Herbicide-resistant acetyl-coa carboxylase mutant and use thereof

By introducing specific mutations into the ACC gene of plants, the resistance of plants to ACCase inhibitor herbicides is improved, and the lack of resistance to herbicides in the prior art is solved, and the resistance of herbicides is significantly improved.

WO2025123591A1PCT designated stage expired Publication Date: 2025-06-19SHANDONG SHUNFENG BIOTECH CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/094848
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-14
Filing Date
2024-05-23
Publication Date
2025-06-19

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the resistance of plants to herbicides, especially to ACC inhibitor-type herbicides.

Method used

The resistance of plants to ACCase inhibitor herbicides is enhanced by introducing specific mutant acetyl-CoA carboxylase (ACC) proteins or polynucleotides, specifically by introducing mutations at conserved sites in the ACC genes of rice or other plants.

Benefits of technology

The plant's resistance to herbicides has been significantly improved, and it can tolerate high concentrations of herbicides, reducing its sensitivity to herbicides, thereby improving crop growth and yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024094848_19062025_PF_FP_ABST
    Figure CN2024094848_19062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides a mutated acetyl-CoA carboxylase (ACC) protein, a nucleic acid, and a use thereof. Specifically, the present invention relates to a mutated ACC protein, a nucleic acid, and a use thereof in plant breeding. Specifically, the present invention provides a mutated ACC protein, and compared with a parent ACC protein, the mutated ACC protein is mutated at the 1878th amino acid and / or the 1879th amino acid corresponding to the amino acid sequence represented by SEQ ID No. 1, or is mutated at the 1791st amino acid and / or the 1792nd amino acid corresponding to the amino acid sequence represented by SEQ ID No. 3. Plants having a mutated ACC have high herbicide resistance, and have wide prospects of application in the cultivation of herbicide-resistant plants.
Need to check novelty before this filing date? Find Prior Art

Description

A herbicide-resistant acetyl-CoA carboxylase mutant and its application

[0001] This application claims priority to Chinese patent application CN202311718231.1, filed December 14, 2023. This application incorporates the entire text of the aforementioned Chinese patent application. Technical Field

[0002] The present invention belongs to the fields of biotechnology and crop genetic breeding, and particularly relates to an acetyl-CoA carboxylase mutant protein, nucleic acid, and a method and application thereof in improving plant resistance to herbicides. Background Art

[0003] Rice (Oryza sativa) is consumed by two-thirds of the world's population and is the main source of energy in the diet of at least half of them. Rice is a low-cost food that is easy and quick to prepare and can be eaten in a variety of dishes.

[0004] The use of herbicides to control weeds and plants in crops has become a nearly universal practice. As an essential component of modern agricultural production systems, herbicides are the most reliable and economical means of farmland weed control. Since the introduction of 2,4-D in the 1940s, the herbicide industry has developed over 60 years of history, resulting in the successful development of a large number of selective herbicides. Research on ACCase inhibitors began in the 1970s. ACC herbicides are classified into three types: cyclohexanediones (DIMs), aryloxyphenoxy propionates (FOPs), and phenylpyrazolines (DENs). ACC herbicides inhibit fatty acid synthesis in grasses, are highly selective, and are transmissible within the plant, enabling post-emergence control of annual and perennial grass weeds. Their high efficacy, low toxicity, long application period, and safety for subsequent crops have earned them a prominent position in the herbicide market.

[0005] Acetyl-CoA carboxylase (ACCase, ACC) is a key target of chemical herbicides and a biotinidase discovered in 1958. It catalyzes the carboxylation of acetyl-CoA to form malonyl-CoA, which provides the substrate for the synthesis of fatty acids and many secondary metabolites. It is a key or rate-limiting enzyme in fatty acid biosynthesis. This carboxylase undergoes a two-step reversible reaction, involving ATP-dependent carboxylation of the biotin group on the substrate domain by biotin-carboxylase activity, followed by transfer of the carboxyl group from biotin to the acetyl-CoA substrate by a carboxyltransferase. Acetyl-CoA carboxylase is a key enzyme in plant fatty acid biosynthesis, a process that occurs in chloroplasts and mitochondria. ACC also plays a role in the formation of long-chain fatty acids and flavonoids, as well as in malonylation in the cytoplasm.

[0006] Summary of the Invention

[0007] The present invention aims to provide a mutant acetyl-CoA carboxylase (ACC) protein or polynucleotide and its application that can confer resistance to herbicides on plants.

[0008] Herein, ACCase or ACC refers to acetyl CoA carboxylase.

[0009] Mutant acetyl-CoA carboxylase (ACC)

[0010] In one aspect, the present invention provides a mutant acetyl-CoA carboxylase (ACC), wherein the mutant acetyl-CoA carboxylase (ACC) has a mutation at amino acid position 1878 corresponding to the amino acid sequence shown in SEQ ID No. 1, or a mutation at amino acid position 1791 corresponding to the amino acid sequence shown in SEQ ID No. 3, compared with the amino acid sequence of the parent acetyl-CoA carboxylase (ACC).

[0011] In one embodiment, the mutant acetyl-Coenzyme A carboxylase (ACC) further undergoes a mutation at amino acid position 1879 corresponding to the amino acid sequence shown in SEQ ID No. 1, or further undergoes a mutation at amino acid position 1792 corresponding to the amino acid sequence shown in SEQ ID No. 3, compared with the amino acid sequence of the parent acetyl-Coenzyme A carboxylase (ACC).

[0012] In one embodiment, the mutant acetyl-CoA carboxylase (ACC) has mutations at amino acids 1878 and 1879 corresponding to the amino acid sequence shown in SEQ ID No. 1, compared with the amino acid sequence of the parent acetyl-CoA carboxylase (ACC).

[0013] In one embodiment, the mutant acetyl-CoA carboxylase (ACC) has mutations at amino acids 1791 and 1792 corresponding to the amino acid sequence shown in SEQ ID No. 3, compared with the amino acid sequence of the parent acetyl-CoA carboxylase (ACC).

[0014] In one embodiment, the amino acid at position 1878 is mutated to a non-N amino acid, for example, A, V, G, L, Q, F, W, Y, D, R, E, K, M, S, T, C, P, H, I; preferably, S, G or D.

[0015] In one embodiment, the amino acid at position 1791 is mutated to a non-N amino acid, for example, A, V, G, L, Q, F, W, Y, D, R, E, K, M, S, T, C, P, H, I; preferably, S, G or D.

[0016] In one embodiment, the amino acid at position 1879 is mutated to an amino acid other than I, for example, A, V, G, L, Q, F, W, Y, D, N, E, K, M, S, T, C, P, H, R; preferably, V.

[0017] In one embodiment, the amino acid at position 1792 is mutated to an amino acid other than I, for example, A, V, G, L, Q, F, W, Y, D, N, E, K, M, S, T, C, P, H, R; preferably, V.

[0018] In a preferred embodiment, the amino acid at position 1878 mutates to S, G or D; and the amino acid at position 1879 mutates to V.

[0019] In a preferred embodiment, the amino acid at position 1791 is mutated to S, G or D; and the amino acid at position 1792 is mutated to V.

[0020] In one embodiment, the mutant acetyl-CoA carboxylase (ACC) further comprises other mutation sites, especially mutation sites that confer resistance to herbicides.

[0021] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from any plant.

[0022] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from a monocot or a dicot.

[0023] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from a monocotyledonous plant.

[0024] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from one or more plants selected from the group consisting of: grasses, leguminous plants, chenopodiaceae, and cruciferous plants.

[0025] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from one or more plants selected from the group consisting of Arabidopsis thaliana, rice, tobacco, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, and strawberry.

[0026] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from one or more plants selected from the group consisting of Arabidopsis thaliana, rice, corn, wheat, and soybean.

[0027] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from one or more plants selected from the group consisting of rice, corn, and wheat.

[0028] In a preferred embodiment, the parent acetyl-CoA carboxylase (ACC) of the present invention is derived from the genus Oryza, particularly rice.

[0029] In a preferred embodiment, the parent acetyl-CoA carboxylase (ACC) of the present invention is derived from rice.

[0030] In a preferred embodiment, the parent acetyl-CoA carboxylase (ACC) of the present invention is derived from japonica rice or indica rice.

[0031] In one embodiment, the parent acetyl-CoA carboxylase (ACC) has ACC activity and the amino acid sequence of the parent ACC has at least 60%, at least 65%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9% sequence identity to the amino acid sequence shown in SEQ ID No. 1 or SEQ ID No. 3 or SEQ ID No. 10 or SEQ ID No. 11 or SEQ ID No. 12 or SEQ ID No. 13.

[0032] In a preferred embodiment, the amino acid sequence of the parent ACC has the sequence shown in SEQ ID No.1.

[0033] In a preferred embodiment, the amino acid sequence of the parent ACC is shown as SEQ ID No. 1.

[0034] In a preferred embodiment, the amino acid sequence of the parent ACC has the sequence shown in SEQ ID No.3.

[0035] In a preferred embodiment, the amino acid sequence of the parent ACC is shown as SEQ ID No. 3.

[0036] In a preferred embodiment, the amino acid sequence of the parent ACC has the sequence shown in SEQ ID No.1 or SEQ ID No.3.

[0037] In a preferred embodiment, the amino acid sequence of the parent ACC is shown as SEQ ID No. 1 or SEQ ID No. 3.

[0038] In a preferred embodiment, the amino acid sequence of the parent ACC is shown as SEQ ID No.1, SEQ ID No.3, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12 or SEQ ID No.13.

[0039] In a preferred embodiment, the amino acid sequence of the parent ACC is shown as SEQ ID No.1, SEQ ID No.3, SEQ ID No.10 or SEQ ID No.11.

[0040] In one embodiment, the amino acid sequence of the parent ACC is as shown in SEQ ID No. 1, and the mutant acetyl-Coenzyme A carboxylase (ACC) is compared with the amino acid sequence of the parent acetyl-Coenzyme A carboxylase (ACC), and the amino acid at position 1878 corresponding to the amino acid sequence shown in SEQ ID No. 1 is mutated, or the amino acid at positions 1878 and 1879 corresponding to the amino acid sequence shown in SEQ ID No. 1 are mutated.

[0041] In one embodiment, the amino acid sequence of the parent ACC is as shown in SEQ ID No. 3, and the mutant acetyl-Coenzyme A carboxylase (ACC) is compared with the amino acid sequence of the parent acetyl-Coenzyme A carboxylase (ACC), and the 1791st amino acid and / or the 1792th amino acid corresponding to the amino acid sequence shown in SEQ ID No. 3 are mutated, or the 1791st amino acid and the 1792th amino acid corresponding to the amino acid sequence shown in SEQ ID No. 3 are mutated.

[0042] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from wheat, and the amino acid sequence of the parent ACC is shown in SEQ ID No. 10. Preferably, the mutant acetyl-CoA carboxylase (ACC) is mutated at amino acid position 1768 and / or amino acid position 1769 corresponding to the amino acid sequence shown in SEQ ID No. 10 compared to the amino acid sequence of the parent acetyl-CoA carboxylase (ACC). Preferably, the amino acid at position 1768 is mutated to an amino acid other than N, for example, A, V, G, L, Q, F, W, Y, D, R, E, K, M, S, T, C, P, H, I; preferably, S, G or D. The amino acid at position 1769 is mutated to an amino acid other than I, for example, A, V, G, L, Q, F, W, Y, D, N, E, K, M, S, T, C, P, H, R; preferably, V.

[0043] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from corn, and the amino acid sequence of the parent ACC is shown in SEQ ID No. 11. Preferably, the mutant acetyl-CoA carboxylase (ACC) is mutated at amino acid position 1783 and / or amino acid position 1784 corresponding to the amino acid sequence shown in SEQ ID No. 11 compared to the amino acid sequence of the parent acetyl-CoA carboxylase (ACC). Preferably, the amino acid at position 1783 is mutated to an amino acid other than N, for example, A, V, G, L, Q, F, W, Y, D, R, E, K, M, S, T, C, P, H, I; preferably, S, G or D. The amino acid at position 1784 is mutated to an amino acid other than I, for example, A, V, G, L, Q, F, W, Y, D, N, E, K, M, S, T, C, P, H, R; preferably, V.

[0044] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from soybean, and the amino acid sequence of the parent ACC is shown in SEQ ID No. 12. Preferably, the mutant acetyl-CoA carboxylase (ACC) is mutated at amino acid position 1718 and / or amino acid position 1719 corresponding to the amino acid sequence shown in SEQ ID No. 12 compared to the amino acid sequence of the parent acetyl-CoA carboxylase (ACC). Preferably, the amino acid at position 1718 is mutated to an amino acid other than N, for example, A, V, G, L, Q, F, W, Y, D, R, E, K, M, S, T, C, P, H, I; preferably, S, G or D. The amino acid at position 1719 is mutated to an amino acid other than I or L, for example, A, V, G, Q, F, W, Y, D, N, E, K, M, S, T, C, P, H, R; preferably, V.

[0045] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from Arabidopsis thaliana, and the amino acid sequence of the parent ACC is shown in SEQ ID No. 13. Preferably, the mutant acetyl-CoA carboxylase (ACC) is mutated at amino acid position 1713 and / or amino acid position 1714 corresponding to the amino acid sequence shown in SEQ ID No. 13 compared to the amino acid sequence of the parent acetyl-CoA carboxylase (ACC). Preferably, the amino acid at position 1713 is mutated to an amino acid other than N, for example, A, V, G, L, Q, F, W, Y, D, R, E, K, M, S, T, C, P, H, I; preferably, S, G or D. The amino acid at position 1714 is mutated to an amino acid other than I or L, for example, A, V, G, Q, F, W, Y, D, N, E, K, M, S, T, C, P, H, R; preferably, V.

[0046] In the present invention, the sequence shown in SEQ ID No. 1 and the sequence shown in SEQ ID No. 3 are both acetyl-CoA carboxylase (ACC) derived from rice; wherein the amino acid position 1878 of the rice ACC shown in SEQ ID No. 1 and the amino acid position 1791 of the rice ACC shown in SEQ ID No. 3 are conserved amino acid positions, and the amino acid position 1879 of the rice ACC shown in SEQ ID No. 1 and the amino acid position 1792 of the rice ACC shown in SEQ ID No. 3 are conserved amino acid positions.

[0047] The present invention found that mutating the above-mentioned conserved sites of acetyl-CoA carboxylase shown in SEQ ID No. 1 or acetyl-CoA carboxylase shown in SEQ ID No. 3 in rice can improve the resistance of rice to ACCase inhibitor herbicides.

[0048] In the present invention, ACC from different plant sources, for example, ACC naturally existing in different plants or ACC from different plant sources that has been artificially modified, can be used as the parent ACC; those skilled in the art can obtain amino acid sites in ACC from different sources that are homologous or conserved to amino acid positions 1878 and 1879 of the amino acid sequence shown in SEQ ID No. 1 or amino acid positions 1791 and 1792 of the amino acid sequence shown in SEQ ID No. 3 using conventional technical knowledge.

[0049] For example, in one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from wheat, and the amino acid sequence of the parent ACC is shown in SEQ ID No. 10; amino acids 1768 and 1769 of the amino acid sequence shown in SEQ ID No. 10 are amino acid positions conserved with amino acids 1878 and 1879 of the amino acid sequence shown in SEQ ID No. 1. In other embodiments, the parent acetyl-CoA carboxylase (ACC) is derived from corn, and the amino acid sequence of the parent ACC is shown in SEQ ID No. 11; amino acids 1783 and 1784 of the amino acid sequence shown in SEQ ID No. 11 are amino acid positions conserved with amino acids 1878 and 1879 of the amino acid sequence shown in SEQ ID No. 1. In other embodiments, the parent acetyl-CoA carboxylase (ACC) is derived from soybean, and the amino acid sequence of the parent ACC is shown in SEQ ID No. 12; amino acids 1718 and 1719 of the amino acid sequence shown in SEQ ID No. 12 are amino acid positions conserved with amino acids 1878 and 1879 of the amino acid sequence shown in SEQ ID No. 1. In other embodiments, the parent acetyl-CoA carboxylase (ACC) is derived from Arabidopsis thaliana, and the amino acid sequence of the parent ACC is shown in SEQ ID No. 13; amino acids 1713 and 1714 of the amino acid sequence shown in SEQ ID No. 13 are amino acid positions conserved with amino acids 1878 and 1879 of the amino acid sequence shown in SEQ ID No. 1.

[0050] In another aspect, the present invention provides a mutant acetyl-CoA carboxylase (ACC), wherein the mutant acetyl-CoA carboxylase (ACC) is selected from any one of the following groups I to IV:

[0051] I. A mutant ACC obtained by a mutation at amino acid position 1878 of the amino acid sequence of SEQ ID No. 1; or a mutant ACC obtained by a mutation at amino acid position 1791 of the amino acid sequence of SEQ ID No. 3; or a mutant ACC obtained by a mutation at amino acid position 1768 of the amino acid sequence of SEQ ID No. 10; or a mutant ACC obtained by a mutation at amino acid position 1783 of the amino acid sequence of SEQ ID No. 11; or a mutant ACC obtained by a mutation at amino acid position 1718 of the amino acid sequence of SEQ ID No. 12; or a mutant ACC obtained by a mutation at amino acid position 1713 of the amino acid sequence of SEQ ID No. 13;

[0052] II. a mutant ACC obtained by mutation at amino acid positions 1878 and 1879 of the amino acid sequence set forth in SEQ ID No. 1; or a mutant ACC obtained by mutation at amino acid positions 1791 and 1792 of the amino acid sequence set forth in SEQ ID No. 3; or a mutant ACC obtained by mutation at amino acid positions 1768 and 1769 of the amino acid sequence set forth in SEQ ID No. 10; or a mutant ACC obtained by mutation at amino acid positions 1783 and 1784 of the amino acid sequence set forth in SEQ ID No. 11; or a mutant ACC obtained by mutation at amino acid positions 1718 and 1719 of the amino acid sequence set forth in SEQ ID No. 12; or a mutant ACC obtained by mutation at amino acid positions 1713 and 1714 of the amino acid sequence set forth in SEQ ID No. 13;

[0053] III. Compared to the mutant ACC described in I or II, the mutant ACC has the mutation site described in I or II; and compared to the mutant ACC described in I or II, the mutant ACC has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9% sequence identity, and retains herbicide resistance activity;

[0054] IV. Compared with the mutant ACC described in I or II, it has the mutation site described in I or II; and, compared with the mutant ACC described in I or II, it has a sequence of one or more amino acid substitutions, deletions or additions, and retains herbicide resistance activity; the one or more amino acids include 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions, deletions or additions.

[0055] In other embodiments, the mutant acetyl-CoA carboxylase of the present invention further comprises other mutation sites that confer resistance to herbicides.

[0056] Those skilled in the art will appreciate that protein structure can be altered without adversely affecting its activity and functionality. For example, one or more conservative amino acid substitutions can be introduced into a protein's amino acid sequence without adversely affecting the activity and / or three-dimensional structure of the protein molecule. Examples and implementations of conservative amino acid substitutions will be apparent to those skilled in the art. Specifically, an amino acid residue can be substituted with another amino acid residue belonging to the same group as the substituted residue, i.e., a non-polar amino acid residue can be substituted for another non-polar amino acid residue, a polar uncharged amino acid residue can be substituted for another polar uncharged amino acid residue, a basic amino acid residue can be substituted for another basic amino acid residue, and an acidic amino acid residue can be substituted for another acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions, where one amino acid is replaced with another amino acid from the same group, fall within the scope of the present invention, as long as the substitution does not inactivate the biological activity of the protein. Therefore, the proteins of the present invention may contain one or more conservative substitutions in their amino acid sequences, preferably generated by substitutions according to Table 1. Furthermore, the present invention also encompasses proteins containing one or more other non-conservative substitutions, as long as such non-conservative substitutions do not significantly affect the desired function and biological activity of the proteins of the present invention.

[0057] Table 1

[0058] Conservative amino acid replacement can be carried out at the non-essential amino acid residue of one or more predictions.A "non-essential" amino acid residue is an amino acid residue that can change (deletion, substitution or replacement) and does not change biological activity, while an "essential" amino acid residue is required for biological activity.A "conservative amino acid replacement" is a replacement in which an amino acid residue is replaced by an amino acid residue with a similar side chain.Amino acid replacement can be carried out in the non-conservative region of ACC. Generally speaking, this type of replacement is not carried out to a conserved amino acid residue, or is not carried out to an amino acid residue positioned within a conserved motif, where this type of residue is required for protein activity.However, it will be appreciated by those skilled in the art that functional variants can have less conservative or non-conservative changes in a conserved region.

[0059] It is well known in the art that one or more amino acid residues can be altered (replaced, deleted, truncated or inserted) from the N and / or C termini of a protein while still retaining its functional activity. Thus, proteins in which one or more amino acid residues are altered from the N and / or C termini of an ACC protein while retaining its desired functional activity are also within the scope of the present invention. These alterations may include those introduced by modern molecular methods such as PCR, which involves PCR amplification of a protein coding sequence by altering or extending the amino acid coding sequence by including the amino acid coding sequence in the oligonucleotides used in the PCR amplification.

[0060] It will be appreciated that proteins can be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions, and methods for such manipulations are generally known in the art. For example, amino acid sequence variants of ACC proteins can be prepared by mutations in the DNA. Other forms of mutagenesis and / or directed evolution can also be employed, for example, using known mutagenesis, recombination, and / or shuffling methods, in combination with relevant screening methods, to perform single or multiple amino acid substitutions, deletions, and / or insertions.

[0061] Those skilled in the art will appreciate that these minor amino acid changes in the ACC proteins of the present invention can occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site, or other functional domains of the protein, the properties of the polypeptide may be altered, but the polypeptide may retain its activity. If the mutations are not located near the catalytic domain, active site, or other functional domains, lesser effects can be expected.

[0062] Those skilled in the art can identify the essential amino acids of the ACC protein using methods known in the art, such as site-directed mutagenesis or protein evolution or bioinformatics analysis. The catalytic domain, active site, or other functional domains of the protein can also be determined by physical analysis of the structure, such as by techniques such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, combined with mutations of amino acids at putative key sites.

[0063] Fusion protein

[0064] On the other hand, the present invention provides a fusion protein comprising the mutant ACC protein of the present invention; further, the fusion protein also includes: a tag peptide, a histidine tag, 6×His, or a plastid-guiding peptide, such as a peptide that guides into the chloroplast, or a regulatory element, such as a promoter sequence, a terminator sequence, a leader sequence, a polyadenylation sequence, a marker gene, etc.

[0065] polynucleotides

[0066] In another aspect, the present invention provides a polynucleotide encoding the mutant ACC protein or an active fragment thereof.

[0067] In one embodiment, the polynucleotide is selected from the group consisting of a genomic sequence, a cDNA sequence, an RNA sequence, or a combination thereof.

[0068] In one embodiment, the polynucleotide is preferably single-stranded or double-stranded.

[0069] In one embodiment, the polynucleotide further contains auxiliary elements flanking the ORF of the mutant protein selected from the following groups: a signal peptide, a secretory peptide, a tag sequence (such as 6His), a nuclear localization signal (NLS) or a combination thereof.

[0070] In one embodiment, the polynucleotide further comprises a promoter operably linked to the ORF sequence of the mutant polypeptide.

[0071] In one embodiment, the promoter is selected from the group consisting of a constitutive promoter, a tissue-specific promoter, an inducible promoter, or a strong promoter.

[0072] Nucleic acid constructs

[0073] In another aspect, the present invention provides a nucleic acid construct comprising the polynucleotide and a regulatory element operably linked thereto.

[0074] In one embodiment, the regulatory element is selected from one or more of the following groups: enhancer, transposon, promoter, terminator, leader sequence, polyadenylation sequence, marker gene.

[0075] carrier

[0076] The present invention also provides a vector comprising a nucleic acid sequence encoding the mutant ACCase or fusion protein of the present invention. Preferably, the vector further comprises an expression control element operably linked to the nucleic acid sequence.

[0077] In one embodiment, the vector includes a cloning vector, an expression vector, a shuttle vector, and an integration vector.

[0078] In one embodiment, the vector can be a vector for gene editing the endogenous ACC gene of the host cell.

[0079] In one embodiment, the expression vector further contains at least one replication origin to achieve self-replication.

[0080] In one embodiment, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.

[0081] The vector can be a plasmid, virus, cosmid, phage, etc., which are well known to those skilled in the art.

[0082] Preferably, the vector in the present invention is a plasmid.

[0083] Gene editing vector system

[0084] On the other hand, the present invention provides a gene editing vector system, comprising one or more vectors, wherein the one or more vectors at least comprise a guide sequence targeting a parent ACC.

[0085] The guide sequence contains a portion of the parent ACC nucleotide sequence, preferably, at least 15bp of ACC nucleotide sequence, more preferably, at least 20bp of ACC nucleotide sequence. In one embodiment, the editing vector further includes a gene editing enzyme. The gene editing enzyme includes nucleases of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (Tanscription Activator-like (TAL) effector nucleases), and ZFN (Zinc finger nuclease) editing tools.

[0086] In one embodiment, the gene editing vector system of the present invention can be used to perform gene editing in plants to produce the aforementioned mutant ACC.

[0087] Preferably, the gene editing enzyme is a Cas protein, also known as CRISPR enzyme or Cas effector protein, and its types include but are not limited to: Cas9 protein, Cas12 protein, Cas13 protein, Cas14 protein, Csm1 protein, FDK1 protein.

[0088] Preferably, the Cas protein is operably linked to a first regulatory element.

[0089] In one embodiment, the gene editing enzyme is a Cas9 protein, and the vector further includes a Scaffold sequence that can specifically bind to the Cas9 protein. After the Scaffold sequence is operably connected to the guide sequence, it constitutes a guide sequence (gRNA). Preferably, the gRNA is operably connected to the second regulatory element.

[0090] In other embodiments, the gene editing enzyme is a Cas12 protein, for example, Cas12a, Cas12b, or Cas12i, and the vector further includes a direct repeat sequence (Direct Repeat) that specifically binds to the Cas12 protein. After the direct repeat sequence is operably connected to the guide sequence, a guide guide sequence (gRNA) is formed. Preferably, the direct repeat sequence is as shown in SEQ ID No.8, and the guide sequence is as shown in SEQ ID No.9; preferably, the gRNA is operably connected to the second regulatory element.

[0091] Such regulatory elements include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences).

[0092] Preferably, the editing vector system further comprises a base editing element, and the base editing element is selected from adenine deaminase and / or cytosine deaminase.

[0093] Preferably, the base editing element is adenine deaminase (also known as adenosine deaminase); more preferably, the base editing element is adenine deaminase TadA8e; more preferably, the base editing element is adenine deaminase TadA8e, whose amino acid sequence is shown in SEQ ID No.6.

[0094] In one embodiment, the editing vector further comprises resistance genes for easy screening, wherein the resistance genes include hyg, bar, kana, rif, spec, and amp, and the resistance genes are well known to those skilled in the art.

[0095] Preferably, the Cas protein is selected from dCas12i3 or other Cas12 proteins with inactivated nuclease activity, wherein "d" represents a Cas protein with inactivated nuclease activity.

[0096] Preferably, the Cas protein is dCas12i3, and the dCas12i3 is a Cas12i3 protein with an E844A mutation; the amino acid sequence of the wild-type Cas12i3 is shown in SEQ ID No.7, and the amino acid sequence of the dCas12i3 is mutated to A at position 844 relative to the amino acid sequence shown in SEQ ID No.7.

[0097] host cells

[0098] On the other hand, the present invention provides a host cell, which contains the mutant acetyl-CoA carboxylase (ACC), the gene encoding the mutant acetyl-CoA carboxylase (ACC), the fusion protein, the vector and the nucleic acid construct, or the polynucleotide is integrated into the host cell genome.

[0099] In one embodiment, the host cell is a prokaryotic cell, such as Escherichia coli.

[0100] In one embodiment, the host cell is a plant cell, and the plant includes angiosperms and gymnosperms.

[0101] In one embodiment, the plants include monocots and dicots.

[0102] In one embodiment, the plants include herbaceous plants and woody plants.

[0103] In one embodiment, the plant comprises Arabidopsis, tobacco, rice, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, or strawberry.

[0104] Herbicide-resistant plants

[0105] In another aspect, the present invention provides a herbicide-resistant plant, comprising one or more of the mutated acetyl-Coenzyme A carboxylase (ACC), the gene encoding the mutated acetyl-Coenzyme A carboxylase (ACC), the fusion protein, the polynucleotide, the vector, the nucleic acid construct, or the host cell; or the polynucleotide is integrated into the plant genome.

[0106] The herbicide resistance is preferably to an ACCase inhibitor, an ACCase inhibitor-type herbicide, or an ACCase-inhibiting herbicide.

[0107] Method for preparing mutant polypeptides

[0108] In another aspect, the present invention provides a method for preparing the mutant ACC polypeptide or an active fragment thereof, the method comprising the steps of:

[0109] (a) culturing a host cell comprising the mutant ACC polypeptide under conditions suitable for expression, thereby expressing the mutant ACC polypeptide;

[0110] Preferably, the method further comprises the step of (b) isolating the mutant ACC polypeptide.

[0111] Method for obtaining herbicide-resistant plants

[0112] In another aspect, the present invention provides a herbicide-resistant plant cell, plant seed, plant tissue, plant part, or plant, wherein the plant cell, plant tissue, plant seed, plant part, or plant contains the mutant ACC polypeptide or its polynucleotide sequence.

[0113] In another aspect, the present invention provides a method for obtaining or preparing a plant cell, plant seed, plant tissue, plant part or plant having herbicide resistance, the method comprising introducing the above-mentioned mutant ACC polypeptide or its polynucleotide sequence into the plant cell, plant seed, plant tissue, plant part or plant.

[0114] Furthermore, the method further comprises the step of causing the plant cells, plant seeds, plant tissues or plant parts to develop into or regenerate into plants.

[0115] In one embodiment, the introduction of the ACC mutant polypeptide of the present invention comprises the step of expressing the ACC mutant polypeptide in plant cells, plant seeds, plant tissues, plant parts or plants, for example, expressing the mutant polypeptide through an expression vector, or integrating the mutant polypeptide into the plant genome for expression.

[0116] In another preferred embodiment, the above method comprises the following steps:

[0117] (1) Providing Agrobacterium carrying an expression vector, wherein the expression vector contains a DNA coding sequence of the mutant ACC polypeptide or an active fragment thereof;

[0118] (2) contacting plant cells, plant tissues, or plant parts with the Agrobacterium of step (1), thereby transferring the DNA coding sequence of the mutant ACC polypeptide or its active fragment into the plant cells and integrating it into the chromosomes of the plant cells; and

[0119] (3) Selecting a plant cell into which the DNA coding sequence of the mutant ACC polypeptide or its active fragment has been transferred.

[0120] In one embodiment, the introduction of the ACC mutant polypeptide includes the step of mutating the endogenous ACC of the plant to introduce the mutant polypeptide; for example, the mutant polypeptide is introduced by mutagenesis, fragment replacement, homologous recombination or gene editing; preferably, the mutant polypeptide can be introduced by gene editing.

[0121] In one embodiment, the gene encoding the endogenous ACC of the plant can be mutated so that the endogenous ACC produces the above mutation at the amino acid position 1878 and / or the amino acid position 1879 corresponding to the amino acid sequence shown in SEQ ID No. 1.

[0122] In one embodiment, the gene encoding the endogenous ACC of the plant can be mutated so that the endogenous ACC produces the above mutation at the amino acid position 1791 and / or the amino acid position 1792 corresponding to the amino acid sequence shown in SEQ ID No. 3.

[0123] In one embodiment, the gene encoding the endogenous ACC of the plant can be mutated so that the endogenous ACC produces the above mutation at the amino acid position 1768 and / or the amino acid position 1769 corresponding to the amino acid sequence shown in SEQ ID No. 10.

[0124] In one embodiment, the gene encoding the endogenous ACC of the plant can be mutated so that the endogenous ACC produces the above mutation at the amino acid position 1783 and / or the amino acid position 1784 corresponding to the amino acid sequence shown in SEQ ID No. 11.

[0125] In one embodiment, the gene encoding the endogenous ACC of the plant can be mutated so that the endogenous ACC produces the above mutation at the amino acid position 1718 and / or the amino acid position 1719 corresponding to the amino acid sequence shown in SEQ ID No. 12.

[0126] In one embodiment, the gene encoding the endogenous ACC of the plant can be mutated so that the endogenous ACC produces the above mutation at the amino acid position 1713 and / or the amino acid position 1714 corresponding to the amino acid sequence shown in SEQ ID No. 13.

[0127] In another preferred embodiment, the method comprises the step of mutating the endogenous ACC coding sequence of plant cells, plant seeds, plant tissues, and plant parts at amino acids 1878 and / or 1879 corresponding to the amino acid sequence shown in SEQ ID No. 1.

[0128] In another preferred embodiment, the method comprises the step of mutating the endogenous ACC coding sequence of plant cells, plant seeds, plant tissues, and plant parts at amino acids 1791 and / or 1792 corresponding to the amino acid sequence shown in SEQ ID No. 3.

[0129] In another preferred embodiment, the method comprises the step of mutating the endogenous ACC coding sequence of plant cells, plant seeds, plant tissues, and plant parts at amino acids 1768 and / or 1769 corresponding to the amino acid sequence shown in SEQ ID No. 10.

[0130] In another preferred embodiment, the method comprises the step of mutating the endogenous ACC coding sequence of plant cells, plant seeds, plant tissues, and plant parts at amino acids 1783 and / or 1784 corresponding to the amino acid sequence shown in SEQ ID No. 11.

[0131] In another preferred embodiment, the method comprises the step of mutating the endogenous ACC coding sequence of plant cells, plant seeds, plant tissues, and plant parts at amino acids 1718 and / or 1719 corresponding to the amino acid sequence shown in SEQ ID No. 12.

[0132] In another preferred embodiment, the method comprises the step of mutating the endogenous ACC coding sequence of plant cells, plant seeds, plant tissues, and plant parts at amino acids 1713 and / or 1714 corresponding to the amino acid sequence shown in SEQ ID No. 13.

[0133] In another preferred embodiment, the method comprises the following steps:

[0134] (1) Introducing the aforementioned gene editing vector system into plant cells, plant seeds, plant tissues, or plant parts;

[0135] (2) A step of allowing a gene editing tool to act on its endogenous ACC and causing a mutation in the amino acid at position 1878 and / or position 1879 corresponding to the amino acid sequence shown in SEQ ID No. 1.

[0136] In another preferred embodiment, the method comprises the following steps:

[0137] (1) Introducing the aforementioned gene editing vector system into plant cells, plant seeds, plant tissues, or plant parts;

[0138] (2) A step of allowing a gene editing tool to act on its endogenous ACC and causing a mutation in the amino acid at position 1791 and / or position 1792 corresponding to the amino acid sequence shown in SEQ ID No. 3.

[0139] Furthermore, the above method also includes the steps of screening mutated plant cells, plant tissues, plant parts, and optionally, isolating the gene editing tool.

[0140] In another preferred embodiment, the gene editing tools include CRISPR, TALEN and ZFN.

[0141] In another preferred embodiment, the plants include angiosperms and gymnosperms.

[0142] In another preferred embodiment, the plants include monocotyledonous plants and dicotyledonous plants.

[0143] In another preferred embodiment, the plants include herbaceous plants and woody plants.

[0144] In another preferred embodiment, the plants include Arabidopsis, tobacco, rice, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, and strawberry.

[0145] The herbicide resistance is preferably to an ACCase inhibitor, an ACCase inhibitor-type herbicide, or an ACCase-inhibiting herbicide.

[0146] On the other hand, the present invention also provides a method for preparing hybrid plants, comprising the step of hybridizing the herbicide-resistant plant obtained by the above method for preparing the herbicide-resistant plant with other plants.

[0147] On the other hand, the present invention also provides a hybrid plant obtained by the above method for preparing a hybrid plant.

[0148] Methods of weed control

[0149] In another aspect, the present invention also provides a method for controlling weed growth near plants, comprising:

[0150] a) providing the above-mentioned herbicide-resistant plants or the above-mentioned hybrid plants;

[0151] b) applying an effective amount of a herbicide to the plants and weeds in the vicinity of the plants, thereby controlling the weeds in the vicinity of the plants.

[0152] The plant is preferably rice.

[0153] In one embodiment, the herbicide is an ACCase inhibitor or an ACCase inhibitor herbicide, and the herbicide is one or more of cyclohexanediones (DIMs), aryloxyphenoxy propionates (FOPs), or phenylpyrazoline (DEN) herbicides.

[0154] In one embodiment, the herbicides include sethoxydim and sethoxydim of the cyclohexanediones (DIMs) herbicide class, haloxyfop-ethyl and quizalofop-ethyl of the aryloxyphenoxy propionates (FOPs) herbicide class, and pinoxaden of the phenylpyrazoline (DEN) herbicide class.

[0155] Preferably, the herbicide comprises sethoxydim, high-efficiency fluazifop-butyl, chlorpyrifos, butyclodim, clethodim, cyclohexene chlorpyrifos, cypermethrin, pyraclostrobin, trimethylol, phenylacetophenone, clodinafop-butyl, clodinafop-butyl, chlorobutane, diclofop-butyl, oxadiazol-butyl, thiazolyl-butyl, fluazifop-butyl, pyraclostrobin, pyraclostrobin, isopropylamine, cyclohexanone, cypermethrin, quizalofop-butyl, quizalofop-ethyl, quizalofop-ethyl, quizalofop-ethyl, trifluoxetine, pinoxaden, oxadiazol-butyl, butyclodim, or one or more of its salts or esters.

[0156] Preferably, the herbicide is one or any combination of quizalofop-p-ethyl, fluazifop-ethyl, clethodim, sethoxydim, and pinoxaden.

[0157] Preferably, the herbicide is sethoxydim.

[0158] In one embodiment, the herbicide is an ACCase inhibitor or an ACCase inhibitor herbicide, including one or more of aryloxyphenoxypropanoates (APP), oxime ether cyclohexanedione (CHD), aryloxyphenylcy-clohexanedione (APCHD) and triketone cyclohexanedione (CTR).

[0159] use

[0160] On the other hand, the present invention provides use of the mutant acetyl-Coenzyme A carboxylase (ACC), the gene encoding the mutant acetyl-Coenzyme A carboxylase (ACC), the fusion protein, the polynucleotide, the vector, the nucleic acid construct or the host cell in a reagent or kit for preparing a plant having herbicide resistance.

[0161] On the other hand, the present invention provides use of the gene editing vector system in a reagent or kit for preparing plants with herbicide resistance.

[0162] On the other hand, the present invention provides uses of the mutant acetyl-CoA carboxylase (ACC), the gene encoding the mutant acetyl-CoA carboxylase (ACC), the fusion protein, the polynucleotide, the vector, the nucleic acid construct or the host cell in controlling weeds.

[0163] In another aspect, the present invention provides use of the gene editing vector system in controlling weeds.

[0164] On the other hand, the present invention provides use of the mutant acetyl-Coenzyme A carboxylase (ACC), the gene encoding the mutant acetyl-Coenzyme A carboxylase (ACC), the fusion protein, the polynucleotide, the vector, the nucleic acid construct or the host cell in preparing a plant having herbicide resistance.

[0165] In another aspect, the present invention provides use of the gene editing vector system in preparing plants with herbicide resistance.

[0166] herbicide

[0167] In one embodiment, the herbicide of the present invention is an ACCase-inhibiting herbicide, which includes but is not limited to one or more of cyclohexanediones (DIMs), aryloxyphenoxy propionates (FOPs) and phenylpyrazoline (DEN) herbicides. The cyclohexanediones (DIMs) herbicides include sethoxydim, cypermethrin, butyclothiocarb, sethoxydim, cypermethrin, pyraclostrobin, and cypermethrin; the aryloxyphenoxy propionates (FOPs) herbicides include high-efficiency fluazifop-butyl, cypermethrin, cypermethrin, cyhalofop-butyl, cyhalofop-butyl, cyhalofop-butyl, cyhalofop-butyl, cyhalofop-butyl, cyhalofop-butyl, cyhalofop-butyl, cyhalofop-butyl, cyhalofop-butyl, cyhalofop-butyl, cyhalofop-butyl, and cyhalofop-butyl; the phenoxypyrazoline (DEN) herbicide includes pinoxaden.

[0168] In one embodiment, the herbicide of the present invention is an ACCase-inhibiting herbicide, and the ACCase-inhibiting herbicide includes but is not limited to one or more of aryloxyphenoxypropanoates (APP), oxime ether cyclohexanedione (CHD), aryloxyphenylcy-clohexanedione (APCHD) and triketone cyclohexanedione (CTR).

[0169] Preferably, the herbicide described in the present invention includes but is not limited to sethoxydim, high-efficiency fluazifop-butyl, chlorfenapyr, butoxydim, cypermethrin, cypermethrin, cypermethrin, cypermethrin, cypermethrin, pyraclostrobin, trimethylol, phenylacetamide, clodinafop-butyl, clodinafop-butyl, chlorobutane, chlorfenapyr, oxadiazol-butyl, thiazolyl-butyl, fluazifop-butyl, pyraclostrobin, pyraclostrobin, pyraclostrobin, isopropyl, cypermethrin, cypermethrin, quinacral, quizalofop-butyl, quizalofop-ethyl, quizalofop-ethyl, trifluoxetine, pinoxaden, oxadiazol-butyl, butoxydim, or one or more of their salts or esters.

[0170] In one embodiment, the herbicides include sethoxydim and sethoxydim of the cyclohexanediones (DIMs) herbicide class, haloxyfop-ethyl and quizalofop-ethyl of the aryloxyphenoxy propionates (FOPs) herbicide class, and pinoxaden of the phenylpyrazoline (DEN) herbicide class.

[0171] Preferably, the herbicide is one or any combination of quizalofop-p-ethyl, fluazifop-p-ethyl, clethodim, sethoxydim, and pinoxaden.

[0172] Preferably, the herbicide is sethoxydim.

[0173] General Definition

[0174] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0175] The terms "polynucleotide," "nucleotide sequence," "nucleic acid sequence," "nucleic acid molecule," and "nucleic acid" are used interchangeably and include DNA, RNA, or hybrids thereof, which may be double-stranded or single-stranded.

[0176] The term "homology" or "identity" is used to refer to the matching of sequences between two polypeptides or between two nucleic acids. Therefore, the compositions and methods of the present invention also include homologs of the nucleotide sequences and polypeptide sequences of the present invention. "Homology" can be calculated by known methods including, but not limited to, Computational Molecular Biology (Lesk, A.M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D.W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A.M. and Griffin, H.G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton, NJ (1993). Stockton Press, New York (1991).

[0177] Specific amino acid positions (numbers) within the proteins of the present invention are determined by aligning the amino acid sequence of the target protein with SEQ ID No. 1 or SEQ ID No. 3 using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, WJ and Lipman, DJ (1983) Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80: 726-730. The default parameters for the ClustalW2 (1.82) algorithm are preferably used: protein gap open penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein / DNA end gap = -1; protein / DNAGAPDIST = 4. Preferably, the AlignX program (part of the vectorNTI group) is used to determine the position of specific amino acids in the protein of the present invention by aligning the amino acid sequence of the protein with SEQ ID No. 1 or SEQ ID No. 3 using default parameters suitable for multiple alignment (gap opening penalty: 10.0 gap extension penalty 0.05).

[0178] The term "encode" refers to the inherent property of a particular nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in a biological process having a defined nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a defined amino acid sequence and the resulting biological properties. Thus, a gene encodes a protein if transcription and translation of the mRNA corresponding to that gene produces the protein in a cell or other biological system.

[0179] The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in living organisms are composed of 20 basic amino acids.

[0180] The terms "protein," "polypeptide," and "peptide" are used interchangeably herein to refer to a polymer of amino acid residues, including polymers in which one or more amino acid residues is a chemical analog of a naturally occurring amino acid residue. The proteins and polypeptides of the present invention can be produced recombinantly or by chemical synthesis.

[0181] The term "mutant protein" or "mutant protein" refers to a protein that has one or more amino acid residue substitutions, insertions, deletions and / or additions compared to the amino acid sequence of a parent protein.

[0182] In the present invention, amino acid residues can be represented by single letters or three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

[0183] The term "AxxB" means that the amino acid A at position xx is changed to amino acid B, for example, N1878S means that the N at position 1878 is changed to S. For double or multiple mutations, each mutation is separated by " / ", for example, N1878S / I1879V means that, relative to the amino acid sequence of SEQ ID No. 1, the N at position 1878 is replaced by S and the I at position 1879 is replaced by V.

[0184] The term "regulatory element," also known as a "regulatory element," as used herein, is intended to include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences), which are described in detail in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, CA (1990). In some cases, regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can primarily direct expression in the desired tissue of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or special cell types (e.g., lymphocytes). In some cases, regulatory elements can also direct expression in a temporally dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue- or cell-type-specific. In some cases, the term "regulatory element" encompasses enhancer elements such as WPRE; CMV enhancer; R-U5' fragment in the LTR of HTLV-I ((Mol. Cell. Biol., Vol. 8(1), pp. 466-472, 1988); SV40 enhancer; and intron sequences between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), pp. 1527-31, 1981).

[0185] As used herein, the term "promoter" has a meaning well known to those skilled in the art and refers to a non-coding nucleotide sequence located upstream of a gene that can initiate expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in a cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when the cell is a cell of the tissue type corresponding to the promoter.

[0186] A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" proteins for import into the cell nucleus via nuclear transport. That is, proteins with an NLS are transported to the cell nucleus. Typically, an NLS comprises a positively charged Lys or Arg residue exposed on the protein surface. Exemplary NLSs include, but are not limited to, NLSs from the SV40 large T antigen, EGL-13, c-Myc, and TUS proteins.

[0187] As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell).

[0188] The term "vector" refers to a vector that contains elements that allow the vector to be integrated into the host cell genome or to replicate autonomously within the cell independently of the genome. The vector may contain any elements that ensure self-replication. It usually carries genes that are not part of the central metabolism of the cell and is usually in the form of double-stranded DNA. The choice of vector usually depends on the compatibility of the vector with the host cell into which the vector is to be introduced. If a vector is used, the choice of vector depends on methods well known to those skilled in the art for transforming host cells. For example, a plasmid vector can be used.

[0189] The term "ACC inhibitor herbicide" refers to a class of herbicides that inhibit fatty acid synthesis in grasses. They are highly selective and transmissible within the plant, enabling post-emergence control of annual and perennial grass weeds. They hold a prominent position among herbicides due to their high efficacy, low toxicity, long application period, and safety for subsequent crops.

[0190] ACC inhibitor herbicides can be divided into three categories, including cyclohexanediones (DIMs), aryloxyphenoxy propionates (FOPs), and phenylpyrazoline (DEN). The cyclohexanediones (DIMs) herbicides include sethoxydim, fenpyroxen, butyclodim, clethodim, cypermethrin, pyraclostrobin, and cypermethrin; the aryloxyphenoxy propionates (FOPs) herbicides include high-efficiency fluazifop-butyl, fenpyroxen, fenpyroxen, pyraclostrobin, cyhalofop-butyl, clodinafop-butyl, quizalofop-butyl, quizalofop-butyl, oxadiazol-butyl, and cyhalofop-butyl; the phenylpyrazoline (DEN) herbicides include pinoxaden.

[0191] In other classification methods, ACC inhibitor herbicides can also be divided into four types, namely, aryloxyphenoxypropanoates (APP), cyclohexanedione oximes (CHD), aryloxyphenylcyclohexanedione (APCHD) and triketone cyclohexanedione (CTR). The results are shown below.

[0192] The herbicides include but are not limited to: sethoxydim, high-efficiency fluazifop-butyl, chlorpyrifos, butoxydim, sethoxydim, cyclohexenethioprine, cypermethrin, sethoxydim, pyraclostrobin, trimethylol, phenylacetophenone, clodinafop-butyl, clodinafop-butyl, chlorobutane, diclofop-butyl, oxadiazol-butyl, thiazolinone, fluazifop-butyl, pyraclostrobin, pyraclostrobin, pyraclostrobin, isopropyl, cyclohexanone, cypermethrin, quizalofop-butyl, quizalofop-ethyl, quizalofop-ethyl, trifluoxetine, pinoxaden, oxadiazol-butyl, butoxydim, cypermethrin.

[0193] "Herbicide resistance" or "herbicide resistance" refers to the inherited ability of a plant to survive and reproduce after exposure to a dose of a herbicide that is normally lethal to the wild type. In plants, resistance may be naturally occurring or induced by techniques such as genetic engineering or selection of variants produced by tissue culture or mutagenesis. Unless otherwise indicated, herbicide "resistance" is heritable and allows a plant to grow and reproduce in the presence of a typical herbicidally effective treatment of a given plant with a herbicide, as suggested by the current edition of the Herbicide Handbook at the time of filing of this disclosure. As will be appreciated by those skilled in the art, a plant may still be considered "resistant" even if some degree of plant damage due to herbicide exposure is evident. As used herein, the term "tolerant" or "tolerance" includes "resistant" or "resistant" plants as defined herein, as well as the improved ability of a particular plant to tolerate various degrees of herbicide-induced damage, typically ethyl, in wild-type plants of the same genotype, at the same herbicide dose.

[0194] In one embodiment, the mutant polypeptide has a tolerance to the maximum ACC-inhibiting herbicide concentration that is increased by at least 1 fold, for example, by at least 1.5 fold, preferably by at least 2 fold, preferably by at least 3 fold, preferably by at least 4 fold, preferably by at least 5 fold, preferably by at least 6 fold, preferably by at least 10 fold, compared to the parent polypeptide.

[0195] In one embodiment, plants containing the mutant polypeptide can tolerate ACC-inhibiting herbicide concentrations that are at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, or at least 10 times the recommended use rate.

[0196] The terms "parental ACC polypeptide" and "parental ACC polypeptide" refer to the polypeptide from which the ACC mutant polypeptide is derived. In a preferred embodiment, the parent ACC polypeptide is a nucleic acid molecule or protein (polypeptide) that can be found in nature, and its nucleotide sequence can be obtained through genetic engineering techniques, such as genome sequencing, polymerase chain reaction (PCR), etc., and its amino acid sequence can be deduced from the nucleotide sequence. The amino acid sequence of the wild-type ACC polypeptide is, for example, shown in SEQ ID No. 1 or SEQ ID No. 3. In certain embodiments, the parent ACC polypeptide can be a polypeptide in which one or more amino acid residues of the wild-type ACC polypeptide are changed, but the enzymatic activity of the polypeptide is not affected.

[0197] The terms "mutated ACC protein", "mutant ACC protein", "mutant ACC", "mutant ACCase", "mutant protein", "mutant polypeptide", "polypeptide of the present invention", "protein of the present invention" and the like are used interchangeably.

[0198] The term "host organism" should be understood as any unicellular or multicellular organism into which a mutant ACC protein encoding nucleic acid can be introduced, including, for example, bacteria such as Escherichia coli, fungi such as yeast (e.g., Saccharomyces cerevisiae), molds (e.g., Aspergillus), plant cells and plants, etc.

[0199] The term "plant" is to be understood as meaning any differentiated multicellular organism capable of photosynthesis, including crop plants, in particular monocotyledonous or dicotyledonous plants, at any stage of maturity or development, vegetable crops, including artichokes, Brussels sprouts, rocket, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, romaine lettuce), bok choy, yellow taro, melons (e.g., cantaloupe, watermelon, Crenshaw melon, honeydew melon, cantaloupe), oilseed crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, kale, Chinese cabbage, bok choy), cardoon, carrot, napa, okra, onion, celery, parsley, chickpeas, parsnips, endive, peppers, potatoes, cucurbits (e.g., zucchini, cucumber, courgette, squash, pumpkin), radish, cabbage, Onions, rutabagas, eggplant (also known as eggplant), salsify, lettuce, shallots, endive, garlic, spinach, green onions, squash, greens, beets (sugar beets and fodder beets), sweet potatoes, Swiss chard, horseradish, tomatoes, turnips, and spices; fruits and / or vines such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus, blueberries, boysenberries, y), cranberries, currants, loganberries, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pome fruits, melons, mangoes, papayas, and lychees; field crops such as clover, alfalfa, evening primrose, meadowsweet, corn / maize (feed corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, and legumes (beans, lentils, peas, soybeans) , oil plants (rapeseed, mustard, poppy, olive, sunflower, coconut, castor oil plant, cocoa bean, peanut), Arabidopsis, fiber plants (cotton, flax, hemp, jute), Lauraceae (cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plant; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants, as well as trees such as forests (broadleaf trees and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other seedlings.

[0200] The term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant callus, plant pieces, as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, ears, roots, root tips, anthers, and the like.

[0201] The term "plant cell" is to be understood as any cell from or found in a plant, which is capable of forming, for example, undifferentiated tissue such as callus, differentiated tissue such as embryos, plant components, plants or seeds.

[0202] The term "gene editing" technology includes CRISPR technology, TALEN technology, and ZFN technology. CRISPR technology refers to clustered, regularly interspaced short palindromic repeats, which come from the immune system of microorganisms. Among them, gene editing tools include guideRNA, Cas proteins (such as Cas9, Cpf1, Cas12i, etc.). The gene editing tool referred to in TALEN technology is a restriction enzyme that can cut a specific DNA sequence, which includes a TAL effector DNA binding domain and a DNA cleavage domain. The gene editing tool referred to in ZFN technology is also a restriction enzyme that can cut a specific DNA sequence, which includes a zinc finger DNA binding domain and a DNA cleavage domain. It is well known to those skilled in the art that by constructing the nucleotides encoding the gene editing tool and other regulatory elements into a suitable vector and then transforming the cell, the editing of the genome in the cell can be achieved. The types of editing include gene knockout, insertion, and base editing.

[0203] As used herein, the term "gene editing enzyme" refers to nucleases suitable for editing tools such as CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (Transcription Activator-like (TAL) effector nuclease technology), and ZFN (Zinc finger nuclease technology). Preferably, the gene editing enzyme is a CRISPR enzyme, also known as a Cas protein, and its types include but are not limited to: Cas9 protein, Cas12 protein, Cas13 protein, Cas14 protein, Csm1 protein, and FDK1 protein. The Cas protein refers to a family of proteins, which may have different structures depending on their source, such as SpCas9 derived from Streptococcus pyogenes and SaCas9 derived from Staphylococcus aureus; it may also be classified according to structural features (such as domains), such as the Cas12 family including Cas12a (also known as Cpf1), Cas12b, Cas12c, Cas12i, etc. The Cas protein may have double-stranded or single-stranded or no cutting activity. The Cas protein of the present invention may be wild type or a mutant thereof, and the mutation type of the mutant may include amino acid replacement, substitution or deletion, and the mutant may or may not change the enzymatic activity of the Cas protein. Preferably, the Cas protein of the present invention has only single-stranded cutting activity or no cutting activity, which is a mutant of the wild-type Cas protein. Preferably, the Cas protein of the present invention is Cas9, Cas12, Cas13 or Cas14 with single-stranded cutting activity. In a preferred embodiment, the Cas12 protein of the present invention includes Cas12i3 and dCas12i3, wherein "d" represents a Cas protein with inactivated nuclease activity. As known to those skilled in the art, a variety of Cas proteins with nucleic acid cleavage activity have been reported in the prior art. The known protein or its modified variant can achieve the function of the present invention, and is herein incorporated by reference into the scope of protection.

[0204] As is well known in the art, one or more amino acid residues can be deleted from the N and / or C terminus of a protein while still retaining its functional activity. Therefore, on the other hand, the present invention also relates to fragments (such as amino acid fragments containing the mutation sites of the present invention) that have deleted one or more amino acid residues from the N and / or C terminus of a mutant ACC protein while retaining its desired functional activity, which are also within the scope of the present invention and are referred to as biologically active fragments. In the present invention, a "biologically active fragment" refers to a portion of a mutant ACC protein of the present invention that retains the biological activity of the mutant ACC protein of the present invention. For example, a biologically active fragment of a mutant ACC protein can be a portion that has deleted one or more (e.g., 1-50, 1-25, 1-10 or 1-5, such as 1, 2, 3, 4 or 5) amino acid residues at the N and / or C terminus of the protein, but still retains the biological activity of the full-length protein.

[0205] In addition, the mutant proteins of the present invention can also be modified. Modifications (usually without altering the primary structure) include: chemical derivatization of the mutant protein in vivo or in vitro, such as acetylation or carboxylation. Modifications also include glycosylation, such as those produced by glycosylation during the synthesis and processing of the mutant protein or in further processing steps. Such modifications can be accomplished by exposing the mutant protein to a glycosylation enzyme (such as a mammalian glycosylase or deglycosylation enzyme). Modified forms also include sequences having phosphorylated amino acid residues (such as phosphotyrosine, phosphoserine, and phosphothreonine). Also included are mutant proteins that have been modified to improve their resistance to proteolysis or optimize their solubility.

[0206] It is well known to those skilled in the art that, due to the degeneracy of the genetic code, a variety of different nucleic acid sequences can encode the amino acid sequences disclosed herein. Generating alternative nucleic acid sequences encoding the same protein is within the capabilities of those skilled in the art, and thus, the present invention encompasses nucleic acid sequences encoding the same amino acid sequence due to the degeneracy of the genetic code. For example, to achieve high expression of a heterologous gene in a target host organism, such as a plant, the gene can be optimized using codons preferred by the host organism to achieve better expression.

[0207] The full-length sequence of the polynucleotide of the present invention can usually be obtained by PCR amplification, recombinant method or artificial synthesis method. For PCR amplification, primers can be designed based on the relevant nucleotide sequence disclosed in the present invention, especially the open reading frame sequence, and a commercially available cDNA library or a cDNA library prepared by conventional methods known to those skilled in the art is used as a template to amplify and obtain the relevant sequence. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then the fragments amplified each time are spliced ​​together in the correct order. The obtained nucleotide sequence can be cloned into a vector, then transferred into cells, and then isolated from the host cells after the proliferation by conventional methods to obtain large quantities of relevant sequences. The mutation site of the present invention can also be introduced by artificial synthesis.

[0208] More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of the gene product. Increasing the number of copies of a polynucleotide can be achieved by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide. In the latter case, cells containing amplified copies of the selectable marker gene and, therefore, additional copies of the polynucleotide can be selected by artificially culturing the cells in the presence of an appropriate selectable agent.

[0209] Methods well known to those skilled in the art can be used to construct vectors containing a DNA sequence encoding an ACC mutant polypeptide and appropriate transcription / translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, and the like. The DNA sequence can be effectively linked to an appropriate promoter in the vector to direct mRNA synthesis. The vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0210] Vectors suitable for use in the present invention include commercially available plasmids such as, but not limited to, pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA), pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174, pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacia).

[0211] The present invention also provides a host cell comprising a nucleic acid sequence encoding an ACC mutant polypeptide of the present invention, a nucleic acid construct, or an expression vector. The vector encoding the present invention is introduced into the host cell such that the vector exists as part of a chromosomal integrant or as a self-replicating extrachromosomal vector as described earlier, or the vector can perform gene editing on the endogenous ACC gene of the host cell. The host cell can be any host cell familiar to those skilled in the art, including prokaryotic and eukaryotic cells.

[0212] The nucleic acid sequence, nucleic acid construct or expression vector of the present invention can be introduced into the host cell by a variety of techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti-plasmid-mediated gene delivery, as well as calcium phosphate transfection, DEAE-dextran-mediated transfection, lipofection or electroporation.

[0213] In the production methods of the present invention, the cells are cultured in a nutrient medium suitable for production of the polypeptide using methods well known in the art. If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted into the medium, it can be recovered from cell lysates.

[0214] As used herein, the terms "guide RNA," "mature crRNA," "guide sequence," and "gRNA" are used interchangeably and have meanings generally understood by those skilled in the art. In general, a guide RNA may comprise a direct repeat (DR) and a guide sequence, or may consist essentially of or consist of a direct repeat and a guide sequence (also referred to as a spacer in the context of an endogenous CRISPR system).

[0215] In some cases, the guide sequence is any polynucleotide sequence that has sufficient complementarity to the target sequence to hybridize with the target sequence and guide the specific binding of the CRISPR / Cas complex to the target sequence. In one embodiment, when optimally aligned, the degree of complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining optimal alignment is within the capabilities of those of ordinary skill in the art. For example, there are publicly available and commercially available alignment algorithms and programs, such as, but not limited to, ClustalW, Smith-Waterman algorithm in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0216] The main advantages of the present invention are:

[0217] 1. The present invention screened out a group of mutant ACC proteins.

[0218] 2. Plants containing the mutant ACC protein of the present invention have significantly enhanced herbicide resistance compared to their parent plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0219] Figure 1. iABE base editor.

[0220] Figure 2. Part A is the target sequence of the iABE base editor, and part B is the codons for the 1878th and 1879th amino acids of the first amino acid sequence encoded by the japonica rice ACC protein and the replacement codons after base editing.

[0221] Figure 3. Comparison of the amino acid sequences encoded by the japonica rice ACCase gene and the indica rice ACCase gene.

[0222] Figure 4. Wild-type japonica rice plants WT and edited plants ACC N1878D ACC N1878S ACC N1878G ACC I1879V ACC N1878S / I1879V herbicide resistance.

[0223] Figure 5. Wild-type japonica rice plants WT and edited plants ACC I1879V ACC N1878D / I1879V ACC N1878S / I1879V , ACC N1878G / I1879V herbicide resistance.

[0224] Figure 6. Wild-type japonica rice plants WT and edited plants ACC N1878S / I1879V Comparison of effective ear number, ear length, single ear fruit setting rate, and 1000-grain weight.

[0225] Figure 7. Wild-type indica rice plants (indica-WT) and edited plants ACC N1791S / I1792V Resistance to the herbicides quizalofop-p-ethyl, fluazifop-ethyl, sethoxydim, sethoxydim, and pinoxaden.

[0226] Figure 8. Comparison of the amino acid sequences encoded by the ACCase genes of rice, wheat, corn, soybean and Arabidopsis.

[0227] Sequence information

[0228] Implementation Method

[0229] The present invention will be further described below with reference to the following embodiments. The following description is merely a preferred embodiment of the present invention and does not limit the present invention in any other form. Any person skilled in the art may utilize the above disclosed technical content to make equivalent embodiments with equivalent variations. Any simple modification or equivalent variation of the following embodiments made in accordance with the technical essence of the present invention without departing from the content of the present invention shall fall within the scope of protection of the present invention.

[0230] Example 1. Construction of gene editing vectors and screening of edited plants

[0231] 1. Construction of the iABE base editor targeting the endogenous ACC gene in rice

[0232] The ABE base editor can achieve A / T->G / C base conversion within a certain sequence window. The present invention uses the iABE (dCas12i3-ABE) base editor as a vector, designs gRNA in the endogenous ACCase gene of rice, and clones it into the iABE vector to form a base editor targeting the endogenous ACCase gene of rice.

[0233] Different rice varieties have different amino acid sequences encoded by the ACCase gene due to different annotations of the gene in different gene databases. Specifically:

[0234] There are two types of amino acid sequences encoded by the japonica rice ACCase gene (this is due to different annotations of genes in different gene databases): in the Rice Genome Annotation Project database, the locus identifier of the japonica rice ACCase gene is LOC_Os05g22940, the amino acid sequence it encodes is shown in SEQ ID No. 1, and the nucleotide sequence (CDS sequence) is shown in SEQ ID No. 2; in the Genebank database, the japonica rice ACCase gene is defined as LOC4338322, the amino acid sequence it encodes is shown in SEQ ID No. 3, and the nucleotide sequence (CDS sequence) is shown in SEQ ID No. 4.

[0235] The Genebank number of the indica rice ACCase gene is EAY97401.1. The amino acid sequence encoded by it is completely identical to the amino acid sequence of the japonica rice ACCase gene in the Genebank database, as shown in SEQ ID No. 3, and the nucleotide sequence (genomic sequence) is shown in SEQ ID No. 5.

[0236] The iABE base editor is shown in Figure 1, wherein pU6 is the U6 promoter, pUBI is the UBI promoter, tNOS is the terminator, and NLS is the nuclear localization signal; ABE is adenosine deaminase, and its amino acid sequence is shown in SEQ ID No. 6; dCas12i3 is a Cas12i3 mutant protein, Cas12i3 is Cas12f.4 in CN111757889B, and its amino acid sequence is shown in SEQ ID No. 7; dCas12i3 is Cas12i3 with E844A mutation, and its nuclease activity is inactivated; gRNA includes a direct repeat sequence (DR) and a guide sequence, the direct repeat sequence is agagaaugugugcauagucacac (SEQ ID No. 8), the guide sequence is gtgtggagaatatacatgga (SEQ ID No. 9), and PAM is TTG.

[0237] In other embodiments, those skilled in the art may also select other types of base editors, for example, selecting adenosine deaminases from different sources and different Cas proteins for combination to achieve the effect of base editing.

[0238] The first amino acid sequence encoded by the japonica rice ACCase gene is as follows (SEQ ID No. 1):

[0239] The first nucleotide sequence of the japonica rice ACCase gene is as follows (SEQ ID No. 2):

[0240] The second amino acid sequence encoded by the japonica rice ACCase gene (also the amino acid sequence encoded by the indica rice ACCase gene) is as follows (SEQ ID No. 3):

[0241] The second nucleotide sequence of the japonica rice ACCase gene is as follows (SEQ ID No. 4):

[0242] The nucleotide sequence of the indica rice ACCase gene is as follows (SEQ ID No. 5):

[0243] The amino acid sequence of adenosine deaminase is as follows (SEQ ID No. 6):

[0244] The amino acid sequence of Cas12i3 is as follows (SEQ ID No.7):

[0245] 2. Genetic transformation of rice and screening and identification of edited plants

[0246] Using japonica rice (Anzhijing 006) as the experimental material, the base editor iABE was transformed with Agrobacterium to obtain gene-edited plants. Transformed seedlings were screened using a medium containing the herbicide sethoxydim at a concentration of 2 mg / L. Alternatively, the transformed seedlings were planted in a cultivation room and sprayed with 2.0 g / L sethoxydim herbicide (corresponding to a field application rate of 40 g.ai / mu). The survival of the seedlings was counted after 10 days.

[0247] Screening for herbicide-resistant edited plants on a medium containing sethoxydim herbicide revealed that they contained multiple ACC protein mutations. This was caused by one or more A-to-G mutations in the codons for amino acid Asn (N) at position 1878 and Ile (I) at position 1879 in the target sequence, as shown in Figure 2. Here, amino acid N at position 1878 and I at position 1879 are amino acid positions obtained from the first amino acid sequence encoded by the wild-type ACCase gene of japonica rice, namely SEQ ID No. 1, as the parent sequence.

[0248] The identification found that the editing types of ACC proteins in these edited plants were N1878D single mutation (the 1878th amino acid of the first amino acid sequence encoded by the ACC protein of the edited plant mutated to D), N1878S single mutation (the 1878th amino acid of the first amino acid sequence encoded by the ACC protein of the edited plant mutated to S), N1878G single mutation (the 1878th amino acid of the first amino acid sequence encoded by the ACC protein of the edited plant mutated to G), I1879V single mutation (the 1879th amino acid of the first amino acid sequence encoded by the ACC protein of the edited plant mutated to V), N1878D The ACCase genotypes of the edited plants were ACC / I1879V double mutation (the 1878th amino acid of the first amino acid sequence encoded by the ACC protein of the edited plant mutated to D and the 1879th amino acid mutated to V), N1878S / I1879V double mutation (the 1878th amino acid of the first amino acid sequence encoded by the ACC protein of the edited plant mutated to S and the 1879th amino acid mutated to V), and N1878G / I1879V double mutation (the 1878th amino acid of the first amino acid sequence encoded by the ACC protein of the edited plant mutated to G and the 1879th amino acid mutated to V). N1878D ACC N1878S ACC N1878G ACC I1879V ACC N1878D / I1879V ACC N1878S / I1879V and ACC N1878G / I1879V These edited plants were self-pollinated to obtain homozygous edited plants.

[0249] Using the same method as above, indica rice was used as the experimental material to obtain herbicide-resistant edited plants with the N1791S / I1792V double mutation (the ACC protein of the edited plant had amino acid N mutated to S and amino acid I mutated to V at position 1791). That is, the ACCase genotype of the edited plant was ACC N1791S / I1792V , the edited plants were self-pollinated to obtain homozygous edited plants; the amino acid N at position 1791 and the amino acid I at position 1792 here are the amino acid sequences encoded by the wild-type ACCase gene of indica rice, that is, the amino acid positions obtained by SEQ ID No. 3 as the maternal sequence.

[0250] The two amino acid sequences encoded by the japonica rice ACCase gene (SEQ ID No. 1 and SEQ ID No. 3) were compared with the amino acid sequence encoded by the indica rice ACCase gene (SEQ ID No. 3), and the results are shown in Figure 3. Overall, the amino acid sequence of the first amino acid sequence encoded by the japonica rice ACCase gene from amino acid position 156 onwards is identical to the amino acid sequence of the second amino acid sequence encoded by the japonica rice ACCase gene (i.e., the amino acid sequence encoded by the indica rice ACCase gene) from amino acid position 69 onwards, that is, the amino acid sequence of the sequence described in SEQ ID No. 1 from amino acid position 156 onwards is identical to the amino acid sequence of the sequence described in SEQ ID No. 3 from amino acid position 69 onwards. In addition, amino acid positions 1878 N and 1879 I of the first amino acid sequence encoded by the japonica rice ACCase gene are identical to amino acid positions 1791 N and 1792 I of the second amino acid sequence encoded by the japonica rice ACCase gene; and amino acid positions 1878 N and 1879 I of the first amino acid sequence encoded by the japonica rice ACCase gene are homologous to amino acid positions 1791 N and 1792 I of the amino acid sequence encoded by the indica rice ACCase gene. That is, amino acid position 1878 N of SEQ ID No. 1 is identical to amino acid position 1791 N of SEQ ID No. 3, and amino acid position 1879 I of SEQ ID No. 1 is identical to amino acid position 1792 I of SEQ ID No. 3.

[0251] Example 2: Testing of Herbicide Resistance and Other Traits of Edited Japonica Rice (Wanzhijing 006) Plants

[0252] Wild-type japonica rice plants WT (Wanzhijing 006 wild-type plants) and edited japonica rice plants obtained in Example 1 (edited plants ACC N1878D ACC N1878S ACC N1878G ACC I1879V ACC N1878D / I1879V ACC N1878S / I1879V ), and then sprayed with water without herbicide or 240 ml / mu of the herbicide sethoxydim (12.5%, EC) for 14 days to observe the growth status and herbicide resistance of the plants. The results are shown in Figure 4. The wild-type japonica rice plants WT sprayed with water and all the edited plants grew normally without any pesticide damage; the wild-type japonica rice plants WT sprayed with sethoxydim all died, and the edited plants ACC sprayed with sethoxydim N1878D ACC N1878S ACC N1878G ACC I1879V ACCN1878D / I1879V Compared with wild-type plants, it can show a certain degree of herbicide resistance; the edited plants sprayed with sethoxydim ACC N1878S / I1879V It can grow normally, has no dried leaves, and shows stronger herbicide resistance.

[0253] Wild-type japonica rice plants WT (Wanzhijing 006 wild-type plants) and edited japonica rice plants obtained in Example 1 (edited plants ACC I1879V ACC N1878D / I1879V ACC N1878S / I1879V ACC N1878G / I1879V ), respectively administered 750g aiha -1 Fourteen days after the application of sethoxydim (12.5%, EC) or clear water without herbicide, the level of phytotoxicity was evaluated (according to the "National Standard of the People's Republic of China for Pesticide Field Efficacy Test Guidelines", crop phytotoxicity is divided into five levels: level 0, no phytotoxicity; level 1, slight phytotoxicity; level 2, moderate phytotoxicity; level 3, severe phytotoxicity; level 4, crop death). The results are shown in Figure 5. The wild-type japonica rice plant WT and all the edited plants grew normally without phytotoxicity under the treatment of clear water without herbicide; the wild-type japonica rice plant WT died after the application of sethoxydim, which was level 4 phytotoxicity; while the edited plant ACC I1879V ACC N1878D / I1879V ACC N1878S / I1879V and ACC N1878G / I1879V Showing different herbicide resistance: among them, the edited plants ACC I1879V Green heart leaves have grown, but the old leaves have dried up, which is level 2 phytotoxicity; edit plant ACC N1878D / I1879V Shows some phytotoxicity, which is level 2.5; edit plant ACC N1878S / I1879V and ACC N1878G / I1879V There is almost no phytotoxicity, the old leaves and heart leaves are normal, and the phytotoxicity level is 0.1; the phytotoxicity level statistics are shown in the following table. I1879V and ACC N1878D / I1879V Has some herbicide resistance, edited plant ACCN 1878S / I1879V and ACC N1878G / I1879V Has high herbicide resistance.

[0254] The above results indicate that single mutations of N1878D, N1878S, or N1878G or double mutations of the above mutation sites (N1878D, N1878S, or N1878G) and I1879V in the japonica rice ACC protein relative to SEQ ID No. 1 can confer herbicide resistance to plants.

[0255] ACC N1878S / I1879VThe field growth test was carried out, and the results are shown in Figure 6. Compared with the wild-type japonica rice plant WT (Wanzhijing 006 wild-type plant), the edited plant ACC N1878S / I1879V There were no significant differences in yield-related traits (e.g., number of effective ears, ear length, fruit set rate per ear, and 1000-grain weight) between the two groups.

[0256] Example 3: Herbicide resistance of edited indica rice plants

[0257] Wild-type indica rice plants WT and the edited indica rice plants obtained in Example 1 (edited plants ACC) were planted in a greenhouse. N1791S / I1792V ), when the rice had three leaves and one heart, it was sprayed with plain water without herbicide or with the herbicides quizalofop-p-ethyl, fluazifop-p-ethyl, sethoxydim, clethodim, and pinoxaden. The symptoms of phytotoxicity, fresh weight, and fresh weight inhibition rate were investigated 15 days after spraying. The fresh weight inhibition rate was calculated as follows: (CK fresh weight - treatment fresh weight) / CK fresh weight*100%.

[0258] In this example, wild-type indica rice plants WT and edited plants ACC N1791S / I1792V There are 6 spraying treatments: CK, 1X, 2X, 4X, 8X, and 16X. CK refers to spraying clean water without adding herbicides. 1X (1 times), 2X (2 times), 4X (4 times), 8X (8 times), and 16X (16 times) refer to different multiples of the herbicide quizalofop-p-ethyl, haloxyfop-ethyl, sethoxydim, clethodim, and pinoxaden. Among them, the concentrations of the herbicides quizalofop-p-ethyl, haloxyfop-ethyl, sethoxydim, clethodim, and pinoxaden at a 1X dose are shown in the following table:

[0259] Fifteen days after spraying herbicide, wild-type indica rice plants WT and edited plants ACC N1791S / I1792V The phytotoxicity symptoms, fresh weight and fresh weight inhibition rate are as follows:

[0260] Symptoms of phytotoxicity after spraying the herbicide Quizalofop-Ph

[0261] Fresh weight and fresh weight inhibition rate of spraying herbicide quizalofop-p-ethyl

[0262] Symptoms of phytotoxicity after spraying the herbicide Halpyralid

[0263] Fresh weight and fresh weight inhibition rate of spraying the herbicide haloxyfop-ethyl

[0264] Symptoms of injury after spraying the herbicide sethoxydim

[0265] Fresh weight and fresh weight inhibition rate of spraying herbicide sethoxydim

[0266] Symptoms of phytotoxicity after spraying the herbicide clethodim

[0267] Fresh weight and fresh weight inhibition rate of spraying herbicide clethodim

[0268] Symptoms of injury after spraying the herbicide pinoxaden

[0269] Fresh weight and fresh weight inhibition rate of spraying the herbicide pinoxaden

[0270] Wild-type indica rice plants (indica-WT) and edited plants ACC N1791S / I1792V The resistance results to the herbicides quizalofop-p-ethyl, fluazifop-p-ethyl, clethodim, sethoxydim, and pinoxaden are shown in FIG7 .

[0271] Combining the above wild-type indica rice plants WT and edited plants ACC N1791S / I1792V Based on the phytotoxicity symptoms, fresh weight, fresh weight inhibition rate and herbicide resistance shown in Figure 7, it can be concluded that:

[0272] Wild-type indica rice plants WT and edited plants ACC sprayed with water N1791S / I1792V All of them grew normally without any damage from pesticides.

[0273] All wild-type indica rice plants WT sprayed with 1X, 2X, 4X, 8X, and 16X of Quizalofop-Phthiophene died; the edited plants ACC sprayed with 1X of Quizalofop-Phthiophene died. N1791S / I1792V The heart leaves turned white and then turned green again, and there was no phytotoxicity; the edited plants sprayed with 2X and 4X quizalofop-p-ethyl had ACC N1791S / I1792V The heart leaves turned white, and there was slight phytotoxicity; the edited plants sprayed with 8X and 16X of Quizalofop-Phthiophene had ACC N1791S / I1792V Dead; visible edited plant ACC N1791S / I1792V It showed strong herbicide resistance to quizalofop-p-ethyl.

[0274] The wild-type indica rice plants WT sprayed with high-efficiency halpyralid 1X had dry heart leaves, sluggish growth, and severe pesticide damage; the wild-type indica rice plants WT sprayed with high-efficiency halpyralid 2X, 4X, 8X, and 16X all died; the edited plants ACC sprayed with high-efficiency halpyralid 1X N1791S / I1792V Normal growth, no pesticide damage; edited plants sprayed with high-efficiency halpyraclostrobin 2X, 4X ACC N1791S / I1792V The heart leaves turned white, and the damage was slight; the edited plants sprayed with high-efficiency halpyrazo-ethyl 8X had ACC N1791S / I1792V The plants were short, grew slowly, and showed some signs of phytotoxicity. The edited plants sprayed with the highly effective halpyralid 16X had ACC. N1791S / I1792VDeath; visible edited plant ACC N1791S / I1792V It showed strong resistance to the highly effective herbicide fluazifop-ethyl.

[0275] All wild-type indica rice plants WT sprayed with clethodim 1X, 2X, 4X, 8X, and 16X died; the edited plants ACC sprayed with clethodim 1X died. N1791S / I1792V The heart leaves turned white, and the damage was slight; the edited plants sprayed with clethodim 2X and 4X had ACC N1791S / I1792V Some leaves dried up, showing some phytotoxicity; the edited plants sprayed with clethodim 8X and 16X ACC N1791S / I1792V Death; visible edited plant ACC N1791S / I1792V It shows strong herbicide resistance to clethodim.

[0276] The heart leaves of wild-type indica rice plants WT sprayed with sethoxydim 1X dried up, grew sluggishly, and were seriously injured by the drug; all wild-type indica rice plants WT sprayed with sethoxydim 2X, 4X, 8X, and 16X died; the edited plants ACC sprayed with sethoxydim 1X and 2X died. N1791S / I1792V Able to grow normally, without dry leaves and without any pesticide damage; edited plants sprayed with sethoxydim 4X ACC N1791S / I1792V The heart leaves turned white, indicating some phytotoxicity; the edited plants sprayed with 8X and 16X of sethoxydim ACC N1791S / I1792V The heart leaves are dry and the plants are short, showing serious damage from the pesticide. N1791S / I1792V It showed strong resistance to the herbicide sethoxydim.

[0277] The heart leaves of wild-type indica rice plants WT sprayed with pinoxaden 1X dried up, grew sluggishly, and were severely damaged by the drug; all wild-type indica rice plants WT sprayed with pinoxaden 2X, 4X, 8X, and 16X died; the edited plants ACC sprayed with pinoxaden 1X N1791S / I1792V Normal growth, no phytotoxicity; edited plants sprayed with pinoxaden 2X ACC N1791S / I1792V The heart leaves turned white, and the damage was slight; the edited plants sprayed with 4X, 8X, and 16X of pinoxaden had ACC N1791S / I1792V Some leaves are dry and the plants are short, showing some damage from the drug; it can be seen that the ACC of the edited plants N1791S / I1792V It shows strong herbicide resistance to pinoxaden.

[0278] The above results indicate that mutations at amino acid positions 1791 and 1792 of the indica rice ACC protein relative to SEQ ID No. 3 can confer strong resistance to ACC-inhibiting herbicides (e.g., quizalofop-p-ethyl, fluazifop-ethyl, clethodim, sethoxydim, and pinoxaden).

[0279] In summary, relative to SEQ ID No. 1, a single site mutation at amino acid position 1878 or a double site mutation at amino acids 1878 and 1879 of the rice ACC protein; or, relative to SEQ ID No. 3, a single site mutation at amino acid position 1791 or a double site mutation at amino acids 1791 and 1792 of the rice ACC protein, can confer strong herbicide resistance to ACCase inhibitor herbicides in rice.

[0280] Example 4: Homology and conservation of ACCase genes in different plants

[0281] The ACCase gene has high homology among different monocots and dicots, and the sequence similarity of the amino acid sequences it encodes is also high. In wheat (monocot), the amino acid sequence encoded by the ACCase gene is shown in SEQ ID No. 10; in corn (monocot), the amino acid sequence encoded by the ACCase gene is shown in SEQ ID No. 11; in soybean (dicot), the amino acid sequence encoded by the ACCase gene is shown in SEQ ID No. 12; and in Arabidopsis (dicot), the amino acid sequence encoded by the ACCase gene is shown in SEQ ID No. 13. The amino acid sequences encoded by the ACCase genes of wheat, corn, soybean, and Arabidopsis are compared with the amino acid sequence encoded by the ACCase gene of rice (monocot) (SEQ ID No. 3) and have sequence similarities of 84%, 84.2%, 69.5%, and 67.8%, respectively.

[0282] The amino acid sequence encoded by the wheat ACCase gene is as follows (SEQ ID No. 10):

[0283] The amino acid sequence encoded by the maize ACCase gene is as follows (SEQ ID No. 11):

[0284] The amino acid sequence encoded by the soybean ACCase gene is as follows (SEQ ID No. 12):

[0285] The amino acid sequence encoded by the Arabidopsis thaliana ACCase gene is as follows (SEQ ID No. 13):

[0286] A comparison of the amino acid sequences encoded by the ACCase genes of rice, wheat, corn, soybean, and Arabidopsis is shown in Figure 8. It can be seen that the amino acid sequences encoded by the ACCase genes of rice, wheat, corn, soybean, and Arabidopsis are relatively conserved, particularly among monocots (rice, wheat, and corn). In particular, amino acids 1781 to 1799 (vgkedglgvenihgsaaia) of the sequence shown in SEQ ID No. 3 are highly conserved across species. In particular, amino acids 1791 and 1792 of the sequence shown in SEQ ID No. 3 in Example 1 are also located within this conserved region.

[0287] In addition, according to Figure 8, the 1791st amino acid N of the amino acid sequence encoded by the rice ACCase gene (SEQ ID No.3) corresponds to the 1768th amino acid N of the amino acid sequence encoded by the wheat ACCase gene (SEQ ID No.10), corresponds to the 1783rd amino acid N of the amino acid sequence encoded by the corn ACCase gene (SEQ ID No.11), corresponds to the 1718th amino acid N of the amino acid sequence encoded by the soybean ACCase gene (SEQ ID No.12), and corresponds to the 1713th amino acid N of the amino acid sequence encoded by the Arabidopsis ACCase gene (SEQ ID No.13). The 1792nd amino acid I of the amino acid sequence encoded by the rice ACCase gene (SEQ ID No. 3) corresponds to the 1769th amino acid I of the amino acid sequence encoded by the wheat ACCase gene (SEQ ID No. 10), corresponds to the 1784th amino acid I of the amino acid sequence encoded by the corn ACCase gene (SEQ ID No. 11), corresponds to the 1719th amino acid L of the amino acid sequence encoded by the soybean ACCase gene (SEQ ID No. 12), and corresponds to the 1714th amino acid L of the amino acid sequence encoded by the Arabidopsis thaliana ACCase gene (SEQ ID No. 13).

[0288] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A mutant acetyl-CoA carboxylase (ACC), wherein the mutant acetyl-CoA carboxylase (ACC) is mutated at the 1878th amino acid corresponding to the amino acid sequence shown in SEQ ID No.1 or is mutated at the 1791st amino acid corresponding to the amino acid sequence shown in SEQ ID No.3 compared with the amino acid sequence of the parent acetyl-CoA carboxylase (ACC); Preferably, the mutant acetyl-CoA carboxylase (ACC) further undergoes a mutation at the 1879th amino acid corresponding to the amino acid sequence shown in SEQ ID No. 1 or at the 1792th amino acid corresponding to the amino acid sequence shown in SEQ ID No. 3, compared with the amino acid sequence of the parent acetyl-CoA carboxylase (ACC).

2. The mutant ACC according to claim 1, characterized in that The parent ACC is derived from a monocot or dicot plant; for example, Arabidopsis, rice, corn, wheat or soybean; Preferably, the parent ACC is derived from rice.

3. The mutant ACC according to claim 1, characterized in that The amino acid at position 1878 or the amino acid at position 1791 mutates to an amino acid other than N, and the amino acid at position 1879 or the amino acid at position 1792 mutates to an amino acid other than I; Preferably, the amino acid at position 1878 or the amino acid at position 1791 mutates to S, G or D, and the amino acid at position 1879 or the amino acid at position 1792 mutates to V.

4. A polynucleotide, characterized in that The polynucleotide encodes the mutated ACC according to any one of claims 1-3.

5. A nucleic acid construct, characterized in that The nucleic acid construct comprises the polynucleotide of claim 4; Preferably, it also contains a regulatory element operably linked thereto; Preferably, the regulatory element is selected from one or any several of the following groups: enhancer, transposon, promoter, terminator, leader sequence, polynucleotide sequence, marker gene.

6. A host cell, characterized in that The host cell comprises the mutated ACC according to any one of claims 1 to 3, or the polynucleotide according to claim 4, or the nucleic acid construct according to claim 5.

7. A method for imparting herbicide resistance to a plant or a method for preparing a plant having herbicide resistance, the method comprising the step of introducing the mutant ACC according to any one of claims 1 to 3 into a plant cell, a plant seed, a plant tissue, a plant part or a plant; Preferably, the method comprises the step of expressing the mutant ACC according to any one of claims 1 to 3 in a plant cell, plant seed, plant tissue, plant part or plant; Preferably, the method comprises the step of mutating the endogenous ACC of the plant to introduce the mutated ACC; More preferably, the method comprises mutating the gene encoding the endogenous ACC of the plant so that the endogenous ACC mutates at the 1878th and / or 1879th amino acid corresponding to the amino acid sequence shown in SEQ ID No. 1; More preferably, the method comprises mutating the gene encoding endogenous ACC of the plant so that the endogenous ACC mutates at the 1791st and / or 1792nd amino acid corresponding to the amino acid sequence shown in SEQ ID No.

3.

8. Use of the mutant ACC according to any one of claims 1 to 3, the polynucleotide according to claim 4, the nucleic acid construct according to claim 5, or the host cell according to claim 6 in preparing a plant having herbicide resistance, or in a reagent or kit for preparing a plant having herbicide resistance.

9. A plant cell, plant seed, plant tissue, plant part or plant comprising the mutant ACC according to any one of claims 1 to 3, the polynucleotide according to claim 4, the nucleic acid construct according to claim 5, or the host cell according to claim 6.

10. A method for preparing a hybrid plant, the method comprising the step of hybridizing the plant prepared by the method according to claim 7 with other plants.

11. A method for controlling weeds in farmland, characterized in that: a) providing a plant prepared by the method according to claim 7 or 10, b) applying an effective amount of a herbicide to the plants and weeds near the plants, thereby controlling the weeds near the plants.

Citation Information

Patent Citations

  • Herbicide resistance mutant and application thereof

    CN108486070A

  • Wheat ACCase mutant gene and application thereof for plants resisting herbicide

    CN109355264A

  • Plant ACCase mutant protein and gene sequence and application thereof

    CN113151200A

  • Herbicide-resistant acetyl-coenzyme A carboxylase mutant and application thereof

    CN115786285A

  • Novel herbicide-resistant acetyl-coa carboxylase mutant and use thereof

    WO2022166955A1