Small non-coding RNA nanopore sequencing

By employing sequence-specific structured adapters for capturing small non-coding RNAs, the method enables direct RNA sequencing and modification quantification on nanopore platforms, addressing the limitations of current technologies and providing a more comprehensive biological dataset.

WO2025124917A1PCT designated stage expired Publication Date: 2025-06-19HUMMINGBIRD DIAGNOSTICS GMBH

Patent Information

Application Number
PCT/EP2024/084016
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-16
Filing Date
2024-11-28
Publication Date
2025-06-19

AI Technical Summary

Technical Problem

Current methods for sequencing small non-coding RNAs, such as miRNAs, on nanopore platforms are limited by the inability to sequence RNA molecules under 100 nucleotides and the loss of chemical modifications during library preparation.

Method used

The use of sequence-specific structured adapters to specifically capture small non-coding RNAs in a single ligation step, enabling direct RNA sequencing and quantification of RNA modifications on a nanopore sequencing platform.

Benefits of technology

This approach allows for the accurate sequencing and modification quantification of small non-coding RNAs, overcoming the limitations of existing technologies and providing a richer dataset reflecting the true biological complexity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000095_0000
    Figure 00000095_0000
  • Figure 00000096_0000
    Figure 00000096_0000
  • Figure 00000097_0000
    Figure 00000097_0000
Patent Text Reader

Abstract

The present invention relates to a method for sequencing small non-coding RNAs on a nanopore platform. In this method, sequence-specific structured adapters are used to specifically capture small non-coding RNAs in a single ligation step reaction, thus enabling direct RNA sequencing.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]Our Ref.: 505-97 PCTSMALL NON-CODING RNA NANOPORE SEQUENCING The present invention relates to a method for sequencing small non-coding RNAs on ananopore platform. In this method, sequence-specific structured adapters are used to specifically capture small non-coding RNAs in a single ligation step reaction, thus enabling direct RNA sequencing. BACKGROUND OF THE INVENTION Small non-coding RNAs such as miRNAs can be used due to their diversity andcharacteristic expression for the diagnosis of human diseases. In order to fully encompass thecomplexity of small non-coding RNAs in a biological sample, e.g. isolated from humanperipheral blood, and to use this information for the discovery of potential biomarkers,biochemical methods are employed that convert small non-coding RNAs into a cDNA library for sequencing such as high-throughput next-generation sequencing. This library preparation process is typically based on enzymatic reactions (ligations, reverse transcription, polymerization) and aims for unbiased and truthful representation of the small non-coding RNA complexity in the initial RNA sample. However, in addition to the canonical RNA bases A, C, U, and G, there are over onehundred different modified bases including many of functional relevance. These include 2'-O-methylation (Nm), N6-methyladenosine (m6A), N6,2′-O-dimethyladenosine (m6Am), 8-oxo-7,8-dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5-methylcytidine (m5C), and N4- acetylcytidine (ac4C). In a typical RNA sequencing library preparation for analysis on asequencing by synthesis (SBS) platform (e.g. Illumina), which is a widely adapted next-generation sequencing (NGS) technology platform worldwide, these are lost in the conversionof RNA to cDNA. In contrast thereto, direct RNA sequencing on a nanopore platform (e.g. the OxfordNanopore platform) offers the ability to sequence RNA in its native state, including all chemicalmodifications that may be present, and enables the collection of a much richer dataset moreclosely reflecting the true biological complexity. The Oxford Nanopore platform, for example,has traditionally been optimized for the sequencing of long nucleic acids, and technicallimitations have prohibited the sequencing of shorter molecules under 100 nucleotides,including miRNAs. Chemical modifications of small non-coding RNAs such as miRNAs have been reportedin diseases and may serve as promising biomarkers.Thus, there is a pressing need for targeted sequencing of small non-coding RNAs suchas miRNAs on a nanopore platform (e.g. the Oxford Nanopore platform) in order tosimultaneously measure both RNA abundance and modification patterns. There is also apressing need for a suitable library preparation method to enable direct sequencing of all smallnon-coding RNAs such as miRNAs present in a sample on a nanopore platform (e.g. the OxfordNanopore platform) for the simultaneous measurement of both RNA abundance and modification patterns. The present inventors have developed sequence-specific structured adapters / adaptercombinations to specifically capture small non-coding RNAs such as miRNAs in a singleligation step reaction, thus enabling direct RNA sequencing and quantification of RNAmodifications on a nanopore sequencing platform. This was not done before. Specifically, the present inventors have utilized the Oxford Nanopore platform to enable the sequencing andquantification of RNA modifications in small RNAs. The present inventors disclose methodsrequired to generate a library of small RNAs for sequencing on the Oxford Nanopore platformas well as bioinformatics for the detection and quantification of RNA modifications.In addition, the present inventors have used the Oxford Nanopore platform for disease such as cancer detection. SUMMARY OF THE INVENTION In a first aspect, the present invention relates to a 5’adapter comprising in the followingorder from 5’ to 3’:(i) a 5’terminal ribonucleotide sequence comprising 6 to 15 ribonucleotides, wherein said6 to 15 ribonucleotides are reverse complementary to a 5’-terminal sequence of a target RNA, and wherein optionally one or more of said 6 to 15 ribonucleotides are locked nucleotide- (LNA-) enhanced, and(ii) a ribonucleotide sequence capable of forming a stem-loop structure containing a loopand a double stranded stem. In a second aspect, the present invention relates to a 3’adapter combination comprising(i) a first oligonucleotide and (ii) a second oligonucleotide, wherein(i) the first oligonucleotide comprises in the following order from 5’ to 3’:(a) a ribonucleotide sequence comprising between 4 and 8 ribonucleotides,wherein the 5’terminal ribonucleotide is phosphorylated, which sequence is reverse complementary to a corresponding sequence in the second oligonucleotide, (b) a poly(A) segment comprising between 8 and 12 adenosine ribonucleotides,(c) a deoxynucleotide spacer sequence comprising between 2 and 5 fixeddeoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 8 and 12 fixed deoxynucleotides, all of which are reversecomplementary to a corresponding sequence in the second oligonucleotide, and (d) a 3’overhanging deoxynucleotide sequence comprising between 8 and 12deoxynucleotides which is capable of complexing with / ligating to a first element allowing nanopore sequencing of target RNA, and,(ii) the second oligonucleotide comprises in the following order from 5’ to 3’:(a) a 5’overhanging deoxynucleotide sequence comprising between 15 and 25deoxynucleotides which is capable of complexing with / ligating to a second element allowing nanopore sequencing of target RNA, (b) a deoxynucleotide spacer sequence comprising between 8 and 12 fixeddeoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 2 and 5 fixed deoxynucleotides, all of which are reversecomplementary to a corresponding sequence in the first oligonucleotide,(c) a poly(T) segment comprising between 8 and 12 thymidine deoxynucleotides,(d) a deoxynucleotide sequence comprising between 4 and 8 deoxynucleotideswhich is reverse complementary to a corresponding sequence in the first oligonucleotide, and(e) a 3’overhanging deoxynucleotide sequence comprising 6 to 15deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of a target RNA, and wherein optionally one or more of said 6 to 15 deoxynucleotides are locked nucleotide- (LNA-) enhanced. In a third aspect, the present invention relates to an adapter system comprising the 5’adapter of the first aspect, and the 3’adapter combination of the second aspect.In a fourth aspect, the present invention relates to a method of ligating a 5’adapter anda 3’adapter combination to a target RNA in a sample comprising the steps of:(i) providing a composition comprising a denatured target RNA in a sample, the renatured5’adapter of the first aspect, and the renatured 3’adapter combination of the second aspect, wherein the 5’adapter and the 3’adapter combination are annealed to the target RNA, and(ii) ligating the 5’adapter and the 3’adapter combination to the target RNA using / with adouble stranded RNA ligase, thereby producing a ligation product. In a fifth aspect, the present invention relates to a method of determining and / orquantifying a target RNA in a sample comprising the steps of:(i) carrying out the method of the fourth aspect, thereby obtaining a ligation product,(ii) optionally reverse transcribing the ligation product, thereby obtaining a RNA / cDNAduplex, and(iii) subjecting the ligation product obtained in step (i) or the RNA / cDNA duplex obtainedin step (ii) to a nanopore sequencing reaction, thereby determining and / or quantifyingthe target RNA. In a sixth aspect, the present invention relates to a method of diagnosing a disease orcondition in a patient comprising the steps of:(ia) carrying out the methods of the fourth and / or fifth aspect, thereby determining thepresence of the target RNA, and(iia) diagnosing whether the patient is afflicted by the disease or condition based on thepresence of the target RNA, or(ib) carrying out the methods of the fourth and / or fifth aspect, thereby determining the targetRNA modification proportion,(iib) comparing the target RNA modification proportion to a reference target RNAmodification proportion, and(iiib) diagnosing whether the patient is afflicted by the disease or condition based on thecomparison. In a seventh aspect, the present invention relates to the use of the 5’adapter of the firstaspect and / or the 3’adapter combination of the second aspect or the adapter system of the third aspect for nanopore sequencing of target RNA. In an eighth aspect, the present invention relates to the use of the 5’adapter of the firstaspect and / or the 3’adapter combination of the second aspect or the adapter system of the third aspect for the determination, characterization, and quantification of the modification status of target RNA. In a ninth aspect, the present invention relates to the use of the 5’adapter of the firstaspect and / or the 3’adapter combination of the second aspect or the adapter system of the thirdaspect for diagnosing a disease or condition in a patient.In a tenth aspect, the present invention relates to a kit comprisingthe 5’adapter of the first aspect, and the 3’adapter combination of the second aspect, orthe adapter system of the third aspect.In an eleventh aspect, the present invention relates to a 5’adapter comprising in thefollowing order from 5’ to 3’:(i) a 5’terminal ribonucleotide sequence comprising 6 to 15 ribonucleotides, wherein said6 to 15 ribonucleotides are random ribonucleotides, and wherein optionally one or more of said 6 to 15 ribonucleotides are locked nucleotide- (LNA-) enhanced, and(ii) a ribonucleotide sequence capable of forming a stem-loop structure containing a loopand a double stranded stem. In a twelfth aspect, the present invention relates to a 3’adapter combination comprising(i) a first oligonucleotide and (ii) a second oligonucleotide, wherein(i) the first oligonucleotide comprises in the following order from 5’ to 3’:(a) a ribonucleotide sequence comprising between 4 and 8 ribonucleotides,wherein the 5’terminal ribonucleotide is phosphorylated, which sequence is reverse complementary to a corresponding sequence in the second oligonucleotide, (b) a poly(A) segment comprising between 8 and 12 adenosine ribonucleotides,(c) a deoxynucleotide spacer sequence comprising between 2 and 5 fixeddeoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 8 to 12 fixed deoxynucleotides, all ofwhich are reverse complementary to a corresponding sequence in the second oligonucleotide, and (d) a 3’overhanging deoxynucleotide sequence comprising between 8 and 12deoxynucleotides which is capable of complexing with / ligating to a first element allowing nanopore sequencing of RNA molecules, and,(ii) the second oligonucleotide comprises in the following order from 5’ to 3’:(a) a 5’overhanging deoxynucleotide sequence comprising between 15 and 25deoxynucleotides which is capable of complexing with / ligating to a second element allowing nanopore sequencing of RNA molecules, (b) a deoxynucleotide spacer sequence comprising between 8 and 12 fixeddeoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 2 and 5 fixed deoxynucleotides, all of which are reverse complementary to a corresponding sequence in the first oligonucleotide, (c) a poly(T) segment comprising between 8 and 12 thymidine deoxynucleotides,(d) a deoxynucleotide sequence comprising between 4 and 8 deoxynucleotideswhich is reverse complementary to a corresponding sequence in the first oligonucleotide, and (e) a 3’overhanging deoxynucleotide sequence comprising 6 to 15deoxynucleotides, wherein said 6 to 15 deoxynucleotides are random deoxynucleotides, and wherein optionally one or more of said 6 to 15 deoxynucleotides are locked nucleotide- (LNA-) enhanced.In a thirteenth aspect, the present invention relates to a set comprising at least two5’adapters of the eleventh aspect, wherein said at least two 5’adapters differ in the sequence oftheir 6 to 15 random ribonucleotides. In a fourteenth aspect, the present invention relates to a set comprising at least two3’adapter combinations of the twelfth aspect, wherein said second oligonucleotides differ in thesequence of their 6 to 15 random deoxynucleotides. In a fifteenth aspect, the present invention relates to an adapter system comprisingthe set comprising at least two 5’adapters of the thirteenth aspect, andthe set comprising at least two 3’adapter combinations of the fourteenth aspect.In a sixteenth aspect, the present invention relates to a method of ligating adapters and adapter combinations to RNA molecules in a sample comprising the steps of:(i) providing a composition comprising denatured RNA molecules in a sample, the setcomprising at least two 5’adapters of the thirteenth aspect, wherein said adapters havebeen renatured, and the set comprising at least two 3’adapter combinations of the fourteenth aspect, wherein said adapter combinations have been renatured, wherein the5’adapters and the 3’adapters are annealed to the RNA molecules, and(ii) ligating the 5’adapters and the 3’adapter combinations to the RNA molecules using / witha double stranded RNA ligase, thereby producing ligation products.In a seventeenth aspect, the present invention relates to a method of producing a RNAlibrary from RNA molecules in a sample comprising the step of:(i) carrying out the method of the sixteenth aspect.In an eighteenth aspect, the present invention relates to a RNA library from RNAmolecules in a sample obtained by the method of the seventeenth aspect.In a nineteenth aspect, the present invention relates to a method of producing a RNA / cDNA duplex library from RNA molecules in a sample comprising the steps of:(i) carrying out the method of the sixteenth aspect, and(ii) reverse transcribing the ligation products, thereby obtaining RNA / cDNA duplexes.In an twentieth aspect, the present invention relates to a RNA / cDNA duplex library from RNA molecules in a sample obtained by the method of the nineteenth aspect. In a twenty-first aspect, the present invention relates to a method of determining a profileof RNA molecules in a sample comprising the step of:(i) nanopore sequencing the RNA library from RNA molecules in a sample produced bythe method of the seventeenth aspect or nanopore sequencing the RNA / cDNA duplexlibrary from RNA molecules in a sample produced by the method of nineteenth aspect. In a twenty-second aspect, the present invention relates to a kit comprisingthe set comprising at least two 5’adapters of the thirteenth aspect, andthe set comprising at least two 3’adapter combinations of the fourteenth aspect, orthe adapter system of the fifteenth aspect.In a twenty-third aspect, the present invention relates to the use of the set comprising atleast two 5’adapters of the thirteenth aspect, and the set comprising at least two 3’adaptercombinations of the fourteenth aspect, or the adapter system of the fifteenth aspect for thegeneration of a library of RNA molecules. This summary of the invention does not necessarily describe all features of the present invention. Other embodiments will become apparent from a review of the ensuing detailed description. DETAILED DESCRIPTION OF THE INVENTION Definitions Before the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. Preferably, the terms used herein are defined as described in “A multilingual glossary of biotechnological terms: (IUPAC Recommendations)”, Leuenberger, H.G.W, Nagel, B. and Kölbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland). Several documents are cited throughout the text of this specification. Each of thedocuments cited herein (including all patents, patent applications, scientific publications,manufacturer's specifications, instructions, GenBank Accession Number sequence submissions etc.), whether supra or infra, is hereby incorporated by reference in its entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. In the event of a conflict between the definitions or teachings of such incorporated references and definitions or teachings recited in the present specification, the text of the present specification takes precedence. The term “comprise” or variations such as “comprises” or “comprising” according tothe present invention means the inclusion of a stated integer or group of integers but not theexclusion of any other integer or group of integers. The term “consisting essentially of” according to the present invention means the inclusion of a stated integer or group of integers, while excluding modifications or other integers which would materially affect or alter the stated integer. The term “consisting of” or variations such as “consists of” according to the present invention means the inclusion of a stated integer or group of integers and the exclusion of any other integer or group of integers. The terms “a” and “an” and “the” and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The term “nucleotide”, as used herein, refers to an organic molecule consisting of a nucleoside and a phosphate. In particular, a nucleotide is composed of three subunit molecules: a nucleobase, a five-carbon sugar (ribose or deoxyribose), and a phosphate group consisting of one to three phosphates. The four nucleobases in DNA are guanine, adenine, cytosine and thymine; in RNA, uracil is used in place of thymine. The nucleotide serves as monomeric unit of nucleic acid polymers, such as deoxyribonucleotide acid (DNA) or ribonucleotide acid (RNA). Thus, the nucleotide is a molecular building-block of DNA and RNA. The term “nucleoside”, as used herein, refers to a glycosylamine that can be thought of as nucleotide without a phosphate group. A nucleoside consists simply of a nucleobase (also termed a nitrogenous base) and a five-carbon sugar (ribose or 2'-deoxyribose) whereas a nucleotide is composed of a nucleobase, a five-carbon sugar, and one or more phosphate groups. In a nucleoside, the anomeric carbon is linked through a glycosidic bond to the N9 of a purine or the N1 of a pyrimindine. The terms “nucleotide sequence” or “polynucleotide” are interchangeably used herein and refer to single-stranded and double-stranded polymers of nucleotide monomers, including without limitation, 2'-deoxyribonucleotides (DNA) and ribonucleotides (RNA) linked by internucleotide phosphodiester bond linkages, or internucleotide analogs, and associated counter ions, e.g., H+, NH4+, trialkylammonium, Mg2+, Na+, and the like. A nucleotide sequence or polynucleotide may be composed entirely of deoxyribonucleotides, entirely of ribonucleotides, or chimeric mixtures thereof and may include nucleotide analogs. The nucleotide monomer units may comprise any of the nucleotides described herein, including, but not limited to, nucleotides and / or nucleotide analogs. The term “RNA molecule”, as used herein, refers to a polymeric form of ribonucleotidesof any length. Like DNA, RNA is assembled as a chain of nucleotides, but unlike DNA, RNA is found in nature as a single strand folded onto itself, rather than a paired double strand. The RNA molecule may be derived from any number of sources, including without limitation, humans and animals. These sources may include, but are not limited to, whole blood, a tissue biopsy, lymph, bone marrow, amniotic fluid, hair, skin, semen, biowarfare agents, anal secretions, vaginal secretions, perspiration, saliva, or buccal swabs. However, various environmental samples (for example, agricultural, water, and soil), research samples generally,purified samples generally, cultured cells and lysed cells may also be used as samples.In the context of the present invention, (all) RNA molecules comprised in a sample, e.g.biological sample, are analysed such as sequenced.The term “small RNA molecule”, as described herein, refers to a polymeric RNA molecule that is less than 200 ribonucleotides, preferably < 50 ribonucleotides, more preferably < 30 ribonucleotides, in length. Specifically, small RNA molecules have a length of between 10 and < 50 ribonucleotides. More specifically, small RNA molecules have a length of between 10 and < 30 ribonucleotides. Small RNA molecules are usually non-coding RNA molecules. The small (non-coding) RNA molecules may be miRNAs, piRNAs, siRNAs, or fragments of longer RNAs, preferably rRNA or tRNA fragments. The term “modified small RNA molecule”, as used herein, refers to an RNA molecule which has been post-transcriptionally edited or modified. This process is also designated as RNA editing. RNA editing influences diverse RNA processes, including generation, transportation, function, and metabolization. Thus, RNA editing is a critical regulator of cell biology. Typical RNA modifications are selected from the group consisting of 2'-O- methylation, N6-methyladenosine (m6A), N6,2′-O-dimethyladenosine (m6Am), 8-oxo-7,8- dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5-methylcytidine (m5C), and N4- acetylcytidine (ac4C). Preferably, the RNA modification is an RNA methylation. The term “methylated small RNA molecule”, as used herein, refers to an RNA moleculewhich has been post-transcriptionally edited or modified by methylation. The methylation canoccur at a base (e.g. methyl-6-adenine, pseudouridine) and / or ribose ring (2′-ortho-methylated nucleotide (2′-O-m)). The methylation of a small RNA molecule occurring at a base is preferably selected from the group consisting of 6-methyladenosine (m6A), 5-methylcytidine (m5C), 5-methyluridine (m5U), 3-methyluridine (m3U), 1-methyladenosine (m1A), and 1- methylguanosine (m1G), or is a combination thereof. The 2′-O-methylation of the backbone ribose is the most common and conserved type of smallRNA modification. The methylation of small RNA occurring at a ribose ring is selected fromthe group consisting of 3′-end 2′-O-methyladenosine (Am), 2′-O-methyluridine (Um), 2′-O- methylguanosine (Gm), and 2′-O-methylcytidine (Cm), or is a combination thereof. Small RNA molecules are usually non-coding RNA molecules. The small (non-coding) RNA molecules may be miRNAs, piRNAs, siRNAs, or fragments of longer RNAs, preferably rRNA or tRNA fragments. The term “target RNA”, as used herein, refers to a ribonucleotide sequence that is sought to be specifically detected. The target RNA may be derived from any number of sources, including without limitation, humans and animals. These sources may include, but are not limited to, whole blood, a tissue biopsy, lymph, bone marrow, amniotic fluid, hair, skin, semen, biowarfare agents, anal secretions, vaginal secretions, perspiration, saliva, or buccal swabs. However, various environmental samples (for example, agricultural, water, and soil), research samples generally, purified samples generally, cultured cells and lysed cells may also be used as samples.It is preferred that the target RNA is non-coding RNA, specifically non-coding small RNA It ismore preferred that the (non-coding) target RNA has a length of < 50 ribonucleotides,particularly a length of between 10 and < 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 ribonucleotides. It is even more preferred that the (non- coding) target RNA has a length of < 30 ribonucleotides, particularly a length of between 10 and < 30 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 ribonucleotides.The (non-coding) target RNA, specifically (non-coding) small RNA, may be a miRNA, piRNA,siRNA, or a fragment of longer RNAs, preferably a rRNA or tRNA fragment.It will be appreciated that the term “target RNA” may refer to the target molecule itself as wellas to surrogates thereof, for example, products obtained by ligation / hybridization (RNA / adapterstructures) or reverse transcription (e.g. cDNAs or RNA / cDNA duplexes).Specifically, the (non-coding) target RNA is a miRNA or a miRNA isoform (an isomiR).The term “miRNA” (the designation “microRNA” is also possible), as used herein, refers to a single-stranded RNA molecule. The miRNA may be a molecule of 10 to 45nucleotides in length, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides in length, notincluding optionally labels and / or elongated sequences (e.g. biotin stretches). The miRNAs regulate gene expression and are encoded by genes from whose DNA they are transcribed but miRNAs are not translated into protein (i.e. miRNAs are non-coding RNAs). The genes encoding miRNAs are longer than the processed mature miRNA molecules. The miRNA is initially transcribed as a longer precursor molecule (>1000 nucleotides long) called a primary miRNA transcript (pri-miRNA). Pri-miRNAs have hairpin structures that are processed by the Drosha enzyme (as part of the microprocessor complex). After Drosha processing, the pri-miRNAs are only 60-100 nucleotides long, and are called precursor miRNAs (pre-miRNAs). At this point, the pre-miRNA is exported to the cytoplasm, where it encounters the Dicer enzyme. Dicer cuts the miRNA in two, resulting in duplexed miRNA strands. Traditionally, only one of these miRNA arms was considered important in gene regulation: the arm that is destined to be loaded into the RNA-induced silencing complex (RISC), and occurs at a higher concentration in the cell. This is often called the “guide” strand and is designated as miR. The other arm is called the “minor miRNA” or “passenger miRNA”, and is often designated as miR*. It was thought that passenger miRNAs were completely degraded, but deep sequencing studies have found that some minor miRNAs persist and in fact have a functional role in gene regulation. Due to these developments, the naming convention has shifted. Instead of the miR / miR* name scheme, a miR-5p / miR-3p nomenclature has been adopted. By the new system, the 5’ arm of the miRNA is always designated miR-5p and the 3’arm is miR-3p. The present nomenclature is as follows: The prefix “miR” is followed by a dash and a number, the latter often indicating order of naming. For example, hsa-miR-16 was named and likely discovered prior to hsa-miR-342. A capitalized “miR-” refers to the mature forms of the miRNA (e.g. hsa-miR-16-5p and hsa-miR-16-3p), while the uncapitalized “mir-” refers to the pre-miRNA and the pri-miRNA (e.g. hsa-mir-16), and “MIR” refers to the gene that encodes them. However, as this is a recent change, literature will often refer to the original miR / miR* names. After processing, the duplexed miRNA strands are loaded onto an Argonaute (AGO)protein to form a precursor to the RISC. The complex causes the duplex to unwind, and thepassenger RNA strand is discarded, leaving behind a mature RISC carrying the mature, singlestranded miRNA. The miRNA remains part of the RISC as it silences the expression of its targetgenes. While this is the canonical pathway for miRNA biogenesis, a variety of others have beendiscovered. These include Drosha-independent pathways (such as the mirtron pathway,snoRNA-derived pathway, and shRNA-derived pathway) and Dicer-independent pathways (such as one that relies on AGO for cleavage, and another which is dependent on tRNaseZ). The term “miRBase”, as used herein, refers to a well-established repository of validated miRNAs. The miRBase (www.mirbase.org) is a searchable database of published miRNA sequences and annotation. Each entry in the miRBase Sequence database represents a predicted hairpin portion of a miRNA transcript (termed mir in the database), with information on the location and sequence of the mature miRNA sequence (termed miR). Both hairpin and mature sequences are available for searching and browsing, and entries can also be retrieved by name, keyword, references and annotation. All sequence and annotation data are also available fordownload. In October 2018, miRbase version 22.1 was released. This is the current version.The term “isomiR” (or “miRNA isoform”), as used herein, refers to a miRNA that variesslightly in sequence, which results from variations in the cleavage site during miRNAbiogenesis or by processes which affect the mature miRNA after the biogenesis has occurred,such as oligouridylation. In particular, imprecise cleavage of Drosha and Dicer or the turnoverof miRNAs can result in miRNAs that are heterogeneous in length and / or sequence. IsomiRs(miRNA isoforms) can be divided into three main categories: 3′ isomiRs (trimmed or additionof one or more nucleotides at the 3′ position), 5′ isomiRs (trimmed or addition of one or morenucleotides at the 5′ position), and polymorphic isomiRs (some nucleotides within the sequenceare different from the wild type mature miRNA sequence). It could be envisioned that the increased expression of miRNA variants, or individual isomiRs, lead to the loss or weakening of the function of the corresponding wild-type mature miRNA or result in the regulation of a different transcriptome. Recent studies suggest that isomiRs probably play vital roles in avariety of cancers, tissues, and cell types. The detection of miRNAs as well as isomiRs is, thus,absolutely required to accurately reflect the underlying biological situation and to make theright diagnostic and treatment decisions. In the context of the present invention, it is referred to target RNAs in case of target specific sequencing and to RNA molecules in case of universal sequencing. In the latter case,all RNA molecules present in a sample, e.g. biological sample, are analysed by sequencing. Forthis purpose a RNA molecule library from all RNA molecules present in a sample e.g. biological sample, or a RNA / cDNA duplex library from all RNA molecules present in a sample e.g. biological sample, is generated. The RNA library as well as the RNA / cDNA duplex library are subsequently sequenced. The term “nanopore sequencing”, as used herein, is a third generation approach used in the sequencing of biopolymers, specifically, polynucleotides in the form of DNA or RNA. Using nanopore sequencing, a single molecule of DNA or RNA can be sequenced without the need for Polymerase Chain Reaction (PCR) amplification or chemical labelling of the sample. Nanopore sequencing has the potential to offer relatively low-cost genotyping, high mobility for testing, and rapid processing of samples. Nanopore sequencing is the only sequencing technology to enable real-time analysis in fully scalable formats. The principle of nanopore sequencing is as follows: The biological or solid-state membrane, where the nanopore is found, is surrounded by electrolyte solution. The membrane splits the solution into two chambers. A bias voltage is applied across the membrane inducing an electric field that drives charged particles, in this case the ions, into motion. This effect is known as electrophoresis. For high enough concentrations, the electrolyte solution is well distributed and all the voltage drop concentrates near and inside the nanopore. This means charged particles in the solution only feel a force from the electric field when they are near the pore region. This region is often referred as the capture region. Inside the capture region, ions have a directed motion that can be recorded as a steady ionic current by placing electrodes near the membrane. Imagine now a nano-sized polymer such as DNA or protein placed in one of the chambers. This molecule also has a net charge that feels a force from the electric field when it is found in the capture region. The molecule approaches this capture region aided by brownian motion and any attraction it might have to the surface of the membrane. Once inside the nanopore, the molecule translocates through via a combination of electro-phoretic, electro- osmotic and sometimes thermo-phoretic forces. Inside the pore the molecule occupies a volume that partially restricts the flow of ions, observed as an ionic current drop. Based on various factors such as geometry, size and chemical composition, the change in magnitude of the ionic current and the duration of the translocation will vary. The magnitude of the electric current density across a nanopore surface depends on the nanopores dimensions and the composition of DNA or RNA that is occupying the nanopore. Sequencing was made possible because, passing through the channel of the nanopore, the samples cause characteristic changes in the density of the electric current flowing through the nanopore. The total charge flowing through a nanopore channel is equal to the surface integral of electric current density flux across the nanopore unit normal surfaces between times t1 and t2. In other words, different molecules can be sensed and potentially identified based on the modulation in ionic current. A strand of DNA or RNA is made up of a sequence of differentcombinations of four nucleotide bases: A, T (or U for RNA), G and C. Each base that passesthrough the nanopore can be identified through the characteristic disruption it causes to the current in real-time. Not only the DNA or RNA sequence can be detected, but also DNA orRNA modifications can be quantified in this way.Two types of nanopore sequencing exist: biological and solid state nanopore sequencing. The term “biological nanopore sequencing”, as used herein, refers to the use of transmembrane proteins, called protein nanopores, in particular, formed by protein toxins, thatare embedded in lipid membranes so as to create size dependent porous surfaces - withnanometer scale "holes" distributed across the membranes. Sufficiently low translocation velocity can be attained through the incorporation of various proteins that facilitate the movement of DNA or RNA through the pores of the lipid membranes Alpha hemolysin, which is a nanopore from bacteria that causes lysis of red blood cells orMycobacterium smegamatis porin A (MspA) may be used for nanopore sequencing.The term “solid state nanopore sequencing”, as used herein, refers to a sequencingapproach which, unlike biological nanopore sequencing, does not incorporate proteins into its system. Instead, solid state nanopore technology uses various metal or metal alloy substrates with nanometer sized pores that allow DNA or RNA to pass through. These substrates most often serve integral roles in the sequence recognition of nucleic acids as they translocate through the channels along the substrates. Nanopore sequencing platforms are offered, for example, by Oxford Nanopore Technologies Ltd. All Oxford Nanopore sequencing devices use flow cells which contain anarray of tiny holes - nanopores - embedded in an electro-resistant membrane. Each nanoporecorresponds to its own electrode connected to a channel and sensor chip, which measures the electric current that flows through the nanopore. When a molecule passes through a nanopore, the current is disrupted to produce a characteristic ‘squiggle’. The squiggle is then decoded using basecalling algorithms to determine the DNA or RNA sequence in real time.Specifically, a strand of DNA or RNA is made up of a sequence of different combinations offour nucleotide bases: A, T (or U for RNA), G and C. Each base that passes through the nanopore can be identified through the characteristic disruption it causes to the current in real- time. This makes nanopore sequencing unique, in that it is the only sequencing technology that enables direct, real-time analysis of DNA / RNA in fully scalable formats. Advantages of real- time sequencing include rapid access to time critical information (e.g. pathogen identification), the generation of early sample insights and more control over the sequencing experiment. Nanopore sequencing is limited only by the length of the DNA / RNA fragment presented to thepore and can, therefore, span entire repetitive regions, resolve structural variants, anddifferentiate between different isoforms. The ability to sequence native DNA and RNA without the requirement for amplification, eliminates PCR bias and allows for the identification of base modifications, such as methylation, alongside nucleotide sequence. Particularly, the nanopore sequencing system, e.g. the Oxford Nanopore sequencingsystem, uses, in addition to flow cells, which contain an array of tiny holes - nanopores -embedded in an electro-resistant membrane, two more elements: a nanopore adapter / motorprotein complex and a tether oligonucleotide. The nanopore adapter is required for attachingthe DNA or RNA molecule to be sequenced to the nanopore. In addition, the motor protein isrequired for directing the DNA or RNA molecule to be sequence through the nanopore in orderto allow sequencing. Specifically, the motor protein controls translocation of the RNA or DNA strand through the nanopore. Once the DNA or RNA has passed through, the motor protein detaches and the nanopore is ready to accept the next DNA or RNA molecule. The motor protein is often an enzyme. The tether oligonucleotide has the function of concentrating the RNA or DNA target which is to be sequenced at the membrane surface of a nanopore flow cell. An electrically resistant membrane is further used, which means that all current must pass through the nanopore to ensure a clean signal. The subsequent sequencing of the DNA or RNA molecule is possible as, when the DNA or RNA molecule passes through the nano-scale hole, the current changes / fluctuates. This signal can be detected and is converted to the nucleotide sequence by a basecalling. The nanopore sequencing platforms available, such as the Oxford Nanopore platform, are optimized for the sequencing of long nucleic acids. Technical limitations have prohibited the sequencing of shorter molecules under 100 nucleotides including miRNAs. Chemical modifications of small non-coding RNAs have been reported in disease and may serve as promising biomarkers. Thus, the provision of methods to enable direct sequencing of small non- coding RNAs on a nanopore sequencing platform such as the Oxford Nanopore platform for the simultaneous measurement of both RNA abundance and modification patterns are highly needed. The standard preparation of a direct RNA sequencing library for use on the Oxford Nanopore platform involves the ligation of a 3’adapter only. This however, prevents thesequencing of the 20-50 nt at the 5’end of RNAs, constituting a small region of sequence thatis lost on long RNA inserts however a much greater proportion of sequence that is lost fromsmaller RNA inserts, such that the sequencing of RNA under 50 nt would be prohibited. Thesequencing of short RNA molecules has not been successfully reported yet. The innovativecontribution of the method of the present invention is the use of a structured dumbbell 5’adapterthat is ligated to the 5’end of the small RNA molecule and enables the extension of the directRNA sequencing library so as to enable accurate nanopore sequencing of the full length smallRNA insert. In addition, a specific 3’adapter combination has been developed. Both, 5’adpaterand 3’adapter combination, as described herein, can be designed for the capture of specificsmall RNAs via engineering of their overhangs with reverse complementary sequence to their target. Alternatively, the overhangs can be comprised of randomised sequence to enable the ligation to RNAs in a non-sequence specific manner to capture an unbiased transcriptome. The term “adapter”, as used herein, refers to a polynucleotide that can be ligated to the5’end of a target RNA / RNA molecule (i.e. “5’adapter”) or to the 3’end of a target RNA / RNAmolecule (i.e. “3’adapter”). The nucleotides of the 5’adapter and the 3’adapter may be standardor natural (i.e. adenosine, guanosine, cytidine, thymidine, and uridine) as well as non-standardnucleotides. Non-limiting examples of non-standard nucleotides include inosine, xanthosine, isoguanosine, isocytidine, diaminopyrimidine and deoxyuridine. The adapters may comprise modified or derivatized nucleotides. Non-limiting examples of modifications in the ribose or base moieties include the addition, or removal, of acetyl groups, amino groups, carboxyl groups, carboxymethyl groups, hydroxyl groups, methyl groups, phosphoryl groups and thiol groups. In particular, included are 2’-0-methyl and locked nucleic acids (LNA) nucleotides. Suitable examples of derivatized nucleotides include those with covalently attached dyes, such asfluorescent dyes or quenching dyes, or other molecules such as biotin, digoxygenin, or magneticparticles or microspheres. The adapters may also comprise synthetic nucleotide analogs such as morpholinos or peptide nucleic acids (PNA). Phosphodiester bonds or phosphothioate bonds may link the nucleotides or nucleotide analogs of the linkers. In the context of the present invention, the term “5’adapter” refers to a polynucleotidethat can be ligated to the 5’end of a target RNA / RNA molecule (i.e. “5’adapter”). The 5’adapter,as described herein, is composed of ribonucleotides. The length of the 5’adapter, as describedherein, can vary depending upon, for example, the desired length of the ligation product andthe desired features of the adapter. In general, the 5’adapter may range from 15 to 70, e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,66, 67, 68, 69, or 70, ribonucleotides in length. Preferably, the 5’adapter comprises a 5’terminalribonucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, (random)ribonucleotides, wherein said 6 to 15 (random) ribonucleotides are reverse complementary to a5’-terminal sequence of a target RNA / RNA molecule. The 5’adapter, as described herein, can be present as linear polynucleotide, e.g. afterdenaturation / when denatured. In this form, the 5’adapter is single-stranded. This primarystructure may be converted into a secondary structure. Specifically, the 5’adapter, as describedherein, is further capable of forming a stem-loop structure. Thus, the 5’adapter can also have a stem-loop structure, e.g. after re-naturation / when re-natured. As used herein, the term “stem-loop structure” refers to a pattern that can occur in single-stranded RNA. The structure is also known as a “hairpin” or “hairpin loop”. It occurs when tworegions of the same strand, usually complementary in nucleotide sequence when read in opposite directions, base-pair to form a double helix that ends in an unpaired loop. The 5’adapter, which is capable of forming a stem-loop structure, comprises a5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. The first stem sequence and the second stem sequence form the “double-stranded region” or “double-stranded stem” of the stem-loop adapter.In one embodiment, the stem of the 5’adapter is between 5 and 20, e.g. 5, 6, 7, 8, 9, 10, 11, 12,13, 14, 15, 16, 17, 18, 19 or 20, ribonucleotides in length. In one preferred embodiment, the stem of the 5’adapter is between 5 and 10, e.g.5, 6, 7, 8, 9, or 10, ribonucleotides in length. As used herein, the term “loop” refers to the single-stranded region of the stem-loop structure. In particular, the loop is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. In other words, the loop is located between the two reverse complementary strands of the stem and typically the loop comprises single-strandedribonucleotides. In one embodiment, the loop sequence of the 5’adpater comprises between 10and 40 ribonucleotides, e.g.10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 ribonucleotides. In one preferredembodiment, the loop sequence of the 5’adapter comprises between 12 and 22 ribonucleotides,e.g. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 ribonucleotides.In the context of the present invention, the term “3’adapter combination” refers to acombination of two single-stranded oligonucleotides, i.e. a first oligonucleotide and a secondoligonucleotide. Both oligonucleotides comprise sections which are reverse complementary toeach other so that they can form a hybrid / double-stranded structure. The length of theoligonucleotides of the 3’adapter combination, as described herein, can vary depending upon,for example, the desired length of the ligation product and the desired features of the adaptercombination. In general, the oligonucleotides of the 3’adapter combination may range from 15to 80, e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80, nucleotides in length.One of said two oligonucleotides can be ligated to the 3’end of a target RNA / RNA molecule.This is possible as it is reverse complementary to the 3’-terminal sequence of a targetRNA / RNA molecule. Preferably, one of said two oligonucleotides of the 3’adapter combinationcomprises a 3’terminal deoxynucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12,13, 14, or 15, (random) deoxynucleotide, wherein said 6 to 15 (random) deoxynucleotide arereverse complementary to a 3’-terminal sequence of a target RNA / RNA molecule. As mentioned above, the two oligonucleotides of the 3’adapter combination, asdescribed herein, can be present as linear oligonucleotides, e.g. after denaturation / whendenatured. In this form, the 3’adapter combination is single-stranded. However, this primarystructure may be converted into a secondary structure. Specifically, the two oligonucleotides ofthe 3’adapter combination, as described herein, are further capable of forming a hybrid (double-stranded) structure. Thus, the 3’adapter combination can also have a hybrid (double-stranded) structure, e.g. after re-naturation / when re-natured. The 5’adapter and / or 3’adapter combination, as described herein, may comprise lockednucleic acids (LNAs).The term “locked nucleic acids (LNAs)”, as used herein, refers to modified nucleotides,specifically deoxynucleotides or ribonucleotides. In case of locked ribonucleotides, the 2’-Oand 4’-C atoms of the ribose are joined through a methylene bridge. This additional bridgelimits the flexibility normally associated with the ring, essentially locking the structure into arigid conformation. These nucleic acid analogs are also referred to in some circles as“inaccessible ribonucleotides”. LNA nucleotides can be mixed with DNA or RNA residues inthe polynucleotide, in effect hybridizing with DNA or RNA according to Watson-Crick base- pairing rules. The inflexible nature of these molecules greatly enhances hybridization stability.Further, polynucleotides containing LNAs offer tremendous discriminatory power, allowingthese molecules to distinguish between exact match and mismatched complementary targetsequences with very little difficulty. In one embodiment, the 5’adapter and / or the 3’adaptercomprise(s) locked nucleotides, in particular ribonucleotides or deoxynucleotides. In onepreferred embodiment, the 5’positioned first stem sequence and / or the 3’positioned secondstem sequence of the 5’adapter is (are) LNA enhanced. In one another preferred embodiment,the 5’positioned first stem sequence and / or the 3’positioned second stem sequence of the3’adapter is (are) LNA enhanced.The 5’adapter and the 3’adapter combination of the present invention allows to specifically capture small non-coding RNAs such as miRNAs in a single ligation step reaction,thus, enabling direct RNA sequencing and quantification of RNA modifications on a nanoporesequencing platform. Further disclosed herein is a method of ligating a 5’ adapter and a 3’adapter combinationto a target RNA / RNA molecule in a sample. This method requires that the 5’adapter and oneoligonucleotide of the 3’adapter combination are annealed to a target RNA / RNA molecule.Before the 5’adapter and one oligonucleotide of the 3’adapter combination are annealed to atarget RNA / RNA molecule, the target RNA / RNA molecule is denatured. In addition, the5’adapter and the 3’adapter combination are denatured and subsequently renatured. The term “annealing”, as used herein, refers to a process of heating and cooling twosingle-stranded polynucleotides with complementary sequences. Heat breaks all hydrogenbonds and cooling allows new bonds to form between the sequences. During this process, the5’adapter attaches to the target RNA / RNA molecule and forms its characteristic stem-loopstructure. The 3’adapter combination forms, during this process, a hybrid / duplex structure. Inparticular, the 5’adapter attaches to the 5’end of the target RNA / RNA molecule and oneoligonucleotide of the 3’adapter combination attached to the 3’end of the target RNA / RNAmolecule. In this respect, it should be noted that the denaturation / renaturation of the 5’adapter and3’adapter combination takes place separately and in the absence of a target RNA / RNA moleculein the method of the present invention. The 5’adapter and the 3’adapter combination is thenligated to the target RNA / RNA molecule using / with a double stranded RNA ligase, therebyproducing a ligation product. As used herein, the term “ligation product” refers to a hybrid molecule comprising atleast one adapter / adapter combination and a target RNA / RNA molecule. For example, theligation product may comprise a 5’adapter and a target RNA / RNA molecule such as miRNAor isomiR. The ligation product may comprise a 3’adapter combination and a target RNA / RNAmolecule such as miRNA or isomiR. In addition, the ligation produced may comprise a5’adapter, a 3’adapter combination, and a target RNA such as miRNA or isomiR.In particular, the annealing of the 5’adapter with the target RNA / RNA molecule generates adouble-stranded hybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of the adapter and the 5’end of the target RNA / RNA molecule. This is an efficient substrate for ligation by a double-stranded RNA ligase. In addition, the annealing of one oligonucleotide ofthe 3’adpater combination with the target RNA / RNA molecule generates a double-strandedhybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of the target RNA / RNAmolecule and the 5’end of the oligonucleotide of the 3’adapter combination. This is also anefficient substrate for ligation by a double-stranded RNA ligase. Generally, any double stranded RNA ligase capable of ligating double stranded RNA nicks / RNA structures may be used for this purpose. In one preferred embodiment, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2) or a Kod1 ligase. In one more preferred embodiment, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2). The conditions of the ligation reaction are typically adjusted so that the ligase functions near itsoptimal activity level. A buffering agent may be used to adjust and maintain the pH at thedesired level. Representative examples of suitable buffers include, but are not limited to,MOPS, HEPES, TAPS, Bicine, Tricine, TES, PIPES, MES, sodium acetate and Tris buffer.Incidentally, it is the oligonucleotide which is designated as second oligonucleotide herein, which allows target RNA / RNA molecule binding of the 3’adapter combination. As used herein, the term “extension reaction” refers to an elongation reaction in whichthe oligonucleotide of the 3’adapter combination ligated to the 3’end of the target RNA / RNAmolecule is extended, in particular in 5’ to 3’ direction, to form an “extension reaction product”comprising a strand reverse complementary to the target RNA / RNA molecule. As used herein,extension reaction is also referred to as “reverse transcription”. In some embodiments, theextension reaction is a reverse transcription reaction comprising a reverse transcriptase,whereby a DNA (in particular cDNA) copy of the ligation product is made. The term “reverse transcriptase”, as used herein, refers to any enzyme having reverse transcriptase activity. In particular, the term “reverse transcriptase”, as used herein, refers to an enzyme used to generate DNA (cDNA) from an RNA template in a process termed reverse transcription. During reverse transcription, a hybrid double strand of RNA and DNA is built up after presentation of a single-stranded RNA by linking complementary paired DNA building blocks (deoxyribonucleotides). For the process of reverse transcription, a RT primer is usuallyrequired. In the present invention, the reverse transcriptase (RT) uses the secondoligonucleotide of the 3’adapter combination as a self-primer to extend. In one preferredembodiment, the reverse transcriptase (RT) is SuperScript III RT, Maxima H-RT or Tth polymerase. The term “sample multiplexing (also known as multiplex sequencing)”, as used herein, allows large numbers of libraries to be pooled and sequenced simultaneously during a single run on sequencing instruments. Sample multiplexing is useful when targeting specific genomic regions or working with smaller genomes. The term “barcoding”, as used herein, refers to a method of of specimen identification using short, standardized segments of nucleotides such as deoxynucleotides or ribonucleotides. Every species has its own barcode, just as every person has their own fingerprint. These DNA can be compared to a reference library to provide an ID. Residues in two or more polynucleotides are said to “correspond” to each other if the residues occupy an analogous position in the polynucleotide structures. It is well known in the art that analogous positions in two or more polynucleotides can be determined by aligning the polynucleotide sequences based on nucleic acid sequence or structural similarities. Such alignment tools are well known to the person skilled in the art and can be, for example, obtained on the World Wide Web, for example, ClustalW or Align using standard settings, preferably for Align EMBOSS::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5. The term “RNA library”, as used herein, refers to a collection of RNA sequences, suchas small non-coding target RNA sequences, comprised in a sample. The RNA library, thus,reflects the composition of the RNA molecules, in particular small non-coding RNA molecules, in a sample. The sample comprises RNA molecules, in particular small non-coding RNA molecules, isolated from organisms, tissues, cells, or bodily fluids such as blood. The preparation of a RNA library enables the identification of new members or new classes of RNA molecules, in particular small non-coding RNAs, comprised in a sample. The preparation of aRNA library also allows to examine the distribution of RNAs, in particular small non-codingRNAs, comprised in a sample. The preparation of a RNA library further allows sequencing ofall RNA molecules, in particular small non-coding RNA molecules, comprised in a sample.The term “cDNA library”, as used herein, refers to a collection of cDNA sequences thatare complementary to RNA sequences, in particular small non-coding target RNA sequences,comprised in a sample. A cDNA library, thus, reflects the composition of RNA molecules, inparticular small non-coding RNA molecules, in a sample. The sample may comprise RNA molecules, in particular small non-coding RNA molecules, isolated from organisms, tissues, cells, or bodily fluids such as blood. The preparation of a cDNA library enables the identification of new members or new classes of RNAs, in particular small non-coding RNAs, comprised in a sample. The preparation of a cDNA library also allows to examine the distribution of RNAs, in particular small non-coding RNAs, comprised in a sample. The preparation of a cDNA library further allows to obtain expression profiles of RNAs, in particular small non-coding RNAs, comprised in a sample. The cDNA library is preferably sequenced. This allows conclusions to be made regarding the composition of the RNA sample. In the present invention, a RNA library or a RNA / cDNA duplex library can be produced.The RNA / cDNA duplex produced herein is composed of a top strand comprising the 5’ adapter, small RNA insert(s), and the first oligonucleotide of the 3’ adapter, and a bottom strandcomprising the second oligonucleotide of the 3’ adapter that has been extended as cDNA byreverse transcription. The term “sample”, as used herein, refers to any sample comprising target RNAs / RNAmolecules, particularly coding and / or non-coding, more particularly small non-coding, targetRNAs. Said sample is specifically derived from the body of a patient / subject. Said sample specifically comprises target RNAs / RNA molecules, in particular small non-coding target RNA / RNA molecules, isolated from organisms, tissues, cells, or bodily fluids such as blood. Thus, the sample is particularly a biological sample. The term “biological sample”, as used herein, refers to any sample having a biologicalorigin and / or comprises biological material. The biological sample may be a body fluid sample,e.g. a blood sample or urine sample, or a tissue sample, e.g. a tissue biopsy sample. Biological samples may be mixed or pooled, e.g. a sample may be a mixture of a blood sample and a urine sample. The term “body fluid sample”, as used herein, refers to any liquid sample comprising target RNA. Said sample is specifically derived from the body of a patient / subject. Said body fluid sample may be a urine sample, blood sample, sputum sample, breast milk sample, cerebrospinal fluid (CSF) sample, cerumen (earwax) sample, gastric juice sample, mucus sample, lymph sample, endolymph fluid sample, perilymph fluid sample, peritoneal fluid sample, pleural fluid sample, saliva sample, sebum (skin oil) sample, semen sample, sweat sample, tears sample, cheek swab, vaginal secretion sample, liquid biopsy, or vomit sample including components or fractions thereof. The term “body fluid sample” also encompasses body fluid fractions, e.g. blood fractions, urine fractions or sputum fractions. Body fluid samples may be mixed or pooled. Thus, a body fluid sample may be a mixture of a blood and a urine sample or a mixture of a blood and cerebrospinal fluid sample. The term “blood sample”, as used herein, encompasses whole blood or a blood fraction.Preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. In particular the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. For example, the blood cell fraction encompasses erythrocytes, leukocytes, and / or thrombocytes. The whole blood sample may be collected by means of a blood collection tube. It is, forexample, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA-tube, in a Na-citrate tube, Heparin-tube, or in a ACD-tube (Acid citrate dextrose). Alternatively, the whole blood sample may be collected in a blood collection tube containing cell-free nucleic acid stabilizing chemical agents, such as glutaraldehyde, formaldehyde, or similar (e.g. Streck cfRNA BCT tube, Streck cfDNA BCT tube), and others, or cellular crowding agents, such as polyethyleneglycol (PEG) (e.g. Norgen cfDNA / cfRNA preservation tube), and others. The whole blood sample may also be collected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. This technique requires smaller sample volumes, typically 45-60 µl for humans or less. For example, the whole blood may be extracted from the patient via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need be taken in handling or shipping. Once at the analysis site, the desired components, e.g. miRNAs, are extracted from the dried blood spots into a supernatant which is then further analyzed. The term “level”, as used herein, refers to an amount (measured for example in grams, mole, or ion counts) or concentration (e.g. absolute or relative concentration, e.g. reads permillion (RPM) or NGS counts) of a target RNA / RNA molecule. The term “level”, as usedherein, also comprises scaled, normalized, or scaled and normalized amounts or values. Inparticular, the level of the target RNA / RNA molecule is determined by sequencing, particularlynanopore sequencing. Specifically, the level of the target RNA / RNA molecule is the expressionlevel of said target RNA / RNA molecule. In the context of the present invention, the term “kit of parts (in short: kit)” is understood to be any combination of at least some of the components identified herein, which arecombined, coexisting spatially, to a functional unit, and which can contain further components. The term “diagnosing a disease or condition in a patient”, as used herein, means determining whether a patient shows signs of or suffers from the disease or condition.Preferably, the disease is cancer.The term “cancer”, as used herein, refers to or describes a physiological condition in an individual that is typically characterized by unregulated cell growth. More preferably, the cancer is lung cancer. The term “diagnosing lung cancer”, as used herein, means determining whether a patient shows signs of or suffers from lung cancer. The term “lung cancer”, as used herein, refers to a disease which consists of uncontrolled cell growth in tissues of the lung. This growth may lead to metastasis, which is the invasion of adjacent tissue and infiltration beyond the lungs. The vast majority of primary lung cancers are carcinomas of the lung, derived from epithelial cells. Lung cancer is the most common cause of cancer-related death in men and women. The most common symptoms are shortness of breath, coughing (including coughing up blood), and weight loss. The term “patient”, as used herein, refers to any individual for whom it is desired toknow whether she or he suffers from a disease or condition. In particular, the term “patient”, asused herein, refers to an individual suspected to be affected by a disease or condition. Thepatient may be diagnosed to be affected by a disease or condition or may be diagnosed to benot affected by a disease or condition, i.e. healthy. The term “patient”, as used herein, also refers to an individual which is affected by a disease or condition. The patient may be retested for thedisease or condition and may be diagnosed to be still affected by the disease or condition, ornot affected by the disease or condition anymore, i.e. healthy, for example after therapeutic intervention. The patient may be a human or an animal. Human individuals are particularlypreferred. Preferably, the disease is cancer. More preferably, the cancer is lung cancer.The term “(control) subject”, as used herein, refers to a subject known to be affected by a disease or condition or known to be not affected by a disease or condition, i.e. healthy. The (control) subject may be a human or an animal. Human individuals are particularly preferred.Preferably, the disease is cancer. More preferably, the cancer is lung cancer.The term “(target) RNA modification proportion”, as used herein, refers to themodification percentage of the (target) RNA in a sample. The sample may be from a patient tobe tested or from a control subject.Specifically, the modification percentage / proportion of the (target) RNA ranges between 100%(i.e. fully modified, or all detected RNA entities are fully modified) and 0% (i.e. not modified, or all detected RNA entities are not modified).More specifically, the modification percentage / proportion of the (target) RNA is 0, 1, 2, 3, 3,4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%.Preferably, the (target) RNA modification proportion is a (target) RNA methylation proportion.Specifically, the modification percentage / proportion of the (target) RNA ranges between 100%(i.e. fully methylated, or all detected RNA entities are fully methylated) and 0% (i.e. notmethylated, or all detected RNA entities are not methylated).More specifically, the methylation percentage / proportion of the (target) RNA is 0, 1, 2, 3, 3, 4,5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%. Embodiments of the invention The present invention will now be further described. In the following passages, differentaspects of the invention are defined in more detail. Each aspect so defined may be combinedwith any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous, unless clearly indicated to the contrary. The present inventors have developed sequence-specific structured adapters / adaptercombinations to specifically capture small non-coding RNAs such as miRNAs in a singleligation step reaction, thus enabling direct RNA sequencing and quantification of RNA modifications on a nanopore sequencing platform. This was not done before. Specifically, the present inventors have utilized the Oxford Nanopore platform to enable the sequencing andquantification of RNA modifications in small RNAs. The present inventors disclose methodsrequired to generate a library of small RNAs for sequencing on the Oxford Nanopore platform as well as bioinformatics for the detection and quantification of RNA modifications. Two different complexes of nanopore sequencing are described herein. The first complex is directed to the sequencing of a specific target RNA present in a sample. The target RNA is preferably a small (non-coding) RNA. This complex encompasses the first to eighthaspect of the present invention. The second complex is directed to the universal sequencing of(all) RNA molecules comprised in a sample. The RNA molecules are preferably small (non-coding) RNA molecules. This complex encompasses the ninth to twenty-first aspect of thepresent invention. In the following, the first complex is described: Thus, in a first aspect, the present invention relates to a 5’adapter comprising in thefollowing order from 5’ to 3’:(i) a 5’terminal ribonucleotide sequence comprising 6 to 15 (e.g. 6, 7, 8, 9, 10, 11, 12, 13,14, or 15) ribonucleotides, wherein said 6 to 15 ribonucleotides are reversecomplementary to a 5’-terminal sequence of a target RNA, and wherein optionally one or more (e.g. 1, 2, 4, or 5) of said 6 to 15 ribonucleotides are locked nucleotide- (LNA-) enhanced, and(ii) a ribonucleotide sequence capable of forming a stem-loop structure containing a loopand a double stranded stem.The 5’adapter is entirely novel and allows direct RNA sequencing of RNA targets, specifically non-coding small RNA targets. Particularly, the 5’adapter enables target RNA, specifically non-coding small RNA, sequencing via extension of the 5’end. In addition, the 5’adapter enables sequence and structure specify as it only ligated to a specific target RNA sequence with a defined 5’end. The locked nucleotides are specifically locked ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine, or LNA-cytosine. For example, every, every second, every third, or every fourth ribonucleotide of the 5’terminal ribonucleotidesequence is a locked ribonucleotide. The LNAs increase the affinity of the 5’adapter.The 5’adapter may range from 15 to 70, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50,51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70, nucleotides inlength. The 5’adapter may be present as linear polynucleotide, particularly in single-strandedform, e.g. after denaturation / when denatured. The 5’adapter is a polynucleotide that can be attached / ligated to the 5’end of a target RNA. When attached / ligated to the 5’end of a target RNA, the 5’adapter has a stem-loop structure. The attachment / ligation is possible as the 5’adapter comprises between 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, ribonucleotides which are reverse complementary to a 5’-terminal sequence of a target RNA. In one embodiment, the ribonucleotide sequence capable of forming a stem-loopstructure of the 5’adapter comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. Thus, the 5’positioned first stem sequence and the 3’positioned second stem sequence can form the double stranded stem.The double stranded stem may have a length of between 5 and 20, e.g. 5, 6, 7, 8, 9, 10, 11, 12,13, 14, 15, 16, 17, 18, 19 or 20, ribonucleotides.Preferably, each one of the 5’positioned first stem sequence and the 3’positioned second stem sequence has a length of between 5 to 10, e.g.5, 6, 7, 8, 9, or 10, ribonucleotides. Particularly,the 5’positioned first stem sequence and the 3’positioned second stem sequence have the samelength, e.g. a length of 5, 6, 7, 8, 9, or 10 ribonucleotides. More preferably, the 5’positioned first stem sequence and / or the 3’positioned second stemsequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between2 to 5, e.g. 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Evenmore preferably, the 5’positioned first stem sequence is LNA enhanced. Particularly, the LNAenhanced sequence comprises between 2 to 5, e.g. 2, 3, 4, or 5, more particularly 3, lockednucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every thirdnucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the3’positioned second stem sequence. In one further embodiment, the nucleotide sequence capable of forming a stem-loopstructure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprisebetween 10 and 40, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, ribonucleotides. Preferably, the loop sequencecomprises between 12 and 22, e.g. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22, ribonucleotides.In one another embodiment, the 5’-terminal sequence is configured such that it forms a single stranded 5’protrusion after formation of the stem-loop structure. In one more preferred embodiment, the 5’adaptercomprises the following sequence from 5’ to 3’: (6-15x)rNrCrGrUrGrGrCrGrUrGrGrArGrUrGrUrUrArArUrUrArArUrGrUrGrCrUrUrUrGrCrCrArUrG (SEQ ID NO: 1), wherein “r” stands for ribonucleotide, and wherein “(6-15x)rN”designates the ribonucleotide sequence reverse complementary to a 5’terminal sequence of a target RNA, oris a variant of this sequence.The 5’adapter variant as described above has a sequence having at least 80%, preferably 85%,more preferably 90%, even more preferably 95%, and still even more preferably 99%, e.g.80,81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identityto the sequence according to SEQ ID NO: 1. Such a 5’adapter variant still comprisesribonucleotides. In addition, such a 5’adapter variant is still capable of forming a stem-loopstructure containing a loop and a double stranded stem. The skilled person can readily assess whether a 5’adapter variant is still capable of forming a stem-loop structure containing a loopand a double stranded stem. For example, the experimental section provides sufficientinformation in this respect. Specifically, the 5’adapter allows (direct) nanopore sequencing of target RNA via the Oxford Nanopore Technology (ONT) platform. It is preferred that the target RNA is non-coding RNA, specifically non-coding smallRNA It is more preferred that the (non-coding) target RNA has a length of < 50 ribonucleotides,particularly a length of between 10 and < 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 ribonucleotides. It is even more preferred that the (non-coding) target RNA has a length of < 30 ribonucleotides, particularly a length of between 10and < 30 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 26, 27, 28, or 29 ribonucleotides.The (non-coding) target RNA, specifically (non-coding) small RNA, may be a miRNA, piRNA,siRNA, or a fragment of longer RNAs, preferably a rRNA or tRNA fragment. In one even more preferred embodiment, the 5’adapter comprises in the following orderfrom 5’ to 3’:(i) a 5’terminal ribonucleotide sequence comprising 6 to 15 (e.g. 6, 7, 8, 9, 10, 11, 12, 13,14, or 15) ribonucleotides, wherein said 6 to 15 ribonucleotides are reverse complementary to a 5’-terminal sequence of a target RNA, and wherein optionally oneor more (e.g. 1, 2, 4, or 5) of said 6 to 15 ribonucleotides are locked nucleotide- (LNA-) enhanced, and(ii) a ribonucleotide sequence capable of forming a stem-loop structure containing a loopand a double stranded stem,wherein the target RNA has a length of < 50 ribonucleotides, specifically of < 30ribonucleotides. In one still even more preferred embodiment, the target RNA is small non-coding RNA, specifically selected from a miRNA, piRNA, siRNA, or a fragment of longer RNAs, preferably a rRNA or tRNA fragment. In a second aspect, the invention relates to a 3’adapter combination comprising (i) a first oligonucleotide and (ii) a second oligonucleotide, wherein(i) the first oligonucleotide comprises in the following order from 5’ to 3’:(a) a ribonucleotide sequence comprising between 4 and 8 (e.g. 4, 5, 6, 7, or 8)ribonucleotides, wherein the 5’terminal ribonucleotide is phosphorylated, which sequence is reverse complementary to a corresponding sequence in the second oligonucleotide, (b) a poly(A) segment comprising between 8 and 12 (e.g. 8, 9, 10, 11, or 12)adenosine ribonucleotides, (c) a deoxynucleotide spacer sequence comprising between 2 and 5 (e.g. 2, 3, 4, or5) fixed deoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 8 and 12 (e.g. 8, 9, 10, 11, or 12) fixeddeoxynucleotides, all of which are reverse complementary to a corresponding sequence in the second oligonucleotide, and(d) a 3’overhanging deoxynucleotide sequence comprising between 8 and 12 (e.g.8, 9, 10, 11, or 12) deoxynucleotides which is capable of complexing with / ligating to a first element allowing nanopore sequencing of target RNA, and,(ii) the second oligonucleotide comprises in the following order from 5’ to 3’:(a) a 5’overhanging deoxynucleotide sequence comprising between 15 and 25 (e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) deoxynucleotides which is capable of complexing with / ligating to a second element allowing nanopore sequencing of target RNA, (b) a deoxynucleotide spacer sequence comprising between 8 and 12 (e.g. 8, 9, 10,11, or 12) fixed deoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 2 and 5 (e.g. 2, 3, 4, or 5) fixed deoxynucleotides, all of which are reverse complementary to a correspondingsequence in the first oligonucleotide,(c) a poly(T) segment comprising between 8 and 12 (e.g. 8, 9, 10, 11, or 12)thymidine deoxynucleotides,(d) a deoxynucleotide sequence comprising between 4 and 8 (e.g. 4, 5, 6, 7, or 8)deoxynucleotides which is reverse complementary to a corresponding sequence in the first oligonucleotide, and (e) a 3’overhanging deoxynucleotide sequence comprising 6 to 15 (e.g. 6, 7, 8, 9,10, 11, 12, 13, 14, or 15) deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of atarget RNA, and wherein optionally one or more (e.g. 1, 2, 3, 4, or 5) of said 6to 15 deoxynucleotides are locked nucleotide- (LNA-) enhanced.The 3’adapter combination is entirely novel and allows target RNA, specifically non-coding small RNA, sequencing. The 3’adpater combination is, in its renatured / hybridized state, a RNA / DNA hybrid polynucleotide. The inclusion of the RNA poly(A) / RNA poly(T) allows improved data processing, including segmentation and basecalling. The optional barcode deoxynucleotides enable multiplexed sequencing. They can also be designated as DNA barcode sequence. The locked nucleotides are specifically locked deoxynucleotides. Examples of locked deoxynucleotides are LNA-guanine, LNA-thymidine, LNA-adenosine, or LNA-cytosine. For example, every, every second, every third, or every fourth nucleotide of the 3’overhanging nucleotide sequence is a locked deoxynucleotide. The LNAs increase annealing and ligationefficiency of the 3’adapter combination to the RNA target.Thus, the 3’adapter combination comprises two oligonucleotides, a first oligonucleotideand a second oligonucleotide. In general, the oligonucleotides of the 3’adapter combinationmay range from 15 to 80, e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80,nucleotides in length. The second oligonucleotide of the two oligonucleotides can be ligated tothe 3’end of a target RNA. This is possible as it is reverse complementary to the 3’-terminalsequence of a target RNA. Specifically, the second oligonucleotide of the two oligonucleotidesof the 3’adapter combination comprises a 3’overhanging deoxynucleotide sequence comprising6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, deoxynucleotide, wherein said 6 to 15 deoxynucleotide are reverse complementary to a 3’-terminal sequence of a target RNA. The two oligonucleotides of the 3’adapter combination, can be present as linearoligonucleotides, e.g. after denaturation / when denatured. In this form, the 3’adapter combination is single-stranded. This primary structure may be converted into a secondarystructure. Specifically, the first and second oligonucleotides of the 3’adapter combination are capable of forming a hybrid (double-stranded) structure via their reverse complementarysequences. Thus, the 3’adapter combination can also have a hybrid (double-stranded) structure,e.g. after re-naturation / when re-natured. Particularly, when the second oligonucleotide of the3’adapter combination is attached / ligated to the 3’end of a target RNA, the 3’adapter combination has a hybrid (double-stranded) structure. In one preferred embodiment, the 3’overhanging deoxynucleotide sequence comprising between 8 and 12 (e.g. 8, 9, 10, 11,or 12) deoxynucleotides in (i)(d) is reverse complement to a corresponding 5’overhangsequence on a nanopore sequencing compatible motor protein / adapter complex, and / or the 5’overhanging deoxynucleotide sequence comprising between 15 and 25 deoxynucleotides in (ii)(a) is reverse complement to a tether oligonucleotide that concentrates the target RNA,specifically a ligation product or a RNA / cDNA duplex thereof (see aspects below), at themembrane surface of a nanopore flow cell. In one particularly preferred embodiment,the first element allowing nanopore sequencing of target RNA is a 5’overhang sequence on ananopore sequencing compatible motor protein / adapter complex, and / orthe second element allowing nanopore sequencing of target RNA is a tether oligonucleotidethat concentrates the target RNA, specifically a ligation product or a RNA / cDNA duplex thereof (see aspects below), at the membrane surface of a nanopore flow cell. Specifically, the 3’adapter combination allows (direct) nanopore sequencing of target RNA via the Oxford Nanopore Technology (ONT) platform. In one more preferred embodiment, the first oligonucleotide of the 3’adaptercombination comprises the following sequence from 5’ to 3’: / 5Phos / rUrArGrCrUrC(8-12x)rAGGNNNNNNNNNNCTTGCTCTTAGGTAGTAGGTTC (SEQ ID NO: 2), wherein “r”stands for ribonucleotide, “ / 5Phos / ” indicates that the 5’-terminal ribonucleotide isphosphorylated, “(8-12x)rA” stands for the poly(A) segment, the deoxynucleotide spacersequence is underlined, and the optional barcode (N) is highlighted in bold, oris a variant of this sequence. The first oligonucleotide variant as described above has a sequence having at least 80%,preferably 85%, more preferably 90%, even more preferably 95%, and still even more preferably 99%, e.g.80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 2. Such a first oligonucleotidevariant still comprises the phosphorylated 5’-terminal ribonucleotide. Further, ribonucleotidesin the first oligonucleotide are also ribonucleotides in the first oligonucleotide variant.Furthermore, the number of the fixed nucleotides in the first oligonucleotide is not amended inthe first oligonucleotide variant. In addition, the poly(A) segment and / or the 3’overhangingdeoxynucleotide sequence comprising between 8 and 12 (e.g. 8, 9, 10, 11, or 12)deoxynucleotides in (i)(d) which is reverse complement to a corresponding 5’overhangsequence on a nanopore sequencing compatible motor protein / adapter complex remainunchanged in the first oligonucleotide variant.Moreover, such a first oligonucleotide variant is still capable of forming a hybrid structure withthe second oligonucleotide. Thus, amendments in the first oligonucleotide should also be included (in reverse complementary way) in the second oligonucleotide. The skilled person canreadily assess whether the formation of a hybrid structure is still possible. For example, theexperimental section provides sufficient information in this respect. In one particularly more preferred embodiment, the first oligonucleotide of the 3’adapter combination comprises the following sequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGNNNNNNNNNNCTTGCTCTTAGGTAGTAGGTTC (SEQ ID NO: 3), oris a variant of this sequence.As to the variant language, it is referred to the above explanations.In one another more preferred embodiment, the second oligonucleotide of the 3’adapter combinationcomprises the following sequence from 5’ to 3’:GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGNNNNNNNNNNCC(8-12x)TGAGCTA(6-15x)N (SEQ ID NO: 4), wherein the deoxynucleotide spacer sequence isunderlined, the optional barcode (N) is highlighted in bold, “(8-12x)T” stands for the poly(T)segment, and “(6-15x)N” designates the deoxynucleotide sequence reverse complementary to a 3’terminal sequence of a target RNA, or is a variant of this sequence. The second oligonucleotide variant as described above has a sequence having at least80%, preferably 85%, more preferably 90%, even more preferably 95%, and still even more preferably 99%, e.g.80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 4.Such a second oligonucleotide variant still comprises deoxynucleotides at positions wheredeoxynucleotides were previously present. Further, the number of the fixed nucleotides in thesecond oligonucleotide is not amended in the second oligonucleotide variant. In addition, thepoly(T) segment and / or the 5’overhanging deoxynucleotide sequence comprising between 15and 25 (e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) deoxynucleotides in (ii)(a) which is reverse complement to a tether oligonucleotide that concentrates the target RNA, specifically a ligation product or a RNA / cDNA duplex thereof, at the membrane surface of a nanopore flowcell remain unchanged in the second oligonucleotide variant.Moreover, such a second oligonucleotide variant is still capable of forming a hybrid structurewith the first oligonucleotide. Thus, amendments in the second oligonucleotide should also be included (in reverse complementary way) in the first oligonucleotide. The skilled person canreadily assess whether the formation of a hybrid structure is still possible. For example, theexperimental section provides sufficient information in this respect. In one particularly more preferred embodiment, the second oligonucleotide of the3’adapter combinationcomprises the following sequence from 5’ to 3’:GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGNNNNNNNNNNCCTTTTTTTTTTGAGCTA(6-15x)N (SEQ ID NO: 5), oris a variant of this sequence. As to the variant language it is referred to the above explanations. It is preferred that the target RNA is non-coding RNA, specifically non-coding smallRNA. It is more preferred that the (non-coding) target RNA has a length of < 50ribonucleotides, particularly a length of between 10 and < 50 ribonucleotides, e.g. a length of10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 ribonucleotides. It is even morepreferred that the (non-coding) target RNA has a length of < 30 ribonucleotides, particularly alength of between 10 and < 30 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17,18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 ribonucleotides.The (non-coding) target RNA, specifically (non-coding) small RNA, may be a miRNA, piRNA,siRNA, or a fragment of longer RNAs, preferably a rRNA or tRNA fragment. In one even more preferred embodiment, the 3’adapter combination comprises (i) a first oligonucleotide and (ii) a second oligonucleotide, wherein(i) the first oligonucleotide comprises in the following order from 5’ to 3’:(a) a ribonucleotide sequence comprising between 4 and 8 (e.g. 4, 5, 6, 7, or 8)ribonucleotides, wherein the 5’terminal ribonucleotide is phosphorylated, which sequence is reverse complementary to a corresponding sequence in the second oligonucleotide,(b) a poly(A) segment comprising between 8 and 12 (e.g. 8, 9, 10, 11, or 12)adenosine ribonucleotides, (c) a deoxynucleotide spacer sequence comprising between 2 and 5 (e.g. 2, 3, 4, or5) fixed deoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 8 and 12 (e.g. 8, 9, 10, 11, or 12) fixeddeoxynucleotides, all of which are reverse complementary to a corresponding sequence in the second oligonucleotide, and (d) a 3’overhanging deoxynucleotide sequence comprising between 8 and 12 (e.g.8, 9, 10, 11, or 12) deoxynucleotides which is capable of complexing with / ligating to a first element allowing nanopore sequencing of target RNA, and,(ii) the second oligonucleotide comprises in the following order from 5’ to 3’:(a) a 5’overhanging deoxynucleotide sequence comprising between 15 and 25 (e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) deoxynucleotides which is capable of complexing with / ligating to a second element allowing nanopore sequencing of target RNA, (b) a deoxynucleotide spacer sequence comprising between 8 and 12 (e.g. 8, 9, 10,11, or 12) fixed deoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 2 and 5 (e.g. 2, 3, 4, or 5) fixed deoxynucleotides, all of which are reverse complementary to a correspondingsequence in the first oligonucleotide,(c) a poly(T) segment comprising between 8 and 12 (e.g. 8, 9, 10, 11, or 12)thymidine deoxynucleotides, (d) a deoxynucleotide sequence comprising between 4 and 8 (e.g. 4, 5, 6, 7, or 8)deoxynucleotides which is reverse complementary to a corresponding sequence in the first oligonucleotide, and(e) a 3’overhanging deoxynucleotide sequence comprising 6 to 15 (e.g. 6, 7, 8, 9,10, 11, 12, 13, 14, or 15) deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of a target RNA, and wherein optionally one or more of said 6 to 15 deoxynucleotides are locked nucleotide- (LNA-) enhanced,wherein the target RNA has a length of < 50 ribonucleotides, specifically of < 30ribonucleotides. In one still even more preferred embodiment, the target RNA is small non-coding RNA, specifically selected from a miRNA, piRNA, siRNA, or a fragment of longer RNAs, preferably a rRNA or tRNA fragment. In a third aspect, the present invention relates to an adapter system comprising the 5’adapter of the first aspect, and the 3’adapter combination of the second aspect. The 5’adapter according to the first aspect and the 3’adapter combination according tothe second aspect may be present in the adapter system individually or together. For example,the 5’adapter according to the first aspect may be comprised in a (first) composition and the 3’adapter combination according to the second aspect may be comprised in another / different (second) composition. Alternatively, the 5’adapter according to the first aspect and the 3’adapter combination according to the second aspect may be comprised in a single composition. The composition may be an aqueous solution such as water or a buffer solution. In a fourth aspect, the present invention relates to a method of ligating a 5’adapter anda 3’adapter combination to a target RNA in a sample comprising the steps of:(i) providing a composition comprising a denatured target RNA in a sample, the renatured5’adapter of the first aspect, and the renatured 3’adapter combination of the secondaspect, wherein the 5’adapter and the 3’adapter combination are annealed to the target RNA, and(ii) ligating the 5’adapter and the 3’adapter combination to the target RNA using / with adouble stranded RNA ligase, thereby producing a ligation product. The annealing of the 5’adapter and 3’adapter combination to the target RNA requiresthat the target RNA is present in denatured form. In one embodiment, the denatured target RNAis produced by heating the target RNA at between 65°C and 75°C, e.g. 65, 66, 67, 68, 69, 70,71, 72, 73, 74, or 75°C, preferably at 70°C, for between 1 to 3 minutes, e.g.1, 2, or 3, minutes, preferably for 2 minutes. It is preferred that the target RNA is immediately placed on ice after denaturation. For the denaturation step, the target RNA is preferably given to an aqueous solution, e.g. water, or to a buffer solution. The target RNA may, after its denaturation, treated with a Polynucleotide Kinase (PNK) which 5’phosphorylates RNA to enable ligation to the 3’ OH group at the 3’ end of the 5’ adapter. This PNK treatment is required for small RNAs that may not contain a 5’ phosphate such as for example fragments of rRNA or tRNA.As to the 5’adapter, a denaturation and a renaturation step is required so that the adaptercan form a stem-loop structure which allows annealing to the target RNA. As to the 3’adaptercombination, a denaturation and a renaturation step is required so that the adapter combination can form a hybrid structure which allows annealing to the target RNA. Annealing is a process of heating and cooling adapter / adapter combination withcomplementary sequences. Heat breaks all hydrogen bonds and cooling allows new bonds toform between the sequences. During this process, the adapter / adapter combination attaches tothe denatured target RNA and forms their characteristic stem-loop structure / hybrid structure.In particular, the 5’adapter attaches to the 5’end / 5’terminal sequence of the target RNA and thesecond oligonucleotide of the 3’adapter combination attaches to the 3’end / 3’terminal sequenceof the target RNA. It is preferred that the adapter and adapter combination are denatured andrenatured together, i.e. in a common reaction vessel. It is further preferred that thedenaturation / renaturation of the adapter and adapter combination takes place separately and inthe absence of the target RNA. In one embodiment, the renatured 5’adapter is produced by denaturing the 5’adapter at between75°C and 85°C, e.g. 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or 85°C, preferably at 82°C, forbetween 1 to 3 minutes, e.g.1, 2, or 3 minutes, preferably for 2 minutes, and renaturing the 5’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s. In one additional or alternative embodiment, the renatured 3’adapter combination is produced by denaturing the 3’adapter combination at between 75°C and 85°C, e.g.75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or 85°C, preferably at 82°C, for between 1 to 3 minutes, e.g.1, 2, or 3 minutes, preferably for 2 minutes, and renaturing the 3’adapter combination by cooling down to 4°C, preferably at a rate of 0.1°C / s.For the denaturation and renaturation step, the 5’adapter and 3’adapter combination arepreferably given to an aqueous buffer comprising 10 mM TRIS HCl pH 7.5, 50 mM NaCl. Inother words, the denaturing and renaturing of the 5’adapter and 3’adapter combination ispreferably carried out in an aqueous buffer comprising 10 mM TRIS HCl pH 7.5, 50 mM NaCl.The composition provided in step (i) of the above method is specifically produced by mixingthe denatured target RNA, the renatured 5’adapter of the fist aspect, and the renatured 3’adaptercombination of the second aspect with each other, thereby annealing the 5’adapter and the3’adapter combination to the target RNA. The annealing of the 5’adapter with the target RNA particularly generates a double- stranded (DNA / RNA) hybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of the adapter and the 5’end of the target RNA. This is an efficient substrate for ligation by adouble stranded RNA ligase. In addition, the annealing of the second oligonucleotide of the3’adpater combination with the target RNA particularly generates a double-stranded(DNA / RNA) hybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of the target RNA and the 5’end of the second oligonucleotide of the 3’adapter combination. This is a substrate for ligation by a double stranded RNA ligase. The ligation is usually carried out in a ligation buffer. An exemplarily ligation buffers is described in the experimental section of the present patent application. In one preferred embodiment, the ligation buffer comprises polyethylene glycol (PEG), e.g. PEG 8000 (5%), and / or adenosine triphosphate (ATP), e.g. 1 mM ATP. The present inventors have noted that PEG had the effect on the ligation reaction such that it functions as molecular crowding agent and / or ATP had the effect on the ligation reaction such that increased concentrations facilitate the ligation reactions. In one embodiment, the ligation is carried out between 36°C and 38°C, e.g. 36, 37, or 38°C, preferably at 37°C, for between 30 minutes and 1.5 hours, e.g.30, 35, 40, 45, 50, 55 minutes, 1, 1.25, or 1.5 hour(s), preferably for 1 hour, then at between 14°C and 18°C, e.g.14, 15, 16, 17, or 18°C, preferably at 16°C, for between 1.5 hours and 2.5 hours, e.g.1.5, 2, or 2.5 hours, preferably for 2 hours, and at 12°C overnight. The double stranded RNA ligase can be any ligase capable of ligating double stranded RNA nicks / RNA structures. Preferably, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2) or a Kod1 ligase. In this respect, it should be noted that only a perfectly hybridized molecule provides a substrate for the double stranded RNA ligase, in particular Rnl2. Also, in case of protrusion of either strand or a gap that is 2 nucleotides or longer, the Rnl2 will ligate the molecule with much lower efficiency. By ligating the 5’adapter and 3’adapter combination to the target RNA using / with adouble stranded RNA ligase, a ligation product is produced. The ligation product can be described as a hybrid molecule comprising at least one adapter / adapter combination and a target RNA. For example, the ligation product may comprise a 5’adapter and a target RNA such as miRNA or isomiR. The ligation product may comprise a 3’adapter combination and a target RNA such as miRNA or isomiR. In addition, the ligation produced may comprise a 5’adapter, a 3’adapter combination and a target RNA such as miRNA or isomiR. In one preferred embodiment, the method of ligating a 5’adapter and a 3’adaptercombination to a target RNA in a sample comprises the steps of:(i) providing a composition comprising a denatured target RNA in a sample, the renatured5’adapter of the first aspect, and the renatured 3’adapter combination of the second aspect, wherein the 5’adapter and the 3’adapter combination are annealed to the target RNA, and(ii) ligating the 5’adapter and the 3’adapter combination to the target RNA using / with adouble stranded RNA ligase, thereby producing a ligation product,wherein the target RNA has a length of < 50 ribonucleotides, specifically of < 30ribonucleotides. In one more preferred embodiment, the target RNA is small non-coding RNA, specifically selected from a miRNA, piRNA, siRNA, or a fragment of longer RNAs, preferably a rRNA or tRNA fragment. The present inventors use a nanopore sequencing platform for sequencing of target RNAs. Nanopore sequencing platforms are offered, for example, by Oxford NanoporeTechnologies Ltd. All Oxford Nanopore sequencing devices use flow cells which contain anarray of tiny holes - nanopores - embedded in an electro-resistant membrane. Each nanoporecorresponds to its own electrode connected to a channel and sensor chip, which measures the electric current that flows through the nanopore. When a molecule passes through a nanopore, the current is disrupted to produce a characteristic ‘squiggle’. The squiggle is then decoded using basecalling algorithms to determine the DNA or RNA sequence in real time.Specifically, a strand of DNA or RNA is made up of a sequence of different combinations offour nucleotide bases: A, T (or U for RNA), G and C. Each base that passes through the nanopore can be identified through the characteristic disruption it causes to the current in real- time. This makes nanopore sequencing unique, in that it is the only sequencing technology that enables direct, real-time analysis of DNA / RNA in fully scalable formats. Advantages of real- time sequencing include rapid access to time critical information (e.g. pathogen identification), the generation of early sample insights and more control over the sequencing experiment. Nanopore sequencing is limited only by the length of the DNA / RNA fragment presented to the pore and can therefore span entire repetitive regions, resolve structural variants, and differentiate between different isoforms. The ability to sequence native DNA and RNA without the requirement for amplification, eliminates PCR bias and allows for the identification of base modifications, such as methylation, alongside nucleotide sequence. The nanopore sequencing platforms available, such as the Oxford Nanopore platform, are optimized for the sequencing of long nucleic acids. Technical limitations have prohibited the sequencing of shorter molecules under 100 nucleotides including miRNAs. Chemical modifications of small non-coding RNAs have been reported in disease and may serve aspromising biomarkers. Thus, the provision of methods to enable direct sequencing of small non-coding RNAs on a nanopore sequencing platform such as the Oxford Nanopore platform forthe simultaneous measurement of both RNA abundance and modification patterns are highlyneeded. The standard preparation of a direct RNA sequencing library for use on the Oxford Nanopore platform involves the ligation of a 3’adapter only. This however, prevents the sequencing of the very 5’end of long RNA inserts and an even greater proportion of smallerRNA inserts. The sequencing of short RNA molecules has not been successfully reported yet.The innovative contribution of the method of the present invention is the use of astructured dumbbell 5’adapter that is ligated to the 5’end of the target RNA and enables theextension of the target RNA so as to enable accurate nanopore sequencing of the full lengthRNA insert. In addition, a specific 3’adapter combination has been developed by the presentinventors. Both, 5’adpater and 3’adapter combination, as described herein, are designed for the capture of specific RNA targets via engineering of their overhangs with reverse complementary sequence to their targets. Thus, in a fifth aspect, the present invention relates to a method of determining and / orquantifying a target RNA in a sample comprising the steps of:(i) carrying out the method of the fourth aspect, thereby obtaining a ligation product,(ii) optionally reverse transcribing the ligation product, thereby obtaining a RNA / cDNAduplex, and(iii) subjecting the ligation product obtained in step (i) or the RNA / cDNA duplex obtainedin step (ii) to a nanopore sequencing reaction, thereby determining and / or quantifying the target RNA.In this aspect, the sequencing can be determined as targeted sequencing. In an optional step, the reverse transcription of the ligation product is performed.Thereby, a RNA / cDNA duplex is obtained. Particularly, the reverse transcription of the ligationproduct is carried out by reverse transcribing the ligation product using a reverse transcriptase(RT). Usually, the reverse transcriptase (RT) uses a RT primer. However, in the context of thepresent invention, the reverse transcriptase (RT) uses the second oligonucleotide of the3’adapter combination as a self-primer to extend. The reverse transcriptase (RT) may be aSuperScript III RT, Maxima H-RT or Tth polymerase. Preferably, said reverse transcribing iscarried out at between 45°C and 60°C, e.g.45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60°C, preferably at 50°C, for between 40 and 60 minutes, e.g.40, 41, 42, 43, 44, 45, 46,47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 minutes, preferably for 50 minutes, thenat between 60°C and 80°C, e.g.60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80°C, preferably at 70°C, for between 8 and 15 minutes, e.g.8, 9, 10, 11, 12, 13,14, or 15 minutes, preferably for 10 minutes, before finally cooling down to 4°C. The result ofthe reverse transcription reaction is the formation of RNA / cDNA duplex. This duplex iscomposed of a top strand comprising the 5’ adapter, small RNA insert(s), and the firstoligonucleotide of the 3’ adapter, and a bottom strand comprising the second oligonucleotide of the 3’ adapter that has been extended as cDNA by reverse transcription. Nanopore sequencing requires flow cells. Flow cells contain an array of tiny holes -nanopores - embedded in an electro-resistant membrane. The nanopore sequencing reactionparticularly further requires / comprises the addition of a structure allowing nanoporesequencing.Specifically, the structure allowing nanopore sequencing is composed of(i) a first element, and(ii) a second element.More specifically,(i) the first element is a 5’overhang sequence on a nanopore sequencing compatible motorprotein / adapter complex, and(ii) the second element is a tether oligonucleotide that concentrates the ligation product (incase no reverse transcription is carried out) or the RNA / cDNA duplex (in case reverse transcription is carried out) at the membrane surface of a nanopore flow cell. The 5’overhang sequence on a nanopore sequencing compatible motor protein / adaptercomplex, thus, established the connection / contact of the 5’adapter / 3’adapter combinationcomplex carrying the target RNA to be sequenced and the motor protein / adapter complex. Even more specifically,(i) the first element recognizes the reverse complementary 3’overhanging deoxynucleotidesequence of the first oligonucleotide of the 3’adapter combination of the second aspect,to which it anneals and is ligated to, to enable nanopore sequencing, and(ii) the second element recognizes the reverse complementary 5’overhangingdeoxynucleotide sequence of the second oligonucleotide of the 3’adapter combinationof the second aspect, to which it anneals and is ligated to, to enable nanopore sequencing. Thus, the nanopore sequencing system uses, in addition to flow cells includingnanopores and an electro-resistant membrane, a nanopore adapter / motor protein complex anda tether oligonucleotide. The nanopore adapter is required for attaching the target RNA to besequenced, specifically the ligation product or the RNA / cDNA duplex, to the nanopore. Inaddition, the motor protein is required for directing the target RNA to be sequence through thenanopore in order to allow sequencing. Specifically, the motor protein controls translocation of the target RNA strand through the nanopore. Once the target RNA has passed thought, the motor protein detaches and the nanopore is ready to accept the next target RNA. The tether oligonucleotide has the function of concentrating the RNA target which is to be sequenced at the membrane surface of a nanopore flow cell. An electrically resistant membrane means that all current must pass through the nanopore to ensure a clean signal. The final sequencing of the target RNA is possible as, when the target RNA passes through the nano-scale hole, the currentchanges / fluctuates. This signal can be detected and is converted to a nucleotide sequence bybasecalling algorithms. Especially, the added structure allows (direct) nanopore sequencing of a target RNA via the Oxford Nanopore Technology (ONT) platform. The nanopore sequencing reaction preferably further allows the detection,characterization, and quantification of nucleotide modifications such as methylations. Thenucleotide modifications are preferably selected from the group consisting of 2'-O-methylation,N6-methyladenosine (m6A), N6,2′-O-dimethyladenosine (m6Am), 8-oxo-7,8- dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5-methylcytidine (m5C), and N4-acetylcytidine (ac4C). The detection, characterization, and quantification of nucleotidemodifications is specifically carried out through analysis of the raw nanopore signal. Specificmodifications will characteristically alter the current associated with a given nucleotide andenable their detection and quantification.Specifically, the method encompasses the determination of the target RNA modificationproportion, particularly target RNA methylation proportion. The target RNA modification proportion, particularly target RNA methylation proportion, is specifically calculated bydividing the number of modified, particularly methylated, target RNA by the total number oftarget RNA in a sample. In this respect, it is also referred to the experimental section. In one preferred embodiment, the method of determining and / or quantifying a targetRNA in a sample comprises the steps of:(i) carrying out the method of the fourth aspect, thereby obtaining a ligation product,(ii) optionally reverse transcribing the ligation product, thereby obtaining a RNA / cDNAduplex, and(iii) subjecting the ligation product obtained in step (i) or the RNA / cDNA duplex obtainedin step (ii) to a nanopore sequencing reaction, thereby determining and / or quantifying the target RNA,wherein the target RNA has a length of < 50 ribonucleotides, specifically of < 30ribonucleotides. In one more preferred embodiment, the target RNA is small non-coding RNA, specifically selected from a miRNA, piRNA, siRNA, or a fragment of longer RNAs, preferably a rRNA or tRNA fragment. In a sixth aspect, the present invention relates to a method of diagnosing a disease orcondition in a patient comprising the steps of:(ia) carrying out the methods of the fourth and / or fifth aspect, thereby determining thepresence of the target RNA, and(iia) diagnosing whether the patient is afflicted by the disease or condition based on thepresence of the target RNA, or(ib) carrying out the methods of the fourth and / or fifth aspect, thereby determining the targetRNA modification proportion,(iib) comparing the target RNA modification proportion to a reference target RNAmodification proportion, and(iiib) diagnosing whether the patient is afflicted by the disease or condition based on thecomparison. Thus, the present invention relates to a method of diagnosing a disease or condition in a patient comprising the steps of:(i) carrying out the methods of the fourth and / or fifth aspect, thereby determining thepresence of the target RNA, and(ii) diagnosing whether the patient is afflicted by the disease or condition based on thepresence of the target RNA. Accordingly, the presence or absence of the target RNA is indicative for the disease orcondition. For example, the patient is diagnosed to be afflicted by the disease or condition, ifthe target RNA is present or absent. Alternatively, the patient is diagnosed to be not afflicted by the disease or condition, if the target RNA is present or absent. Preferably, the disease is cancer. More preferably, the disease is lung cancer. Alternatively, the present invention relates to a method of diagnosing a disease orcondition in a patient comprising the steps of:(i) carrying out the methods of the fourth and / or fifth aspect, thereby determining the targetRNA modification proportion,(ii) comparing the target RNA modification proportion to a reference target RNAmodification proportion, and(iii) diagnosing whether the patient is afflicted by the disease or condition based on thecomparison. Specifically, the modification is a methylation. More specifically, the modification isselected from the group consisting of 2'-O-methylation, N6-methyladenosine (m6A), N6,2′-O- dimethyladenosine (m6Am), 8-oxo-7,8-dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5- methylcytidine (m5C), and N4-acetylcytidine (ac4C). The target RNA modification proportion is determined in a sample. In this case, thesample is preferably obtained from a patient to be tested. In addition, the reference target RNAmodification proportion is determined in a reference sample. In this case, the reference sampleis preferably obtained from a healthy subject / subject not suffering from a disease or condition.The target RNA modification proportion, particularly target RNA methylationproportion, is specifically calculated by dividing the number of modified, particularlymethylated, target RNA by the total number of target RNA in a sample.In one embodiment, the reference target RNA modification proportion, particularlyreference target RNA methylation proportion, is the modification proportion, particularlymethylation proportion, of the target RNA determined by measuring at least one referencesample from a healthy subject / subject known to not suffer from the disease or condition. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, or more reference sample(s) from (a) healthy subject(s) / (a) subject(s) known to notsuffer from the disease or condition may be measured.The reference target RNA modification proportion, particularly reference target RNA methylation proportion, is specifically calculated by dividing the number of modified,particularly methylated, target RNA by the total number of target RNA in the at least onereference sample. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, or more reference sample(s) from (a) healthy subject(s) / (a) subject(s) known to notsuffer from the disease or condition may be measured.Specifically, the modification percentage / proportion of the target RNA ranges between100% (i.e. fully modified, or all detected RNA entities are fully modified) and 0% (i.e. notmodified, or all detected RNA entities are not modified).More specifically, the modification percentage / proportion of the target RNA is 0, 1, 2, 3, 3, 4,5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%. Preferably, the target RNA modification proportion is a target RNA methylation proportion.Specifically, the methylation percentage / proportion of the target RNA ranges between 100%(i.e. fully methylated, or all detected RNA entities are fully methylated) and 0% (i.e. notmethylated, or all detected RNA entities are not methylated).More specifically, the methylation percentage / proportion of the target RNA is 0, 1, 2, 3, 3, 4,5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81,82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%.Especially, the reference modification proportion such as reference methylationproportion of the target RNA is an average modification proportion such as average methylationproportion. It is determined by measuring the modification proportion such as methylationproportion of target RNA in samples of control subjects known to be healthy / known to notsuffer from the disease or condition and calculating the “average” proportion (e.g. mean,median or modal value) thereof. It is preferred that the reference sample is from the same source (e.g. blood cells, serum, or plasma) than the sample isolated from the patient to be tested. It isfurther preferred that the reference modification proportion such as methylation proportion ofthe target RNA is obtained from control subjects known to be healthy / known to not suffer fromthe disease or condition of the same gender (e.g. female or male) and / or of a similar age / phaseof life (e.g. adults or elderly) than the patient to be tested. Particularly, the referencemodification proportion such as methylation proportion of the target RNA represents anaverage value in a healthy population. Adifference like an increase or a decrease in the modification proportion such asmethylation proportion of the target RNA in the sample and the target RNA in the reference sample indicates that the disease or condition is present. For example, the modification proportion such as methylation proportion of the target RNA may be increased or decreased by at least 5%, more specifically by at least 10%, even more specifically by at least 20%, still even more specifically by at least 30%, and most specifically by at least 40 or 50%, e.g. at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50% between the sample and the reference sample. In the examples, a significant increase in miLung#1 with a GmCm methylation pattern in a patients sample compared to a healthy control sample was observed which is indicative forlung cancer in the patient (see also Figures 8 and 9).In the methods according to the fourth to sixth aspect of the present invention, thesample is preferably a biological sample. The biological sample may be any sample having abiological origin. For example, the biological sample may be a body fluid sample, e.g. a bloodsample or urine sample, or a tissue sample, e.g. a tissue biopsy sample. Biological samples may be mixed or pooled, e.g. a sample may be a mixture of a blood sample and a urine sample.The body fluid sample may be a urine sample, blood sample, sputum sample, breast milksample, cerebrospinal fluid (CSF) sample, cerumen (earwax) sample, gastric juice sample, mucus sample, lymph sample, endolymph fluid sample, perilymph fluid sample, peritoneal fluid sample, pleural fluid sample, saliva sample, sebum (skin oil) sample, semen sample, sweat sample, tears sample, cheek swab, vaginal secretion sample, liquid biopsy, or vomit sample including components or fractions thereof. The term “body fluid sample” also encompasses body fluid fractions, e.g. blood fractions, urine fractions or sputum fractions. Body fluid samples may be mixed or pooled. Thus, a body fluid sample may be a mixture of a blood and a urine sample or a mixture of a blood and cerebrospinal fluid sample. More preferably, the biological sample is a blood sample. Even more preferably, the blood sample is a whole blood or a blood fraction, preferably blood cells (e.g. erythrocytes, leukocytes, and / or thrombocytes), serum, or plasma. For example, the blood cell fractionencompasses erythrocytes, leukocytes, and / or thrombocytes. The whole blood sample may becollected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA-tube, in a Na-citrate tube, Heparin-tube, or in a ACD-tube (Acid citrate dextrose). Alternatively, the whole blood sample may be collected in a blood collection tube containing cell-free nucleic acid stabilizing chemical agents, such as glutaraldehyde, formaldehyde, or similar (e.g. Streck cfRNA BCT tube, Streck cfDNA BCT tube), and others, or cellular crowding agents, such as polyethyleneglycol (PEG) (e.g.Norgen cfDNA / cfRNA preservation tube), and others. The whole blood sample may also becollected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. Thistechnique requires smaller sample volumes, typically 45-60 µl for humans or less. For example,the whole blood may be extracted from the patient via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need be taken in handling or shipping. Once at the analysis site, the desired components, e.g. miRNAs, are extracted from the dried blood spots into a supernatant which is then further analyzed. Specifically, the sample used in the methods according to the fourth to sixth aspect ofthe present invention contains total RNA specifically cellular total RNA. Particularly, cellular total RNA includes RNA having a length of < 50 nucleotides such as a miRNA or a miRNA isoform (an isomiR). The cellular total RNA may be obtained from blood cells, e.g. erythrocytes, leukocytes, and / or thrombocytes. It is preferred that the target RNA is non-coding RNA, specifically non-coding smallRNA It is more preferred that the (non-coding) target RNA has a length of < 50 ribonucleotides,particularly a length of between 10 and < 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 ribonucleotides. It is even more preferred that the (non-coding) target RNA has a length of < 30 ribonucleotides, particularly a length of between 10and < 30 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 26, 27, 28, or 29 ribonucleotides. The (non-coding) target RNA, specifically (non-coding) small RNA, may be a miRNA, piRNA, siRNA, or a fragment of longer RNAs, preferably a rRNA or tRNA fragment. In a seventh aspect, the present invention relates to the use of the 5’adapter of the firstaspect and / or the 3’adapter combination of the second aspect or the adapter system of the third aspect for nanopore sequencing of target RNA. The nanopore sequencing of target RNA may be carried out via the Oxford Nanopore Technology (ONT) platform. It is preferred that the target RNA is non-coding RNA, specifically non-coding smallRNA It is more preferred that the (non-coding) target RNA has a length of < 50 ribonucleotides,particularly a length of between 10 and < 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 ribonucleotides. It is even more preferred that the (non- coding) target RNA has a length of < 30 ribonucleotides, particularly a length of between 10 and < 30 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 ribonucleotides.In an eighth aspect, the present invention relates to the use of the 5’adapter of the firstaspect and / or the 3’adapter combination of the second aspect or the adapter system of the third aspect for the determination, characterization, and quantification of the modification status of target RNA. The determination, characterization, and quantification of the modification status of target RNA may be carried out via the Oxford Nanopore Technology (ONT) platform. It is preferred that the target RNA is non-coding RNA, specifically non-coding smallRNA It is more preferred that the (non-coding) target RNA has a length of < 50 ribonucleotides,particularly a length of between 10 and < 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 ribonucleotides. It is even more preferred that the (non-coding) target RNA has a length of < 30 ribonucleotides, particularly a length of between 10and < 30 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 26, 27, 28, or 29 ribonucleotides. The modification status of target RNA specifically means the nucleotide modification status of target RNA. Preferably, the nucleotide modification is a methylation. More preferably, the nucleotide modifications are selected from the group consisting of 2'-O-methylation, N6- methyladenosine (m6A), N6,2′-O-dimethyladenosine (m6Am), 8-oxo-7,8-dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5-methylcytidine (m5C), and N4-acetylcytidine (ac4C). It is even more preferred, that the present invention relates to the use of the 5’adapter ofthe first aspect and / or the 3’adapter combination of the second aspect or the adapter system of the third aspect for the determination, characterization, and quantification of the nucleotidemodification status of target RNA, wherein the target RNA has a length of < 50 ribonucleotides,specifically of < 30 ribonucleotides. It is still even more preferred that the target RNA is smallnon-coding RNA, specifically selected from a miRNA, piRNA, siRNA, or a fragment of longer RNAs, preferably a rRNA or tRNA fragment. In a ninth aspect, the present invention relates to the use of the 5’adapter of the firstaspect and / or the 3’adapter combination of the second aspect or the adapter system of the thirdaspect for diagnosing a disease or condition in a patient.In order to diagnose a disease or condition in a patient, it may be evaluated whether atarget RNA is present in a sample of the patient or is not present in a sample of the patient. Itmay alternatively be evaluated whether the modification proportion such as methylationproportion of the target RNA in a sample of a patient differs from the modification proportionsuch as methylation proportion of the target RNA in a reference sample (e.g. obtained from a(control) subject known to be healthy / known to not suffer from the disease or condition). Adifference (e.g. increase or decrease) in the modification proportion such as methylation proportion of the target RNA in the sample and the target RNA in the reference sample indicates that the disease or condition is present. It is preferred that the target RNA is non-coding RNA, specifically non-coding smallRNA It is more preferred that the (non-coding) target RNA has a length of < 50 ribonucleotides,particularly a length of between 10 and < 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 ribonucleotides. It is even more preferred that the (non-coding) target RNA has a length of < 30 ribonucleotides, particularly a length of between 10and < 30 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 26, 27, 28, or 29 ribonucleotides. In a tenth aspect, the present invention relates to a kit comprisingthe 5’adapter of the first aspect, andthe 3’adapter combination of the second aspect, orthe adapter system of the third aspect. Preferably, the kit further comprises(i) a double stranded RNA ligase, more preferably a T4 RNA ligase 2 (Rnl2) or a Kod1ligase,(ii) a reverse transcriptase (RT), more preferably SuperScript III RT, Maxima H-RT or Tthpolymerase, and / or(iii) a structure allowing nanopore sequencing.It should be noted that the kit allows to conduct the methods of the fourth to sixth aspect.The kit may further comprise(i) one or more containers for the different components of the kit, and / or(ii) a data carrier.Said data carrier may be a non-electronical data carrier, e.g. a graphical data carrier such as an information leaflet, an information sheet, a bar code or an access code, or an electronical data carrier such as a floppy disk, a compact disk (CD), a digital versatile disk (DVD), a microchipor another semiconductor-based electronical data carrier. The access code may allow the accessto a database, e.g. an internet database, a centralized, or a decentralized database. The accesscode may also allow access to an application software that causes a computer to perform tasksfor computer users or a mobile app which is a software designed to run on smartphones and other mobile devices. Said data carrier may comprise information or instructions on how to carry out the methods ofthe fourth to sixth aspect of the present invention.Said kit may also comprise materials desirable from a commercial and user standpointincluding a buffer(s), a reagent(s) and / or a diluent(s) which might be possible to carry out themethods of the fourth to sixth aspect of the present invention. In particular, the kit may alsocomprise buffers and components for carrying out annealing and ligation of the adapter / adaptercombinations to a target RNA, and / or buffers and components for carrying out reversetranscription of the target RNA. As mentioned above, two different complexes of nanopore sequencing are described herein. The first complex is directed to the sequencing of a specific target RNA present in a sample. The target RNA is preferably a small (non-coding) RNA. This complex encompasses the first to tenth aspect of the present invention. The second complex is directed to the universalsequencing of (all) RNA molecules comprised in a sample. The RNA molecules are preferablysmall (non-coding) RNA molecules. This complex encompasses the eleventh to twenty-threeaspect of the present invention. In the following, the second complex is described: Thus, in a eleventh aspect, the present invention relates to a 5’adapter comprising in thefollowing order from 5’ to 3’:(i) a 5’terminal ribonucleotide sequence comprising 6 to 15 (e.g. 6, 7, 8, 9, 10, 11, 12, 13,14, or 15) ribonucleotides, wherein said 6 to 15 ribonucleotides are random ribonucleotides, and wherein optionally one or more (e.g. 1, 2, 4, or 5) of said 6 to 15 ribonucleotides are locked nucleotide- (LNA-) enhanced, and(ii) a ribonucleotide sequence capable of forming a stem-loop structure containing a loopand a double stranded stem. The 5’adapter is entirely novel and allows direct RNA sequencing of (all) RNA molecules, specifically non-coding small RNA molecules, present in a sample. The 5’adapter attaches via its 5’terminal ribonucleotide sequence comprising random ribonucleotides to RNAmolecules present in a sample.The locked nucleotides are specifically locked ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine, or LNA-cytosine. For example, every, every second, every third, or every fourth ribonucleotide of the 5’terminal ribonucleotide sequence is a locked ribonucleotide. The LNAs increase the affinity of the 5’adapter. The 5’adapter may range from 15 to 70, e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50,51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70, nucleotides inlength. The 5’adapter may be present as linear polynucleotide, particularly in single-strandedform, e.g. after denaturation / when denatured. The 5’adapter is a polynucleotide that can be attached / ligated to RNA molecules. When attached / ligated to RNA molecules, the 5’adapter has a stem-loop structure. The attachment / ligation is possible as the 5’adapter comprises between 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, ribonucleotides which are random ribonucleotides. In one embodiment, the ribonucleotide sequence capable of forming a stem-loopstructure of the 5’adapter comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. Thus, the 5’positioned first stem sequence and the 3’positioned second stem sequence can form the double stranded stem.The double stranded stem may have a length of between 5 and 20, e.g. 5, 6, 7, 8, 9, 10, 11, 12,13, 14, 15, 16, 17, 18, 19 or 20, ribonucleotides.Preferably, each one of the 5’positioned first stem sequence and the 3’positioned second stem sequence has a length of between 5 to 10, e.g.5, 6, 7, 8, 9, or 10, ribonucleotides. Particularly,the 5’positioned first stem sequence and the 3’positioned second stem sequence have the samelength, e.g. a length of 5, 6, 7, 8, 9, or 10 ribonucleotides. More preferably, the 5’positioned first stem sequence and / or the 3’positioned second stemsequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between2 to 5, e.g. 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Evenmore preferably, the 5’positioned first stem sequence is LNA enhanced. Particularly, the LNAenhanced sequence comprises between 2 to 5, e.g. 2, 3, 4, or 5, more particularly 3, lockednucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every thirdnucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the3’positioned second stem sequence. In one further embodiment, the nucleotide sequence capable of forming a stem-loopstructure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprisebetween 10 and 40, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, ribonucleotides. Preferably, the loop sequencecomprises between 12 and 22, e.g.12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22, ribonucleotides. In one another embodiment, the 5’-terminal sequence is configured such that it forms a single stranded 5’protrusion after formation of the stem-loop structure. In one more preferred embodiment, the 5’adapter comprises the following sequence from 5’ to 3’: (6- 15x)rNrCrGrUrGrGrCrGrUrGrGrArGrUrGrUrUrArArUrUrArArUrGrUrGrCrUrUrUrGrCrCrArUrG (SEQ ID NO: 6), wherein “r” stands for ribonucleotide, and wherein “(6-15x)rN”designates the random ribonucleotides, or is a variant of this sequence.The 5’adapter variant as described above has a sequence having at least 80%, preferably 85%,more preferably 90%, even more preferably 95%, and still even more preferably 99%, e.g.80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 1. Such a 5’adapter variant still comprisesribonucleotides. In addition, such a 5’adapter variant is still capable of forming a stem-loopstructure containing a loop and a double stranded stem. The skilled person can readily assess whether a 5’adapter variant is still capable of forming a stem-loop structure containing a loop and a double stranded stem. For example, the experimental section provides sufficient information in this respect. Specifically, the 5’adapter allows (direct) nanopore sequencing of RNA molecules viathe Oxford Nanopore Technology (ONT) platform. In a twelfth aspect, the invention relates to a 3’adapter combination comprising (i) a firstoligonucleotide and (ii) a second oligonucleotide, wherein(i) the first oligonucleotide comprises in the following order from 5’ to 3’:(a) a ribonucleotide sequence comprising between 4 and 8 (e.g. 4, 5, 6, 7, or 8)ribonucleotides, wherein the 5’terminal ribonucleotide is phosphorylated, which sequence is reverse complementary to a corresponding sequence in the second oligonucleotide, (b) a poly(A) segment comprising between 8 and 12 (e.g. 8, 9, 10, 11, or 12)adenosine ribonucleotides, (c) a deoxynucleotide spacer sequence comprising between 2 and 5 (e.g. 2, 3, 4, or5) fixed deoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 8 and 12 (e.g. 8, 9, 10, 11, or 12) fixeddeoxynucleotides, all of which are reverse complementary to a corresponding sequence in the second oligonucleotide, and(d) a 3’overhanging deoxynucleotide sequence comprising between 8 and 12 (e.g.8, 9, 10, 11, or 12) deoxynucleotides which is capable of complexing with / ligating to a first element allowing nanopore sequencing of RNA molecules, and,(ii) the second oligonucleotide comprises in the following order from 5’ to 3’:(a) a 5’overhanging deoxynucleotide sequence comprising between 15 and 25 (e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) deoxynucleotides which is capable of complexing with / ligating to a second element allowing nanopore sequencing of RNA molecules, (b) a deoxynucleotide spacer sequence comprising between 8 and 12 (e.g. 8, 9, 10,11, or 12) fixed deoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 2 and 5 (e.g. 2, 3, 4, or 5) fixed deoxynucleotides, all of which are reverse complementary to a correspondingsequence in the first oligonucleotide,(c) a poly(T) segment comprising between 8 and 12 (e.g. 8, 9, 10, 11, or 12)thymidine deoxynucleotides, (d) a deoxynucleotide sequence comprising between 4 and 8 (e.g. 4, 5, 6, 7, or 8)deoxynucleotides which is reverse complementary to a corresponding sequence in the first oligonucleotide, and(e) a 3’overhanging deoxynucleotide sequence comprising 6 to 15 (e.g. 6, 7, 8, 9,10, 11, 12, 13, 14, or 15) deoxynucleotides, wherein said 6 to 15 deoxynucleotides are random deoxynucleotides, and wherein optionally one or more (e.g. 1, 2, 3, 4, or 5) of said 6 to 15 deoxynucleotides are locked nucleotide-(LNA-) enhanced. The 3’adapter combination is entirely novel and allows RNA molecule, specificallynon-coding small RNA molecule, sequencing, e.g. of all RNA molecules present in a sample.The second oligonucleotide of the 3’adapter combination attaches via its 3’overhangingdeoxynucleotide sequence comprising random deoxynucleotides to RNA molecules present ina sample. The 3’adpater combination is, in its renatured / hybridized state, a RNA / DNA hybridpolynucleotide. The inclusion of the RNA poly(A) / RNA poly(T) allows improved data processing, including segmentation and basecalling. The optional barcode deoxynucleotidesenable multiplexed sequencing. They can also be designated as DNA barcode sequence. The locked nucleotides are specifically locked deoxynucleotides. Examples of locked deoxynucleotides are LNA-guanine, LNA-thymidine, LNA-adenosine, or LNA-cytosine. For example, every, every second, every third, or every fourth nucleotide of the 3’overhanging nucleotide sequence is a locked deoxynucleotide. The LNAs increase annealing and ligation efficiency of the 3’adapter combination to RNA molecules. Thus, the 3’adapter combination comprises two oligonucleotides, a first oligonucleotideand a second oligonucleotide. In general, the oligonucleotides of the 3’adapter combinationmay range from 15 to 80, e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80,nucleotides in length. The second oligonucleotide of the two oligonucleotides can be attached / ligated to RNA molecules. This is possible as it comprises random deoxynucleotides. The two oligonucleotides of the 3’adapter combination can be present as linearoligonucleotides, e.g. after denaturation / when denatured. In this form, the 3’adapter combination is single-stranded. This primary structure may be converted into a secondarystructure. Specifically, the first and second oligonucleotides of the 3’adapter combination arecapable of forming a hybrid (double-stranded) structure via their reverse complementarysequences. Thus, the 3’adapter combination can also have a hybrid (double-stranded) structure,e.g. after re-naturation / when re-natured. Particularly, when the second oligonucleotide of the3’adapter combination is attached / ligated to a RNA molecule, the 3’adapter combination has a hybrid (double-stranded) structure. In one preferred embodiment, the 3’overhanging deoxynucleotide sequence comprising between 8 and 12 (e.g. 8, 9, 10, 11,or 12) deoxynucleotides in (i)(d) is reverse complement to a corresponding 5’overhangsequence on a nanopore sequencing compatible motor protein / adapter complex, and / orthe 5’overhanging deoxynucleotide sequence comprising between 15 and 25 (e.g. 15, 16, 17,18, 19, 20, 21, 22, 23, 24, or 25) deoxynucleotides in (ii)(a) is reverse complement to a tetheroligonucleotide that concentrates the RNA molecules, specifically a RNA library or a RNA / cDNA duplex library made therefrom (see aspects below), at the membrane surface of a nanopore flow cell.In one particularly preferred embodiment,the first element allowing nanopore sequencing of RNA molecules is a 5’overhang sequenceon a nanopore sequencing compatible motor protein / adapter complex, and / orthe second element allowing nanopore sequencing of RNA molecules is a tether oligonucleotidethat concentrates the RNA molecules, specifically a RNA library or a RNA / cDNA duplexlibrary made therefrom (see aspects below), at the membrane surface of a nanopore flow cell.Specifically, the 3’adapter combination allows (direct) nanopore sequencing of RNAmolecules via the Oxford Nanopore Technology (ONT) platform.In one more preferred embodiment, the first oligonucleotide of the 3’adaptercombination comprises the following sequence from 5’ to 3’: / 5Phos / rUrArGrCrUrC(8-12x)rAGGNNNNNNNNNNCTTGCTCTTAGGTAGTAGGTTC (SEQ ID NO: 2), wherein “r”stands for ribonucleotide, “ / 5Phos / ” indicates that the 5’-terminal ribonucleotide isphosphorylated, “(8-12x)rA” stands for the poly(A) segment, the deoxynucleotide spacersequence is underlined, and the optional barcode (N) is highlighted in bold, oris a variant of this sequence. The first oligonucleotide variant as described above has a sequence having at least 80%,preferably 85%, more preferably 90%, even more preferably 95%, and still even more preferably 99%, e.g.80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 2. Such a first oligonucleotidevariant still comprises the phosphorylated 5’-terminal ribonucleotide. Further, ribonucleotidesin the first oligonucleotide are also ribonucleotides in the first oligonucleotide variant.Furthermore, the number of the fixed nucleotides in the first oligonucleotide is not amended inthe first oligonucleotide variant. In addition, the poly(A) segment and / or the 3’overhangingdeoxynucleotide sequence comprising between 8 and 12 (e.g. 8, 9, 10, 11, or 12) deoxynucleotides in (i)(d) which is reverse complement to a corresponding 5’overhangsequence on a nanopore sequencing compatible motor protein / adapter complex remainunchanged in the first oligonucleotide variant.Moreover, such a first oligonucleotide variant is still capable of forming a hybrid structure withthe second oligonucleotide. Thus, amendments in the first oligonucleotide should also be included (in reverse complementary way) in the second oligonucleotide. The skilled person can readily assess whether the formation of a hybrid structure is still possible. For example, the experimental section provides sufficient information in this respect. In one particularly more preferred embodiment, the first oligonucleotide of the 3’adapter combination comprises the following sequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGNNNNNNNNNNCTTGCTCTTAGGTAGTAGGTTC (SEQ ID NO: 3), or is a variant of this sequence. As to the variant language, it is referred to the above explanations. In one another more preferred embodiment, the second oligonucleotide of the 3’adapter combination comprises the following sequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGNNNNNNNNNNCC(8-12x)TGAGCTA(6-15x)N (SEQ ID NO: 7), wherein the deoxynucleotide spacer sequence isunderlined, the optional barcode (N) is highlighted in bold, “(8-12x)T” stands for the poly(T)segment, and “(6-15x)N” designates the random deoxynucleotides, or is a variant of this sequence. The second oligonucleotide variant as described above has a sequence having at least80%, preferably 85%, more preferably 90%, even more preferably 95%, and still even more preferably 99%, e.g.80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 4.Such a second oligonucleotide variant still comprises deoxynucleotides at positions wheredeoxynucleotides were previously present. Further, the number of the fixed nucleotides in thesecond oligonucleotide is not amended in the second oligonucleotide variant. In addition, thepoly(T) segment and / or the 5’overhanging deoxynucleotide sequence comprising between 15and 25 (e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) deoxynucleotides in (ii)(a) which is reverse complement to a tether oligonucleotide that concentrates the RNA molecules, specifically a RNA library or a RNA / cDNA duplex library made therefrom, at the membranesurface of a nanopore flow cell remain unchanged in the second oligonucleotide variant.Moreover, such a second oligonucleotide variant is still capable of forming a hybrid structurewith the first oligonucleotide. Thus, amendments in the second oligonucleotide should also be included (in reverse complementary way) in the first oligonucleotide. The skilled person can readily assess whether the formation of a hybrid structure is still possible. For example, the experimental section provides sufficient information in this respect. In one particularly more preferred embodiment, the second oligonucleotide of the 3’adapter combination comprises the following sequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGNNNNNNNNNNCCTTTTTTTTTTGAGCTA(6-15x)N (SEQ ID NO: 8), oris a variant of this sequence. As to the variant language it is referred to the above explanations.In a thirteenth aspect, the present invention relates to a set comprising at least two5’adapters of the eleventh aspect, wherein said at least two 5’adapters differ in the sequence oftheir 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, random ribonucleotides. At least two, e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500, 5’adapters which differ in the sequence of their 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, random ribonucleotides are required to finally establish a RNA library or RNA / cDNA duplex library of RNA molecules comprised in a sample, e.g. biological sample. In a fourteenth aspect, the present invention relates to a set comprising at least two3’adapter combinations of the twelfth aspect, wherein said second oligonucleotides differ in thesequence of their 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, random deoxynucleotides.At least two, e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500,3’adapter combinations, wherein the second oligonucleotides differ in the sequence of their 6to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, random deoxynucleotides are required to finallyestablish a RNA library or RNA / cDNA duplex library of RNA molecules comprised in asample, e.g. biological sample. Alternatively, the set comprises a first oligonucleotide and at least two, e.g.2, 3, 4, 5, 6, 7, 8, 9,10, 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500, second oligonucleotides which differ inthe sequence of their 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, random deoxynucleotides.Reason for this is that only the second oligonucleotide of the 3’adapter combination comprisesrandom deoxynucleotides to catch RNA molecules. In a fifteenth aspect, the present invention relates to an adapter system comprisingthe set comprising at least two 5’adapters of the thirteenth aspect, andthe set comprising at least two 3’adapter combinations of the fourteenth aspect.The 5’adapters of the set of the thirteenth aspect and the 3’adapter combinations of theset of the fourteenth aspect may be present in the adapter system individually or together. Forexample, the 5’adapters of the set of the thirteenth aspect may be comprised in a (first)composition and the 3’adapter combinations of the set of the fourteenth aspect may becomprised in another / different (second) composition. Alternatively, the 5’adapters of the set ofthe thirteenth aspect and the 3’adapter combinations of the set of the fourteenth aspect may becomprised in a single composition. The composition may be an aqueous solution such as water or a buffer solution. In a sixteenth aspect, the present invention relates to a method of ligating adapters andadapter combinations to RNA molecules in a sample comprising the steps of:(i) providing a composition comprising denatured RNA molecules in a sample, the setcomprising at least two 5’adapters of the thirteenth aspect, wherein said adapters havebeen renatured, and the set comprising at least two 3’adapter combinations of the fourteenth aspect, wherein said adapter combinations have been renatured, wherein the5’adapters and the 3’adapters are annealed to the RNA molecules, and(ii) ligating the 5’adapters and the 3’adapter combinations to the RNA molecules using / witha double stranded RNA ligase, thereby producing ligation products. The annealing of the 5’adapter and 3’adapter combination to the RNA moleculescomprised in a sample requires that the RNA molecules are present in denatured form. In oneembodiment, the denatured RNA molecules are produced by heating the RNA molecules atbetween 65°C and 75°C, e.g.65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or 75°C, preferably at 70°C, for between 1 to 3 minutes, e.g.1, 2, or 3, minutes, preferably for 2 minutes.It is preferred that the RNA molecules are immediately placed on ice after denaturation.For the denaturation step, the RNA molecules are preferably given to an aqueous solution, e.g.water, or to a buffer solution. The RNA molecules may, after their denaturation, treated with a Polynucleotide Kinase (PNK) which 5’phosphorylates RNA to enable ligation to the 3’ OH group at the 3’ end of the 5’ adapter. This PNK treatment is required for small RNAs that may not contain a 5’ phosphate such as for example fragments of rRNA or tRNA. As to the 5’adapter, a denaturation and a renaturation step is required so that the adaptercan form a stem-loop structure which allows annealing to the RNA molecules. As to the3’adapter combination, a denaturation and a renaturation step is required so that the adaptercombination can form a hybrid structure which allows annealing to the RNA molecules.Annealing is a process of heating and cooling adapter / adapter combination withcomplementary sequences. Heat breaks all hydrogen bonds and cooling allows new bonds toform between the sequences. During this process, the adapter / adapter combination attaches tothe denatured RNA molecules and forms their characteristic stem-loop structure / hybridstructure. In particular, the 5’adapter attaches via its 5’terminal ribonucleotide sequencecomprising random ribonucleotides to the RNA molecules and the second oligonucleotide ofthe 3’adapter combination attaches via its 3’overhanging deoxynucleotide sequence comprisingrandom deoxynucleotides to the RNA molecules. It is preferred that the adapter and adaptercombination are denatured and renatured together, i.e. in a common reaction vessel. It is furtherpreferred that the denaturation / renaturation of the adapter and adapter combination takes placeseparately and in the absence of the RNA molecules. In one embodiment, the renatured 5’adapter is produced by denaturing the 5’adapter at between 75°C and 85°C, e.g. 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or 85°C, preferably at 82°C, for between 1 to 3 minutes, e.g.1, 2, or 3 minutes, preferably for 2 minutes, and renaturing the 5’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s. In one additional or alternative embodiment, the renatured 3’adapter combination is produced by denaturing the 3’adapter combination at between 75°C and 85°C, e.g.75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or 85°C, preferably at 82°C, for between 1 to 3 minutes, e.g.1, 2, or 3 minutes,preferably for 2 minutes, andrenaturing the 3’adapter combination by cooling down to 4°C, preferably at a rate of 0.1°C / s.For the denaturation and renaturation step, the 5’adapter and 3’adapter combination arepreferably given to an aqueous buffer comprising 10 mM TRIS HCl pH 7.5, 50 mM NaCl. Inother words, the denaturing and renaturing of the 5’adapter and 3’adapter combination ispreferably carried out in an aqueous buffer comprising 10 mM TRIS HCl pH 7.5, 50 mM NaCl.The composition provided in step (i) of the above method is specifically produced by mixing the denatured RNA molecules, the set comprising at least two 5’adapters of the thirteenth aspect, wherein said adapters have been renatured, and the set comprising at least two 3’adaptercombinations of the fourteenth aspect, wherein said adapter combinations have been renatured,with each other, thereby annealing the renatured 5’adapters and the renatured 3’adaptercombinations to the RNA molecules.The annealing of the 5’adapter with the RNA molecules particularly generates a double-stranded (DNA / RNA) hybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of the adapter and the 5’end of the RNA molecules. This is an efficient substrate for ligation bya double stranded RNA ligase. In addition, the annealing of the second oligonucleotide of the3’adpater combination with the RNA molecules particularly generates a double-stranded(DNA / RNA) hybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of theRNA molecules and the 5’end of the second oligonucleotide of the 3’adapter combination. Thisis a substrate for ligation by a double stranded RNA ligase. The ligation is usually carried out in a ligation buffer. An exemplarily ligation buffers is described in the experimental section of the present patent application. In one preferred embodiment, the ligation buffer comprises polyethylene glycol (PEG), e.g. PEG 8000 (5%), and / or adenosine triphosphate (ATP), e.g. 1 mM ATP. The present inventors have noted that PEG had the effect on the ligation reaction such that it functions as molecular crowding agent and / or ATP had the effect on the ligation reaction such that increased concentrations facilitate the ligation reactions. In one embodiment, the ligation is carried out between 36°C and 38°C, e.g. 36, 37, or 38°C, preferably at 37°C, for between 30 minutes and 1.5 hours, e.g.30, 35, 40, 45, 50, 55 minutes, 1, 1.25, or 1.5 hour(s), preferably for 1 hour, then at between 14°C and 18°C, e.g.14, 15, 16, 17, or 18°C, preferably at 16°C, for between 1.5 hours and 2.5 hours, e.g.1.5, 2, or 2.5 hours, preferably for 2 hours, and at 12°C overnight. The double stranded RNA ligase can be any ligase capable of ligating double stranded RNA nicks / RNA structures. Preferably, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2) or a Kod1 ligase. In this respect, it should be noted that only a perfectly hybridized molecule provides a substrate for the double stranded RNA ligase, in particular Rnl2. Also, in case of protrusion ofeither strand or a gap that is 2 nucleotides or longer, the Rnl2 will ligate the molecule with muchlower efficiency. By ligating the 5’adapter and 3’adapter combination to the RNA molecule using / with adouble stranded RNA ligase, a ligation product is produced. The ligation product can be described as a hybrid molecule comprising at least one adapter / adapter combination and a RNA molecule. For example, the ligation product may comprise a 5’adapter and a RNA molecule such as miRNA or isomiR. The ligation product may comprise a 3’adapter combination and aRNA molecule such as miRNA or isomiR. In addition, the ligation produced may comprise a5’adapter, a 3’adapter combination and a RNA molecule such as miRNA or isomiR.In a seventeenth aspect, the present invention relates to a method of producing a RNAlibrary from RNA molecules in a sample comprising the step of:(i) carrying out the method of the sixteenth aspect.In an eighteenth aspect, the present invention relates to a RNA library from RNAmolecules in a sample obtained by the method of the seventeenth aspect.The RNA library contains the entire spectrum of RNA types, specifically small non- coding RNA types, present in a sample, e.g. biological sample. In a nineteenth aspect, the present invention relates to a method of producing aRNA / cDNA duplex library from RNA molecules in a sample comprising the steps of:(i) carrying out the method of the sixteenth aspect, and(ii) reverse transcribing the ligation products, thereby obtaining RNA / cDNA duplexes.Particularly, the reverse transcription of the ligation products is carried out by reversetranscribing the ligation products using a reverse transcriptase (RT). Usually, the reversetranscriptase (RT) uses a RT primer. However, in the context of the present invention, the reverse transcriptase (RT) uses the second oligonucleotide of the 3’adapter combination as aself-primer to extend. The reverse transcriptase (RT) may be a SuperScript III RT, Maxima H-RT or Tth polymerase. Preferably, said reverse transcribing is carried out at between 45°C and60°C, e.g.45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60°C, preferably at 50°C, for between 40 and 60 minutes, e.g.40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55,56, 57, 58, 59, or 60 minutes, preferably for 50 minutes, then at between 60°C and 80°C, e.g.60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80°C, preferably at 70°C, for between 8 and 15 minutes, e.g.8, 9, 10, 11, 12, 13, 14, or 15 minutes, preferably for 10 minutes, before finally cooling down to 4°C. The result of the reverse transcription reaction is the formation of RNA / cDNA duplex. This duplex is composed of a top strand comprising the 5’ adapter, small RNA insert(s), and the first oligonucleotide of the 3’ adapter, and a bottom strand comprising the second oligonucleotide of the 3’ adapter that has been extended as cDNA by reverse transcription. In an twentieth aspect, the present invention relates to a RNA / cDNA duplex library fromRNA molecules in a sample obtained by the method of the nineteenth aspect.The RNA / cDNA duplex library contains the entire spectrum of RNA types, specifically small non-coding RNA types, present in a sample, e.g. biological sample. In a twenty-one aspect, the present invention relates to a method of determining a profileof RNA molecules in a sample comprising the step of:(i) nanopore sequencing the RNA library from RNA molecules in a sample produced bythe method of the seventeenth aspect or nanopore sequencing the RNA / cDNA duplex library from RNA molecules in a sample produced by the method of nineteenth aspect.The sequencing of (all) RNA molecules present in a sample, e.g. biological sample, can be designated as universal RNA sequencing. Nanopore sequencing requires flow cells. Flow cells contain an array of tiny holes -nanopores - embedded in an electro-resistant membrane. The nanopore sequencing reactionparticularly further requires / comprises the addition of a structure allowing nanoporesequencing.Specifically, the structure allowing nanopore sequencing is composed of(i) a first element, and(ii) a second element.More specifically,(i) the first element is a 5’overhang sequence on a nanopore sequencing compatible motorprotein / adapter complex, and(ii) the second element is a tether oligonucleotide that concentrates the RNA library (in caseno reverse transcription is carried out) or the RNA / cDNA duplex library (in case reverse transcription is carried out) at the membrane surface of a nanopore flow cell. The 5’overhang sequence on a nanopore sequencing compatible motor protein / adapter complex, thus, established the connection / contact of the 5’adapter / 3’adapter combinationcomplex carrying the RNA molecule to be sequenced and the motor protein / adapter complex.Even more specifically,(i) the first element recognizes the reverse complementary 3’overhanging deoxynucleotidesequence of the first oligonucleotide of the 3’adapter combination of the second aspect,to which it anneals and is ligated to, to enable nanopore sequencing, and(ii) the second element recognizes the reverse complementary 5’overhangingdeoxynucleotide sequence of the second oligonucleotide of the 3’adapter combinationof the second aspect, to which it anneals and is ligated to, to enable nanopore sequencing. Thus, the nanopore sequencing system uses, in addition to flow cells includingnanopores and an electro-resistant membrane, a nanopore adapter / motor protein complex anda tether oligonucleotide. The nanopore adapter is required for attaching the RNA molecules tobe sequenced, specifically the RNA library or the RNA / cDNA duplex library, to the nanopore.In addition, the motor protein is required for directing the RNA molecules to be sequencethrough the nanopore in order to allow sequencing. Specifically, the motor protein controlstranslocation of the RNA molecule strand through the nanopore. Once the RNA molecule haspassed thought, the motor protein detaches and the nanopore is ready to accept the next RNAmolecule. The tether oligonucleotide has the function of concentrating the RNA moleculeswhich are to be sequenced at the membrane surface of a nanopore flow cell. An electricallyresistant membrane means that all current must pass through the nanopore to ensure a cleansignal. The final sequencing of the RNA molecules is possible as, when the RNA moleculespass through the nano-scale hole, the current changes / fluctuates. This signal can be detectedand is converted to a nucleotide sequence by basecalling algorithms.Especially, the added structure allows (direct) nanopore sequencing of (all) RNAmolecules present in a sample via the Oxford Nanopore Technology (ONT) platform. The nanopore sequencing reaction preferably further allows the detection,characterization, and quantification of nucleotide modifications such as methylations. The nucleotide modifications are preferably selected from the group consisting of 2'-O-methylation, N6-methyladenosine (m6A), N6,2′-O-dimethyladenosine (m6Am), 8-oxo-7,8- dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5-methylcytidine (m5C), and N4-acetylcytidine (ac4C). The detection, characterization, and quantification of nucleotidemodifications is specifically carried out through analysis of the raw nanopore signal. Specific modifications will characteristically alter the current associated with a given nucleotide and enable their detection and quantification. In the methods according to the sixteenth, seventeenth, nineteenth, and / or twenty-one aspect of the present invention, the sample is preferably a biological sample. The biologicalsample may be any sample having a biological origin. For example, the biological sample maybe a body fluid sample, e.g. a blood sample or urine sample, or a tissue sample, e.g. a tissuebiopsy sample. Biological samples may be mixed or pooled, e.g. a sample may be a mixture of a blood sample and a urine sample.The body fluid sample may be a urine sample, blood sample, sputum sample, breast milksample, cerebrospinal fluid (CSF) sample, cerumen (earwax) sample, gastric juice sample, mucus sample, lymph sample, endolymph fluid sample, perilymph fluid sample, peritoneal fluid sample, pleural fluid sample, saliva sample, sebum (skin oil) sample, semen sample, sweat sample, tears sample, cheek swab, vaginal secretion sample, liquid biopsy, or vomit sample including components or fractions thereof. The term “body fluid sample” also encompasses body fluid fractions, e.g. blood fractions, urine fractions or sputum fractions. Body fluid samples may be mixed or pooled. Thus, a body fluid sample may be a mixture of a blood and a urine sample or a mixture of a blood and cerebrospinal fluid sample. More preferably, the biological sample is a blood sample. Even more preferably, the blood sample is a whole blood or a blood fraction, preferably blood cells (e.g. erythrocytes, leukocytes, and / or thrombocytes), serum, or plasma. For example, the blood cell fractionencompasses erythrocytes, leukocytes, and / or thrombocytes. The whole blood sample may becollected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA-tube, in a Na-citrate tube, Heparin-tube, or in a ACD-tube (Acid citrate dextrose). Alternatively, the whole blood sample may be collected in a blood collection tube containing cell-free nucleic acid stabilizing chemical agents, such as glutaraldehyde, formaldehyde, or similar (e.g. Streck cfRNA BCT tube, Streck cfDNA BCT tube), and others, or cellular crowding agents, such as polyethyleneglycol (PEG) (e.g.Norgen cfDNA / cfRNA preservation tube), and others. The whole blood sample may also becollected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. Thistechnique requires smaller sample volumes, typically 45-60 µl for humans or less. For example,the whole blood may be extracted from the patient via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need be taken in handling or shipping. Once at the analysis site, the desired components, e.g. miRNAs, are extracted from the dried blood spots into a supernatant which is then further analyzed. Specifically, the sample used in the methods according to the sixteenth, seventeenth,nineteenth, and / or twenty-one aspect of the present invention contains total RNA specificallycellular total RNA. Particularly, cellular total RNA includes RNA having a length of < 50 nucleotides such as a miRNA or a miRNA isoform (an isomiR). The cellular total RNA may be obtained from blood cells, e.g. erythrocytes, leukocytes, and / or thrombocytes. It is preferred that the RNA molecules are non-coding RNA molecules, specifically non-coding small RNA molecules. It is more preferred that the (non-coding) RNA molecules havea length of < 50 ribonucleotides, particularly a length of between 10 and < 50 ribonucleotides,e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 ribonucleotides. It iseven more preferred that the (non-coding) RNA molecules have a length of < 30ribonucleotides, particularly a length of between 10 and < 30 ribonucleotides, e.g. a length of10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 ribonucleotides.The (non-coding) RNA molecules, specifically (non-coding) small RNA molecules, may bemiRNAs, piRNAs, siRNAs, or fragments of longer RNAs, preferably rRNA or tRNA fragments. In a twenty-two aspect, the present invention relates to a kit comprisingthe set comprising at least two 5’adapters of the thirteenth aspect, andthe set comprising at least two 3’adapter combinations of the fourteenth aspect, orthe adapter system of the fifteenth aspect. Preferably, the kit further comprises(i) a double stranded RNA ligase, more preferably a T4 RNA ligase 2 (Rnl2) or a Kod1ligase,(ii) a reverse transcriptase (RT), more preferably SuperScript III RT, Maxima H-RT or Tthpolymerase, and / or(iii) a structure allowing nanopore sequencing. It should be noted that the kit allows to conduct the methods of the sixteenth, seventeenth, nineteenth, and / or twenty-one aspect of the present invention. The kit may further comprise(i) one or more containers for the different components of the kit, and / or(ii) a data carrier.Said data carrier may be a non-electronical data carrier, e.g. a graphical data carrier such as an information leaflet, an information sheet, a bar code or an access code, or an electronical data carrier such as a floppy disk, a compact disk (CD), a digital versatile disk (DVD), a microchip or another semiconductor-based electronical data carrier. The access code may allow the access to a database, e.g. an internet database, a centralized, or a decentralized database. The accesscode may also allow access to an application software that causes a computer to perform tasksfor computer users or a mobile app which is a software designed to run on smartphones and other mobile devices. Said data carrier may comprise information or instructions on how to carry out the methods ofthe sixteenth, seventeenth, nineteenth, and / or twenty-one aspect of the present invention.Said kit may also comprise materials desirable from a commercial and user standpointincluding a buffer(s), a reagent(s) and / or a diluent(s) which might be possible to carry out themethods of the sixteenth, seventeenth, nineteenth, and / or twenty-one aspect of the presentinvention. In particular, the kit may also comprise buffers and components for carrying out annealing and ligation of the adapter / adapter combinations to RNA molecules, and / or buffers and components for carrying out reverse transcription of the RNA molecules. In a twenty-third aspect, the present invention relates to the use of the the set comprisingat least two 5’adapters of the thirteenth aspect, and the set comprising at least two 3’adaptercombinations of the fourteenth aspect, or the adapter system of the fifteenth aspect for thegeneration of a library of RNA molecules. Preferably, the library of RNA molecules is a RNAlibrary or a RNA / cDNA duplex library.Various modifications and variations of the invention will be apparent to those skilled in the art without departing from the scope of invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art in the relevant fields are intended to be covered by the present invention. BRIEF DESCRIPTION OF THE FIGURES The following Figures are merely illustrative of the present invention and should not be construed to limit the scope of the invention as indicated by the appended claims in any way. Figure 1: Shows the principle of nanopore sequencing on the platform of OxfordNanopore Technologies (ONT). A MinION flow cell contains 512 channels with 4 nanopores in each channel, for a total of 2,048 nanopores used to sequence DNA or RNA. The wells are inserted into an electrically resistant polymer membrane supported by an array of microscaffolds connected to a sensor chip. Each channel associates with a separate electrode in the sensor chip and is controlled and measured individually by the application-specific integration circuit (ASIC). Ionic current passes through the nanopore because a constant voltage is applied across the membrane, where the trans side is positively charged. Under the control of a motor protein, a double-stranded DNA (dsDNA) molecule (or an RNA–DNA hybrid duplex) is first unwound, then single-stranded DNA or RNA with negative charge is ratcheted through the nanopore, driven by the voltage. As nucleotides pass through the nanopore, a characteristic current change is measured and is used to determine the corresponding nucleotide type at ~450 bases per s (R9.4 nanopore). Figure 2: Shows a schematic diagram of the library preparation for small RNA directRNA sequencing on the ONT platform of the present invention. Ligation of both a structured 5’ adapter, and 3’ adapter in the 1ststep, enclose the small RNA in adapter sequence and enable accurate sequencing and RNA modification detection and quantification. Figure 3: Schematic diagram of the training and inference process for barcode demultiplexing and RNA modification quantification with Nano-smallRNAseq. Figure 4: Shows a schematic structure of a 5’adapter of the present invention.Figure 5: Shows a schematic structure of a 3’adapter combination of the presentinvention. Figure 6: Shows in a. A confusion matrix which reveals high accuracy of the milung#1RNA modification classifier to detect methylation patterns in single RNA molecules. b.Alignment visualisation of milung#1 containing Nano-smallRNAseq library against theexpected library sequence, revealing full coverage of insert region. c. Quantitification ofmilung#1 modification status in wild type and mutant HCC cell lines reveals the expected lowlevels of GmCm and GmC in the SNORD102 mutant, and low levels of GmCm and GCm inthe SNORD75 mutant. milung#1 is a rRNA fragment having the sequence GCCGCCGGTGAAATACCACTAC (SEQ ID NO: 9). It is known to be modified with 2'-0-methylation at two distinct sites (G7 and C19).Figure 7: Shows a confusion matrix which reveals high accuracy of barcodeclassification, enabling multiplexed direct RNA sequencing of small RNAs on the ONTplatform. Figure 8: Shows that GmCm (Gm4020Cm4032) methylation in milung#1 is diagnosticfor lung cancer. The methylation proportion of GmCm (Gm4020Cm4032) in milung#1 issignificantly increased in plasma cell-free RNA (cfRNA) samples from lung cancer patientscompared to healthy controls (p = 1.36e-4). Figure 9: Shows a diagnostic ROC curve based on the methylation proportion ofGmCm (Gm4020Cm4032) in milung#1 within plasma cell-free RNA (cfRNA) samples (ROCAUC = 0.84). EXAMPLES The examples given below are for illustrative purposes only and do not limit theinvention described above in any way. 1. Design of the 5’adapter and 3’adapter combination of the present invention Nanopore sequencing is usually performed as shown in Figure 1. The Nano-smallRNAseq method described by the present inventors contains several innovativecontributions that lower the limit of the shortest RNAs that can be sequenced on the ONTplatform (~20 nucleotides) and permit the generation of sequencing libraries containing theentire spectrum of small RNA types in an unbiased or sequence specific manner (see Figure 2). Critical, is the use of a structured dumbbell 5’adapter that is ligated to the 5’end of the small RNA and enables the extension of the 5’end of the direct RNA sequencing library so as to enable accurate nanopore sequencing of the full length small RNA insert (see Figure 4). The structured dumbbell 5’ adapter is engineered with a 3’overhang either complementary to a given target (for targeted sequencing) or with random nucleotides (for universal small RNA sequencing). The overhang region may also contain LNA modified nucleotides to improveaffinity to small RNAs and, therefore, ligation efficiency. The structured stem is also essentialto impart structural specificity such that the adapter will only ligate to the free 5’end of a small RNA and not internally within a longer sequence. The 3’adapter combination has also undergone modifications compared to the ONT 3’adapter (Figure 5). These include the addition of LNA modified nucleotides to the overhang of the second oligonucleotide of the 3’adapter combination, designed to capture the insert RNA with greater affinity. A poly(A) RNA tract has also been inserted into the first oligonucleotideand a poly(T) RNA tract has also been inserted into the second oligonucleotide of the 3’adaptercombination to improve the data segmentation and basecalling for insert RNAs that lack apoly(A) tail, such as small RNAs. Finally, a DNA barcode is encoded within the 3’adaptercombination to enable multiplexed direct RNA sequencing on the ONT platform.2. Direct RNA sequencing protocol with the 5’adapter and 3’adapter combination of the present invention Follow ONT instructions for Direct RNA sequencing protocol with the following key modifications: 1. RNA PNK pre-treatment.1.1.In a 0.2 ml PCR tube, prepare a maximum of 1 mg of total RNA and adjust the volume to 16 μl with Nuclease-free Water.1.2.Place the tube in a thermal cycler and incubate at 70°C for 2 min. Immediately place on ice. 1.3.In a new 0.2 ml PCR tube add 15.6 μl denatured RNA from the previous stepand the following reagents: Denatured RNA 15.6 μlT4 PNK Reaction Buffer (10X) 2 μlATP (100 mM) 2 μlT4 PNK (10 units) 0.4 μlTotal 20 μl1.4.Place the tube(s) in a thermal cycler and incubate at 37°C for 30 min. Heat inactivate by incubating at 65°C for 20 minutes. Immediately place on ice. 2. Preparing 5’ and 3’ adapters for RNA ligation:2.1.Prepare the Annealing buffer (10 mM Tris-HCl pH 7.5, 50 mM NaCl).Prepare the 3’ adapter by annealing 1.4 µM Oligo A and Oligo B in a 1:1 ratioin Annealing buffer.Resuspend and dilute the 5’ adapter in Annealing buffer to result in a 2.5 μMworking concentration. Place the 3’ adapter and the 5’ adapter in the thermal cycler and incubate at 82°C for 2 min followed by a ramp down 0.1°C / sec to 4°C. Store in -20°C.NA Ligation:Mix by pipetting the following reagents together to make the RNA ligation master mix: 5’ adapter (2.5 μM) 2 μlPEG8000 (50%) 2 μl10x RNA ligation buffer 2 μlT4 Rnl2 (10 U / μl) 1 μlATP 10mM 2 μlTotal 10 μlIf preparing more than one sample (for multiplexing), mix in different 0.2 mlPCR tubes 10 μl of the previous Master mix, 9 μl PNK treated RNA and 1 μlof the corresponding barcoded 3’ adapter (1.4 μM). Mix by pipetting.Place the tube(s) in a thermal cycler and incubate at 37°C for 60 min and the lid heated at 45°C, then at 16°C for 2 h and 12°C overnight. Heat inactivate the T4 Rnl2 at 80°C for 5 minutes.e Transcription:Use the 20 μl of the previous adapter-ligated RNA to continue with the Reverse transcription: Ligation product (previous step) 20 μlNuclease-free water 4 μl5x first-strand buffer 8 μldNTPs, 10mM 2 μlDTT, 0.1 M 4 μlSuperScript III (reverse transcriptase) 2 μlTotal 40 μl4.2. Place the tube(s) in a thermal cycler and incubate at 50°C for 50 min, then at70°C for 10 min and 4°C until the next step. beads clean-up with Agencourt RNAClean XPTransfer the product to a 1.5 ml Eppendorf DNA LoBind tube.Resuspend the stock of beads by vortexing.Adjust the ratio beads:RNA to 2x (example: for 40 µl of reverse transcriptionreaction, add 80 µl of resuspended beads) and mix by pipetting.Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.Prepare 500 µl of fresh 70%.Spin down the sample and pellet on a magnet.Wait until the supernatant is transparent (approx. 7-10 min) and pipette it off.Keep the tube on magnet and add 200 µl of 70% ethanol without disturbing the pellet.Keep the magnetic rack on the bench, rotate the bead-containing tube by 180°.Wait for the beads to migrate and then rotate the tube back to the starting position.Wait for the beads to migrate back and remove the ethanol.Spin down and place the tubes back on the magnet. Pipette off any residual ethanol.Remove the tube from the magnetic rack and resuspend the pellet in 21 µl ofNuclease-free water.Incubate 5 minutes at room temperature.Pellet the beads on a magnet until eluate is clear and colorless.Pipette 20 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.ond RNA Ligation: RNA Adapters (RMX):d the next reagents in the following order:Clean cDNA 20 µlNEBNext Quick Ligation Reaction Buffer 8 µlRNA Adapter (RMX) 6 µlNuclease-free water 3 µlT4 DNA Ligase 3 µlTotal 40µl6.2. Incubate the reaction for 10 to 20 minutes at room temperature.7. 2nd beads clean-up with Agencourt RNAClean XP7.1. Resuspend the stock of beads by vortexing7.2. Adjust the ratio beads:RNA to 0.4x (example: for 40 µl of ligation product, add 16µl of resuspended beads) and mix by pipetting.7.3. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.7.4. Spin down the sample and pellet on a magnet.7.5. Wait until the supernatant is transparent (approx. 7-10 min) and pipette it off7.6. Keep the tube on magnet and add 150 µl of Wash Buffer (WSB) to the beads.7.7. Close the tube lid and resuspend by flicking the tube.7.8. Short spin and return the tube to the magnetic rack.7.9. Wait for the beads to migrate and pipette off the supernatant.7.10. Repeat the previous step.7.11. Remove the tube from the magnetic rack.7.12. Resuspend the pellet in 23 µl of Elution Buffer (EB) by the gentle flicking the tube.7.13. Incubate 10 minutes at room temperature.7.14. Pellet the beads on a magnet until eluate is clear and colorless.7.15. Pipette 20 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.The reverse-transcribed and adapted RNA is now ready for loading into the flow cell.8. Data analysis and bioinformatics: Following the flowchart detailed in Figure 3.8.1. Raw data in the fast5 format is 1st basecalled with Guppy Basecalling Software(Version 6.5.7+ca6d6a) provided by Oxford Nanopore and the Nova lab rna_r9.4.1_70bps_sup model (Cruciani et al, 2023). 8.2. Reads with PHRED ≤ 7 are removed.8.3. Reads are mapped to the target library with Burrows-Wheeler Aligner (BWA) and onlyretained if they map to both target insert sequence and the 5’ adapter. 8.4. Reads are segmented into a 5’ RNA portion (containing target small RNA) and a 3’DNA portion (containing 3’ adapter and barcode) using a dynamic programming point detection approach (Truong et al, 2020). 8.5. Both segments are normalized by Median Absolute Deviation (MAD).8.6. Both segments are scaled to a fixed length of 5000.8.7. Outliers (defined as + / - 3 standard deviations) are clipped.8.8. The processed data is passed to two different trained neural networks:8.8.1.An insert model trained with ground truth data for all possible modifications classes of the target small RNA insert. 8.8.2.A barcode model trained with ground truth data for all possible barcodes. 8.9. The predictions are combined to calculate the number of target modification classes aredetected per barcode. 3. Detection and quantification of RNA modifications With the newfound ability to directly sequence small RNAs on the ONT platform,methods for the accurate detection and quantification of RNA modifications have beendeveloped. As a proof of principle, the reported lung cancer biomarker, the rRNA fragment miLung#1 (GCCGCCGGTGAAATACCACTAC, SEQ ID NO: 9), which is known to be modified with 2'-O-methylation at two distinct sites (G7 and C19), was used. Raw sequencing data was used to train deep learning models to classify the methylationstatus of a read (see Figure 3), achieving accuracies of 90% in the test dataset (Figure 6a). The utility of these models was tested using direct RNA sequencing libraries prepared from wild type HCC cells and mutants for SNORD102 and SNORD75 which are the snoRNAs responsible for the 2'-O-methylation of G7 and C19 respectively. Visualisation of the alignment from direct RNA sequencing of these samples (seeFigure 6b) reveals for the first-time accurate sequencing of ~20 nt small RNAs on the ONTplatform. The developed classification model enables the quantification of methylation dynamicson a single RNA molecule, and reveals the expected specific reduction of methylation at theG7 and C19 sites in the respective mutant cells lines (see Figure 6c). 4. Barcode implementation Finally, a version of barcoding was implemented to enable multiplexed measurement of samples. A 10 nt DNA barcode was inserted into the DNA portion of the 3’adapter (see Figure5). The raw barcode data was used to train a deep learning based model for classification (seeFigure 3). This enables a modular approach, whereby the barcode classification is separate from the insert classification. Successful classification of 3 multiplexed barcodes with accuracy in the test set of 98% could be demonstrated (see Figure 7).5. Lung cancer detection on the basis of RNA modificationsThe ONT platform was used to measure miLung#1 methylation status from plasma cell-free RNA (cfRNA) samples from a lung cancer clinical cohort to explore the diagnostic valueof biomarker RNA modification profiling. cfRNA was manually extracted from plasma collected in Streck cfRNA tubes from a total of 43 patients (27 cancer, 16 control). Sequencinglibraries were created for the ONT platform method and methylation status was inferred at thesingle molecule level per patient with a deep learning model. As mentioned above, the rRNAfragment miLung#1 (GCCGCCGGTGAAATACCACTAC, SEQ ID NO: 9) is known to bemodified with 2'-O-methylation at two distinct sites (G7 and C19, in bold). A methylation atboth sites is designated as GmCm (or Gm4020Cm4032). A significant increase in miLung#1with a GmCm (or Gm4020Cm4032) methylation pattern with a diagnostic performance of 0.84ROC AUC was observed (see Figures 8 and 9).These findings highlight the importance of this method to measure RNA modifications at individual sites within single molecules to reveal differences that may otherwise be obscured.Together, the ONT platform method described here enables the single molecule RNAmodification profiling of small RNA biomarkers with diagnostic value demonstrated for the detection of lung cancer. Sequences: Name Sequence 5’ to 3’first Oligo (A) 5’- universal of the / 5PHOS / rUrArGrCrUrCrArArArArArArArArArAGGNNNNNNNNNNCT 3’adapter TGCTCTTAGGTAGTAGGTTC (SEQ ID NO: 3) combination second Oligo 5’- (B) universal of GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGNNNNNNNNNNCCTT the 3’adapter TTTTTTTTGAGCTANNNNNNNNNN (SEQ ID NO: 10) combination 5’adapter 5’- universal rNrNrNrNrNrNrNrNrCrGrUrGrGrCrGrUrGrGrArGrUrGrUrUrArArUrU rArArUrGrUrGrCrUrUrUrGrCrCrArUrG (SEQ ID NO: 11)Table 1: Oligo sequences for universal Nano-smallRNAseq. Bold Ns indicate the barcode.ONT compatible sequence to enable ligation to the ONT RMX adapter is in italic. Bold Ns arethe overhang regions designed to capture small RNAs into the Nano-smallRNAseq library. rdenotes that the proceeding nucleotide is RNA. Name Sequence 5’ to 3’first Oligo (A) 5’- miLung#1 / 5PHOS / rUrArGrCrUrCrArArArArArArArArArAGGAAACAAACACCT barcode_1 TGCTCTTAGGTAGTAGGTTC (SEQ ID NO: 12) first Oligo (A) 5'- miLung#1 / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGCTCTTGTGGGCTT barcode_2 GCTCTTAGGTAGTAGGTTC (SEQ ID NO: 13) first Oligo (A) 5'- miLung#1 / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGAGGGCCGATTCTT barcode_3 GCTCTTAGGTAGTAGGTTC (SEQ ID NO: 14) second Oligo 5’- (B) miLung#1 GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGGTGTTTGTTTCCTT barcode_1 TTTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 15) second Oligo 5'- (B) miLung#1 GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGCCCACAAGAGCCT barcode_2 TTTTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 16) second Oligo 5'- (B) miLung#1 GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAATCGGCCCTCCTT barcode_3 TTTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 17) 5’adapter 5’- miLung#1 rCrCrGrGrCrGrGrCrCrGrUrGrGrCrGrUrGrGrArGrUrGrUrUrArArUr UrArArUrGrUrGrCrUrUrUrGrCrCrArUrG (SEQ ID NO: 18)Table 2: Oligo sequences for targeted Nano-smallRNAseq. Bold underlined sequence indicatesthe barcode. ONT compatible sequence to enable ligation to the ONT RMX adapter is in italic.Bold black are the overhang regions designed to capture small RNAs into the Nano- smallRNAseq library. r denotes that the proceeding nucleotide is RNA. A + denotes that theproceeding base is LNA modified.

Claims

CLAIMS1. A 5’adapter comprising in the following order from 5’ to 3’:(i) a 5’terminal ribonucleotide sequence comprising 6 to 15 ribonucleotides,wherein said 6 to 15 ribonucleotides are reverse complementary to a 5’-terminal sequence of a target RNA, and wherein optionally one or more of said 6 to 15 ribonucleotides are locked nucleotide- (LNA-) enhanced, and(ii) a ribonucleotide sequence capable of forming a stem-loop structure containing aloop and a double stranded stem.

2. The 5’adapter of claim 1, wherein the ribonucleotide sequence capable of forming astem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other.

3. The 5’adapter of claim 2, wherein each one of the 5’positioned first stem sequence andthe 3’positioned second stem sequence has a length of 5 to 10 ribonucleotides.

4. The 5’adapter of claim 3, wherein the 5’positioned first stem sequence and the3’positioned second stem sequence have the same length.

5. The 5’adapter of any one of claims 2 to 4, wherein the 5’positioned first stem sequenceand / or the 3’positioned second stem sequence is (are) LNA enhanced.

6. The 5’adapter of claim 5, wherein the LNA enhanced sequence comprises 2 to 5,preferably 3, locked nucleotides.

7. The 5’adapter of any one of claims 2 to 6, wherein the ribonucleotide sequence capableof forming a stem-loop structure comprises a loop sequence which is located betweenthe 5’positioned first stem sequence and the 3’positioned second stem sequence.

8. The 5’adapter of claim 7, wherein the loop sequence comprises between 12 and 22ribonucleotides.

9. The 5’adapter of any one of claims 1 to 8, wherein the 5’-terminal ribonucleotide isconfigured such that it forms a single stranded 5’protrusion after formation of the stem- loop structure.

10. The 5’adapter of any one of claims 1 to 9, wherein the 5’adapter comprises the followingsequence from 5’ to 3’: (6- 15x)rNrCrGrUrGrGrCrGrUrGrGrArGrUrGrUrUrArArUrUrArArUrGrUrGrCrUrUrUr GrCrCrArUrG (SEQ ID NO: 1), wherein “r” stands for ribonucleotide, and wherein “(6-15x)rN” designates the ribonucleotide sequence reverse complementary to a 5’terminal sequence of a target RNA.

11. The 5’adapter of any one of claims 1 to 10, wherein the target RNA is RNA having alength of < 50 ribonucleotides.

12. The 5’adapter of claim 11, wherein the target RNA is RNA having a length of < 30ribonucleotides.

13. The 5’adapter of claims 11 or 12, wherein the RNA is a miRNA, piRNA, siRNA, or afragment of longer RNAs, preferably a rRNA or tRNA fragment.

14. A 3’adapter combination comprising (i) a first oligonucleotide and (ii) a secondoligonucleotide, wherein(i) the first oligonucleotide comprises in the following order from 5’ to 3’:(a) a ribonucleotide sequence comprising between 4 and 8 ribonucleotides,wherein the 5’terminal ribonucleotide is phosphorylated, which sequence is reverse complementary to a corresponding sequence in the second oligonucleotide, (b) a poly(A) segment comprising between 8 and 12 adenosineribonucleotides, (c) a deoxynucleotide spacer sequence comprising between 2 and 5 fixeddeoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 8 and 12 fixed deoxynucleotides,all of which are reverse complementary to a corresponding sequence in the second oligonucleotide, and(d) a 3’overhanging deoxynucleotide sequence comprising between 8 and 12deoxynucleotides which is capable of complexing with / ligating to a first element allowing nanopore sequencing of target RNA, and, (ii) the second oligonucleotide comprises in the following order from 5’ to 3’:(a) a 5’overhanging deoxynucleotide sequence comprising between 15 and25 deoxynucleotides which is capable of complexing with / ligating to a second element allowing nanopore sequencing of target RNA, (b) a deoxynucleotide spacer sequence comprising between 8 and 12 fixeddeoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 2 and 5 fixed deoxynucleotides, all of which are reverse complementary to a corresponding sequence in the first oligonucleotide,(c) a poly(T) segment comprising between 8 and 12 thymidinedeoxynucleotides, (d) a deoxynucleotide sequence comprising between 4 and 8deoxynucleotides which is reverse complementary to a corresponding sequence in the first oligonucleotide, and (e) a 3’overhanging deoxynucleotide sequence comprising 6 to 15deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of a target RNA, and wherein optionally one or more of said 6 to 15 deoxynucleotides are locked nucleotide- (LNA-) enhanced.

15. The 3’adapter combination of claim 14, wherein the first oligonucleotide and the secondoligonucleotide are capable of forming a hybrid structure via their reverse complementary sequences.

16. The 3’adapter combination of claims 14 or 15, wherein the 3’overhangingdeoxynucleotide sequence comprising between 8 and 12 deoxynucleotides in (i)(d) is reverse complement to a corresponding 5’overhang sequence on a nanopore sequencing compatible motor protein / adapter complex.

17. The 3’adapter combination of any one of claims 14 to 16, wherein the first elementallowing nanopore sequencing of target RNA is a 5’overhang sequence on a nanoporesequencing compatible motor protein / adapter complex.

18. The 3’adapter combination of any one of claims 14 to 17, wherein the 5’overhangingdeoxynucleotide sequence comprising between 15 and 25 deoxynucleotides in (ii)(a) is reverse complement to a tether oligonucleotide that concentrates the target RNA, specifically a ligation product or a RNA / cDNA duplex thereof, at the membrane surface of a nanopore flow cell.

19. The 3’adapter combination of any one of claims 14 to 18, wherein the second elementallowing nanopore sequencing of target RNA is a tether oligonucleotide thatconcentrates the target RNA, specifically a ligation product or a RNA / cDNA duplex thereof, at the membrane surface of a nanopore flow cell.

20. The 3’adapter combination of any one of claims 14 to 19, wherein the firstoligonucleotide comprises the following sequence from 5’ to 3’: / 5Phos / rUrArGrCrUrC(8- 12x)rAGGNNNNNNNNNNCTTGCTCTTAGGTAGTAGGTTC (SEQ ID NO: 2),wherein “r” stands for ribonucleotide, “ / 5Phos / ” indicates that the 5’-terminal ribonucleotide is phosphorylated, “(8-12x)rA” stands for the poly(A) segment, thedeoxynucleotide spacer sequence is underlined, and the optional barcode (N) ishighlighted in bold.

21. The 3’adapter combination of claim 20, wherein the first oligonucleotide comprises thefollowing sequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGNNNNNNNNNNCTTGCTCTTA GGTAGTAGGTTC (SEQ ID NO: 3).

22. The 3’adapter combination of any one of claims 14 to 21, wherein the secondoligonucleotide comprises the following sequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGNNNNNNNNNNCC(8- 12x)TGAGCTA(6-15x)N (SEQ ID NO: 4), wherein the deoxynucleotide spacersequence is underlined, the optional barcode (N) is highlighted in bold, “(8-12x)T”stands for the poly(T) segment, and “(6-15x)N” designates the deoxynucleotide sequence reverse complementary to a 3’terminal sequence of a target RNA.

23. The 3’adapter combination of claim 22, wherein the second oligonucleotide comprisesthe following sequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGNNNNNNNNNNCCTTTTTTTT TTGAGCTA(6-15x)N (SEQ ID NO: 5).

24. The 3’adapter combination of any one of claims 14 to 23, wherein the target RNA isRNA having a length of < 50 ribonucleotides.

25. The 3’adapter combination of claim 24, wherein the target RNA is RNA having a lengthof < 30 ribonucleotides.

26. The 3’adapter combination of claims 24 or 25, wherein the RNA is a miRNA, piRNA,siRNA, or a fragment of longer RNAs, preferably a rRNA or tRNA fragment.

27. An adapter system comprisingthe 5’adapter of any one of claims 1 to 13, and the 3’adapter combination of any one of claims 14 to 26.

28. A method of ligating a 5’adapter and a 3’adapter combination to a target RNA in asample comprising the steps of: (i) providing a composition comprising a denatured target RNA in a sample, therenatured 5’adapter of any one of claims 1 to 13, and the renatured 3’adapter combination of any one of claims 14 to 26, wherein the 5’adapter and the3’adapter combination are annealed to the target RNA, and (ii) ligating the 5’adapter and the 3’adapter combination to the target RNAusing / with a double stranded RNA ligase, thereby producing a ligation product.

29. The method of claim 28, wherein the denatured target RNA is produced by heating thetarget RNA at between 65°C and 75°C, preferably at 70°C, for between 1 and 3 minutes,preferably for 2 minutes.

30. The method of claims 28 or 29, wherein the renatured 5’adapter is produced bydenaturing the 5’adapter at between 75°C and 85°C, preferably at 82°C, for between 1 and 3 minutes, preferably for 2 minutes, andrenaturing the 5’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s.

31. The method of any one of claims 28 to 30, wherein the renatured 3’adapter combinationis produced by denaturing the 3’adapter combination at between 75°C and 85°C, preferably at 82°C, for between 1 and 3 minutes, preferably for 2 minutes, andrenaturing the 3’adapter combination by cooling down to 4°C, preferably at a rate of 0.1°C / s.

32. The method of any one of claims 28 to 31, wherein the renatured 5’adapter and 3’adaptercombination are produced separately and in the absence of target RNA.

33. The method of any one of claims 28 to 32, wherein the denaturing and renaturing iscarried out in an aqueous buffer comprising 10 mM TRIS HCl pH 7.5, and 50 mM NaCl.

34. The method of any one of claims 28 to 33, wherein the composition is produced bymixing the denatured target RNA, the renatured 5’adapter of any one of claims 1 to 13, and the renatured 3’adapter combination of any one of claims 14 to 26 with each other,thereby annealing the 5’adapter and the 3’adapter combination to the target RNA.

35. The method of any one of claims 28 to 34, wherein the ligation is carried out in a ligationbuffer comprising polyethylene glycol (PEG).

36. The method of any one of claims 28 to 35, wherein the ligation is carried out between36°C and 38°C, preferably at 37°C, for between 30 minutes and 1.5 hours, preferably for 1 hour, then at between 14°C and 18°C, preferably at 16°C, for between 1.5 hoursand 2.5 hours, preferably for 2 hours, and at 12°C overnight.

37. The method of any one of claims 28 to 36, wherein the double stranded RNA ligase isa T4 RNA ligase 2 (Rnl2) or a Kod1 ligase.

38. A method of determining and / or quantifying a target RNA in a sample comprising thesteps of: (i) carrying out the method of any one of claims 28 to 37, thereby obtaining aligation product, (ii) optionally reverse transcribing the ligation product, thereby obtaining aRNA / cDNA duplex, and (iii) subjecting the ligation product obtained in step (i) or the RNA / cDNA duplexobtained in step (ii) to a nanopore sequencing reaction, thereby determining and / or quantifying the target RNA.

39. The method of claim 38, wherein the reverse transcription of the ligation product iscarried out by reverse transcribing the ligation product using a reverse transcriptase (RT).

40. The method of claims 38 or 39, wherein said reverse transcribing is carried out atbetween 45°C and 60°C, preferably at 50°C, for between 40 and 60 minutes, preferably for 50 minutes, then at between 60°C and 80°C, preferably at 70°C, for between 8 and15 minutes, preferably for 10 minutes, before finally cooling down to 4°C.

41. The method of claims 39 or 40, wherein the reverse transcriptase (RT) is SuperScriptIII RT, Maxima H-RT or Tth polymerase.

42. The method of any one of claims 38 to 41, wherein the nanopore sequencing reactioncomprises the addition of a structure allowing nanopore sequencing.

43. The method of claim 42, wherein the structure allowing nanopore sequencing iscomposed of (i) a first element, and(ii) a second element.

44. The method of claim 43 wherein(i) the first element is a 5’overhang sequence on a nanopore sequencing compatiblemotor protein / adapter complex, and(ii) the second element is a tether oligonucleotide that concentrates the ligationproduct or the RNA / cDNA duplex at the membrane surface of a nanopore flowcell.

45. The method of claims 43 or 44, wherein(i) the first element recognizes the reverse complementary 3’overhangingdeoxynucleotide sequence of the first oligonucleotide of the 3’adaptercombination of any one of claims 14 to 26, to which it anneals and is ligated to,to enable nanopore sequencing, and (ii) the second element recognizes the reverse complementary 5’overhangingdeoxynucleotide sequence of the second oligonucleotide of the 3’adaptercombination of any one of claims 14 to 26, to which it anneals and is ligated to,to enable nanopore sequencing.

46. The method of any one of claims 38 to 45, wherein the nanopore sequencing reactionfurther allows the detection, characterization, and quantification of nucleotide modifications.

47. The method of claim 46, wherein the nucleotide modifications are selected from thegroup consisting of 2'-O-methylation, N6-methyladenosine (m6A), N6,2′-O- dimethyladenosine (m6Am), 8-oxo-7,8-dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5-methylcytidine (m5C), and N4-acetylcytidine (ac4C).

48. The method of any one of claims 28 to 47, wherein the sample is a biological sample.

49. The method of claim 48, wherein the biological sample is a blood sample.

50. The method of claim 49, wherein the blood sample is a whole blood or a blood fraction,preferably blood cells, serum, or plasma.

51. The method of any one of claims 28 to 50, wherein the sample contains total RNA.

52. The method of claim 51, wherein the sample contains cellular total RNA.

53. The method of any one of claims 28 to 52, wherein the target RNA is RNA having alength of < 50 ribonucleotides.

54. The method of claim 53, wherein the target RNA is RNA having a length of < 30ribonucleotides.

55. The method of claims 53 or 54, wherein the RNA is a miRNA, piRNA, siRNA, or afragment of longer RNAs, preferably a rRNA or tRNA fragment.

56. A method of diagnosing a disease or condition in a patient comprising the steps of:(ia) carrying out the methods of any one of claims 28 to 55, thereby determining thepresence of the target RNA, and (iia) diagnosing whether the patient is afflicted by the disease or condition based onthe presence of the target RNA, or (ib) carrying out the methods of any one of claims 28 to 55, thereby determining thetarget RNA modification proportion,(iib) comparing the target RNA modification proportion to a reference target RNAmodification proportion, and (iiib) diagnosing whether the patient is afflicted by the disease or condition based onthe comparison.

57. The method of claim 56, wherein the modification is selected from the group consistingof 2'-O-methylation, N6-methyladenosine (m6A), N6,2′-O-dimethyladenosine (m6Am), 8-oxo-7,8-dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5-methylcytidine (m5C), and N4-acetylcytidine (ac4C).

58. The method of claims 56 or 57, wherein the (reference) target RNA is RNA having alength of < 50 ribonucleotides.

59. The method of claim 58, wherein the (reference) target RNA is RNA having a length of< 30 ribonucleotides.

60. The method of claims 58 or 59, wherein the RNA is a miRNA, piRNA, siRNA, or afragment of longer RNAs, preferably a rRNA or tRNA fragment.

61. The method of any one of claims 56 to 60, wherein the disease is cancer.

62. The method of claim 61, wherein the cancer is lung cancer.

63. Use of the 5’adapter of any one of claims 1 to 13 and / or the 3’adapter combination ofany one of claims 14 to 26 or the adapter system of claim 27 for nanopore sequencing of target RNA.

64. The use of claim 63, wherein the target RNA is RNA having a length of < 50ribonucleotides.

65. The use of claim 64, wherein the target RNA is RNA having a length of < 30ribonucleotides.

66. Use of the 5’adapter of any one of claims 1 to 13 and / or the 3’adapter combination ofany one of claims 14 to 26 or the adapter system of claim 27 for the determination, characterization, and quantification of the modification status of target RNA.

67. The use of claim 66, wherein the target RNA is RNA having a length of < 50ribonucleotides.

68. The use of claim 67, wherein the target RNA is RNA having a length of < 30ribonucleotides.

69. Use of the 5’adapter of any one of claims 1 to 13 and / or the 3’adapter combination ofany one of claims 14 to 26 or the adapter system of claim 27 for diagnosing a disease or condition in a patient.

70. The use of claim 69, wherein the target RNA is RNA having a length of < 50ribonucleotides.

71. The use of claim 70, wherein the target RNA is RNA having a length of < 30ribonucleotides.

72. A kit comprisingthe 5’adapter of any one of claims 1 to 13, and the 3’adapter combination of any one of claims 14 to 26, or the adapter system of claim 27.

73. The kit of claim 72, wherein the kit further comprises(i) a double stranded RNA ligase, preferably a T4 RNA ligase 2 (Rnl2) or a Kod1ligase, (ii) a reverse transcriptase (RT), preferably SuperScript III RT, Maxima H-RT orTth polymerase, and / or (iii) a structure allowing nanopore sequencing.

74. The kit of claims 72 or 73, wherein the kit allows to conduct the methods of any one ofclaims 28 to 62.

75. A 5’adapter comprising in the following order from 5’ to 3’:(i) a 5’terminal ribonucleotide sequence comprising 6 to 15 ribonucleotides,wherein said 6 to 15 ribonucleotides are random ribonucleotides, and wherein optionally one or more of said 6 to 15 ribonucleotides are locked nucleotide- (LNA-) enhanced, and(ii) a ribonucleotide sequence capable of forming a stem-loop structure containing aloop and a double stranded stem.

76. The 5’adapter of claim 75, wherein the ribonucleotide sequence capable of forming astem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other.

77. The 5’adapter of claim 76, wherein each one of the 5’positioned first stem sequence andthe 3’positioned second stem sequence has a length of 5 to 10 ribonucleotides.

78. The 5’adapter of claim 77, wherein the 5’positioned first stem sequence and the3’positioned second stem sequence have the same length.

79. The 5’adapter of any one of claims 76 to 78, wherein the 5’positioned first stemsequence and / or the 3’positioned second stem sequence is (are) LNA enhanced.

80. The 5’adapter of claim 79, wherein the LNA enhanced sequence comprises 2 to 5,preferably 3, locked nucleotides.

81. The 5’adapter of any one of claims 76 to 80, wherein the ribonucleotide sequencecapable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence.

82. The 5’adapter of claim 81, wherein the loop sequence comprises between 12 and 22ribonucleotides.

83. The 5’adapter of any one of claims 75 to 82, wherein the 5’-terminal sequence isconfigured such that it forms a single stranded 5’protrusion after formation of the stem-loop structure.

84. The 5’adapter of any one of claims 75 to 83, wherein the 5’adapter comprises thefollowing sequence from 5’ to 3’: (6- 15x)rNrCrGrUrGrGrCrGrUrGrGrArGrUrGrUrUrArArUrUrArArUrGrUrGrCrUrUrUr GrCrCrArUrG (SEQ ID NO: 6), wherein “r” stands for ribonucleotide, and wherein “(6-15x)rN” designates the random ribonucleotides.

85. A 3’adapter combination comprising (i) a first oligonucleotide and (ii) a secondoligonucleotide, wherein (i) the first oligonucleotide comprises in the following order from 5’ to 3’:(a) a ribonucleotide sequence comprising between 4 and 8 ribonucleotides,wherein the 5’terminal ribonucleotide is phosphorylated, which sequence is reverse complementary to a corresponding sequence in the second oligonucleotide, (b) a poly(A) segment comprising between 8 and 12 adenosineribonucleotides,(c) a deoxynucleotide spacer sequence comprising between 2 and 5 fixeddeoxynucleotides, followed by optional 10 variable barcode deoxynucleotides, and further between 8 to 12 fixed deoxynucleotides,all of which are reverse complementary to a corresponding sequence in the second oligonucleotide, and (d) a 3’overhanging deoxynucleotide sequence comprising between 8 and 12deoxynucleotides which is capable of complexing with / ligating to a firstelement allowing nanopore sequencing of RNA molecules, and, (ii) the second oligonucleotide comprises in the following order from 5’ to 3’:(a) a 5’overhanging deoxynucleotide sequence comprising between 15 and25 deoxynucleotides which is capable of complexing with / ligating to a second element allowing nanopore sequencing of RNA molecules, (b) a deoxynucleotide spacer sequence comprising between 8 and 12 fixeddeoxynucleotides, followed by optional 10 variable barcodedeoxynucleotides, and further between 2 and 5 fixed deoxynucleotides, all of which are reverse complementary to a corresponding sequence in the first oligonucleotide,(c) a poly(T) segment comprising between 8 and 12 thymidinedeoxynucleotides, (d) a deoxynucleotide sequence comprising between 4 and 8deoxynucleotides which is reverse complementary to a corresponding sequence in the first oligonucleotide, and(e) a 3’overhanging deoxynucleotide sequence comprising 6 to 15deoxynucleotides, wherein said 6 to 15 deoxynucleotides are randomdeoxynucleotides, and wherein optionally one or more of said 6 to 15 deoxynucleotides are locked nucleotide- (LNA-) enhanced.

86. The 3’adapter combination of claim 85, wherein the first oligonucleotide and the secondoligonucleotide are capable of forming a hybrid structure via their reverse complementary sequences.

87. The 3’adapter combination of claims 85 or 86, wherein the 3’overhangingdeoxynucleotide sequence comprising between 8 and 12 deoxynucleotides in (i)(d) isreverse complement to a corresponding 5’overhang sequence on a nanopore sequencing compatible motor protein / adapter complex.

88. The 3’adapter combination of any one of claims 85 to 87, wherein the first elementallowing nanopore sequencing of RNA molecules is a 5’overhang sequence on ananopore sequencing compatible motor protein / adapter complex.

89. The 3’adapter combination of any one of claims 85 to 88, wherein the 5’overhangingdeoxynucleotide sequence comprising between 15 and 25 deoxynucleotides in (ii)(a) is reverse complement to a tether oligonucleotide that concentrates the RNA molecules, specifically a RNA library or a RNA / cDNA duplex library made therefrom, at the membrane surface of a nanopore flow cell.

90. The 3’adapter combination of any one of claims 85 to 89, wherein the second elementallowing nanopore sequencing of RNA molecules is a tether oligonucleotide thatconcentrates the RNA molecules, specifically a RNA library or a RNA / cDNA duplex library made therefrom, at the membrane surface of a nanopore flow cell.

91. The 3’adapter combination of any one of claims 85 to 90, wherein the firstoligonucleotide comprises the following sequence from 5’ to 3’: / 5Phos / rUrArGrCrUrC(8- 12x)rAGGNNNNNNNNNNCTTGCTCTTAGGTAGTAGGTTC (SEQ ID NO: 2),wherein “r” stands for ribonucleotide, “ / 5Phos / ” indicates that the 5’-terminal ribonucleotide is phosphorylated, “(8-12x)rA” stands for the poly(A) segment, thedeoxynucleotide spacer sequence is underlined, and the optional barcode (N) ishighlighted in bold.

92. The 3’adapter combination of claim 91, wherein the first oligonucleotide comprises thefollowing sequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGNNNNNNNNNNCTTGCTCTTA GGTAGTAGGTTC (SEQ ID NO: 3).

93. The 3’adapter combination of any one of claims 85 to 92, wherein the secondoligonucleotide comprises the following sequence from 5’ to 3’:GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGNNNNNNNNNNCC(8- 12x)TGAGCTA(6-15x)N (SEQ ID NO: 7), wherein the deoxynucleotide spacersequence is underlined, the optional barcode (N) is highlighted in bold, “(8-12x)T”stands for the poly(T) segment, and “(6-15x)N” designates the random deoxynucleotides.

94. The 3’adapter combination of claim 93, wherein the second oligonucleotide comprisesthe following sequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGNNNNNNNNNNCCTTTTTTTT TTGAGCTA(6-15x)N (SEQ ID NO: 8).

95. A set comprising at least two 5’adapters of any one of claims 75 to 84, wherein said atleast two 5’adapters differ in the sequence of their 6 to 15 random ribonucleotides.

96. A set comprising at least two 3’adapter combinations of any one of claims 85 to 94,wherein said second oligonucleotides differ in the sequence of their 6 to 15 random deoxynucleotides.

97. An adapter system comprisingthe set comprising at least two 5’adapters of claim 95, and the set comprising at least two 3’adapter combinations of claim 96.

98. A method of ligating adapters and adapter combinations to RNA molecules in a samplecomprising the steps of: (i) providing a composition comprising denatured RNA molecules in a sample, theset comprising at least two 5’adapters of claim 95, wherein said adapters have been renatured, and the set comprising at least two 3’adapter combinations of claim 96, wherein said adapter combinations have been renatured, wherein the 5’adapters and the 3’adapters are annealed to the RNA molecules, and (ii) ligating the 5’adapters and the 3’adapter combinations to the RNA moleculesusing / with a double stranded RNA ligase, thereby producing ligation products.

99. The method of claim 98, wherein the denatured RNA molecules are produced by heatingthe RNA molecules at between 65°C and 75°C, preferably at 70°C, for between 1 and3 minutes, preferably for 2 minutes.

100. The method of claims 98 or 99, wherein the renatured 5’adapters are produced bydenaturing the 5’adapters at between 75°C and 85°C, preferably at 82°C, for between 1and 3 minutes, preferably for 2 minutes, andrenaturing the 5’adapters by cooling down to 4°C, preferably at a rate of 0.1°C / s.

101. The method of any one of claims 98 to 100, wherein the renatured 3’adaptercombinations are produced by denaturing the 3’adapter combinations at between 75°Cand 85°C, preferably at 82°C, for between 1 and 3 minutes, preferably for 2 minutes,and renaturing the 3’adapter combinations by cooling down to 4°C, preferably at a rate of 0.1°C / s.

102. The method of any one of claims 98 to 101, wherein the renatured 5’adapters and3’adapter combinations are produced separately and in the absence of the RNAmolecules.

103. The method of any one of claims 98 to 102, wherein the denaturing and renaturing iscarried out in an aqueous buffer comprising 10 mM TRIS HCl pH 7.5, and 50 mM NaCl.

104. The method of any one of claims 98 to 103, wherein the composition is produced bymixing the denatured RNA molecules, the set comprising at least two 5’adapters of claim 95, wherein said adapters have been renatured, and the set comprising at least two3’adapter combinations of claim 96, wherein said adapter combinations have beenrenatured, with each other, thereby annealing the renatured 5’adapters and the renatured 3’adapter combinations to the RNA molecules.

105. The method of any one of claims 98 to 104, wherein the ligation is carried out in aligation buffer comprising polyethylene glycol (PEG).

106. The method of any one of claims 98 to 105, wherein the ligation is carried out between36°C and 38°C, preferably at 37°C, for between 30 minutes and 1.5 hours, preferablyfor 1 hour, then at between 14°C and 18°C, preferably at 16°C, for between 1.5 hours and 2.5 hours, preferably for 2 hours, and at 12°C overnight.

107. The method of any one of claims 98 to 106, wherein the double stranded RNA ligase isa T4 RNA ligase 2 (Rnl2) or a Kod1 ligase.

108. A method of producing a RNA library from RNA molecules in a sample comprising thestep of: (i) carrying out the method of any one of claims 98 to 107.

109. A RNA library from RNA molecules in a sample obtained by the method of claim 108.

110. A method of producing a RNA / cDNA duplex library from RNA molecules in a samplecomprising the steps of: (i) carrying out the method of any one of claims 98 to 107, and(ii) reverse transcribing the ligation products, thereby obtaining RNA / cDNAduplexes.

111. The method of claim 110, wherein the reverse transcription of the ligation products iscarried out by reverse transcribing the ligation products using a reverse transcriptase (RT).

112. The method of claims 110 or 111, wherein said reverse transcribing is carried out atbetween 60°C and 45°C, preferably at 50°C, for between 40 and 60 minutes, preferably for 50 minutes, then at between 60°C and 80°C, preferably at 70°C, for between 8 and 15 minutes, preferably for 10 minutes, before finally cooling down to 4°C.

113. The method of claims 111 or 112, wherein the reverse transcriptase (RT) is SuperScriptIII RT, Maxima H-RT or Tth polymerase.

114. A RNA / cDNA duplex library from RNA molecules in a sample obtained by the methodof any one of claims 110 to 113.

115. A method of determining a profile of RNA molecules in a sample comprising the stepof: (i) nanopore sequencing the RNA library from RNA molecules in a sampleproduced by the method of claim 108 or nanopore sequencing the RNA / cDNA duplex library from RNA molecules in a sample produced by the method of anyone of claims 110 to 113.

116. The method of claim 115, wherein the nanopore sequencing comprises the addition ofa structure allowing nanopore sequencing.

117. The method of claim 116, wherein the structure allowing nanopore sequencing iscomposed of (i) a first element, and(ii) a second element.

118. The method of claim 117 wherein(i) the first element is a 5’overhang sequence on a nanopore sequencing compatiblemotor protein / adapter complex, and (ii) the second element is a tether oligonucleotide that concentrates the RNA libraryor the RNA / cDNA duplex library at the membrane surface of a nanopore flow cell.

119. The method of claims 117 or 118, wherein(i) the first element recognizes the reverse complementary 3’overhangingdeoxynucleotide sequences of the first oligonucleotides of the 3’adapters of theset of claim 96, to which it anneals and is ligated to, to enable nanopore sequencing, and (ii) the second element recognizes the reverse complementary 5’overhangingdeoxynucleotide sequences of the second oligonucleotides of the 3’adapters ofthe set of claim 96, to which it anneals and is ligated to, to enable nanopore sequencing.

120. The method of any one of claims 115 to 119, wherein the nanopore sequencing reactionfurther allows the detection, characterization, and quantification of nucleotide modifications.

121. The method of claim 120, wherein the nucleotide modification are selected from thegroup consisting of 2'-O-methylation, N6-methyladenosine (m6A), N6,2′-O- dimethyladenosine (m6Am), 8-oxo-7,8-dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5-methylcytidine (m5C), and N4-acetylcytidine (ac4C).

122. The method of any one of claims 98 to 121, wherein the sample is a biological sample.

123. The method of claim 122, wherein the biological sample is a blood sample.

124. The method of claim 123, wherein the blood sample is a whole blood or a blood fraction,preferably blood cells, serum, or plasma.

125. The method of any one of claims 98 to 124, wherein the sample contains total RNA.

126. The method of claim 125, wherein the sample contains cellular total RNA.

127. The method of any one of claims 98 to 126, wherein the RNA molecules are RNAmolecules having a length of < 50 ribonucleotides.

128. The method of claim 127, wherein the RNA molecules are RNA molecules having alength of < 30 ribonucleotides.

129. The method of claims 127 or 128, wherein the RNA molecules are miRNAs, piRNAs,siRNAs, or fragments of longer RNAs, preferably rRNA or tRNA fragments.

130. A kit comprisingthe set comprising at least two 5’adapters of claim 95, and the set comprising at least two 3’adapter combinations of claim 96, or the adapter system of claim 97.

131. The kit of claim 130, wherein the kit further comprises(i) a double stranded RNA ligase, preferably a T4 RNA ligase 2 (Rnl2) or a Kod1ligase, (ii) a reverse transcriptase (RT), preferably SuperScript III RT, Maxima H-RT orTth polymerase, and / or (iii) a structure allowing nanopore sequencing.

132. The kit of claims 130 or 131, wherein the kit allows to conduct the methods of any oneof claims 98 to 108, 110 to 113, or 115 to 129.

133. Use of the the set comprising at least two 5’adapters of claim 95, and the set comprisingat least two 3’adapter combinations of claim 96, or the adapter system of claim 97 forthe generation of a library of RNA molecules.

134. The use of claim 133, wherein the library of RNA molecules is a RNA library or aRNA / cDNA duplex library.

Citation Information

Patent Citations

  • Oligonucleotides and methods for the preparation of RNA libraries

    US20140128291A1

  • Advanced dumbell PCR for isomir detection

    US20230313284A1

  • RNA ligase enzymes and methods of preparation and use thereof

    WO2023085955A1

Cited By

  • Joint element and method for constructing Oxford nanopore direct RNA sequencing library by joint element

    CN121951000A

  • Frogligo TRNA chaining strategy

    WO2026090306A1