compositions
[0081] The compositions herein include doses and pharmaceutical compositions such as formulations that include an effective amount of a ds RNAi agent that modulates ANGPTL3 expression. Such doses and pharmaceutical compositions can be used in attenuating, preventing and / or treating diseases, disorders and / or conditions associated with ANGPTL3 expression.
[0082] With regard to doses, a dose of the ds RNAi agent can be from about 24 mg to about 960 mg. In some instances, the dose can be from about 28 mg to about 656 mg, from about 32 mg to about 652 mg, from about 36 mg to about 648, from about 40 mg to about 644 mg, from about 44 mg to about 640 mg, from about 48 mg to about 636 mg, from about 52 mg to about 632 mg, from about 56 mg to about 628 mg, from about 60 mg to about 624 mg, from about 64 mg to about 620 mg, from about 68 mg to about 616 mg, from about 72 mg to about 612 mg, from about 76 mg to about 608 mg, from about 80 mg to about 604 mg from about 84 mg to about 600 mg, from about 88 mg to about 596 mg, from about 92 mg to about 592 mg, from about 96 mg to about 588 mg, from about 100 mg to about 884 mg, from about 104 mg to about 880 mg, from about 108 mg to about 876 mg, from about 112 mg to about 872 mg, from about 116 mg to about 868 mg, from about 120 mg to about 864 mg, from about 124 mg to about 860 mg, from about 128 mg to about 856 mg, from about 132 mg to about 852 mg, from about 136 mg to about 848 mg, from about 140 mg to about 844 mg, from about 144 mg to about 840mg, from about 148 mg to about 836 mg, from about 152 mg to about 832 mg, from about 156 mg to about 828 mg, from about 160 mg to about 824, from about 164 mg to about 820 mg, from about 168 mg to about 816 mg, from about 172 mg to about 812 mg, from about 176 mg to about 808 mg, from about 180 mg to about 804 mg, from about 184 mg to about 800 mg, from about 188 mg to about 796 mg, from about 192 mg to about 762 mg, from about 196 mg to about 758 mg, from about 200 mg to about 754 mg, from about 204 mg to about 750 mg, from about 208 mg to about 746 mg, from about 212 mg to about 742 mg, from about 216 mg to about 738 mg, from about 220 mg to about 734 mg, from about 224 mg to about 730 mg, from about 228 mg to about 726 mg, from about 232 mg to about 722 mg, from about 236 mg to about 718 mg, from about 240 mg to about 714 mg, from about 244 mg to about 710 mg, from about 248 mg to about 706 mg, from about 252 mg to about 702 mg, from about 256 mg to about 698 mg, from about 260 mg to about 694 mg, from about 264 mg to about 690 mg, from about 268 mg to about 686 mg, from about 272 mg to about 682 mg, from about 276 to about 678 mg, from about 280 mg to about 674 mg, from about 284 mg to about 670 mg, from about 288 mg to about 664 mg, from about 292 mg to about 660 mg, from about 296 mg to about 656 mg, from about 300 mg to about 652 mg, from about 304 mg to about 648 mg, from about 308 mg to about 644 mg, from about 312 mg to about 640 mg, from about 316 mg to about 636 mg, from about 320 mg to about 632 mg, from about 324 mg to about 628 mg, from about 328 mg to about 624 mg, from about 332 mg to about 620 mg, from about 336 mg to about 616 mg, from about 340 mg to about 612 mg, from about 344 mg to about 608 mg, from about 348 mg to about 604 mg, from about 352 mg to about 600 mg, from about 356 mg to about 596 mg, from about 360 mg to about 592 mg, from about 364 mg to about 588 mg, from about 368 mg to about 584 mg, from about 372 mg to about 580 mg, from about 376 mg to about 576 mg, from about 380 mg to about 572 mg, from about 384 mg to about 568 mg, from about 388 mg to about 564 mg, from about 392 mg to about 560 mg, from about 396 mg to about 556 mg, from about 400 mg to about 552 mg, from about 404 mg to about 548 mg, from about 408 mg to about 544 mg, from about 412 mg to about 540 mg, from about 416 mg to about 536 mg, from about 420 mg to about 532 mg, from about 424 mg to about 528, from about 428 mg to about 524 mg, from about 432 mg to about 520 mg, from about 436 mg to about 516 mg, from about 440 mg to about 512 mg, from about 444 mg to about 508 mg, from about 448 mg to about 504 mg, from about 452 mg to about 500 mg, from about 456 mg to about 496 mg, from about 460 mg to about 492 mg, from about 464 mg to about 488 mg, fromabout 468 mg to about 484 mg, from about 472 mg to about 480 mg, or about 476 mg. In other instances, the dose can be from about 24 mg to about 28 mg, from about 28 mg to about 32 mg, from about 32 mg to about 36 mg, from about 36 mg to about 40 mg, from about 40 mg to about 44 mg, from about 44 mg to about 48 mg, from about 48 mg to about 52 mg, from about 52 mg to about 56 mg, from about 56 mg to about 60 mg, from about 60 mg to about 64 mg, from about 64 mg to about 68 mg, from about 68 mg to about 72 mg, from about 72 mg to about 76 mg, from about 76 mg to about 80 mg, from about 80 mg to about 84 mg, from about 84 mg to about 88 mg, from about 88 mg to about 92 mg, from about 92 mg to about 96 mg, from about 96 mg to about 100 mg, from about 100 mg to about 104 mg, from about 104 mg to about 108 mg, from about 108 mg to about 112 mg, from about 112 mg to about 116 mg, from about 116 mg to about 120 mg, from about 120 mg to about 124 mg, from about 124 mg to about 128 mg, from about 128 mg to about 132 mg, from about 132 mg to about 136 mg, from about 136 mg to about 140 mg, from about 140 mg to about 144 mg, from about 144 mg to about 148 mg, from about 148 mg to about 152 mg, from about 152 mg to about 156 mg, from about 156 mg to about 160 mg, from about 160 mg to about 164 mg, from about 164 mg to about 168 mg, from about 168 mg to about 172 mg, from about 172 mg to about 176 mg, from about 176 mg to about 180 mg, from about 180 mg to about 184 mg, from about 184 mg to about 188 mg, from about 188 mg to about 192 mg, from about 192 mg to about 196 mg, from about 196 mg to about 200 mg, from about 200 mg to about 204 mg, from about 204 mg to about 208 mg, from about 208 mg to about 212 mg, from about 212 mg to about 216 mg, from about 216 mg to about 220 mg, from about 220 mg to about 224 mg, from about 224 mg to about 228 mg, from about 228 mg to about 232 mg, from about 232 mg to about 236 mg, from about 236 mg to about 240 mg, from about 240 mg to about 244 mg, from about 244 mg to about 248 mg from about 248 mg to about 252 mg, from about 252 mg to about 256 mg, from about 256 mg to about 260 mg, from about 260 mg to about 264 mg, from about 264 mg to about 268 mg, from about 268 mg to about 272 mg, from about 272 mg to about 276 mg, from about 276 mg to about 280 mg, from about 280 mg to about 284 mg, from about 284 mg to about 288 mg, from about 288 mg to about 292 mg, from about 292 mg to about 296 mg, from about 296 mg to about 300 mg, from about 300 mg to about 304 mg, from about 304 mg to about 308 mg, from about 308 mg to about 312 mg, from about 312 mg to about 316 mg, from about 316 mg to about 320 mg, from about 320 mg to about 324 mg, from about 324 mg to about 328 mg, from about 328 mg to about 332 mg, from about 332 mg to about 336 mg,from about 336 mg to about 340 mg, from about 340 mg to about 344 mg, from about 344 mg to about 348 mg, from about 348 mg to about 352 mg, from about 352 mg to about 356 mg, from about 356 mg to about 360 mg, from about 360 mg to about 364 mg, from about 364 mg to about 368 mg, from about 368 mg to about 372 mg, from about 372 mg to about 376 mg, from about 376 mg to about 380 mg, from about 380 mg to about 384 mg, from about 384 mg to about 388 mg, from about 388 mg to about 392 mg, from about 392 mg to about 396 mg, from about 396 mg to about 400 mg, from about 400 mg to about 404 mg, from about 404 mg to about 408 mg, from about 408 mg to about 412 mg, from about 412 mg to about 416 mg, from about 416 mg to about 420 mg, from about 420 mg to about 424 mg, from about 424 mg to about 428 mg, from about 428 mg to about 432 mg, from about 432 mg to about 436 mg, from about 436 mg to about 440 mg, from about 440 mg to about 444 mg, from about 444 mg to about 448 mg, from about 448 mg to about 452 mg, from about 452 mg to about 456 mg, from about 456 mg to about 460 mg, from about 460 mg to about 464 mg, from about 464 mg to about 468 mg, from about 468 mg to about 472 mg, from about 472 mg to about 476 mg, from about 476 mg to about 480 mg, from about 480 mg to about 484 mg, from about 484 mg to about 488 mg, from about 488 mg to about 492 mg, from about 492 mg to about 496 mg, from about 496 mg to about 500 mg, from about 500 mg to about 504 mg, from about 504 mg to about 508 mg, from about 508 mg to about 512 mg, from about 512 mg to about 516 mg, from about 516 mg to about 520 mg, from about 520 mg to about 524 mg, from about 524 mg to about 528 mg, from about 528 mg to about 532 mg, from about 532 mg to about 536 mg, from about 536 mg to about 540 mg, from about 540 mg to about 544 mg, from about 544 mg to about 548 mg, from about 548 mg to about 552 mg, from about 552 mg to about 556 mg, from about 556 mg to about 560 mg, from about 560 mg to about 564 mg, from about 564 mg to about 568 mg, from about 568 mg to about 572 mg, from about 572 mg to about 576 mg, from about 576 mg to about 580 mg, from about 580 mg to about 584 mg, from about 584 mg to about 588 mg, from about 588 mg to about 592 mg, from about 592 mg to about 596 mg, from about 596 mg to about 600 mg, from about 600 mg to about 604 mg, from about 604 mg to about 608 mg, from about 608 mg to about 612 mg, from about 612 mg to about 616 mg, from about 616 mg to about 620 mg, from about 620 mg to about 624 mg, from about 624 mg to about 628 mg, from about 628 mg to about 632 mg, from about 632 mg to about 636 mg, from about 636 mg to about 640 mg, from about 644 mg to about 648 mg, from about 648 mg to about 652 mg, from about 652 mg to about 656 mg, from about 656 mg to about 660 mg,from about 664 mg to about 668 mg, from about 668 mg to about 672 mg, from about 672 mg to about 676 mg, from about 676 mg to about 680 mg, from about 680 mg to about 684 mg, from about 684 mg to about 688 mg, from about 688 mg to about 692 mg, from about 692 mg to about 696 mg, from about 696 mg to about 700 mg, from about 700 mg to about 704 mg, from about 704 mg to about 708 mg, from about 708 mg to about 712 mg, from about 712 mg to about 716 mg, from about 716 mg to about 720 mg, from about 720 mg to about 724 mg, from about 724 mg to about 728 mg, from about 728 mg to about 732 mg, from about 732 mg to about 736 mg, from about 736 mg to about 740 mg, from about 740 mg to about 744 mg, from about 744 mg to about 748 mg, from about 748 mg to about 752 mg, from about 752 mg to about 756 mg, from about 756 mg to about 760 mg, from about 760 mg to about 764 mg, from about 764 mg to about 768 mg, from about 768 mg to about 772 mg, from about 772 mg to about 776 mg, from about 776 mg to about 780 mg, from about 780 mg to about 784 mg, from about 784 mg to about 788 mg, from about 788 mg to about 792 mg from about 792 mg to about 796 mg, from about 796 mg to about 800 mg, from about 800 mg to about 804 mg, from about 804 mg to about 808 mg, from about 808 mg to about 812 mg, from about 812 mg to about 816 mg, from about 816 mg to about 820 mg, from about 820 mg to about 824 mg, from about 824 mg to about 828 mg, from about 828 mg to about 832 mg, from about 832 mg to about 836 mg, from about 836 mg to about 840 mg, from about 840 mg to about 844 mg, from about 848 mg to 852 mg, from about 852 mg to about 856 mg, from about 856 mg to about 860 mg, from about 860 mg to about 864 mg, from about 864 mg to about 868 mg, from about 868 mg to about 872 mg, from about 872 mg to about 876 mg, from about 876 mg to about 880 mg, from about 880 mg to about 884 mg, from about 884 mg to about 888 mg, from about 888 mg to about 892 mg, from about 896 mg to about 900 mg, from about 900 mg to about 904 mg, from about 904 mg to about 908 mg, from about 908 mg to about 912 mg, from about 912 mg to about 916 mg, from about 916 mg to about 920 mg, from about 920 mg to about 924 mg, from about 924 mg to about 928 mg, from about 928 mg to about 932 mg, from about 932 mg to about 936 mg, from about 936 mg to about 940 mg, from about 940 mg to about 944 mg, from about 944 mg to about 948 mg, from about 948 mg to about 952 mg, from about 952 mg to about 956 mg, from about 956 mg to about 960 mg. In certain instances, the dose can be about 24 mg, about 28 mg, about 32 mg, about 36 mg, about 40 mg, about 44 mg, about 48 mg, about 52 mg, about 56 mg, about 60 mg, about 64 mg, about 68 mg, about 72 mg, about 76 mg, about 80 mg, about 84 mg, about 88 mg, about 92 mg, about 96 mg, about100 mg, about 104 mg, about 108 mg, about 112 mg, about 116 mg, about 120 mg, about 124 mg, about 128 mg, about 132 mg, about 136 mg, about 140 mg, about 144 mg, about 148 mg, about 152 mg, about 156 mg, about 160 mg, about 164 mg, about 168 mg, about 172 mg, about 176 mg, about 180 mg, about 184 mg, about 188 mg, about 192 mg, about 196 mg, about 200 mg, about 204 mg, about 208 mg, about 212 mg, about 216 mg, about 220 mg, about 224 mg, about 228 mg, about 232 mg, about 236 mg, about 240 mg, about 244 mg, about 248 mg, about 252 mg, about 256 mg, about 260 mg, about 264 mg, about 268 mg, about 272 mg, about 276 mg, about 280 mg, about 284 mg, about 288 mg, about 292 mg, about 286 mg, about 300 mg, about 304 mg, about 308 mg, about 312 mg, about 316 mg, about 320 mg, about 324 mg, about 328 mg, about 332 mg, about 336 mg, about 340 mg, about 344 mg, about 348 mg, about 352 mg, about 356 mg, about 360 mg, about 364 mg, about 368 mg, about 372 mg, about 376 mg, about 380 mg, about 384 mg, about 388 mg, about 392 mg, about 396 mg, about 400 mg, about 404 mg, about 408 mg, about 412 mg, about 416 mg, about 420 mg, about 424 mg, about 428 mg, about 432 mg, about 436 mg, about 440 mg, about 444 mg, about 448 mg, about 452 mg, about 456 mg, about 460 mg, about 464 mg, about 468 mg, about 472 mg, about 476 mg, about 480 mg, about 484 mg, about 488 mg, about 492 mg, about 496 mg, about 500 mg, about 504 mg, about 508 mg, about 512 mg, about 516 mg, about 520 mg, about 524 mg, about 528 mg, about 532 mg, about 536 mg, about 540 mg, about 544 mg, about 548 mg, about 552 mg, about 556 mg, about 560 mg, about 564 mg, about 568 mg, about 572 mg, about 576 mg, about 580 mg, about 584 mg, about 588 mg, about 592 mg, about 596 mg, about 600 mg, about 604 mg, about 608 mg, about 612 mg, about 616 mg, about 620 mg, about 624 mg, about 628 mg, about 632, about 636 mg, about 640 mg, about 644 mg, about 648 mg, about 652 mg, about 656 mg, about 660 mg, about 664 mg, about 668 mg, about 672 mg, about 676 mg, about 680 mg, about 684 mg, about 688 mg, about 692 mg, about 696 mg, about 700 mg, about 704 mg, about 708 mg, about 712 mg, about 716 mg, about 720 mg, about 724 mg, about 728 mg, about 732 mg, about 736 mg, about 740 mg, about 744 mg, about 748 mg, about 752 mg, about 756 mg, about 760 mg, about 764 mg, about 768 mg, about 772 mg, about 776 mg, about 780 mg, about 784 mg, about 788 mg, about 792 mg, about 796 mg, about 800 mg, about 804 mg, about 808 mg, about 812 mg, about 816 mg, about 820 mg, about 824 mg, about 828 mg, about 832 mg, about 836 mg, about 840 mg, about 844 mg, about 848 mg, about 852 mg, about 856 mg, about 860 mg, about 864 mg, about 868 mg, about 872 mg, about 876 mg, about 880 mg, about 884 mg, about 888 mg, about 892 mg, about 896 mg, about 900 mg, about 904 mg, about 908 mg, about912 mg, about 916 mg, about 920 mg, about 924 mg, about 928 mg, about 932 mg, about 936 mg, about 940 mg, about 944 mg, about 948 mg, about 952 mg, about 956 mg or about 960 mg. In other certain instances, the dose can In some instances, the dose can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg, especially about 24 mg, about 72 mg, about 100 mg, about 208 mg, about 400 mg, about 480 mg, about 800 mg or about 960 mg.
[0083] Alternatively, the dose can be from about 1 mg to about 5 mg, about 5 mg to about 10 mg, about 10 mg to about 15 mg, about 15 mg to about 20 mg, about 20 mg to about 25 mg, about 25 mg to about 30 mg, about 30 mg to about 35 mg, about 35 mg to about 40 mg, about 40 mg to about 45 mg, about 45 mg to about 50 mg, about 50 mg to about 55 mg, about 55 mg to about 60 mg, about 60 mg to about 65 mg, about 65 mg to about 70 mg, about 70 mg to about 75 mg, about 75 mg to about 80 mg, about 80 mg to about 85 mg, about 85 mg to about90 mg, about 90 mg to about 95 mg, about 95 mg to about 100 mg, about 100 mg to about 105 mg, about 105 mg to about 110 mg, about 110 mg to about 115 mg, about 115 mg to about 120 mg, about 120 mg to about 125 mg, about 125 mg to about 130 mg, about 130 mg to about 135 mg, about 135 mg to about 140 mg, about 140 mg to about 145 mg, about 145 mg to about 150 mg, about 150 mg to about 155 mg, about 155 mg to about 160 mg, about 160 mg to about 165 mg, about 165 mg to about 170 mg, about 170 mg to about 175 mg, about 175 mg to about 180 mg, about 180 mg to about 185 mg, about 185 mg to about 190 mg, about 190 mg to about 195 mg, about 195 mg to about 200 mg, about 200 mg to about 205 mg, about 205 mg to about 210 mg, about 210 mg to about 215 mg, about 215 mg to about 220 mg, about 220 mg to about 225 mg, about 225 mg to about 230 mg, about 230 mg to about 235 mg, about 235 mg to about 240 mg, about 240 mg to about 245 mg, about 245 mg to about 250 mg, about 250 mg to about 255 mg, about 255 mg to about 260 mg, about 260 mg to about 265 mg, about 265 mg to about 270 mg, about 270 mg to about 275 mg, about 275 mg to about 280 mg, about 280 mg to about 285 mg, about 285 mg to about 290 mg, about 290 mg to about 295 mg, about 295 mg to about 300 mg, about 300 mg to about 305 mg, about 305 mg to about 310 mg, about 310 mg to about 315 mg, about 315 mg to about 320 mg, about 320 mg to about 325 mg, about 325 mg to about 330 mg, about 330 mg to about 335 mg, about 335 mg to about 340 mg, about 340 mg to about 345mg, about 345 mg to about 350 mg, about 350 mg to about 355 mg, about 355 mg to about 360 mg, about 360 mg to about 365 mg, about 365 mg to about 370 mg, about 370 mg to about 375 mg, about 375 mg to about 380 mg, about 380 mg to about 385 mg, about 385 mg to about 390 mg, about 390 mg to about 395 mg, about 395 mg to about 400 mg, about 400 mg to about 405 mg, about 405 mg to about 410 mg, about 410 mg to about 415 mg, about 415 mg to about 420 mg, about 420 mg to about 425 mg, about 425 mg to about 430 mg, about 430 mg to about 435 mg, about 435 mg to about 440 mg, about 440 mg to about 445 mg, about 445 mg to about 450 mg, about 450 mg to about 455 mg, about 455 mg to about 460 mg, about 460 mg to about 465 mg, about 465 mg to about 470 mg, about 470 mg to about 475 mg, about 475 mg to about 480 mg, about 480 mg to about 485 mg, about 485 mg to about 490 mg, about 490 mg to about 495 mg, about 495 mg to about 500 mg, about 500 mg to about 505 mg, about 505 mg to about 510 mg, about 510 mg to about 515 mg, about 515 mg to about 520 mg, about 520 mg to about 525 mg, about 525 mg to about 530 mg, about 530 mg to about 535 mg, about 535 mg to about 540 mg, about 540 mg to about 545 mg, about 545 mg to about 550 mg, about 550 mg to about 555 mg, about 555 mg to about 560 mg, about 560 mg to about 565 mg, about 565 mg to about 570 mg, about 570 mg to about 575 mg, about 575 mg to about 580 mg, about 580 mg to about 585 mg, about 585 mg to about 590 mg, about 590 mg to about 595 mg, or about 595 mg to about 600 mg, about 600 mg to about 605 mg, about 605 mg to about 610 mg, about 610 mg to about 615 mg, about 615 mg to about 620 mg, about 620 mg to about 625 mg, about 625 mg to about 630 mg, about 630 mg to about 635 mg, about 635 mg to about 640 mg, about 640 mg to about 645 mg, about 645 mg to about 650 mg, about 650 mg to about 655 mg, about 655 mg to about 660 mg, about 660 mg to about 665 mg, about 665 mg to about 670 mg, about 670 mg to about 675 mg, about 675 mg to about 680 mg, about 680 mg to about 685 mg, about 685 mg to about 690 mg, about 690 mg to about 695 mg, about 695 mg to about 700 mg, about 700 mg to about 705 mg, about 705 mg to about 710 mg, about 710 mg to about 715 mg, about 715 mg to about 720 mg, about 720 mg to about 725 mg, about 725 mg to about 730 mg, about 730 mg to about 735 mg, about 735 mg to about 740 mg, about 740 mg to about 745 mg, about 745 mg to about 750 mg, about 750 mg to about 755 mg, about 755 mg to about 760 mg, about 760 mg to about 765 mg, about 765 mg to about 770 mg, about 770 mg to about 775 mg, about 775 mg to about 780 mg, about 780 mg to about 785 mg, about 785 mg to about 790 mg, about 790 to about 795 mg, about 795 mg to about 800 mg, about 800 mg to about 805 mg, about 805 mg to about 810 mg, about 810 mg to about 815 mg, about 815 mg to about 820 mg, about 820 mg to about825 mg, about 825 mg to about 830 mg, about 830 mg to about 835 mg, about 835 mg to about 840 mg, about 840 mg to about 845 mg, about 845 mg to about 850 mg, about 850 mg to about 855 mg, about 855 mg to about 860 mg, about 860 mg to about 865 mg, about 865 mg to about 870 mg, about 870 mg to about 875 mg, about 880 mg to about 885 mg, about 885 mg to about 890 mg, about 890 mg to about 895 mg, about 895 mg to about 900 mg, about 900 mg to about 905 mg, about 905 mg to about 910 mg, about 910 mg to about 915 mg, about 915 mg to about 920 mg, about 920 mg to about 925 mg, about 925 mg to about 930 mg, about 930 mg to about 935 mg, about 935 mg to about 940 mg, about 940 mg to about 945 mg, about 945 mg to about 950 mg, about 950 mg to about 955 mg, or about 955 mg to about 960 mg.
[0084] Alternatively, the dose can be from about 1 mg to about 20 mg, about 10 mg to about 20 mg, about 20 mg to about 30 mg, about 30 mg to about 40 mg, about 40 mg to about 50 mg, about 50 mg to about 60 mg, about 60 mg to about 70 mg, about 70 mg to about 80 mg, about 80 mg to about 90 mg, about 90 mg to about 100 mg, about 100 mg to about 110 mg, about 110 mg to about 120 mg, about 120 mg to about 130 mg, about 130 mg to about 140 mg, about 140 mg to about 150 mg, about 150 mg to about 160 mg, about 160 mg to about 170 mg, about 170 mg to about 180 mg, about 180 mg to about 190 mg, about 190 mg to about 200 mg, about 200 mg to about 210 mg, about 210 mg to about 220 mg, about 220 mg to about 230 mg, about 230 mg to about 240 mg, about 240 mg to about 250 mg, about 250 mg to about 260mg, about 260 mg to about 270 mg, about 270 mg to about 280 mg, about 280 mg to about 290 mg, about 290 mg to about 300 mg, about 300 mg to about 310 mg, about 310 mg to about 320 mg, about 320 mg to about 330 mg, about 330 mg to about 340 mg, about 340 mg to about 350 mg, about 350 mg to about 360 mg, about 360 mg to about 370 mg, about 370 mg to about 380 mg about 380 mg to about 390 mg, about 390 mg to about 400 mg, about 400 mg to about 410 mg, about 410 mg to about 420 mg, about 420 mg to about 430 mg, about 430 mg to about 440 mg, about 440 mg to about 450 mg, about 450 mg to about 460 mg, about 460 mg to about 470 mg, about 470 mg to about 480 mg, about 480 mg to about 490 mg, about 490 mg to about 500 mg, about 500 mg to about 510 mg, about 510 mg to about 520 mg, about 520 mg to about 530 mg, about 530 mg to about 540 mg, about 540 mg to about 550 mg, about 550 mg to about 560 mg, about 560 mg about 570 mg, about 570 mg to about 580 mg, about 580 mg to about 590 mg, about 590 mg about 600 mg, about 600 mg to about 610 mg, about 610 mg to about 620 mg, about 620 mg to about 630 mg, about 630 mg to about 640 mg, about 640 mg to about 650 mg, about 650 mg to about 660 mg, about 660 mg to about 670 mg, about 670 mg to about 680 mg, about680 mg to about 690 mg, about 690 mg to about 700 mg, about 700 mg to about 710 mg, about 710 mg to about 720 mg, about 720 mg to about 730 mg, about 730 mg to about 740 mg, about 740 mg to about 750 mg, about 750 mg to about 760 mg, about 760 mg to about 770 mg, about 770 mg to about 780 mg, about 780 mg to about 790 mg, about 790 mg to about 800 mg, about 800 mg to about 810 mg, about 810 mg to about 820 mg, about 820 mg to about 830 mg, about 830 mg to about 840 mg, about 840 mg to about 850 mg, about 850 mg to about 860 mg, about 860 mg to about 870 mg, about 870 mg to about 880 mg, about 880 mg to about 890 mg, about 890 mg to about 900 mg, about 900 mg to about 910 mg, about 910 mg to about 920 mg, about 920 mg to about 930 mg, about 930 mg to about 940 mg, about 940 mg to about 950 mg, or about 950 mg to about 960 mg.
[0085] Alternatively, the dose can be from about 4 mg to about 25 mg, about 25 mg to about 50 mg, about 50 mg to about 75 mg, about 75 mg to about 100 mg, about 100 mg to about 125 mg, about 125 mg to about 150 mg, about 150 mg to about 175 mg, about 175 mg to about 200 mg, about 200 mg to about 225 mg, about 225 mg to about 250 mg, about 250 mg to about 275 mg, about 275 mg to about 300 mg, about 300 mg to about 325 mg, about 325 mg to about 350 mg, about 350 mg to about 375 mg, about 375 mg to about 400 mg, about 400 mg to about 425 mg, about 425 mg to about 450 mg, about 450 mg to about 475 mg, about 475 mg to about 500 mg, about 500 mg to about 525 mg, about 525 mg to about 550 mg, about 550 mg to about 575 mg, about 575 mg to about 600 mg, about 600 mg to about 625 mg, about 625 mg to about 650 mg, about 650 mg to about 675 mg, about 675 mg to about 700 mg, about 700 mg to about 725 mg, about 725 mg to about 750 mg, about 750 mg to about 775 mg, about 775 mg to about 800 mg, about 800 mg to about 825 mg, about 825 mg to about 850 mg, about 850 mg to about 875 mg, about 875 mg to about 900 mg, about 900 mg to about 925 mg, about 925 mg to about 950 mg, or about 950 mg to about 975 mg.
[0086] Alternatively, the dose can be from about 1 mg to about 50 mg, about 50 mg to about 100 mg, about 100 mg to about 150 mg, about 150 mg to about 200 mg, about 200 mg to about 250 mg, about 250 mg to about 300 mg, about 300 mg to about 350 mg, about 350 mg to about 400 mg, about 400 mg to about 450 mg, about 450 mg to about 500 mg, about 500 mg to about 550 mg, about 550 to about 600 mg, about 600 mg to about 650 mg, about 650 mg to about 700 mg, about 700 mg to about 750 mg, about 750 mg to about 800 mg, about 800 mg to about 850 mg, about 850 mg to about 900 mg, about 900 mg to about 950 mg, or about 950 mg to about 1000 mg.
[0087] Alternatively, the dose can be from about 1 mg to about 75 mg, about 75 mg to about 150 mg, about 150 mg to about 225 mg, about 225 mg to about 300 mg, about 300 mg to about 375 mg, about 375 mg to about 450 mg, about 450 mg to about 525 mg, about 525 mg to about 600 mg, about 600 mg to about 675 mg, about 675 mg to about 750 mg, about 750 mg to about 825 mg, about 825 mg to about 900 mg, or about 900 mg to about 975 mg.
[0088] Alternatively, the dose can be from about 1 mg to about 100 mg, about 100 mg to about 200 mg, about 200 mg to about 300 mg, about 300 mg to about 400 mg, about 400 mg to about 500 mg, about 500 mg to about 600 mg, about 600 mg to about 700 mg, about 700 mg to about 800 mg, about 800 mg to about 900 mg, or about 900 mg to about 1000 mg.
[0089] In some instances, the ds RNAi agent includes a sense strand having a nucleotide sequence of SEQ ID NO: 1 and includes an antisense strand having a nucleotide sequence of SEQ ID NO:2. In other instances, the sense strand is a nucleotide sequence of SEQ ID NO:3 and the antisense strand is a nucleotide sequence of SEQ ID NO:4.
[0090] To facilitate administering the doses of the ds RNAi agent to an individual in need thereof, the doses can be incorporated into pharmaceutical compositions such as formulations. Such pharmaceutical compositions can include a concentration of the ds RNAi agent or a pharmaceutically acceptable salt thereof (e.g., calcium, magnesium or sodium) in H2O, especially water-for-inj ection (WFI).
[0091] In some instances, the ds RNAi agent includes a sense strand having a nucleotide sequence of SEQ ID NO: 1 and an antisense strand having a nucleotide sequence of SEQ ID NO:2. In other instances, the sense strand is a nucleotide sequence of SEQ ID NO:3 and the antisense strand is a nucleotide sequence of SEQ ID NO:4.
[0092] In some instances, the concentration of the ds RNAi agent in the pharmaceutical composition can be from about 100 mg / mL to about 300 mg / mL. In other instances, the concentration can be from about 110 mg / mL to about 290 mg / mL, from about 120 mg / mL to about 280 mg / mL, from about 130 mg / mL to about 270 mg / mL, from about 140 mg / mL to about 260 mg / mL, from about 150 mg / mL to about 250 mg / mL, from about 160 mg / mL to about 240 mg / mL, from about 170 mg. to about 230 mg / mL, from about 180 mg / mL to about 220 mg / mL, from about 190 mg / mL to about 210 mg / mL or about 200 mg / mL. In yet other instances, the concentration can be from about 100 mg / mL to about 110 mg / mL, from about 110 mg / mL to about 120 mg / mL, from about 120 mg / mL to about 130 mg / mL, from about 130 mg / mL to about 140 mg / mL, from about 140 mg / mL to about 150 mg / mL, from about 150mg / mL to about 160 mg / mL, from about 160 mg / mL to about 170 mg / mL, from about 170 mg / mL to about 180 mg / mL, from about 180 mg / mL to about 190 mg / mL, from about 190 mg / mL to about 200 mg / mL, from about 200 mg / mL to about 210 mg / mL, from about 210 mg / mL to about 220 mg / mL, from about 220 mg / mL to about 230 mg / mL, from about 230 mg / mL to about 240 mg / mL, from about 240 mg / mL to about 250 mg / mL, from about 250 mg / mL to about 260 mg / mL, from about 260 mg / mL to about 270 mg / mL, from about 270 mg / mL to about 280 mg / mL, from about 280 mg / mL to about 290 mg / mL, or from about 290 mg / mL to about 300 mg / mL. In certain instances, the concentration can be about 100 mg / mL, about 110 mg / mL, about 120 mg / mL, about 130 mg / mL, about 140 mg / mL, about 150 mg / mL, about 160 mg / mL, about 170 mg / mL, about 180 mg / mL, about 190 mg / mL, about 200 mg / mL, about 210 mg / mL, about 220 mg / mL, about 230 mg / mL, about 240 mg / mL, about 250 mg / mL, about 260 mg / mL, about 270 mg / mL, about 280 mg / mL, about 290 mg / mL or about 300 mg / mL, especially about 160 mg / mL or about 200 mg / mL.
[0093] In some instances, the pH of the pharmaceutical compositions can be from about 6.0 to about 8.0. In other instances, the pH can be from about 6.1 to about 7.9, from about 6.2 to about 7.8, from about 6.3 to about 7.7, from about 6.4 to about 7.6, from about 6.5 to about 7.5, from about 6.6 to about 7.4, from about 6.7 to about 7.3, from about 6.8 to about 7.2, from about 6.9 to about 7.1, or about 7.0. In yet other instances, the pH can be from about from about 6.0 to about 6.1, from about 6.1 to about 6.2, from about 6.2 to about 6.3, from about 6.3 to about 6.4, from about 6.4 to about 6.5, from about 6.5 to about 6.6, from about 6.6 to about 6.7, from about 6.7 to about 6.8, from about 6.8 to about 6.9, from about 6.9 to about 7.0, from about 7.0 to about 7.1, from about 7.1 to about 7.2, from about 7.2 to about 7.3, from about 7.3 to about 7.4, from about 7.4 to about 7.5, from about 7.5 to about 7.6, from about 7.6 to about 7.7, from about 7.7 to about 7.8, from about 7.8 to about 7.9, from about 7.9 to about 8.0. In certain instances, the pH can be about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9 or about 8.0, especially about 7.0. Sodium hydroxide (NaOH) or hydrochloric acid (HC1) can be used to adjust the pH as may be needed.
[0094] In some instances, the pharmaceutical compositions are sterile when first produced. As such, they optionally can include a preservative that is compatible with the other components of the composition and that may be added at sufficient strength to meet applicable regulatory anti-microbial preservative requirements. Pharmaceutically acceptablepreservatives are known to one of skill in the art (see, e.g., Remington: The Science and Practice of Pharmacy (Troy, Ed., 21stEdition, Lippincott, Williams & Wilkins, 2006). In other instances, the formulations herein are preservative free.
[0095] In some instances, the pharmaceutical compositions can be stored at a temperature from about 2°C to about 8°C. In other instances, the temperature can be from about 3°C to about 7°C, from about 4°C to about 6°C, or about 5°C. In yet other instances, the temperature can be from about 2°C to about 3°C, from about 3°C to about 4°C, from about 4°C to about 5°C, from about 5°C to about 6°C, from about 6°C to about 7°C, or from about 7°C to about 8°C. In certain instances, the temperature can be about 2°C, about 3°C, about 4°C, about 5°C, about 6°C, about 7°C or about 8°C. In other instances, the formulations can be stored at a temperature from about 20°C to about 22°C (i.e., room temperature) or higher. For example, the pharmaceutical compositions can be stored at a temperature from about 30°C to about 40°C. In yet other instances, the temperature can be from about 31°C to about 39°C, from about 32°C to about 38°C, from about 33°C to about 37°C, from about 34°C to about 36°C or about 35°C. Alternatively, the temperature can be about 30°C, about 31°C, about 32°C, about 33°C, about 34°C, about 35°C, about 36°C, about 37°C, about 38°C, about 39°C or about 40°C.
[0096] In some instances, such as for low doses, the pharmaceutical compositions can be diluted with about 0.9% NaCl for injection. In other instances, the pharmaceutical compositions can be diluted with mannitol or dextrose for injection.
[0097] In one particular instance, a pharmaceutical composition includes a ds RNAi agent that modulates ANGPTL3 expression or pharmaceutically acceptable salt thereof having a sense strand with a nucleotide sequence of SEQ ID NO:1 and an antisense strand with a nucleotide sequence of SEQ ID NO:2 in H2O at pH 7.0, where the ds RNAi agent is at a concentration from about 150 mg / mL to about 170 mg / mL, especially about 160 mg / mL.
[0098] In another particular instance, a pharmaceutical composition includes a ds RNAi agent that modulates ANGPTL3 expression or a pharmaceutically acceptable salt thereof having a sense strand with a nucleotide sequence of SEQ ID NO: 1 and an antisense strand with a nucleotide sequence of SEQ ID NO:2 in H2O at pH 7.0, where the ds RNAi agent is at a concentration from about 190 mg / mL to about 210 mg / mL, especially about 200 mg / mL.
[0099] In another particular instance, a pharmaceutical composition includes a ds RNAi agent that modulates ANGPTL3 expression or a pharmaceutically acceptable salt thereof having a sense strand with a nucleotide sequence of SEQ ID NO:3 and an antisense strand witha nucleotide sequence of SEQ ID NO:4 in H2O at pH 7.0, where the ds RNAi agent is at a concentration from about 150 mg / mL to about 170 mg / mL, especially about 160 mg / mL.
[0100] In another particular instance, a pharmaceutical composition includes a ds RNAi agent that modulates ANGPTL3 expression or a pharmaceutically acceptable salt thereof having a sense strand with a nucleotide sequence of SEQ ID NO:3 and an antisense strand with a nucleotide sequence of SEQ ID NO:4 in H2O at pH 7.0, where the ds RNAi agent is at a concentration from about 190 mg / mL to about 210 mg / mL, especially about 200 mg / mL.
[0101] The pharmaceutical compositions can be administered IV or SC, especially SC. The pharmaceutical compositions can be administered using a pre-filled, disposable pen, reusable pen or automatic pen injector. Alternatively, the pharmaceutical compositions may be administered using a single-use vial, a multi-use vial or a pump device. In some instances, the device is an automatic injection apparatus as described in US Patent No. 8,734,394.
[0102] The pharmaceutical compositions therefore may be presented in a pre-filled syringe / multi-use vial. Such pre-filled syringe / multi-use vial may be useful for administering from about 0.5 mL to about 5 mL of the formulation per individual per dose. The dose may be administered using a dosing schedule determined by a clinician, physician or other trained medical professional.
[0103] Alternatively, the pharmaceutical compositions can be prepared for a cartridge and therefore may differ from the above by including an optional preservative, especially if for multi-use.
[0104] Alternatively, the pharmaceutical compositions can be prepared as part of an article of manufacture comprising the ds RNAi agent, where the article of manufacture can be a multiuse vial, a reusable pen injector, a pre-filled, disposable pen, an autoinjector or a pump.
[0105] In view of the above, the pharmaceutical compositions are associated with acceptable shelf-life stability, in-use stability and acceptable injection site experience.
[0106] Dosing Regimens and Other Methods
[0107] The ds RNAi agent that modulates ANGPTL3 and compositions thereof such as the doses and formulations herein can be used for attenuating, preventing and / or treating diseases, disorders and / or conditions associated with ANGPTL3 expression. For example, the ds RNAi agent or compositions including the same may be used in individuals at high risk of MACE,including myocardial infarction (MI), stroke, coronary revascularization, unstable angina, peripheral artery revascularization, peripheral vascular events and CV death.
[0108] The methods can include the steps described herein, and these maybe be, but not necessarily, carried out in the sequence as described. Other sequences, however, also are conceivable. Moreover, individual or multiple steps may be carried out either in parallel and / or overlapping in time and / or individually or in multiply repeated steps. Furthermore, the methods may include additional, unspecified steps.
[0109] While the details of various methods are provided below, each can include an optional step of selecting an individual who has or is predisposed to having a disease, disorder and / or condition associated with ANGPTL3 expression. For example, and in some instances, the individual can have elevated ApoB, LDL-C, non-HDL-C, TC and / or TG with established CV disease. In some instances, the individual can have an ApoB level of > about 80 mg mg / dL prior to administering a first dose. In other instances, the individual can have a LDL-C level of > about 70 mg / dL prior to administering a first dose. In yet other instances, the individual can have a non-HDL-C level of about > about 100 mg / dL prior to administering a first dose. In yet other instances, the individual can have a TC level of > about 180 mg / dL prior to administering a first dose. In yet other instances, the individual can have a TG level of > about 150 mg / dL to < about 500 mg / dL prior to administering a first dose. In certain instances, the individual can have an ApoB level of > about 80 mg / dL, a LDL-C level of > about 70 mg / dL, a non-HDL-C level of > about 100 mg / dL, a TC level of > about 180 mg / dL and / or a TG level of > about 150 mg / dL to < about 500 mg / dL prior to administering the first dose.
[0110] In some instances, the disease, disorder and / or condition associated with ANGPTL3 expression includes, but is not limited to, abnormal lipid and / or cholesterol metabolism, acute pancreatitis, atherosclerosis, cardiovascular disease, coronary artery disease, diabetic nephropathy, homozygous and heterozygous familial hypercholesterolemia, hyperlipidemia, hypertriglyceridemia, obesity, NAFLD, NASH, nephrotic syndrome, PAD, severe hypertriglyceridemia, statin-resistant hypercholesterolemia and type II diabetes mellitus.
[0111] For example, methods are provided for reducing ANGPTL3 expression in an individual, where such methods include a step of administering to the individual a first dose of a ds RNAi agent that modulates ANGPTL3 expression or a pharmaceutical composition thereof such as a formulation herein, where the ds RNAi agent includes a sense strand having anucleotide sequence of SEQ ID NO: 1 or 3 and an antisense strand having a nucleotide sequence of SEQ ID NO:2 or 4, where the first dose can be from about 24 mg to about 960 mg.
[0112] In some instances, the first dose can be administered IV or can be administered SC, especially SC.
[0113] In some instances, the sense strand is SEQ ID NO:3. In other instances, the antisense strand is SEQ ID NON. In certain instances, the sense strand is SEQ ID NON and the antisense strand is SEQ ID NON.
[0114] In some instances, the first dose can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg. In other instances, the first dose can be about 24 mg, about 72 mg, about 100 mg, about 208 mg, about 400 mg, about 480 mg, about 800 mg or about 960 mg.
[0115] The method also can include a step of administering to the individual one or more subsequent doses (ie., at least a second dose) of the ds RNAi agent, where the one or more subsequent doses can be from about 24 mg to about 960 mg, and where the one or more subsequent doses can be the same as the first dose or can be different from the first dose and can be administered at about Q1M, about Q3M, about Q6M or about Q9M after the first dose or a previous dose. Alternatively, the one or more subsequent doses can be administered at about two months (Q2M), about four months (Q4M), about five months (Q5M), about seven months (Q7M), about eight months (Q8M) or about ten months (Q10M) after the first dose or a previous dose.
[0116] In some instances, the one or more subsequent doses can be administered IV or can be administered SC, especially SC.
[0117] In some instances, the one or more subsequent doses can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg. In other instances, the one or more subsequent doses can be about 24 mg, about 72 mg, about 100 mg, about 208 mg, about 400 mg, about 480 mg, about 800 mg or about 960 mg.
[0118] When a subsequent dose (z.e., third, fourth, fifth, et seq. dose) is administered, the subsequent dose can be the same as a second dose (or from any preceding dose in the case of a fourth, fifth, et seq. dose) or can be different from the second dose (or from any preceding dose in the case of a fourth, fifth, et seq. dose). In addition, the subsequent dose can be administered from about Q1M to about Q10M (z.e., about Q1M, Q2M, Q3M, Q4M, Q5M, Q6M, Q7M, Q8M, Q9M or Q10M) from the second dose (or from any preceding dose in the case of a fourth, fifth, et seq. dose).
[0119] In some instances, the one or more subsequent doses can be about 24 mg administered every Q1M, about 24 mg administered every Q2M, about 24 mg administered every Q3M, about 24 mg administered every Q4M, about 24 mg administered every Q5M, about 24 mg administered every Q6M, about 24 mg administered every Q7M, about 24 mg delivered every Q8M, about 24 mg administered every Q9M, or about 24 mg administered every Q10M.
[0120] In some instances, the one or more subsequent doses can be about 72 mg administered every Q1M, about 72 mg administered every Q2M, about 72 mg administered every Q3M, about 72 mg administered every Q4M, about 72 mg administered every Q5M, about 72 mg administered every Q6M, about 72 mg administered every Q7M, about 72 mg delivered every Q8M, about 72 mg administered every Q9M, or about 72 mg administered every Q10M.
[0121] In some instances, the one or more subsequent doses can be about 100 mg administered every Q1M, about 100 mg administered every Q2M, about 100 mg administered every Q3M, about 100 mg administered every Q4M, about 100 mg administered every Q5M, about 100 mg administered every Q6M, about 100 mg administered every Q7M, about 100 mg delivered every Q8M, about 100 mg administered every Q9M, or about 100 mg administered every Q10M.
[0122] In some instances, the one or more subsequent doses can be about 208 mg administered every Q1M, about 208 mg administered every Q2M, about 208 mg administered every Q3M, about 208 mg administered every Q4M, about 208 mg administered every Q5M, about 208 mg administered every Q6M, about 208 mg administered every Q7M, about 208 mg delivered every Q8M, about 208 mg administered every Q9M, or about 208 mg administered every Q10M.
[0123] In some instances, the one or more subsequent doses can be about 400 mg administered every Q1M, about 400 mg administered every Q2M, about 400 mg administered every Q3M, about 400 mg administered every Q4M, about 400 mg administered every Q5M,about 400 mg administered every Q6M, about 400 mg administered every Q7M, about 400 mg delivered every Q8M, about 400 mg administered every Q9M, or about 400 mg administered every Q10M.
[0124] In some instances, the one or more subsequent doses can be about 480 mg administered every Q1M, about 480 mg administered every Q2M, about 480 mg administered every Q3M, about 480 mg administered every Q4M, about 480 mg administered every Q5M, about 480 mg administered every Q6M, about 480 mg administered every Q7M, about 480 mg delivered every Q8M, about 480 mg administered every Q9M, or about 480 mg administered every Q10M.
[0125] In some instances, the one or more subsequent doses can be about 800 mg administered every Q1M, about 800 mg administered every Q2M, about 800 mg administered every Q3M, about 800 mg administered every Q4M, about 800 mg administered every Q5M, about 800 mg administered every Q6M, about 800 mg administered every Q7M, about 800 mg delivered every Q8M, about 800 mg administered every Q9M, or about 800 mg administered every Q10M.
[0126] In some instances, the one or more subsequent doses can be about 960 mg administered every Q1M, about 960 mg administered every Q2M, about 960 mg administered every Q3M, about 960 mg administered every Q4M, about 960 mg administered every Q5M, about 960 mg administered every Q6M, about 960 mg administered every Q7M, about 960 mg delivered every Q8M, about 960 mg administered every Q9M, or about 960 mg administered every Q10M.
[0127] Assuming a pharmaceutical formulation with a concentration of ds RNAi agent at about 160 mg / mL is used, exemplary volumes to deliver the doses note above are as follows:• about 150 pL to deliver the about 24 mg dose,• about 450 pL to deliver the about 72 mg dose,• about 625 pL to deliver the about 100 mg dose,• about 1.3 mL to deliver the about 208 mg dose,• about 2.5 mL to deliver the about 400 mg dose,• about 3.0 mL to deliver the about 480 mg dose,• about 5.0 mL to deliver the about 800 mg dose, and• about 6.0 mL to deliver the about 960 mg dose.
[0128] Alternatively, and a pharmaceutical formulation with a concentration of ds RNAi agent at about 200 mg / mL is used, exemplary volumes to deliver the doses note above are as follows:• about 120 pL to deliver the about 24 mg dose,• about 360 pL to deliver the about 72 mg dose,• about 500 pL to deliver the about 100 mg dose,• about 1.04 mL to deliver the about 208 mg dose,• about 2.0 mL to deliver the about 400 mg dose,• about 2.4 mL to deliver the about 480 mg dose,• about 4.0 mL to deliver the about 800 mg dose, and• about 4.8 mL to deliver the about 960 mg dose.
[0129] As noted above, the one or more subsequent doses (e.g., second, third, fourth, fifth, et seq. dose) can be administered at the same dosing frequency or can be administered at a different dosing frequency distinct from one another, which can be guided by, for example, a degree of change in the individual’s ANGPTL3 expression. As such, the methods also can include a step of adjusting the one or more subsequent doses after comparing the individual’s ANGPTL3 expression following a dose to a control or a previously measured / recorded ANGPTL3 expression.
[0130] In addition to the above, methods are provided for attenuating, preventing and / or treating diseases, disorders and / or conditions associated with ANGPTL3 expression, where such methods include a step of administering to an individual in need thereof a first dose of a ds RNAi agent that modulates ANGPTL3 expression or a pharmaceutical composition thereof such as a formulation herein, where the ds RNAi agent includes a sense strand having a nucleotide sequence of SEQ ID NO: 1 or 3 and an antisense strand having a nucleotide sequence of SEQ ID NO:2 or 4, and where the first dose can be from about 24 mg to about 960 mg.
[0131] In some instances, the first dose can be administered IV or can be administered SC, especially SC.
[0132] In some instances, the sense strand is SEQ ID NO:3. In other instances, the antisense strand is SEQ ID NO:4. In certain instances, the sense strand is SEQ ID NO:3 and the antisense strand is SEQ ID NO:4.
[0133] In some instances, the first dose can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg. In other instances, the first dose can be about 24 mg, about 72 mg, about 100 mg, about 208 mg, about 400 mg, about 480 mg, about 800 mg or about 960 mg.
[0134] The method also can include a step of administering to the individual one or more subsequent doses of the ds RNA agent, where the one or more subsequent doses can be from about 24 mg to about 960 mg, and where the one or more subsequent doses can be the same as the first dose or can be different from the first dose and can be administered about Q1M, about Q3M, about Q6M or about Q9M after the first dose. Alternatively, the one or more subsequent doses, such as a second dose, can be administered about Q2M, about Q4M, about Q5M, about Q7M, about Q8M or about Q10M after the first dose.
[0135] In some instances, the one or more subsequent doses can be administered IV or can be administered SC, especially SC.
[0136] In some instances, the one or more subsequent doses can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg. In other instances, the one or more subsequent doses can be about 24 mg, about 72 mg, about 100 mg, about 208 mg, about 400 mg, about 480 mg, about 800 mg or about 960 mg.
[0137] When a subsequent dose (z.e., third, fourth, fifth, et seq. dose) is administered, the subsequent dose can be the same as a second dose (or from any preceding dose in the case of a fourth, fifth, et seq. dose) or can be different from the second dose (or from any preceding dose in the case of a fourth, fifth, et seq. dose). In addition, the subsequent dose can be administered from about Q1M to about Q10M (z.e., about Q1M, Q2M, Q3M, Q4M, Q5M, Q6M, Q7M, Q8M, Q9M or Q10M) from the second dose (or from any preceding dose in the case of a fourth, fifth, et seq. dose).
[0138] In some instances, the one or more subsequent doses can be about 24 mg administered every Q1M, about 24 mg administered every Q2M, about 24 mg administered every Q3M,about 24 mg administered every Q4M, about 24 mg administered every Q5M, about 24 mg administered every Q6M, about 24 mg administered every Q7M, about 24 mg delivered every Q8M, about 24 mg administered every Q9M, or about 24 mg administered every Q10M.
[0139] In some instances, the one or more subsequent doses can be about 72 mg administered every Q1M, about 72 mg administered every Q2M, about 72 mg administered every Q3M, about 72 mg administered every Q4M, about 72 mg administered every Q5M, about 72 mg administered every Q6M, about 72 mg administered every Q7M, about 72 mg delivered every Q8M, about 72 mg administered every Q9M, or about 72 mg administered every Q10M.
[0140] In some instances, the one or more subsequent doses can be about 100 mg administered every Q1M, about 100 mg administered every Q2M, about 100 mg administered every Q3M, about 100 mg administered every Q4M, about 100 mg administered every Q5M, about 100 mg administered every Q6M, about 100 mg administered every Q7M, about 100 mg delivered every Q8M, about 100 mg administered every Q9M, or about 100 mg administered every Q10M.
[0141] In some instances, the one or more subsequent doses can be about 208 mg administered every Q1M, about 208 mg administered every Q2M, about 208 mg administered every Q3M, about 208 mg administered every Q4M, about 208 mg administered every Q5M, about 208 mg administered every Q6M, about 208 mg administered every Q7M, about 208 mg delivered every Q8M, about 208 mg administered every Q9M, or about 208 mg administered every Q10M.
[0142] In some instances, the one or more subsequent doses can be about 400 mg administered every Q1M, about 400 mg administered every Q2M, about 400 mg administered every Q3M, about 400 mg administered every Q4M, about 400 mg administered every Q5M, about 400 mg administered every Q6M, about 400 mg administered every Q7M, about 400 mg delivered every Q8M, about 400 mg administered every Q9M, or about 400 mg administered every Q10M.
[0143] In some instances, the one or more subsequent doses can be about 480 mg administered every Q1M, about 480 mg administered every Q2M, about 480 mg administered every Q3M, about 480 mg administered every Q4M, about 480 mg administered every Q5M, about 480 mg administered every Q6M, about 480 mg administered every Q7M, about 480 mg delivered every Q8M, about 480 mg administered every Q9M, or about 480 mg administered every Q10M.
[0144] In some instances, the one or more subsequent doses can be about 800 mg administered every Q1M, about 800 mg administered every Q2M, about 800 mg administered every Q3M, about 800 mg administered every Q4M, about 800 mg administered every Q5M, about 800 mg administered every Q6M, about 800 mg administered every Q7M, about 800 mg delivered every Q8M, about 800 mg administered every Q9M, or about 800 mg administered every Q10M.
[0145] In some instances, the one or more subsequent doses can be about 960 mg administered every Q1M, about 960 mg administered every Q2M, about 960 mg administered every Q3M, about 960 mg administered every Q4M, about 960 mg administered every Q5M, about 960 mg administered every Q6M, about 960 mg administered every Q7M, about 960 mg delivered every Q8M, about 960 mg administered every Q9M, or about 960 mg administered every Q10M.
[0146] As noted above, the one or more subsequent doses (e.g., second, third, fourth, fifth, et seq. dose) can be administered at the same dosing frequency or can be administered at a different dosing frequency distinct from one another, which can be guided by, for example, a degree of change in the individual’s TG concentration and / or LDL-C concentration (or other lipid profile constituent) following a dose. As such, the methods also can include a step of measuring or recording at least one of the individual’s lipid profile constituent values such as, for example, apolipoprotein A (Apo(a)), ApoB, HDL-C, LDL-C, Lp(a), non-HDL-C, TC and / or TG and comparing the at least one value to a control value or to another measured / recorded value from the individual. In some instances, the method further can include a step of adjusting the one or more subsequent doses after comparing the measured / recorded value to a control or a previously measured / recorded value of the individual.
[0147] In any of the above methods, each dose independently can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg, where a first dose can be administered at day 0 and each subsequent dose (z.e., second, third, fourth, fifth, et seq. dose) can be administered at a frequency of about every Q1M therefrom.
[0148] In any of the above methods, each dose independently can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg, where a first dose can be administered at day 0 and each subsequent dose (z.e., second, third, fourth, fifth, et seq. dose) can be administered at a frequency of about every Q2M therefrom.
[0149] In any of the above methods, each dose independently can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg, where a first dose can be administered at day 0 and each subsequent dose (z.e., second, third, fourth, fifth, et seq. dose) can be administered at a frequency of about every Q3M therefrom.
[0150] In any of the above methods, each dose independently can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg, where a first dose can be administered at day 0 and each subsequent dose (z.e., second, third, fourth, fifth, et seq. dose) can be administered at a frequency of about every Q4M therefrom.
[0151] In any of the above methods, each dose independently can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg, where a first dose can be administered at day 0 and each subsequent dose (z.e., second, third, fourth, fifth, et seq. dose) can be administered at a frequency of about every Q5M therefrom.
[0152] In any of the above methods, each dose independently can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760,mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg, where a first dose can be administered at day 0 and each subsequent dose (z.e., second, third, fourth, fifth, et seq. dose) can be administered at a frequency of about every Q6M therefrom.
[0153] In any of the above methods, each dose independently can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg, where a first dose can be administered at day 0 and each subsequent dose (z.e., second, third, fourth, fifth, et seq. dose) can be administered at a frequency of about every Q7M therefrom.
[0154] In any of the above methods, each dose independently can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg, where a first dose can be administered at day 0 and each subsequent dose (z.e., second, third, fourth, fifth, et seq. dose) can be administered at a frequency of about every Q8M therefrom.
[0155] In any of the above methods, each dose independently can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg., where a first dose can be administered at day 0 and each subsequent dose (z.e., second, third, fourth, fifth, et seq. dose) can be administered at a frequency of about every Q9M therefrom.
[0156] In any of the above methods, each dose independently can be about 24 mg, about 48 mg, about 72 mg, about 100 mg, about 140 mg, about 208 mg, about 240 mg, about 272 mg, about 304 mg, about 336 mg, about 368 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, about 640 mg, about 680 mg, about 720 mg, about 760, mg, about 800 mg, about 840 mg, about 860 mg, about 900 mg or about 960 mg, where a first dose can be administered at day 0 and each subsequent dose (z.e., second, third, fourth, fifth, et seq. dose) can be administered at a frequency of about every Q10M therefrom.
[0157] As noted above, the first dose and the one or more subsequent doses can be the same or can be different from one another. In some instances, the first dose can be the same as the one or more subsequent doses. That is, for example, the first dose can be about 400 mg, and each subsequent dose can be about 400 mg. Alternatively, the first dose can be about 800 mg, and each subsequent dose can be about 800 mg. In other instances, the first dose can be greater than the one or more subsequent doses. That is, for example, the first dose can be about 800 mg, and each subsequent dose can be about 400 mg.
[0158] In any of the above methods, the injections can be administered via a 27-G needle into the SC tissue of the abdominal wall of the individual, about 10 cm from the umbilicus. For example, injections can be administered at an about 45° angle without pinching a skinfold. If more than 2 mL solution is required to deliver a dose, then it can be split into injections up to a maximum volume of 2 mL / inj ection. In this manner, multiple injections can be performed in quick succession, and each can be delivered in 1 of the 4 quadrants of the anterior abdominal wall. In other instances, a single injection of >2.0 mL can be used to deliver the dose.
[0159] In any of the above, the method also can include a step of measuring / recording the individual’s frequency and severity of AEs following a dose. In some instances, the method further can include a step of adjusting the one or more subsequent doses of the ds RNAi agent after assessing the individual’s frequency and severity of AEs.
[0160] In any of the above, the individual’s ApoB level can be < about 80 mg / dL within a predetermined time following one or more doses of the ds RNAi agent.
[0161] In any of the above, the individual’s LDL-C level can be < about 100 mg / dL within a predetermined time following one or more doses of the ds RNAi agent.
[0162] In any of the above, the individual’s non-HDL-C level can be < about 130 mg / dL within a predetermined time following one or more doses of the ds RNAi agent.
[0163] In any of the above, the individual’s TC level can be < about 180 mg / dL within a predetermined time following a dose of the ds RNAi agent.
[0164] In any of the above, the individual’s TG level can be < about 150 mg / dL within a predetermined time following one or more doses of the ds RNAi agent.
[0165] In any of the above, the individual’s ANGPTL3 protein can be decreased by at least about 80% within a predetermined time following one or more doses of the ds RNAi agent.
[0166] In some instances, the predetermined time can be about 1 week, about 2 weeks, about 3 weeks, about 4 weeks (z.e., 1 month), about 2 months, about 3 months, about 4 months, about 5 months or about 6 months.
[0167] In any of the above, the individual may be on a concomitant lipid-lowering therapy such as, for example, a therapy to reduce LDL-C levels (e.g., a PCSK9 inhibitor, a statin, a cholesterol absorption inhibitor, LDL apheresis or combinations thereof).EXAMPLES
[0168] The following non -limiting examples are offered for purposes of illustration, not limitation.
[0169] PHARMACEUTICAL FORMULATION
[0170] Example 1 : Pharmaceutical Formulation Including a ds RNAi Agent
[0171] The formulation was prepared substantially as described herein, where the formulation includes a ds RNAi agent (e.g., sense strand of SEQ ID NO:3 and antisense strand of SEQ ID NO:4; sodium equivalent) at 160 mg / mL or 200 mg / mL in H2O (WFI; unbuffered) and having a pH of 6 to 8. The formulation is supplied for use as a solution formulation in glass vials (2 mL vial).
[0172] CHEMICAL AND PHYSICAL STABILITY
[0173] Example 2: In-Use Stability Studies
[0174] Methods: The formulations (z.e., 160 mg / mL and 200 mg / mL) were prepared as described in Example 1. Formulation stability was evaluated in glass vials at various temperatures from 2°C-8°C and at 25°C and 40°C, as well as under an extreme lowered condition of -20°C (for 200 mg / mL only), for various durations. The formulation was monitored for degradation using denaturing and non-denaturing methods.
[0175] Results: Based upon these studies, the formulation has extended stability of up to 5 years at 2°C-8°C and 25°C, as well as were stable for several months at 40°C.
[0176] Table 1 : Table 2: Chemical and Physical Stability of 160 mg / mL GMP ds RNAi Agent DP Formulation.
[0177] Table 2: Chemical and Physical Stability of 200 mg / mL GMP ds RNAi Agent DPFormulation.
[0178] Table 3: Chemical Stability of 160 mg / mL GMP ds RNAi Agent DP Formulation(concentration and strand purity).
[0179] Table 4: Chemical Stability of 200 mg / mL GMP ds RNAi Agent DP Formulation (concentration and strand purity).
[0180] DOSING
[0181] Example 3: A Study of a ds RNAi Agent for Modulating ANGPTL3 Expression inAdults with Mixed Dyslipidemia
[0182] Methods: Multicenter studies were designed to evaluate the safety, tolerability, pharmacodynamics (PD) and pharmacokinetics (PK) of a ds RNAi agent for modulating ANGPTL3 expression (SEQ ID NOS:3 and 4 for the sense and antisense strands, respectively) in otherwise healthy individuals with mixed dyslipidemia. Such studies were a randomized, investigator- and participant-blind, and placebo-controlled.
[0183] In part A, individuals were SC administered single-ascending doses of the ds RNAi agent at 24 mg, 72 mg, 208 mg, 480 mg and 960 mg. Each dose cohort included 8 individuals who were randomized to receive the ds RNAi agent or placebo in a ratio of 3 : 1.
[0184] In part B, individuals were SC administered 2 doses of the ds RNAi agent at 208 mg or 480 mg. The second dose was administered 28 days after the first dose. Each dose cohort included 8 individuals who were randomized to receive repeat SC doses of the ds RNAi agent or placebo in a ratio of 3 : 1.
[0185] In part C, individuals of Japanese descent were SC administered a single dose of the ds RNAi agent at 208 mg or 480 mg. A total of 18 individuals were randomized to receive a single SC dose of the ds RNAi agent at 208 mg or at 480 mg or placebo in a ratio of 1 : 1 : 1.
[0186] For Parts A and B, individuals had TG and LDL-C levels assessed at screening as 150 mg / dL < TG < 500 mg / dL and LDL-C > 70 mg / dL. In these cohorts, PD effects were assessed by changes in levels of ANGPTL3, TG and LDL-C. For Part C, however, a minimum TG or LDL-C level was not required for the individuals to qualify for Part C.
[0187] All injections were administered into the tissue of the abdominal wall. The ds RNAi agent was provided as a 160 mg / mL solution. Placebo was administered as 2.5 mL 0.9% NaCl solution for injection.
[0188] Blood samples were collected pre-dose and at 0.5, 1.5, 3, 6, 9, 12, 16, 24, 36, 48 and 72 hrs post-dose and on day 29, 57, 85, 113, 141, 169, 197 and 225 post-dose to determine plasma concentration of the ds RNAi agent. Plasma concentrations were used to compute PD and / or PK parameters.
[0189] PD analysis: included ANGPTL3, TG, HDL-C, LDL-C, ApoB and / or a lipid panel.
[0190] PK analysis: included AUC(o-tiast), AUC(o-co), Cmax, tmax, t’ and CL / F.
[0191] Safety analysis: included physical examinations, vital sign assessments, 12-lead ECG, clinical laboratory assessments, cytokine panel, assessment for injection-site reactions, immunogenicity and adverse events.
[0192] Results: PD and PK data is summarized below in Tables 3-16.
[0193] Table 3 : Summary of PD Parameters - Part A, 24 mg
[0194] Table 4: Summary of PD Parameters - Part A, 72 mg
[0195] Table 5: Summary of PD Parameters - Part A, 208 mg
[0196] Table 6: Summary of PD Parameters - Part A, 480 mg
[0197] Table 7: Summary of PD Parameters - Part A, 960 mg
[0198] Table 8: Summary of PD Parameters - Part A, 0 mg (placebo)
[0199] Table 9: Summary of PD Parameters - Part B, 208 mg
[0200] Table 10: Summary of PD Parameters - Part B, 480 mg
[0201] Table 11 : Summary of PD Parameters - Part B, 0 mg (placebo)
[0202] Table 12: Summary ofPK Parameters - Part A
[0203] Table 13: Summary of PK Parameters - Part B (Day 1)
[0205] Table 15: Summary of PK Parameters - Part C
[0206] PD: Dose-dependent reductions were observed in ANGPTL3, TG, non-HDL-C and ApoB, with a maximum mean change from baseline (CFB) up to 86%, 73%, 46% and 36%, respectively. Moreover, the reductions were sustained up to Day 169 depending on dose level.
[0207] PK: With regard to Part A, single doses, PK across the tested dose range exhibited a linear PK, a median tmax between 7.5 hrs and 12.5 hrs, and a mean terminal half-life (t’ ) from 5.5 hrs to 12.9 hrs.
[0208] With regard to Part B, after 2 doses, PK exhibited approximate dose proportionality across the dose range tested, consistent PK with single-ascending dose cohorts, a median tmax between 9 hrs and 16 hrs after the first dose, a median tmax between 9 hrs and 10.5 hrs after the second dose on Day 29, and a mean t’ of about 7 hrs.
[0209] With regard to Part C, PK showed a median tmax of 6 hrs and 12.5 hrs after single dose of 208 mg and 480 mg, respectively. The t’ was about 6 hrs.
[0210] Safety and tolerability: The ds RNAi agent as well tolerated when administered as single doses up to 960 mg or as 2 doses of either 208 or 480 mg. Treatment emergent adverse events (TEAEs) mostly were mild in severity.
[0211] With regard to Part A, TEAEs were reported by at least 2 individuals, which included headache, increased blood creatine phosphokinase and rash. After single doses, transient elevations of liver enzymes (AST or ALT >2x ULN) and / or creatine kinase (>5x ULN) were observed. These were not associated with any clinical signs or symptoms. All injection site reactions (ISRs) resolved spontaneously, and there was no apparent relationship of the frequency or severity with the dose.
[0212] With regard to Part B, TEAEs were reported by at least 2 participants, which included headache, increased hepatic enzymes and rash. No clinically relevant changes in laboratory values were observed. ISRs were reported after administration of 1 dose or repeat dosing, which spontaneously resolved with no apparent relationship to dose.
[0213] With regard to Part C, TEAEs were reported by at least 2 participants, which included ecchymosis. One participant had ALT >2x ULN, but less than 3x ULN with no associated clinical signs or symptoms. ISRs were reported by 4 participants.
[0214] Example 4: A Randomized, Double-Blind, Placebo-Controlled Study to Investigate the Efficacy and Safety of a ds RNAi Agent for Modulating ANGPTL3 Expression in Adults with Mixed Dyslipidemia
[0215] Methods: Multicenter studies are designed to evaluate the efficacy and safety of repeat doses of a ds RNAi agent for modulating ANGPTL3 expression (SEQ ID NOS:3 and 4 for the sense and antisense strands, respectively) in a larger population of individuals with higher TG and non-HLD-C levels than in Example 3 (z.e., TG > 150 mg / dL, fasting LDL-C of > 70 mg / dL and / or non-HDL-C > 130 mg / dL). The study is randomized, investigator- and participant-blind, and placebo-controlled.
[0216] Doses of the ds RNAi agent are assessed over 270 days or 360 days in 175 individuals who are randomized in a 2: 1 :2:2 ratio to placebo in the arms in Table 16. Dosing is twice for each individual; Day 0 and Day 90 (± -5 to +10 days). If an individual’s ApoB level does not return to >80% of baseline on Day 270, then the individual continues to a follow-up visit at Day 360. If, however, an individual’s ApoB level returns to >80% of baseline on Day 270, then Day 270 is the individual’s last visit.
[0217] Table 16: ds RNAi Agent Study Design.
[0218] All injections are administered into the tissue of the abdominal wall. The ds RNAi agent is provided as a 200 mg / mL solution. As in Example 3, placebo is 0.9% NaCl solution for injection (administered in a range from about 0.1 mL to about 2.5 mL).
[0219] PD, PK and safety analyses generally are performed as described in Example 3.
[0220] Results:
[0221] PD: As for PD, the findings are similar to those observed in Example 3. Moreover, significant reductions in hepatic fat were observed with the ds RNAi agent when compared to placebo.
[0222] Table 17: Summary of PD Parameters - 0 mg (placebo)
[0223] Table 18: Summary of PD Parameters - 100 mg
[0224] Table 19: Summary of PD Parameters - 400 mg
[0225] Table 20: Summary of PD Parameters - 800 mg
[0226] PK: As for PK, the findings are similar to those observed in Example 3.
[0227] Safety and tolerability: As for safety, the findings are similar to those observed in Example 3. The ds RNAi agent as well tolerated with few TEAEs.SEQUENCE LISTING
[0228] The following nucleotide and / or amino acid sequences are referred to in the disclosure above and are provided below for reference.
[0229] SEQ ID NO: 1 - Unmodified Sense Strand (36 nt)UCAAAAUGGAAGGUUAUACAGCAGCCGAAAGGCUGC
[0230] SEQ ID NO:2 - Unmodified Antisense Strand (22 nt) UGUAUAACCUUCCAUUUUGAGG
[0231] SEQ ID NO:3 - Modified Sense Strand (36 nt)[mUs] [mC] [mA] [mA] [mA] [mA] [mU] [fG] [fG] [fA] [fA] [mG] [mG] [mU] [mU] [mA] [mU] [mA] [mC] [mA] [mG] [mC] [mA] [mG] [mC] [mC] [mG] [adem A-GalNAc] [adem A-GalNAc] [adem A- GalNAc] [mG] [mG] [mC] [mU] [mG] [mC]
[0232] SEQ ID NO:4 - Modified Antisense Strand (22 nt)[MePhosphonate-4O- mUs] [fGs] [fUs] [fA] [fU] [mA] [fA] [mC] [mC] [fU] [mU] [mC] [mC] [fA] [mU] [mU] [mU] [mU] [m G][mAs][mGs][mG]
Claims
CLAIMSThe invention claimed is:
1. A pharmaceutical composition comprising: a double-stranded (ds) RNAi agent or its pharmaceutically acceptable salt thereof at a concentration from about 100 mg / mL to about 300 mg / mL in water (H2O), wherein the pharmaceutical composition is at a pH from about 6.0 to about 8.0, and wherein the ds RNAi agent comprises:(1) a sense strand comprising a nucleotide sequence of SEQ ID NO: 1, and(2) an antisense strand comprising a nucleotide sequence of SEQ ID NO:2.
2. The pharmaceutical composition of Claim 1, wherein the concentration is from about 150 mg / mL to about 170 mg / mL or from about 190 mg / mL to about 210 mg / mL.
3. The pharmaceutical composition of Claim 2, wherein the concentration is about 160 mg / mL or about 200 mg / mL.
4. The pharmaceutical composition of any one of Claims 1 to 3, wherein the sense strand is SEQ ID NO:3.
5. The pharmaceutical composition of any one of Claims 1 to 4, wherein in the antisense strand is SEQ ID NO:4.
6. The pharmaceutical composition of any one of Claims 1 to 5, wherein the pH is about 7.0.
7. The pharmaceutical composition of any one of Claims 1 to 6, wherein the composition is preservative free.
8. A pharmaceutical formulation comprising:(1) a double-stranded (ds) RNAi agent comprising:(a) a sense strand comprising a nucleotide sequence of SEQ ID NO: 1, and(b) an antisense strand comprising a nucleotide sequence of SEQ ID NO:2; and(2) water (H2O), wherein the ds RNAi agent is at a concentration from about 150 mg / mL to about 170 mg / mL or from about 190 mg / mL to about 210 mg / mL, and wherein the formulation is at a pH of about 7.0.
9. A pharmaceutical formulation comprising:(1) a double-stranded (ds) RNAi agent comprising:(a) a sense strand comprising a nucleotide sequence of SEQ ID NO:3, and(b) an antisense strand comprising a nucleotide sequence of SEQ ID NO:4; and(2) water (H2O), wherein the ds RNAi agent is at a concentration from about 150 mg / mL to about 170 mg / mL or from about 190 mg / mL to about 210 mg / mL, and wherein the formulation is at a pH of about 7.0.
10. The pharmaceutical formulation of Claim 8 or 9, wherein the ds RNAi agent is at a concentration of about 160 mg / mL or about 200 mg / mL.
11. The pharmaceutical composition of any one of Claims 8 to 10, wherein the formulation is preservative free.
12. A method of attenuating, preventing and / or treating a disease, disorder and / or condition associated with angiopoi etin-like 3 gene (ANGPTL3) expression in an individual, the method comprising the steps of:(a) administering to the individual a first dose of a double-stranded (ds) RNAi agent that modulates ANGPTL3 expression, wherein the first dose is from about 24 mg to about 960 mg, and wherein the ds RNAi agent comprises:(i) a sense strand comprising SEQ ID NO: 1, and(ii) an antisense strand comprising SEQ ID NO:2; and(b) administering to the individual one or more subsequent doses of the ds RNAi agent at an interval selected from the group consisting of about every month (Q1M), about every three months (Q3M), about every six months (Q6M) and about every nine months (Q9M) from the first dose or from a previous dose, wherein the one or more subsequent doses are from about 24 mg to about 960 mg.
13. The method of Claim 12, wherein the administering is intravenously (IV) or subcutaneously (SC).
14. The method of Claim 13, wherein the administering is SC.
15. The method of any one of Claims 12 to 14, wherein the sense strand is SEQ ID NO:3.
16. The method of any one of Claim 12 to 15, wherein the antisense strand is SEQ ID NO:4.
17. The method of any one of Claims 12 to 16, wherein the one or more subsequent doses are the same as the first dose.
18. The method of any one of Claims 12 to 16, wherein the one or more of the subsequent doses are not the same as the first dose.
19. The method of any one of Claims 12 to 18, wherein the first dose is selected from the group consisting of about 24 mg, about 72 mg, about 100 mg, about 208 mg, about 400 mg, about 480 mg, about 800 mg and about 960 mg.
20. The method of any one of Claims 12 to 19, wherein the one or more subsequent doses are independently selected from the group consisting of about 24 mg, about 72 mg, about 100 mg, about 208 mg, about 400 mg, about 480 mg, about 800 mg and about 960 mg.
21. The method of any one of Claims 12 to 16, wherein the first dose is about 24 mg, and wherein the one or more subsequent doses are about 24 mg administered about every Q1M,about 24 mg administered about every Q3M, about 24 mg administered about every Q6M, or about 24 mg administered about every Q9M.
22. The method of any one of Claims 12 to 16, wherein the first dose is about 72 mg, and wherein the one or more subsequent doses are about 72 mg administered about every Q1M, about 72 mg administered about every Q3M, about 72 mg administered about every Q6M, or about 72 mg administered about every Q9M.
23. The method of any one of Claims 12 to 16, wherein the first dose is about 100 mg, and wherein the one or more subsequent doses are about 100 mg administered about every Q1M, about 100 mg administered about every Q3M, about 100 mg administered about every Q6M, or about 100 mg administered about every Q9M.
24. The method of any one of Claims 12 to 16, wherein the first dose is about 208 mg, and wherein the one or more subsequent doses are about 208 mg administered about every Q1M, about 208 mg administered about every Q3M, about 208 mg administered about every Q6M, or about 208 mg administered about every Q9M.
25. The method of any one of Claims 12 to 16, wherein the first dose is about 400 mg, and wherein the one or more subsequent doses are about 400 mg administered about every Q1M, about 400 mg administered about every Q3M, about 400 mg administered about every Q6M, or about 400 mg administered about every Q9M.
26. The method of any one of Claims 12 to 16, wherein the first dose is about 480 mg, and wherein the one or more subsequent doses are about 480 mg administered about every Q1M, about 480 mg administered about every Q3M, about 480 mg administered about every Q6M, or about 480 mg administered about every Q9M.
27. The method of any one of Claims 12 to 16, wherein the first dose is about 800 mg, and wherein the one or more subsequent doses are about 800 mg administered about every Q1M, about 800 mg administered about every Q3M, about 800 mg administered about every Q6M, or about 800 mg administered about every Q9M.
28. The method of any one of Claims 12 to 16, wherein the first dose is about 960 mg, and wherein the one or more subsequent doses are about 960 mg administered Q1M, about 960 mg administered Q3M, about 960 mg administered Q6M, or about 960 mg administered Q9M.
29. The method of any one of Claims 12 to 16, wherein the first dose is from about 24 mg to about 960 mg, and wherein the one or more subsequent doses are from about 24 mg to about 960 mg and are administered about every Q3M from the first dose or from the previous dose.
30. The method of any one of Claims 12 to 16, wherein the first dose is from about 24 mg to about 960 mg, and wherein the one or more subsequent doses are from about 24 mg to about 960 mg and is administered about every Q6M from the second dose or from the previous dose.
31. The method of any one of Claims 12 to 16, wherein the first dose is from about 24 mg to about 960 mg, and wherein the one or more subsequent doses are from about 24 mg to about 960 mg and are administered about every Q9M from the first dose or from the previous dose.
32. The method of Claim 12, wherein the disease, disorder and / or condition associated with ANGPTL3 expression is selected from the group consisting of abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, homozygous and heterozygous familial hypercholesterolemia, hyperlipidemia, hypertriglyceridemia, obesity, type II diabetes mellitus, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), peripheral artery disease (PAD) and statin-resistant hypercholesterolemia.
33. A method of reducing with angiopoietin-like 3 gene (ANGPTL3) expression in an individual having mixed dyslipidemia, the method comprising the step of:(a) administering to the individual a first dose of a double-stranded (ds) RNAi agent that modulates ANGPTL3 expression, wherein the dose is from about 24 mg to about 960 mg, and wherein the ds RNAi agent comprises:(i) a sense strand comprising SEQ ID NO: 1, and(ii) an antisense strand comprising SEQ ID NO: 2,whereby apolipoprotein B (ApoB), angiopoietin-like 3 protein (ANGPTL3), low- density lipoprotein-cholesterol (LDL-C), non-high-density lipoprotein-chol esterol (non-HDL- C) and / or triglyceride (TG) level of the individual is reduced by at least about 50% within about 14 days from the first dose.
34. The method of Claim 33, wherein the sense strand is SEQ ID NO:3.
35. The method of Claim 33 or 34, wherein the antisense strand is SEQ ID NO:4.
36. The method of any one of Claims 33 to 35, further comprising the step of:(b) administering to the individual one or more subsequent doses of the ds RNAi agent, wherein one or more subsequent doses are from about 24 mg to about 960 mg, and wherein the one or more subsequent doses are administered from about every 1 month (Q1M) to about every 9 months (Q9M) from the first dose or from a previous dose, whereby ApoB, ANGPTL3, LDL-C, non-HDL-C and / or TG level of the individual is maintained at the level following the first dose or is reduced further beyond the level following the first dose in response to the one or more subsequent doses.
37. The method of any one of Claims 33 to 36, wherein the administering is intravenously (IV) or subcutaneously (SC).
38. The method of Claim 37, wherein the administering is SC.
39. The method of any one of Claims 36 to 38, wherein the one or more subsequent doses are the same as the first dose.
40. The method of any one of Claims 36 to 38, wherein the one or more subsequent doses are not the same as the first dose.
41. The method of any one of Claims 33 to 40, wherein the first dose is selected from the group consisting of about 24 mg, about 72 mg, about 100 mg, about 208 mg, about 400 mg, about 480 mg, about 800 mg and about 960 mg.
42. The method of any one of Claims 33 to 41, wherein the one or more subsequent doses are independently selected from the group consisting of about 24 mg, about 72 mg, about 100 mg, about 208 mg, about 400 mg, about 480 mg, about 800 mg and about 960 mg.
43. The method of Claim 36, wherein the first dose is about 24 mg, and wherein the one or more subsequent doses are about 24 mg administered about every Q1M, about 24 mg administered about every three months (Q3M), about 24 mg administered about every six months (Q6M), or about 24 mg administered about every Q9M.
44. The method of Claim 36, wherein the first dose is about 72 mg, and wherein the one or more subsequent doses are about 72 mg administered about every Q1M, about 72 mg administered about every three months (Q3M), about 72 mg administered about every six months (Q6M), or about 72 mg administered about every Q9M.
45. The method of Claim 36, wherein the first dose is about 100 mg, and wherein the one or more subsequent doses are about 100 mg administered about every Q1M, about 100 mg administered about every three months (Q3M), about 100 mg administered about every six months (Q6M), or about 100 mg administered about every Q9M.
46. The method of Claim 36, wherein the first dose is about 208 mg, and wherein the one or more subsequent doses are about 208 mg administered about every Q1M, about 208 mg administered about every three months (Q3M), about 208 mg administered about every six months (Q6M), or about 208 mg administered about every Q9M.
47. The method of Claim 36, wherein the first dose is about 400 mg, and wherein the one or more subsequent doses are about 400 mg administered about every Q1M, about 400 mg administered about every three months (Q3M), about 400 mg administered about every six months (Q6M), or about 400 mg administered about every Q9M.
48. The method of Claim 36, wherein the first dose is about 480 mg, and wherein the one or more subsequent doses are about 480 mg administered about every Q1M, about 480 mgadministered about every three months (Q3M), about 480 mg administered about every six months (Q6M), or about 480 mg administered about every Q9M.
49. The method of Claim 36, wherein the first dose is about 800 mg, and wherein the one or more subsequent doses are about 800 mg administered about every Q1M, about 800 mg administered about every three months (Q3M), about 800 mg administered about every six months (Q6M), or about 800 mg administered about every Q9M.
50. The method of Claim 36, wherein the first dose is about 960 mg, and wherein the one or more subsequent doses are about 960 mg administered about every Q1M, about 960 mg administered about every three months (Q3M), about 960 mg administered about every six months (Q6M), or about 960 mg administered about every Q9M.
51. The method of Claim 36, wherein the first dose if from about 24 mg to about 960 mg, and wherein the one or more subsequent doses are from about 24 mg to about 960 mg and are administered about every three months (Q3M) from the first dose or from the previous dose.
52. The method of Claim 36, wherein the first dose is from about 24 mg to about 960 mg, and wherein any subsequent dose is from about 4 mg to about 608 mg and is administered about every six months (Q6M) from the second dose or from the previous dose.
53. The method of Claim 36, wherein the first dose is from about 24 mg to about 960 mg, wherein the one or more subsequent doses are from about 24 mg to about 960 mg and are administered about every Q9M from the first dose or from the previous dose.
54. The method of any one of Claims 33 to 53 further comprising the steps of:(c) measuring the individual’s ApoB, ANGPTL3, LDL-C, non-HDL-C and / or TG level at least once during step (a) and / or step (b);(d) optionally recording a frequency and severity of the individual’s adverse events (AEs) during step (a) and / or step (b);(e) determining an adjusted subsequent dose of the ds RNAi agent from the individual’s ApoB, ANGPTL3, LDL-C, non-HDL-C and / or TG level of step (c) and / or from the frequency and severity of the individual’s AEs of step (d); and(f) administering to the individual the adjusted subsequent dose of the ds RNAi agent.
55. The method of any one of Claims 33 to 54, wherein the individual’s ApoB, ANGPTL3, LDL-C, non-HDL-C and / or TG level is reduced for up to about 150 days following the first dose.
56. The method of any one of Claims 33 to 55, wherein the individual has a disease, disorder and / or condition associated with ANGPTL3 expression selected from the group consisting of abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, homozygous and heterozygous familial hypercholesterolemia, hyperlipidemia, hypertriglyceridemia, obesity, type II diabetes mellitus, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), peripheral artery disease (PAD) and statin-resistant hypercholesterolemia.
57. A method of attenuating, preventing and / or treating a disease, disorder and / or condition associated with angiopoi etin-like 3 gene (ANGPTL3) expression in an individual, the method comprising the step of:(a) administering to an individual an effective amount of the pharmaceutical composition of any one of Claims 1 to 11.
58. A method of reducing angiopoi etin-like 3 gene (ANGPTL3) expression in an individual having mixed dyslipidemia, the method comprising the step of:(a) administering to the individual an effective amount of the pharmaceutical composition of any one of Claims 1 to 11.
Citation Information
Patent Citations
Automatic injection device with delay mechanism including dual functioning biasing member
US8734394B2
Compositions and methods for inhibiting angptl3 expression
WO2021188795A1