Modified 5'-untranslated region and method for producing target substance using same

Abstract

Provided is a DNA molecule containing a modified promoter. The modified promoter contains modified 5'UTR containing a heterologous polynucleotide. The heterologous polynucleotide is a polynucleotide containing the nucleotide sequence of SEQ ID NO: 70 or containing a nucleotide sequence having at least 80% identity with said sequence.

Description

Modified 5' untranslated region and method for producing target substance using same

[0001] The present invention relates to a DNA molecule containing a modified 5' untranslated region or a promoter containing the same, and a method for producing a target substance using the same.

[0002] In the industrial production of substances using microorganisms, improving productivity is an important issue. Many studies have been conducted on modifying expression control regions such as promoters to improve the expression of target genes.

[0003] Patent Document 1 describes that a modified promoter obtained by mutating a catabolite responsive element (cre)-like sequence derived from the alkaline cellulase gene of Bacillus sp. KSM-S237 strain (FERM BP-7875) and KSM-64 strain (FERM BP-2886) improves expression of a target gene. Patent Document 2 describes that a modified promoter obtained by inserting bases between positions 326 and 330 of the nucleotide sequence of the alkaline cellulase gene promoter region of the KSM-64 strain improves expression of a target gene. Patent Documents 3 and 4 describe that a 5' untranslated region (5'UTR) sequence obtained from the aprE gene of Bacillus subtilis is operably linked to a heterologous gene to improve expression of the gene. Patent Document 5 describes improving expression of a target gene by ligating a modified mRNA processing / stabilizing sequence with an additional Shine-Dalgarno sequence downstream of the promoter region and upstream of the ribosome binding region of the target gene. Patent Document 6 describes a method for increasing production of a target substance by introducing a specific stem-loop-forming DNA sequence at least 7 nucleotides downstream of the transcription start site of a gene involved in the synthesis of the target substance. Non-Patent Document 1 describes controlling sacB expression in Bacillus subtilis by introducing a Shine-Dalgarno-like sequence into the 5'UTR of the sacB repressor gene sacR, and that expression increased or decreased depending on the number and position of the introduced sequence. Non-Patent Document 2 describes improving expression of a target gene in the genus Bacillus by introducing multiple sequences containing a ribosome binding site (RBS) and an initiation codon into the 5'UTR region of the target gene.

[0004] (Patent Document 1) JP 2011-103875 (Patent Document 2) JP 2000-078981 (Patent Document 3) JP 2018-505686 (Patent Document 4) JP 2020-534821 (Patent Document 5) International Publication No. 2008 / 140615 (Patent document 6) Japanese translation of PCT publication No. 2009-518019 (Non-patent document 1) Lett Appl Microbiol, 2005, 41(2):221-226 (Non-patent document 2) Nucleic Acids Research, 2022, 50(20):11979-11990

[0005] In one embodiment, the present invention provides a DNA molecule comprising a modified promoter, wherein the modified promoter comprises a modified 5'UTR containing a heterologous polynucleotide, and the heterologous polynucleotide is a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 70 or a nucleotide sequence having at least 80% identity to said sequence. In another embodiment, the present invention provides a transformant containing the DNA molecule. In yet another embodiment, the present invention provides a method for producing a target substance, comprising culturing the transformant. In yet another embodiment, the present invention provides a method for producing a modified promoter, the method comprising modifying a 5'UTR contained in a parent promoter, wherein the modification of the 5'UTR comprises replacing a part or all of the 5'UTR with a heterologous polynucleotide or adding the heterologous polynucleotide to the 5'UTR, the heterologous polynucleotide is a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 70 or a nucleotide sequence having at least 80% identity to said sequence, and the parent promoter is a promoter comprising a 5'UTR that does not contain the heterologous polynucleotide.

[0006] P containing the modified 5'UTR constructed in Example 2 SP64 The shaded area represents the region replaced with the parent sequence. The spoVG promoter containing the modified 5'UTR constructed in Example 3. The shaded area represents the region replaced with the parent sequence. The P promoter containing the modified 5'UTR and a heterologous RBS constructed in Example 7.SP64 The shaded area represents the region replaced with the parent sequence, and the black bar represents the heterologous RBS. SP64 Improved productivity of KP43 protease by promoter. Improved productivity of KP43 protease by spoVG promoter containing modified 5'UTR. SP64 Improved amylase productivity by promoter. Improved amylase productivity by spoVG promoter containing modified 5'UTR. SP64 Improved Cry5B productivity by promoter. SP64 Lipase productivity improvement by promoter. P containing modified 5'UTR and additional RBS SP64 Promoter-driven Cry5B productivity improvement. Detailed Description of the Invention

[0007] All patents, non-patent documents, and other publications cited herein are hereby incorporated by reference in their entirety.

[0008] In this specification, the identity of amino acid sequences and nucleotide sequences is calculated by the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, the identity is calculated by performing analysis using the homology analysis (Search homology) program of genetic information processing software GENETYX Ver. 12 (Japan Server Co., Ltd.) with the unit size to compare (ktup) set to 2.

[0009] As used herein, "at least 80% identity" with respect to amino acid sequences and nucleotide sequences means identity of 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 98% or more, and even more preferably 99% or more.

[0010] Unless otherwise defined herein, the term "one or several" used in reference to deletion, substitution, addition, or insertion of amino acid residues or nucleotides in an amino acid sequence or nucleotide sequence preferably means 1 to 5, more preferably 1 to 4, even more preferably 1 to 3, and even more preferably 1 to 2. As used herein, "addition" of an amino acid residue or nucleotide includes addition of an amino acid residue or nucleotide to one or both ends of a sequence.

[0011] As used herein, a "corresponding position" or "corresponding region" in an amino acid sequence or nucleotide sequence can be determined by aligning a target sequence with a reference sequence (e.g., the amino acid sequence of SEQ ID NO: 3) to maximize homology. Alignment of amino acid sequences or nucleotide sequences can be performed using known algorithms, and the procedures are well known to those skilled in the art. For example, alignment can be performed using the Clustal W multiple alignment program (Thompson, J.D. et al., 1994, Nucleic Acids Res. 22:4673-4680) with default settings. Clustal W is available, for example, on the website of the DNA Data Bank of Japan (DDBJ [www.ddbj.nig.ac.jp / searches-j.html]), operated by the National Institute of Genetics. A position in a target sequence aligned to any position in a reference sequence by the above-described alignment is considered to be a "position corresponding to" that position. Furthermore, a region flanked by corresponding positions or consisting of corresponding motifs is considered to be a corresponding region.

[0012] As used herein, the term "amino acid residue" refers to the 20 amino acid residues that make up proteins: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine ​​(Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V).

[0013] As used herein, a "promoter" refers to a DNA sequence that functions to control the expression of a gene (a polynucleotide encoding an expression product). Generally, the "promoter" of a gene is located upstream of the gene's open reading frame (ORF) and controls the expression of the ORF. A promoter may include regions such as a transcription start point and a 5' untranslated region (5'UTR), or may further be defined as a region including enhancers and cis elements. Enhancers and cis elements are located upstream of the transcription start point and enhance promoter activity through the binding of transcription factors and the like. Promoter activation promotes the transcription of a gene into mRNA. The 5'UTR is the region downstream of the transcription start point up to the start codon; it is itself transcribed into mRNA but not translated, and functions as a regulatory region when translating mRNA into protein. The 5'UTR of Bacillus bacteria contains a Shine-Dalgarno (SD) sequence, which is a ribosome binding site.

[0014] As used herein, "open reading frame (ORF)" refers to the region from the initiation codon to the termination codon. The ORF includes the coding sequence (CDS) of a gene.

[0015] As used herein, the term "expression control region" (or simply "control region") refers to a DNA sequence that has the function of controlling the transcription or translation of a gene, and includes a promoter, the 5'UTR that constitutes the promoter, the transcription initiation site, the ribosome binding site and other sites and regions, enhancers and cis elements that improve the transcriptional activity of the promoter, and the 3' untranslated region (3'UTR).

[0016] As used herein, "upstream" and "downstream" when used with respect to a gene or a regulatory region such as a promoter or 5'UTR refer to the 5' and 3' sides of the gene or region, respectively. Unless otherwise defined, the upstream and downstream of a gene are not limited to the upstream and downstream regions adjacent to the ORF of the gene, respectively. Furthermore, unless otherwise defined, the upstream and downstream of a promoter or 5'UTR are not limited to the upstream region adjacent to the 5' end of the region and the downstream region adjacent to the 3' end of the region, respectively.

[0017] As used herein, "operably linked" between a regulatory region and a gene refers to a link between a gene (ORF) and a regulatory region such that the gene can be expressed under the control of the regulatory region. Also, as used herein, "operably linked" between each region contained in the regulatory region (e.g., a promoter and a 5'UTR) refers to a link between each region within the regulatory region such that the region can control the expression of the downstream gene (ORF). Therefore, in this specification, a "gene" operably linked to a regulatory region basically refers to an ORF. Procedures for "operably linking" a gene to a regulatory region, or each region within a regulatory region, are well known to those skilled in the art.

[0018] As used herein, the term "expression cassette" refers to a polynucleotide construct for controlling the expression of a gene of interest contained therein. Typically, an expression cassette contains a gene of interest to be expressed and a control region for controlling the expression of the gene. The control region preferably includes a promoter, which is located upstream of and operably linked to the ORF of the gene of interest. For example, if the gene of interest encodes a polynucleotide encoding a preproprotein containing a signal peptide, the promoter is located upstream of the region encoding the signal peptide and operably linked to the polynucleotide encoding the preproprotein to control the expression of the preproprotein. The expression cassette may also contain the 3' untranslated region (3'UTR) of the gene of interest. Preferably, the expression cassette has restriction enzyme recognition sites at its ends to enable insertion of the expression cassette into a vector or genomic DNA. The expression cassette can be used to construct an expression vector or introduce a foreign gene into genomic DNA. Preferably, the expression cassette of the present invention is a DNA construct.

[0019] As used herein, "heterologous" with respect to polynucleotides such as genes and regulatory regions means that the two elements are not derived from the same polynucleotide strand. For example, when two polynucleotides are "heterologous" to each other, they are derived from separate polynucleotide strands, regardless of whether they are derived from genes of the same name or genes of different names. Thus, when the 5'UTR of a promoter of a gene is replaced with a foreign DNA fragment, the 5'UTR and the DNA fragment are "heterologous" to each other, even if they are derived from genes of the same name, and the DNA fragment is heterologous to the promoter. Thus, "heterologous" with respect to a polynucleotide encompasses the meaning that the two elements are not derived from the same gene. In this case, when the 5'UTR of a gene is replaced with a DNA fragment derived from a different gene, the 5'UTR and the DNA fragment are "heterologous" to each other.

[0020] As used herein, the term "Bacillus" refers to bacteria of the genus Bacillus in the family Bacillaceae. Examples of Bacillus include B. subtilis, B. cereus, B. thuringiensis, B. megaterium, B. amyloliquefaciens, B. pumilus, B. liqueniformis, B. licheniformis, and mutant strains thereof.

[0021] As used herein, the term "target substance" refers to any substance (e.g., peptide, protein, metabolite, etc.) that is desired to be produced by a host cell. As used herein, the term "target gene" refers to a polynucleotide that encodes a target substance or a substance that promotes its production process (e.g., biosynthesis or extracellular transport). For example, target genes include genes that encode proteins or peptides that are the target substance, genes that encode proteins involved in the biosynthesis of metabolites that are the target substance, and genes that encode proteins involved in the extracellular transport of the target substance. The target gene may be a heterologous gene that encodes a heterologous expression product, a homologous gene introduced from the outside, a gene that encodes an expression product inherent to the host cell, or a gene that encodes any other expression product (protein, peptide, etc.).

[0022] Examples of substances encoded by the target gene include enzymes, antibodies, insecticidal proteins, hormones, cytokines, other physiologically active peptides, enzymes for the biosynthesis of metabolites, and transporters involved in the excretion of metabolites outside the cell, but enzymes and insecticidal proteins are preferred. Examples of enzymes include oxidoreductases, transferases, hydrolases, lyases, isomerases, and synthetases (ligases or synthetases). Preferred examples include cellulosic biomass decomposition enzymes such as cellulase and hemicellulase, exoglucanases, endoglucanases, β-glucosidases, laccases, lactases, esterases, pectate lyases, pectinases, peroxidases, phytases, pullulanases, PETases, proteases, lipases, mannanases, arabinases, galactases, and amylases. More preferred are proteases, lipases, and amylases. Examples of insecticidal proteins include Cry proteins produced by Bacillus thuringiensis, preferably Cry proteins classified as Cry4, Cry5, and Cry11, more preferably Cry5B, Cry4Aa, Cry4Ba, and Cry11Aa, and even more preferably Cry5B.

[0023] As used herein, the term "expression" of a gene encompasses both the process of transcription from a gene to mRNA and the process of translation from mRNA to protein, and is used appropriately depending on the context. Essentially, improved expression of a target gene leads to increased production of a target substance. The expression level of a target gene can be measured by gene expression analysis or by quantifying the production of a protein expressed from the target gene. For example, when comparing the production levels of the same target substance produced in different cells, the concentrations of the target substance produced can be compared, or, if the target substance is an enzyme, enzyme activity values ​​can be compared. Enzyme activity values ​​and substance concentrations are measured by methods well known to those skilled in the art. Furthermore, as used herein, "improvement" and "promotion" can be used interchangeably with respect to gene expression, and "increase" and "improvement" can be used interchangeably with respect to protein production.

[0024] Unless otherwise specified, gene or protein names described herein follow the registration information in the Protein Data Bank (PDB) ([www.rcsb.org / ]).

[0025] The present invention relates to a DNA molecule containing a modified 5'UTR that promotes gene expression or a promoter containing the same, and a method for producing a target substance using the same.

[0026] The present inventors have found that the expression of a target gene in a microorganism can be significantly promoted by replacing at least a portion of the 5'UTR contained in the promoter of the target gene with a specific DNA fragment derived from the 5'UTR of an endoglucanase gene of a Bacillus bacterium.

[0027] According to the present invention, the productivity of a target substance by a microorganism can be significantly improved.

[0028] The present invention provides modified 5'UTRs, modified promoters containing the same, and their use in the production of target substances by microorganisms.

[0029] The modified 5'UTR provided by the present invention can be constructed by modifying the 5'UTR to be modified (hereinafter also referred to as the "parent 5'UTR") with a heterologous polynucleotide. More specifically, the modified 5'UTR of the present invention can be constructed by replacing part or all of the parent 5'UTR with a heterologous polynucleotide or by adding a heterologous polynucleotide to the parent 5'UTR. Therefore, the parent 5'UTR of the modified 5'UTR is a 5'UTR that does not contain the heterologous polynucleotide.

[0030] The heterologous polynucleotide used to modify the 5'UTR is a polynucleotide heterologous to the parent 5'UTR (i.e., derived from a different polynucleotide strand). Preferably, the heterologous polynucleotide is a fragment derived from the 5'UTR of a Bacillus endoglucanase gene. An example of a Bacillus endoglucanase gene is the endoglucanase (e.g., alkaline cellulase) gene of Bacillus sp. strain KSM-S237 (FERM BP-7875).

[0031] The heterologous polynucleotide comprises the Shine-Dalgarno (SD) sequence GGAGG, which functions as a ribosome binding site in a Bacillus gene. Preferably, the heterologous polynucleotide comprises AGGAGG (SEQ ID NO: 1). More preferably, the heterologous polynucleotide comprises AGGAGGTAATATG (SEQ ID NO: 2). Preferably, the heterologous polynucleotide has a length of at least 20 nt. The upper limit of the length of the heterologous polynucleotide is not particularly limited, but is preferably 100 nt or less.

[0032] Preferably, the heterologous polynucleotide comprises the nucleotide sequence of WAWWTTWAGGAGGTAATATG (SEQ ID NO:70, where W is A or T), or a nucleotide sequence having at least 80% identity thereto, with the proviso that these heterologous polynucleotides comprise AGGAGG (SEQ ID NO:1) at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO:70. Preferably, these heterologous polynucleotides comprise AGGAGGTAATATG (SEQ ID NO:2) at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO:70. In one embodiment, the heterologous polynucleotide consists of the nucleotide sequence of SEQ ID NO:70. In one embodiment, the heterologous polynucleotide comprises a sequence derived from the 5'UTR of a Bacillus endoglucanase gene adjacent to the 5' end of the nucleotide sequence of SEQ ID NO:70. For example, the heterologous polynucleotide consists of a fragment (the 3' end of which consists of the nucleotide sequence of SEQ ID NO: 70) consisting of the 3'-terminal region of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 69 or a sequence having at least 80% identity thereto.

[0033] In one embodiment, the heterologous polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3. The nucleotide sequence of SEQ ID NO: 3 is derived from the 5'UTR (SEQ ID NO: 69) of the alkaline cellulase gene of Bacillus sp. KSM-S237 (FERM BP-7875). In a preferred embodiment, the heterologous polynucleotide consists of the nucleotide sequence of SEQ ID NO: 3.

[0034] In another embodiment, the heterologous polynucleotide comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 3. In a preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 3. In another preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence in which one or more nucleotides have been deleted, substituted, added, or inserted relative to the nucleotide sequence of SEQ ID NO: 3. However, these heterologous polynucleotides contain AGGAGG (SEQ ID NO: 1) at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 3. Preferably, these heterologous polynucleotides contain AGGAGGTAATATG (SEQ ID NO: 2) at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 3.

[0035] In another embodiment, the heterologous polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4. The nucleotide sequence of SEQ ID NO: 4 is derived from the 5'UTR (SEQ ID NO: 69) of the alkaline cellulase gene of Bacillus sp. KSM-S237 (FERM BP-7875) and comprises the nucleotide sequence of SEQ ID NO: 3. In a preferred embodiment, the heterologous polynucleotide consists of the nucleotide sequence of SEQ ID NO: 4. In another preferred embodiment, the heterologous polynucleotide is a fragment (21 to 93 nt) of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, which comprises the nucleotide sequence of SEQ ID NO: 3.

[0036] In another embodiment, the heterologous polynucleotide comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 4 or a fragment thereof. In a preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 4. In another preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence in which one or several nucleotides have been deleted, substituted, added, or inserted relative to the nucleotide sequence of SEQ ID NO: 4 or a fragment thereof. However, these heterologous polynucleotides comprise AGGAGG (SEQ ID NO: 1) at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 3. Preferably, these heterologous polynucleotides comprise AGGAGGTAATATG (SEQ ID NO: 2) at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 3.

[0037] In another embodiment, the heterologous polynucleotide comprises the nucleotide sequence of SEQ ID NO:5. In a preferred embodiment, the heterologous polynucleotide consists of the nucleotide sequence of SEQ ID NO:5. In another embodiment, the heterologous polynucleotide comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO:5. In a preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO:5. In another preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence in which one or more nucleotides have been deleted, substituted, added, or inserted relative to the nucleotide sequence of SEQ ID NO:5. However, these heterologous polynucleotides comprise AGGAGG (SEQ ID NO:1) at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO:5. Preferably, these heterologous polynucleotides comprise AGGAGGTAATATG (SEQ ID NO:2) at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO:5.

[0038] In another embodiment, the heterologous polynucleotide comprises the nucleotide sequence of SEQ ID NO: 6. In a preferred embodiment, the heterologous polynucleotide consists of the nucleotide sequence of SEQ ID NO: 6. In another embodiment, the heterologous polynucleotide comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 6. In a preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 6. In another preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence in which one or more nucleotides have been deleted, substituted, added, or inserted relative to the nucleotide sequence of SEQ ID NO: 6. However, these heterologous polynucleotides comprise AGGAGG (SEQ ID NO: 1) at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 6. Preferably, these heterologous polynucleotides comprise AGGAGGTAATATG (SEQ ID NO: 2) at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 6.

[0039] SEQ ID NO: 3: AATATTAGGAGGTAATATG SEQ ID NO: 4: GTTTTTTTAAAACTTTAACGAAAGCACTTTCGGTAATGCTTATGAATTTAGCTAT TTGATTCAATTACTTTAAAAATATTTAGGAGGTAATATG SEQ ID NO: 5: TAATTTTAGGAGGTAATATG SEQ ID NO: 6: TAATTTAAGGAGGTAATATG

[0040] The heterologous polynucleotide can be prepared according to genetic engineering techniques known in the art. For example, the heterologous polynucleotide can be isolated from the genome of a Bacillus bacterium (e.g., KSM-S237) according to known techniques. Alternatively, a heterologous polynucleotide having a desired nucleotide sequence can be prepared by mutagenesis of the isolated polynucleotide according to known techniques. Methods for deleting, substituting, inserting, or adding nucleotides to a nucleotide sequence are described, for example, in Dieffenbach et al. (Cold Spring Harbor Laboratory Press, New York, 581-621, 1995). Alternatively, the heterologous polynucleotide can be chemically synthesized. Commercially available DNA synthesis services can be used for chemically synthesizing polynucleotides.

[0041] The parent 5'UTR to be modified with the heterologous polynucleotide is preferably a 5'UTR contained in a promoter of a Bacillus gene. The promoter is preferably a highly functional promoter that exhibits high transcription-promoting activity in Bacillus bacteria. Examples of such promoters include those from genes encoding secreted proteins of Bacillus bacteria, such as the endoglucanase gene of Bacillus sp. KSM-64, the endoglucanase gene of Bacillus sp. KSM-S237, the aprE, nprE, and amyE genes of Bacillus subtilis, and the B. Examples of the promoter include a promoter of a gene selected from the group consisting of amyL and amyQ from B. licheniformis; a promoter of the spoVG gene from Bacillus subtilis; a promoter of a ribosomal RNA gene and a ribosome-related gene, such as a promoter of a gene selected from the group consisting of rrnO, rrnE, rrnI, rrnJ, rrnB, rpsD, rpsJ, and rpoD; a promoter of a cry crystal protein gene from B. thuringensis, such as the cryIIIA gene; and a P43 promoter, SP82 promoter, or scr promoter from Bacillus genus, provided that the parent 5'UTR does not have the sequence of SEQ ID NO:70.

[0042] Preferably, the parent 5'UTR is derived from a promoter of a gene different from the gene from which the heterologous polynucleotide is derived. For example, when the heterologous polynucleotide comprises the nucleotide sequence of SEQ ID NOs: 3 to 6, the parent 5'UTR is preferably not the 5'UTR of the alkaline cellulase gene of Bacillus sp. KSM-S237.

[0043] The parent 5'UTR may be present in the genome of a cell, in an isolated polynucleotide fragment (e.g., an isolated promoter-containing region fragment), or contained in a vector such as an expression vector. For example, a heterologous polynucleotide can be directly substituted for or added to the parent 5'UTR in the genome of a cell by homologous recombination or the like. Alternatively, a modified 5'UTR can be constructed by substituting or adding a heterologous polynucleotide to the parent 5'UTR in a promoter fragment isolated from the genome or to the parent 5'UTR on an expression vector.

[0044] The substitution or addition of the heterologous polynucleotide to the parent 5'UTR can be performed according to conventional methods in the art. For example, a fragment containing the parent 5'UTR and a fragment containing the heterologous polynucleotide can be amplified by PCR or the like, and the resulting fragments can be ligated by SOE (splicing by overlap extension)-PCR (Gene, 1989, 77(1): pp. 61-68) to construct a modified 5'UTR. Alternatively, the modified 5'UTR can be constructed by inverse PCR using a vector containing the heterologous polynucleotide as a template and primers encoding the polynucleotide of the modified 5'UTR.

[0045] In a preferred embodiment, the resulting modified 5'UTR contains the heterologous polynucleotide at its 3'-end. That is, the heterologous polynucleotide is added to the 3'-end of the parent 5'UTR, or the 3'-end of the parent 5'UTR is replaced with the heterologous polynucleotide. Preferably, the modified 5'UTR is constructed by replacing the 3'-end of the parent 5'UTR with the heterologous polynucleotide, resulting in the loss of one or more nucleotides at the 3'-end of the parent 5'UTR. The length of the 3'-end portion of the parent 5'UTR replaced with the heterologous polynucleotide is not particularly limited and may be, for example, 20 nt or more, and may even replace the entire parent 5'UTR.

[0046] In a preferred embodiment, the modified 5'UTR is constructed by replacing at least 20 nucleotides at the 3' end (1 to 20 nucleotides from the 3' end) of the parent 5'UTR with the heterologous polynucleotide, but does not include at least 20 nucleotides at the 3' end of the parent 5'UTR. In another preferred embodiment, the modified 5'UTR is constructed by replacing at least 26 nucleotides at the 3' end (1 to 26 nucleotides from the 3' end) of the parent 5'UTR with the heterologous polynucleotide, but does not include at least 26 nucleotides at the 3' end of the parent 5'UTR. In another preferred embodiment, the modified 5'UTR is constructed by replacing the region from the SD sequence (i.e., the sequence consisting of GGAGG) to the 3' end of the parent 5'UTR with the heterologous polynucleotide, but does not include the region from the SD sequence to the 3' end of the parent 5'UTR. In another preferred embodiment, the modified 5'UTR is constructed by replacing the region of the parent 5'UTR from the sequence consisting of AGGAGG (SEQ ID NO: 1) to the 3' end with the heterologous polynucleotide, and does not include the region of the parent 5'UTR from the sequence consisting of SEQ ID NO: 1 to the 3' end. In another preferred embodiment, the modified 5'UTR consists of the heterologous polynucleotide. That is, the entire parent 5'UTR is replaced with the heterologous polynucleotide.

[0047] The modified 5'UTR obtained by the present invention does not need to contain the SD sequence of the parent 5'UTR, but may contain it. The length of the modified 5'UTR obtained by the present invention is not particularly limited, as long as it can exert the effect of improving gene expression.

[0048] In a further embodiment of the present invention, the modified 5'UTR may further comprise at least one additional ribosome binding region (RBS) (i.e., a heterologous RBS). The heterologous RBS is located upstream of the SD sequence GGAGG contained in the modified 5'UTR. Preferably, the heterologous RBS is located upstream of the region consisting of AGGAGG (SEQ ID NO: 1) contained in the modified 5'UTR. More preferably, the heterologous RBS is located 8 or more nucleotides upstream of the region consisting of AGGAGG (SEQ ID NO: 1) contained in the modified 5'UTR. Even more preferably, the heterologous RBS is located upstream of the heterologous polynucleotide contained in the modified 5'UTR. When two or more heterologous RBSs are present, all of them are located upstream of the SD sequence contained in the modified 5'UTR, preferably upstream of the region consisting of SEQ ID NO: 1, more preferably 8 or more nucleotides upstream of the region consisting of SEQ ID NO: 1, and even more preferably upstream of the heterologous polynucleotide. When the modified 5'UTR contains two or more SD sequences, for example, when it contains an SD sequence derived from the parent 5'UTR and the heterologous polynucleotide, the heterologous RBS is positioned upstream of all of them. As used herein, the expression "positioned upstream of a certain region (or sequence)" refers to the RBS being positioned so that its 3' end is located upstream of the 5' end of the region (or sequence). Also, as used herein, the expression "positioned N nucleotides upstream of a certain region (or sequence)" refers to the RBS being positioned so that its 3' end is located N nucleotides upstream of the 5' end of the region (or sequence).

[0049] In one embodiment, the modified 5'UTR does not contain the SD sequence derived from the parent 5'UTR, and the heterologous RBS is positioned 8 or more nucleotides upstream of the AGGAGG (SEQ ID NO: 1) region derived from the heterologous polynucleotide contained in the modified 5'UTR. When two or more heterologous RBSs are present, all of them are positioned 8 or more nucleotides upstream of the AGGAGG (SEQ ID NO: 1) region derived from the heterologous polynucleotide.

[0050] In another embodiment, the modified 5'UTR does not contain the SD sequence from the parent 5'UTR, and the heterologous RBS is located upstream of the heterologous polynucleotide contained in the modified 5'UTR. If there is more than one heterologous RBS, all of them are located upstream of the heterologous polynucleotide.

[0051] The heterologous RBS is a polynucleotide comprising the nucleotide sequence AGGAGG (SEQ ID NO: 1). Examples of the heterologous RBS include a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of any one of the nucleotide sequences of SEQ ID NOs: 7 to 11, and a polynucleotide consisting of a nucleotide sequence in which one or more nucleotides have been deleted, substituted, added, or inserted relative to the nucleotide sequence of any one of SEQ ID NOs: 1 and 7 to 11, provided that the nucleotide sequence comprises AGGAGG (SEQ ID NO: 1). SEQ ID NO: 7: AGGAGGGA SEQ ID NO: 8: GAAAGGAGG SEQ ID NO: 9: GAAAGGAGGGA SEQ ID NO: 10: CGAAAGGAGGGAT SEQ ID NO: 11: CTTGAAAGGAGGGATGCCTAA

[0052] At least one of the heterologous RBSs is located 10 to 100 nucleotides downstream, preferably 10 to 60 nucleotides downstream, and more preferably 13 to 55 nucleotides downstream, from the transcription start point upstream of the modified 5'UTR (or the transcription start point of a modified promoter comprising the modified 5'UTR, as described below). When two or more heterologous RBSs are present, the insertion positions of the remaining RBSs are not particularly limited, but are preferably located 10 to 150 nucleotides downstream, more preferably 10 to 100 nucleotides downstream, even more preferably 10 to 60 nucleotides downstream, and even more preferably 13 to 55 nucleotides downstream from the transcription start point. As used herein, the phrase "the RBS is located N nucleotides downstream from the transcription start point" means that the 5' end of the RBS is located N nucleotides downstream from the 3' end of the transcription start point.

[0053] The modified 5'UTR containing the heterologous RBS can be constructed by substituting, inserting, or adding a polynucleotide for the heterologous RBS into the modified 5'UTR containing the heterologous polynucleotide. For example, the polynucleotide for the heterologous RBS can be substituted, inserted, or added upstream of the SD sequence or heterologous polynucleotide region contained in the modified 5'UTR. Alternatively, the modified 5'UTR containing the heterologous RBS can be constructed by substituting, inserting, or adding a polynucleotide for the heterologous RBS into the parent 5'UTR, and then substituting or adding the heterologous polynucleotide downstream of the polynucleotide. Alternatively, the modified 5'UTR containing the heterologous RBS can be constructed by substituting, inserting, or adding the polynucleotide for the heterologous RBS and a fragment containing the heterologous polynucleotide, starting from the upstream, for part or all of the parent 5'UTR. The procedure for substituting, inserting, or adding a polynucleotide for the heterologous RBS into the parent 5'UTR or modified 5'UTR can be performed according to known methods, such as the SOE-PCR and inverse PCR described above.

[0054] The modified 5'UTR obtained by the present invention functions to improve the expression of a gene controlled by a promoter containing the modified 5'UTR. Specifically, the modified 5'UTR is positioned downstream of the transcription start site in the promoter and upstream of the ORF of the gene, and is operably linked to the ORF of the gene.

[0055] In a preferred embodiment, the present invention provides a modified promoter comprising the modified 5'UTR. The modified promoter is produced by modifying the 5'UTR contained in a promoter (parent promoter) comprising a parent 5'UTR that does not contain the heterologous polynucleotide. The modification of the 5'UTR is carried out by replacing part or all of the 5'UTR with a heterologous polynucleotide, or by adding the heterologous polynucleotide to the 5'UTR. The modification of the 5'UTR may further include substituting, inserting, or adding a heterologous RBS into the 5'UTR. The heterologous polynucleotide and heterologous RBS used in the modification, as well as the techniques for substituting, inserting, or adding a heterologous polynucleotide or heterologous RBS into the 5'UTR, are as described above. Therefore, the heterologous polynucleotide and heterologous RBS contained in the modified promoter are heterologous (derived from a different polynucleotide strand) to the parent promoter. Preferably, the heterologous polynucleotide contained in the modified promoter is derived from a gene different from that of the parent promoter.

[0056] The parent promoter to be modified may be a promoter derived from the regulatory region of any gene, but is preferably a promoter of a Bacillus gene. The parent promoter is preferably a highly functional promoter capable of exhibiting high transcription-promoting activity in Bacillus bacteria. Preferred examples of the parent promoter include genes encoding secreted proteins of Bacillus bacteria, such as the endoglucanase gene of Bacillus sp. KSM-64, the endoglucanase gene of Bacillus sp. KSM-S237, the aprE, nprE, and amyE genes of Bacillus subtilis, and the B. Examples of promoters include promoters of genes selected from the group consisting of amyL and amyQ from Bacillus licheniformis; promoters of the Bacillus subtilis spoVG gene; promoters of ribosomal RNA genes and ribosome-related genes, such as promoters of genes selected from the group consisting of rrnO, rrnE, rrnI, rrnJ, rrnB, rpsD, rpsJ, and rpoD; promoters of cry crystal protein genes, such as the cryIIIA gene from B. thuringensis; P43 promoter, SP82 promoter, scr promoter, and modified promoters derived therefrom. Preferred examples include the promoter derived from the alkaline cellulase gene of Bacillus sp. KSM-64 shown in SEQ ID NO:72 and the promoter of the Bacillus subtilis spoVG gene shown in SEQ ID NO:76. Other preferred examples of parent promoters include a polynucleotide consisting of a nucleotide sequence having at least 80% identity to the nucleotide sequence shown in SEQ ID NO: 72 and having the function of regulating gene expression, or a polynucleotide consisting of a nucleotide sequence having at least 80% identity to the nucleotide sequence shown in SEQ ID NO: 76 and having the function of regulating gene expression. The function of a promoter polynucleotide to regulate gene expression can be measured by known methods.

[0057] The parent promoter may be present in the genome of a cell, may be an isolated polynucleotide fragment, or may be contained in a vector such as an expression vector. For example, a modified promoter fragment can be constructed by preparing a polynucleotide fragment of a parent promoter from a Bacillus bacterium and replacing part or all of the 5'UTR contained in the parent promoter fragment with a heterologous polynucleotide or adding a heterologous polynucleotide to the 5'UTR. Alternatively, a modified promoter can be constructed in the genome of a Bacillus bacterium by modifying the 5'UTR contained in the parent promoter in the genome of the Bacillus bacterium by replacing part or all of the 5'UTR with a heterologous polynucleotide or adding a heterologous polynucleotide to the 5'UTR, for example, by homologous recombination. Alternatively, a modified promoter can be constructed in the genome of a Bacillus bacterium by replacing a promoter in the genome of the Bacillus bacterium with a modified promoter containing the modified 5'UTR, for example, by homologous recombination.

[0058] When placed in a promoter, the modified 5'UTR functions to improve gene expression. A modified promoter containing the modified 5'UTR can further improve gene expression compared to a parent promoter containing the unmodified parent 5'UTR (i.e., the promoter before being modified to include the modified 5'UTR). Preferably, a modified promoter containing the modified 5'UTR increases gene expression by at least 10%, preferably at least 20%, more preferably at least 25%, and even more preferably at least 30% compared to the parent promoter. When the modified 5'UTR includes the heterologous RBS described above, the modified promoter can further improve gene expression, preferably by at least 40%, more preferably at least 50%, even more preferably at least 100%, even more preferably at least 200%, even more preferably at least 300%, and even more preferably at least 400% compared to the parent promoter.

[0059] The modified 5'UTR and a modified promoter containing the same can be used to improve expression of a gene of interest. Thus, the present invention provides polynucleotides containing the modified 5'UTR or a modified promoter containing the same, as well as uses thereof for expressing a gene of interest. Preferably, the polynucleotide is DNA.

[0060] In one embodiment, the polynucleotide comprising the modified 5'UTR or modified promoter can be directly introduced into the genome of a host cell, for example, the polynucleotide comprising the modified 5'UTR or modified promoter can be introduced into the genome of a host cell and operably linked to the gene of interest.

[0061] In one embodiment, the polynucleotide comprising the modified 5'UTR or modified promoter is an expression cassette. In addition to the modified 5'UTR or modified promoter, the expression cassette may also comprise a cis-element that improves the transcriptional activity of the promoter, a 3'UTR, or the like. Furthermore, the expression cassette may also comprise a selectable marker gene such as a drug resistance gene or an auxotrophic marker gene.

[0062] In one embodiment, the polynucleotide comprising the modified 5'UTR or modified promoter further comprises a gene of interest, wherein the gene of interest is operably linked to the modified 5'UTR or modified promoter.

[0063] In one embodiment, the expression cassette is an expression vector. For example, the expression vector can be prepared by inserting a polynucleotide containing the modified 5'UTR or modified promoter into any vector using standard methods. For example, the polynucleotide is constructed to have restriction enzyme recognition sequences at both ends. The expression vector of the present invention can be constructed by incorporating this into an expression vector that has been cleaved with a restriction enzyme (restriction enzyme method). Preferably, in the expression vector, the modified 5'UTR or modified promoter is operably linked upstream of the polynucleotide of the gene of interest.

[0064] The type of the vector is not particularly limited and may be any vector, such as a plasmid, phage, phagemid, cosmid, virus, YAC vector, or shuttle vector. The vector may be a vector for introduction into the genome of a host cell, or a vector maintained outside the genome. The vector is preferably a vector that can be amplified in bacteria, more preferably in Bacillus bacteria (e.g., Bacillus subtilis or a mutant thereof). Preferably, the vector is an expression vector that can induce expression of an introduced gene in Bacillus bacteria.

[0065] Examples of the vector include pBluescript II SK(-) (Stratagene), pUC vectors such as pUC18 / 19 and pUC118 / 119 (Takara Bio), pET vectors (Takara Bio), pGEX vectors (GE Healthcare), pCold vectors (Takara Bio), pHY300PLK (Takara Bio), pUB110 (Plasmid, 1986, 15(2):93-103), pBR322 (Takara Bio), and pRS 403 (Stratagene), pMW-based vectors such as pMW118 / 119 and pMW218 / 219 (Nippon Gene), pRI-based vectors such as pRI909 / 910 (Takara Bio), pBI-based vectors (Clontech), IN3-based vectors (Implanta Innovations), pPTR1 / 2 (Takara Bio), pDJB2 (Gene, 1985, 36: 321-331), pAB4-1 (Mol Gen Genet, 1987, 206: 71-75), pLeu4 (Gene, 1989, 84: 335-343), pPyr225 (Mol Genet Genomics, 2002, 268: 397-406), pFG1 (Curr Genet, 1990, 18: 447-451), yeast expression vector pNAN8142 (Biosci Biotechnol Biochem, 1996, 60: 383-389), pMA91 (Biosci Biotechnol Biochem, 1998, 62: 1615-1618), and the like.

[0066] The present invention also provides a transformant containing a polynucleotide comprising the modified 5'UTR or modified promoter. The transformant can be produced by introducing a polynucleotide comprising the modified 5'UTR or modified promoter into a host.

[0067] Examples of hosts for the transformant include microbial cells, preferably bacteria of the genus Bacillus, bacteria of the genus Clostridium, yeast, Escherichia coli, etc., of which bacteria of the genus Bacillus are preferred, and Bacillus subtilis or a mutant thereof is more preferred. Therefore, the transformant of the present invention is preferably a recombinant Bacillus, more preferably a recombinant of Bacillus subtilis or a mutant thereof.

[0068] To introduce a polynucleotide comprising the modified 5'UTR or modified promoter into a host cell, well-known transformation techniques can be applied, such as the calcium phosphate method, electroporation, lipofection, particle gun method, PEG method, etc. For example, methods applicable to Bacillus subtilis or a mutant strain thereof include competent cell transformation (J Bacteriol, 1967, 93:1925-1937), electroporation (FEMS Microbiol Lett, 1990, 55:135-138), protoplast transformation (Mol Gen Genet, 1979, 168:111-115), and Tris-PEG method (J Bacteriol, 1983, 156:1130-1134).

[0069] The transformant can be used to express a gene of interest. In the cells of the transformant, the modified 5'UTR or modified promoter improves the expression of the gene of interest operably linked thereto, thereby improving the productivity of the target substance by the transformant. For example, a transformant cell containing an expression cassette including a modified promoter containing the modified 5'UTR and a gene of interest increases the expression level of the gene of interest by preferably at least 10%, more preferably at least 20%, and even more preferably at least 30%, when the expression level of the gene of interest in a cell containing an expression cassette including a parent promoter and a gene of interest is taken as 100%. Furthermore, when the modified 5'UTR contains the heterologous RBS described above, the expression level of the gene of interest can be further improved. For example, a transformed cell containing an expression cassette comprising a modified promoter containing a modified 5'UTR containing a heterologous RBS and a gene of interest preferably increases the expression level of the gene of interest by at least 50%, more preferably at least 100%, even more preferably at least 200%, even more preferably at least 300%, and even more preferably at least 400%, when the expression level of the gene of interest in a cell containing an expression cassette comprising a parent promoter and a gene of interest is taken as 100%.

[0070] Therefore, the present invention also provides a method for producing a target substance, which comprises culturing the transformant. The transformant can be cultured according to a method commonly used in the art. For example, when the transformant is Bacillus subtilis or a mutant thereof, the culture medium may contain a carbon source and an inorganic or organic nitrogen source necessary for the growth of Bacillus subtilis. If necessary, the medium may also contain other nutrients, such as inorganic salts, vitamins, antibiotics, etc. Culture conditions, such as temperature, aeration and agitation conditions, medium pH, and culture time, can be appropriately selected depending on the species and characteristics of the microorganism, the culture scale, etc.

[0071] After culturing, the target substance can be recovered from the culture. If necessary, the recovered target substance may be further purified. The method for recovering or purifying the target substance from the culture is not particularly limited, and may be performed according to a known recovery or purification method. For example, the culture may be recovered, and if necessary, cells may be disrupted by ultrasound, pressure, or the like. Subsequently, cellular components may be removed by decantation, filtration, centrifugation, or the like, and the remaining fraction containing the target substance may be recovered. Alternatively, the target substance can be produced and secreted outside the cells by operably linking a polynucleotide encoding a secretory signal peptide that functions in the transformant to a gene encoding the target substance. In this case, a fraction containing the target substance can be recovered without disrupting the cells.

[0072] If necessary, the target substance can be purified by subjecting the recovered fraction containing the target substance to dialysis, salting out, ion exchange, distillation, solvent extraction, or a combination of these. In the method for producing a target substance according to the present invention, the culture of the transformant and the collection of the target substance may be carried out by any of a batch system, a semi-batch system, and a continuous system.

[0073] As exemplary embodiments of the present invention, the following substances, manufacturing methods, uses, methods, etc. are further disclosed herein, but the present invention is not limited to these embodiments.

[0074] [1] A DNA molecule comprising a modified promoter, wherein the modified promoter comprises a modified 5'UTR containing a heterologous polynucleotide, and the heterologous polynucleotide is a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 70, or a nucleotide sequence having at least 80% identity to said sequence. [2] Preferably, the heterologous polynucleotide is any of the following polynucleotides a), c), and d): a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 80% identity to said sequence; c) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 5, or a nucleotide sequence having at least 80% identity to said sequence; d) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 80% identity to said sequence. [3] The DNA molecule of [2], preferably, the polynucleotide of a) comprises: b) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence having at least 80% identity to said sequence, or a fragment thereof. [4] The DNA molecule of any one of [1] to [3], wherein the heterologous polynucleotide preferably comprises the nucleotide sequence of SEQ ID NO: 1 at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 70, more preferably comprises the nucleotide sequence of SEQ ID NO: 1 at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 3 or at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 5 or 6, or preferably comprises the nucleotide sequence of SEQ ID NO: 2 at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 70, more preferably comprises the nucleotide sequence of SEQ ID NO: 2 at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 3 or at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 5 or 6. [5] The DNA molecule of any one of [1] to [4], wherein the heterologous polynucleotide is preferably 100 nt or less in length.[6] The DNA molecule according to any one of [1] to [5], wherein the modified 5'UTR is preferably a DNA sequence in which a part or all of the pre-modification 5'UTR has been replaced with the heterologous polynucleotide, or a DNA sequence in which the heterologous polynucleotide has been added to the pre-modification 5'UTR. [7] The DNA molecule according to any one of [1] to [6], wherein the heterologous polynucleotide is preferably located at the 3' end of the modified 5'UTR. [8] The DNA molecule according to [7], wherein the modified 5'UTR preferably does not include at least 20 nucleotides from the 3' end of the pre-modification 5'UTR, does not include at least 26 nucleotides from the 3' end of the 5'UTR, or does not include the region from the Shine-Dalgarno (SD) sequence to the 3' end of the 5'UTR. [9] The DNA molecule according to any one of [1] to [8], wherein the modified 5'UTR preferably contains a heterologous ribosome binding region in addition to the heterologous polynucleotide, and the ribosome binding region is located upstream of the region consisting of the nucleotide sequence of SEQ ID NO: 1 contained in the modified 5'UTR.

[10] The DNA molecule according to [9], wherein the heterologous ribosome binding region is preferably located upstream of the heterologous polynucleotide.

[11] The DNA molecule of [9] or

[10] , preferably wherein the modified 5'UTR contains one heterologous ribosome binding region, and the heterologous ribosome binding region is located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, or wherein the modified 5'UTR contains two or more heterologous ribosome binding regions, and at least one of the two or more heterologous ribosome binding regions is located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, and the rest are located 10 to 150 nucleotides downstream from the transcription start point.

[12] The DNA molecule of any one of [1] to

[11] , preferably wherein the parent promoter of the modified promoter is a promoter derived from the genus Bacillus.

[13] The DNA molecule according to

[12] , wherein the parent promoter is preferably a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 72 or a nucleotide sequence having at least 80% identity thereto, or a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 76 or a nucleotide sequence having at least 80% identity thereto.

[14] The DNA molecule according to any one of [1] to

[13] , wherein the modified promoter is preferably consisting of the nucleotide sequences of SEQ ID NOs: 73, 74, 75, 77, 78, 79, and 80.

[15] The DNA molecule according to any one of [1] to

[14] , further comprising a gene of interest, wherein the gene of interest is a polynucleotide encoding a substance of interest or a substance involved in the biosynthesis or extracellular transport thereof.

[16] The DNA molecule according to

[15] , wherein the substance of interest is preferably an enzyme or an insecticidal protein, and more preferably a protease, lipase, amylase, or Cry5B.

[17] The DNA molecule of

[15] or

[16] , which is preferably an expression cassette or an expression vector.

[18] A transformant containing the DNA molecule of any one of [1] to

[17] .

[19] The transformant of

[18] , which contains the DNA molecule of

[17] , which is an expression cassette containing the modified promoter and further containing a gene of interest, and which increases the expression level of the gene of interest by preferably at least 10%, more preferably at least 20%, even more preferably at least 30%, even more preferably at least 50%, even more preferably at least 100%, even more preferably at least 200%, even more preferably at least 300%, and even more preferably at least 400%, when the expression level of the gene of interest in a cell containing an expression cassette containing a parent promoter of the modified promoter and further containing the gene of interest is taken as 100%.

[20] The transformant of

[18] or

[19] , which is preferably a bacterium of the genus Bacillus.

[21] A method for producing a target substance, comprising culturing the transformant according to any one of

[18] to

[20] .

[0075]

[22] A method for producing a modified promoter, the method comprising modifying a 5'UTR contained in a parent promoter, wherein the modification of the 5'UTR comprises replacing part or all of the 5'UTR with a heterologous polynucleotide or adding the heterologous polynucleotide to the 5'UTR, the heterologous polynucleotide being a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 70 or a nucleotide sequence having at least 80% identity to said sequence, and the parent promoter being a promoter comprising a 5'UTR that does not comprise the heterologous polynucleotide.

[23] The method of

[22] , wherein the heterologous polynucleotide is preferably any of the following polynucleotides a), c), and d): a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 80% identity to said sequence; c) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 5, or a nucleotide sequence having at least 80% identity to said sequence; d) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 80% identity to said sequence.

[24] The method of

[23] , wherein the polynucleotide of a) preferably comprises: b) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence having at least 80% identity to said sequence, or a fragment thereof.

[25] The method according to any one of

[22] to

[24] , wherein the heterologous polynucleotide: preferably comprises the nucleotide sequence of SEQ ID NO: 1 at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 70, more preferably comprises the nucleotide sequence of SEQ ID NO: 1 at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 3 or positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 5 or 6, or preferably comprises the nucleotide sequence of SEQ ID NO: 2 at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 70, more preferably comprises the nucleotide sequence of SEQ ID NO: 2 at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 3 or positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 5 or 6.

[26] The method according to any one of

[22] to

[25] , preferably wherein the heterologous polynucleotide is 100 nt or less in length.

[27] The method according to any one of

[22] to

[26] , preferably wherein the modification of the 5'UTR comprises substituting or adding the heterologous polynucleotide to the 5'UTR so that the heterologous polynucleotide is located at the 3' end of the modified 5'UTR.

[28] The method according to

[27] , preferably wherein the modification of the 5'UTR comprises substituting at least 20 nucleotides at the 3' end of the 5'UTR with the heterologous polynucleotide, substituting at least 26 nucleotides at the 3' end of the 5'UTR with the heterologous polynucleotide, or substituting the region from the Shine-Dalgarno (SD) sequence to the 3' end of the 5'UTR with the heterologous polynucleotide.

[29] The method according to any one of

[22] to

[28] , wherein the modification of the 5'UTR preferably further comprises substituting, inserting, or adding a ribosome binding region into the 5'UTR, and the ribosome binding region is located upstream of a region comprised of the nucleotide sequence of SEQ ID NO: 1 contained in the 5'UTR.

[30] The method according to

[29] , wherein the heterologous ribosome binding region is located upstream of the heterologous polynucleotide.

[31] The method according to

[29] or

[30] , preferably, wherein the modification of the 5'UTR comprises substituting, inserting, or adding one ribosome binding region into the 5'UTR, and the ribosome binding region is positioned 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, or wherein the modification of the 5'UTR comprises substituting, inserting, or adding two or more ribosome binding regions into the 5'UTR, and at least one of the two or more ribosome binding regions is positioned 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, and the rest are positioned 10 to 150 nucleotides downstream from the transcription start point.

[32] The method according to any one of

[22] to

[31] , preferably, wherein the parent promoter is a promoter derived from the genus Bacillus.

[33] The method described in

[32] , wherein the parent promoter is preferably a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 72 or a nucleotide sequence having at least 80% identity to said sequence, or a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 76 or a nucleotide sequence having at least 80% identity to said sequence.

[0076] The present invention will be described in more detail below with reference to the following examples. In the following examples and figures, a.u. means arbitrary unit.

[0077] Example 1: Construction of a Plasmid for Introducing the KP43 Protease Expression Cassette A plasmid for introducing a protease expression cassette into the amyE locus in the B. subtilis genome by homologous recombination was constructed as follows. A vector fragment was amplified by PCR using the pMW119 plasmid as a template and a forward primer (SEQ ID NO: 12) and a reverse primer (SEQ ID NO: 13). Next, an insert fragment was amplified from the ORF sequence of the amyE gene by PCR using the B. subtisli strain 168 genome as a template and a forward primer (SEQ ID NO: 14) and a reverse primer (SEQ ID NO: 15). The vector fragment and insert fragment were ligated by an in-fusion reaction and transformed into Escherichia coli to obtain the pMW-amy plasmid. A vector fragment was amplified by PCR using the pMW-amy plasmid as a template and a forward primer (SEQ ID NO: 16) and a reverse primer (SEQ ID NO: 17). Next, an insert fragment containing the ORF sequence of the spectinomycin resistance gene was amplified by PCR using the kao119 strain genome (Japanese Patent No. 6088282) as a template and a forward primer (SEQ ID NO: 18) and a reverse primer (SEQ ID NO: 19). The vector fragment and insert fragment were ligated by an in-fusion reaction, and transformed into Escherichia coli to obtain the pMW-amy-sp plasmid.

[0078] A vector fragment was amplified by PCR using the pMW-amy-sp plasmid as a template and a forward primer (SEQ ID NO: 16) and a reverse primer (SEQ ID NO: 20).SP64 An insert fragment was amplified by PCR using -TS43 (SEQ ID NO: 71) as a template and a forward primer (SEQ ID NO: 21) and a reverse primer (SEQ ID NO: 22). This insert fragment contained a synthetic promoter (P SP64 The vector fragment and the insert fragment were ligated by in-fusion reaction, and transformed into Escherichia coli to obtain the pMW-TS43 plasmid.

[0079] Example 2 Construction of a Plasmid for Introducing a KP43 Protease Expression Cassette Containing a Modified 5'UTR The promoter (P SP64 ) 5'UTR (UTR SP64 ) was modified. 1) Using the pMW-TS43 plasmid as a template, a vector fragment was amplified by PCR using a forward primer (SEQ ID NO: 23) and a reverse primer (SEQ ID NO: 24). Next, an insert fragment containing the sequence of SEQ ID NO: 4 was amplified by PCR using pHY-YR288 (JP 2022-019601 A) as a template and a forward primer (SEQ ID NO: 25) and a reverse primer (SEQ ID NO: 26). The sequence of SEQ ID NO: 4 was a partial fragment (94 nt) of the 5'UTR contained in the promoter of the endoglucanase gene derived from KSM-S237. The vector fragment and insert fragment were ligated by an in-fusion reaction and transformed into E. coli to obtain pMW-UTR. S237 The pMW-UTR-a-TS43 plasmid was obtained. S237 The promoter contained in the -a-TS43 plasmid is P SP64 -UTR S237 It is written as -a.

[0080] 2) Furthermore, a fragment was constructed by inverse PCR using pMW-TS43 as a template and a forward primer (SEQ ID NO: 27) and a reverse primer (SEQ ID NO: 28), and the fragment was transformed into E. coli to obtain pMW-UTR. S237 Furthermore, a fragment was constructed by inverse PCR using a forward primer (SEQ ID NO: 29) and a reverse primer (SEQ ID NO: 30) as a template for pMW-TS43, and the fragment was transformed into E. coli to obtain pMW-UTR. S237 -c-TS43 plasmid was obtained.

[0081] pMW-UTR S237 -a-TS43, pMW-UTR S237 -b-TS43, and pMW-UTR S237 -Promoter P contained in c-TS43 SP64 -UTR S237 -a (SEQ ID NO: 73), P SP64 -UTR S237 -b (SEQ ID NO: 74), and P SP64 -UTR S237 -c (SEQ ID NO: 75) each had a modified 5'UTR as shown in Figure 1. SP64 -UTR S237 -a has the sequence of SEQ ID NO: 4 (hatched portion) at the 3' end of the 5'UTR region, SP64 -UTR S237 -b and P SP64 -UTR S237 -c each had the sequence of SEQ ID NO: 3 (hatched portion) at the 3' end of the 5'UTR.

[0082] Example 3 Construction of a Plasmid for Introducing a spoVG Expression Cassette Containing a Modified 5'UTR The promoter of the pMW-TS43 plasmid constructed in Example 1 was substituted with the promoter of the spoVG gene of B. subtisli strain 168 (P spoVGThe promoter (P) of the spoVG gene of B. subtisli strain 168 was replaced with the promoter (P spoVG The vector fragment and the insert fragment were ligated by in-fusion reaction, and transformed into E. coli to produce pMW-P spoVG -TS43 plasmid was obtained.

[0083] The pMW-P spoVG -P in TS43 plasmid spoVG 5'UTR region (UTR spoVG ) was modified. spoVG A fragment was constructed by inverse PCR using -TS43 as a template and a forward primer (SEQ ID NO: 35) and a reverse primer (SEQ ID NO: 36), and the fragment was transformed into E. coli to produce pMW-P spoVG -UTR S237 As shown in Figure 2, the control region P spoVG -UTR S237 (SEQ ID NO: 77) had the entire 5'UTR of the parent promoter replaced with the sequence of SEQ ID NO: 3 (hatched portion).

[0084] Example 4 Construction of a Plasmid for Introducing an Amylase Expression Cassette Containing a Modified 5'UTR A YR288 amylase expression cassette was constructed as follows. Using the pMW-TS43 plasmid constructed in Example 1 as a template, a vector fragment was amplified by PCR using a forward primer (SEQ ID NO: 23) and a reverse primer (SEQ ID NO: 37). Next, using pHY-YR288 (JP Patent Publication No. 2022-019601) as a template, a forward primer (SEQ ID NO: 38) and a reverse primer (SEQ ID NO: 39) was used to amplify an insert fragment containing the ORF sequence of the YR288 amylase gene. The vector fragment and insert fragment were ligated by an in-fusion reaction, and transformed into E. coli to produce pMW-P SP64 The -YR288 plasmid was obtained.

[0085] pMW-UTR constructed in Example 2 S237 A vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 23) and reverse primer (SEQ ID NO: 40) with the pHY-a-TS43 plasmid as a template. Next, an insert fragment containing the ORF sequence of the YR288 amylase gene was amplified by PCR using the forward primer (SEQ ID NO: 41) and reverse primer (SEQ ID NO: 39) with the pHY-YR288 as a template. The vector fragment and insert fragment were ligated by an in-fusion reaction, and transformed into E. coli to produce pMW-P SP64 -UTR S237 -a-YR288 plasmid was obtained.

[0086] pMW-P constructed in Example 3 spoVG A vector fragment was amplified by PCR using -TS43 as a template and a forward primer (SEQ ID NO: 23) and a reverse primer (SEQ ID NO: 42). Next, an insert fragment containing the ORF sequence of the YR288 amylase gene was amplified by PCR using pHY-YR288 as a template and a forward primer (SEQ ID NO: 43) and a reverse primer (SEQ ID NO: 39). The vector fragment and insert fragment were ligated by an in-fusion reaction, and transformed into E. coli to produce pMW-P spoVG The -YR288 plasmid was obtained.

[0087] pMW-P constructed in Example 3 spoVG -UTR S237 A vector fragment was amplified by PCR using -TS43 as a template and a forward primer (SEQ ID NO: 23) and a reverse primer (SEQ ID NO: 44). Next, an insert fragment containing the ORF sequence of the YR288 amylase gene was amplified by PCR using pHY-YR288 as a template and a forward primer (SEQ ID NO: 41) and a reverse primer (SEQ ID NO: 39). The vector fragment and insert fragment were ligated by an in-fusion reaction and transformed into E. coli to produce pMW-P spoVG -UTR S237 The -YR288 plasmid was obtained.

[0088] pMW-P spoVG -UTR S237 A fragment was constructed by inverse PCR using the -YR288 plasmid as a template and a forward primer (SEQ ID NO: 45) and a reverse primer (SEQ ID NO: 46), and the fragment was transformed into E. coli to obtain pMW-P spoVG -UTR S237 The pMW-P-mut1-YR288 plasmid was also obtained. spoVG -UTR S237 A fragment was constructed by inverse PCR using -YR288 as a template and a forward primer (SEQ ID NO: 47) and a reverse primer (SEQ ID NO: 48), and the fragment was transformed into E. coli to produce pMW-P spoVG -UTR S237 The control region P of these plasmids was spoVG -UTR S237 -mut1 (SEQ ID NO: 78) and P spoVG -UTR S237 -mut2 (SEQ ID NO: 79) had the sequences of SEQ ID NO: 5 and SEQ ID NO: 6 at the 3' end of the 5'UTR, respectively.

[0089] Example 5 Construction of a Plasmid for Introducing a Cry5B Expression Cassette Comprising a Modified 5'UTR A Cry5B expression cassette was constructed. Using the pMW-TS43 plasmid constructed in Example 1 as a template, a vector fragment was amplified by PCR using a forward primer (SEQ ID NO: 23) and a reverse primer (SEQ ID NO: 37). Next, using pHY-Pscry5B (Japanese Patent No. 7218090) as a template, a forward primer (SEQ ID NO: 49) and a reverse primer (SEQ ID NO: 50) was used to amplify an insert fragment containing the ORF sequence of the Cry5B gene. The vector fragment and insert fragment were ligated by an in-fusion reaction and transformed into Escherichia coli to produce pMW-P SP64 -cry5B plasmid was obtained.

[0090] pMW-UTR constructed in Example 2 S237 The vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 23) and reverse primer (SEQ ID NO: 40) with the -a-TS43 plasmid as a template. Next, an insert fragment containing the ORF sequence of the Cry5B gene was amplified by PCR using the forward primer (SEQ ID NO: 51) and reverse primer (SEQ ID NO: 50) with the pHY-Pscry5B as a template. The vector fragment and insert fragment were ligated by an in-fusion reaction and transformed into E. coli to produce pMW-P SP64 -UTR S237 -a-cry5B plasmid was obtained.

[0091] Example 6 Construction of a Plasmid for Introducing a Lipase Expression Cassette Comprising a Modified 5'UTR A lipase expression cassette was constructed. Using the pMW-TS43 plasmid constructed in Example 1 as a template, a vector fragment was amplified by PCR using a forward primer (SEQ ID NO: 23) and a reverse primer (SEQ ID NO: 37). Next, using pHY-CnLip (SEQ ID NO: 52) as a template, a forward primer (SEQ ID NO: 53) and a reverse primer (SEQ ID NO: 54) was used to amplify an insert fragment containing the ORF sequence of the lipase gene. The vector fragment and insert fragment were ligated by an in-fusion reaction, and transformed into Escherichia coli to produce pMW-P SP64-Lip plasmid was obtained.

[0092] pMW-UTR constructed in Example 2 S237 A vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 23) and reverse primer (SEQ ID NO: 40) with the -a-TS43 plasmid as a template. Next, an insert fragment containing the ORF sequence of the lipase gene was amplified by PCR using the forward primer (SEQ ID NO: 55) and reverse primer (SEQ ID NO: 54) with the pHY-CnLip as a template. The vector fragment and insert fragment were ligated by an in-fusion reaction, and transformed into E. coli to produce pMW-P SP64 -UTR S237 -a-Lip plasmid was obtained.

[0093] Example 7 Addition of a RBS to a KP43 protease control region containing a modified 5'UTR An investigation was carried out to add a ribosome binding site (RBS) (CTTGAAAGGAGGGATGCCTAA; SEQ ID NO: 11) to a KP43 protease control region containing a modified 5'UTR. SP64 -UTR S237 A fragment was constructed by inverse PCR using the -a-cry5B plasmid as a template and a forward primer (SEQ ID NO: 56) and a reverse primer (SEQ ID NO: 57), and the fragment was transformed into E. coli to produce pMW-P SP64 -UTR S237 As shown in Figure 3, the control region P SP64 -UTR S237 -a-RBS (SEQ ID NO: 80) had an RBS (black bar) added downstream of the transcription initiation site, and had the sequence of SEQ ID NO: 4 (hatched area) at the 3' end of the 5'UTR.

[0094] Example 8 Preparation of recombinant Bacillus containing modified 5'UTR 1) Construction of prsA overexpression strain A prsA overexpression strain was prepared by introducing a prsA gene overexpression cassette (SEQ ID NO: 58) into a sigF gene-deficient strain of B. subtilis 168 (ΔsigF strain: Japanese Patent No. 4336082). A DNA fragment for introducing the prsA overexpression cassette was constructed by the following method. First, the following PCR fragments 1 to 3 were constructed: PCR fragment 1: forward primer; SEQ ID NO: 59, reverse primer; SEQ ID NO: 60, template DNA: prsA-Ka strain genomic DNA (Japanese Patent No. 4,839,144); PCR fragment 2: forward primer; SEQ ID NO: 61, reverse primer; SEQ ID NO: 62), template DNA: MazF cassette (Genet. Syst., 84(4):315-318, 2009); PCR fragment 3: forward primer; SEQ ID NO: 63, reverse primer; SEQ ID NO: 64), template DNA: 168 strain genomic DNA. PCR fragments 1 to 3 were ligated by SOE-PCR (forward primer; SEQ ID NO: 65, reverse primer; SEQ ID NO: 66) to construct a DNA fragment for introducing a prsA overexpression cassette. The constructed DNA fragment for introducing the prsA overexpression cassette was introduced into the ΔsigF strain, and the prsA overexpression cassette was introduced into the nprE locus of the ΔsigF strain. Gene introduction was performed by homologous recombination according to the marker-free deletion method developed by Morimoto et al. ( Genet. Syst., 84(4):315-318, 2009 ) ( FIG. 4 ). The resulting prsA-overexpressing ΔsigF strain (ΔsigF-prsA strain) was used as a parent strain to prepare recombinant Bacillus bacteria carrying the following target gene expression cassettes:

[0095] 2) Introduction of target gene expression cassette into parent strain genome Protease and amylase expression strains were constructed by the following method. Using the target gene expression cassette introduction plasmids constructed in Examples 1 to 4 and 7 as templates, a PCR fragment for genome introduction was obtained by PCR using a forward primer (SEQ ID NO: 67) and a reverse primer (SEQ ID NO: 68). This PCR fragment was introduced into the ΔsigF-prsA strain prepared in 1) above by the competent cell method (see Japanese Patent No. 6088282), and transformed by homologous recombination into the amyE gene locus on the genome.

[0096] Cry5B and lipase-expressing strains were constructed by the following method. A PCR fragment for genome introduction was obtained by PCR using a forward primer (SEQ ID NO: 67) and a reverse primer (SEQ ID NO: 68) and the plasmid for introducing the target gene expression cassette constructed in Examples 5 and 6 as a template. This PCR fragment was introduced into the ΔsigF strain (Japanese Patent No. 4336082) by the competent cell method (see Japanese Patent No. 6088282), and then introduced by homologous recombination into the amyE gene locus on the genome to generate a recombinant Bacillus bacterium into which the expression cassette was introduced.

[0097] Example 9: Production of a target protein by culturing recombinant Bacillus bacteria The recombinant Bacillus bacteria carrying the target gene expression cassette obtained in Example 8 were cultured overnight in 2 mL of LB medium in a 10 mL round-bottom spitz tube at 30°C with shaking at 180 rpm. 500 μL of the resulting culture was removed and inoculated into 20 mL of 2×L-maltose medium (2% peptone, 1% yeast extract, 1% NaCl, 7.5% maltose, 7.5 ppm manganese tetra-pentahydrate, antifoaming agent; % v / w%). This was then cultured at 32°C (30°C for the Cry5B-expressing strain and lipase-expressing strain) and 210 rpm for 72 hours.

[0098] Example 10: Measurement of Target Protein Production 1) Method The amount of target protein produced by the recombinant Bacillus bacteria prepared in Example 8 was measured. The amount of protease produced was calculated as protease activity. After the completion of the culture in Example 9, the protease activity of the culture supernatant from which the bacterial cells had been removed was measured using the following procedure. 0.9 mL of 1 / 15 M phosphate buffer (pH 7.4) and 0.05 mL of 40 mM Glt-Ala-Ala-Pro-Leu-p-nitroanilide / dimethyl sulfoxide solution were placed in a test tube and incubated at 30°C for 5 minutes. 0.05 mL of the culture supernatant was added and reacted at 30°C for 10 minutes. The reaction was terminated by adding 2.0 mL of 5% (w / v) citric acid solution, and the absorbance at 420 nm was measured using a spectrophotometer to determine the protease activity. The protease activity of recombinant Bacillus bacteria into which an expression cassette containing a modified 5'UTR had been introduced was expressed as a relative value (au), with the activity of recombinant Bacillus bacteria into which an expression cassette containing an unmodified 5'UTR had been introduced being taken as 1.

[0099] The amount of amylase produced was determined as amylase activity. Amylase activity measurement was performed as follows. After the completion of the culture in Example 9, the amylase activity of the culture supernatant from which the bacterial cells had been removed was measured using the following procedure. 0.9 mL of an aqueous solution prepared by suspending one tablet of Padebas Amylase Test in 5 mL of 1 / 15 M phosphate buffer (pH 7.4) was added to a test tube and incubated at 30°C for 15 minutes. 0.05 mL of enzyme solution (culture supernatant) appropriately diluted with 2 mM calcium chloride aqueous solution was added, and the reaction was carried out at 30°C for exactly 10 minutes. After that, 2 mL of 5% (w / v) citric acid aqueous solution was added to stop the reaction. The enzyme reaction solution was centrifuged at 3000 rpm for 5 minutes, and the absorbance of the supernatant at 750 nm was measured using a spectrophotometer, which was used as the amylase activity value. The amylase activity of recombinant Bacillus bacteria into which an expression cassette containing a modified 5'UTR was introduced was expressed as a relative value (au), with the activity of recombinant Bacillus bacteria into which an expression cassette containing an unmodified 5'UTR was introduced being taken as 1.

[0100] The amount of Cry5B produced was determined as protein concentration. The Cry5B protein concentration was measured by the method described in Japanese Patent No. 7218090. Specifically, after the completion of the culture in Example 9, the Cry5B concentration in the culture supernatant from which the bacterial cells had been removed was measured by the following procedure. The culture supernatant and bovine serum albumin (BSA) (manufactured by Wako Pure Chemical Industries, Ltd.) as a standard protein were subjected to SDS-PAGE. The gel was then purified by Bio-Safe TM The gel was stained with shaking in a Coomassie (BIO-RAD) for 1 hour and destained with ion-exchanged water. The brightness of each band in the gel image was analyzed using ImageJ (rsb.info.nih.gov / ij / download.html), an imaging software developed by the National Institutes of Health (NIH). A calibration curve was created from the BSA data. The Cry5B protein concentration was calculated from this calibration curve. The Cry5B protein concentration of recombinant Bacillus spp. into which an expression cassette containing a modified 5'UTR had been introduced was expressed as a relative value (au), with the Cry5B protein concentration of recombinant Bacillus spp. into which an expression cassette containing an unmodified 5'UTR had been introduced being set at 1.

[0101] The amount of lipase produced was determined as the lipase activity value. After the completion of the culture in Example 9, the lipase activity of the culture supernatant from which the bacterial cells had been removed was measured by the following method. Lipase activity was determined by measuring the rate of increase in absorbance accompanying the liberation of p-nitrophenol by the action of lipase. A substrate solution was prepared by adding p-nitrophenylbutyric acid (pNPB) (SIGMA) to a final concentration of 2 mM to 20 mM Tris-HCl (pH 7.0) and mixing the mixture. 4 μL of the culture supernatant appropriately diluted with 20 mM Tris-HCl (pH 7.0) and 100 μL of the substrate solution were mixed in each well of a 96-well assay plate, and the change in absorbance (OD / min) at 405 nm at 30°C was measured. The difference ΔOD / min from the blank (sample without culture supernatant) was determined. The lipase activity of recombinant Bacillus bacteria into which an expression cassette containing a modified 5'UTR was introduced was expressed as a relative value (au), with the lipase activity of recombinant Bacillus bacteria into which an expression cassette containing an unmodified 5'UTR was introduced being set at 1.

[0102] 2) Results FIG. 5 shows the modified P gene containing the modified 5′UTR constructed in Example 2. SP64Promoter (P SP64 -UTR S237 1 shows the improvement in the production of KP43 protease by recombinant Bacillus bacteria into which a KP43 protease expression cassette having the modified 5'UTR was introduced. SP64 -UTR S237 -a, b and c are parent promoters (P SP64 -UTR SP64 When the production of KP43 protease using the spoVG promoter (P) was taken as 100%, the protease production in the recombinant Bacillus bacteria was improved by 45%, 38%, and 42%, respectively, compared to the parent promoter. spoVG -UTR S237 4 shows the improvement in the production of KP43 protease by recombinant Bacillus bacteria into which a KP43 protease expression cassette having a modified 5'UTR has been introduced. spoVG -UTR S237 represents the parent promoter (P spoVG -UTR spoVG ) the amount of protease produced by the recombinant Bacillus was improved by 4.0 times compared to the previous method.

[0103] FIG. 7 shows the modified P construct containing the modified 5′UTR constructed in Example 4. SP64 Promoter (P SP64 -UTR S237 1 shows the improvement of amylase production by recombinant Bacillus bacteria into which an amylase expression cassette having the modified 5'UTR (a) has been introduced. SP64 -UTR S237 -a is the parent promoter (P SP64 -UTR SP64 ) the amylase production in the recombinant Bacillus was improved by 2.7 times compared to the modified 5'UTR constructed in Example 4. spoVG -UTR S237 , P spoVG -UTR S237 -mut1 and P spoVG -UTR S2371 shows the improved amylase production by recombinant Bacillus bacteria into which an amylase expression cassette having a modified 5'UTR (-mut2) was introduced. spoVG -UTR S237 , P spoVG -UTR S237 -mut1 and P spoVG -UTR S237 -mut2 is the parent promoter containing the unmodified 5′UTR (P spoVG -UTR spoVG ) the amylase production in the recombinant Bacillus was improved by 7.5 times, 2.6 times, and 7.8 times, respectively.

[0104] FIG. 9 shows the modified P construct containing the modified 5′UTR constructed in Example 5. SP64 Promoter (P SP64 -UTR S237 1 shows the improvement of Cry5B production by recombinant Bacillus bacteria into which a Cry5B expression cassette having the modified 5'UTR was introduced. SP64 -UTR S237 -a is the parent promoter (P SP64 -UTR SP64 ) compared to the recombinant Bacillus strain, the Cry5B production was improved by 3.3 times.

[0105] FIG. 10 shows the modified P construct containing the modified 5′UTR constructed in Example 6. SP64 Promoter (P SP64 -UTR S237 1 shows an improvement in the production of lipase by a recombinant Bacillus bacterium into which a lipase expression cassette having the modified 5'UTR (a) has been introduced. SP64 -UTR S237 -a is the parent promoter (P SP64 -UTR SP64 ) and improved lipase production in recombinant Bacillus by 34% compared to the conventional method.

[0106] FIG. 11 shows the modified P5′UTR containing the modified 5′UTR with an additional RBS constructed in Example 7. SP64 Promoter (P SP64 -UTR S237The figure shows the improvement of Cry5B production by recombinant Bacillus bacteria into which a Cry5B expression cassette having a modified promoter (P-a-RBS) with an additional RBS was introduced. SP64 -UTR S237 -a-RBS) is a modified promoter without an additional RBS (P SP64 -UTR S237 When the amount of Cry5B produced when using -a) is taken as 100%, P SP64 -UTR S237 Compared to -a, the production of Cry5B was improved by 56%. SP64 -UTR S237 -a-RBS is the parent promoter (P SP64 -UTR SP64 ) the production of Cry5B in the recombinant Bacillus was improved by 5.1 times.

Claims

1. A DNA molecule comprising a modified promoter, said modified promoter comprising a modified 5'UTR containing a heterologous polynucleotide, said heterologous polynucleotide being a polynucleotide comprising the nucleotide sequence of SEQ ID NO:70, or a nucleotide sequence having at least 80% identity thereto.

2. The DNA molecule according to claim 1, wherein the heterologous polynucleotide is any of the following polynucleotides a) to d): a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:3, or a nucleotide sequence having at least 80% identity to said sequence; b) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO:4, or a nucleotide sequence having at least 80% identity to said sequence, or a fragment thereof; c) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:5, or a nucleotide sequence having at least 80% identity to said sequence; d) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:6, or a nucleotide sequence having at least 80% identity to said sequence.

3. The DNA molecule of claim 1 or 2, wherein said heterologous polynucleotide comprises the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:

2.

4. The DNA molecule of any one of claims 1 to 3, wherein said heterologous polynucleotide is 100 nt or less in length.

5. The DNA molecule of any one of claims 1 to 4, wherein the heterologous polynucleotide is located at the 3' end of the modified 5'UTR.

6. A DNA molecule according to any one of claims 1 to 5, wherein the modified 5'UTR contains, in addition to the heterologous polynucleotide, a heterologous ribosome binding region, the ribosome binding region being located upstream of a region consisting of the nucleotide sequence of SEQ ID NO:1 contained in the modified 5'UTR.

7. The DNA molecule of claim 6, wherein said heterologous ribosome binding region is located upstream of said heterologous polynucleotide.

8. The DNA molecule of claim 6 or 7, wherein the heterologous ribosome binding region is located 10 to 100 nucleotides downstream from the transcription start site of the modified promoter.

9. The DNA molecule according to any one of claims 1 to 8, wherein the parent promoter of said modified promoter is a promoter derived from the genus Bacillus.

10. The DNA molecule of claim 9, wherein the parent promoter is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO:72 or a nucleotide sequence having at least 80% identity thereto, or a polynucleotide consisting of the nucleotide sequence of SEQ ID NO:76 or a nucleotide sequence having at least 80% identity thereto.

11. The DNA molecule according to any one of claims 1 to 10, further comprising a gene of interest.

12. The DNA molecule of claim 11, which is an expression cassette or an expression vector.

13. A transformant containing the DNA molecule according to claim 12.

14. The transformant according to claim 13, which contains the DNA molecule according to claim 12, which is an expression cassette containing the modified promoter and further containing a target gene, and when the expression level of the target gene in a cell containing an expression cassette containing a parent promoter of the modified promoter and further containing the target gene is taken as 100%, the transformant increases the expression level of the target gene by at least 10%.

15. The transformant according to claim 13 or 14, which is a bacterium of the genus Bacillus.

16. A method for producing a target substance, comprising culturing the transformant according to any one of claims 13 to 15.

17. A method for producing a modified promoter, the method comprising modifying a 5'UTR contained in a parent promoter, wherein modifying the 5'UTR comprises replacing part or all of the 5'UTR with a heterologous polynucleotide or adding the heterologous polynucleotide to the 5'UTR, the heterologous polynucleotide being a polynucleotide comprising the nucleotide sequence of SEQ ID NO:70, or a nucleotide sequence having at least 80% identity to said sequence, and the parent promoter being a promoter comprising a 5'UTR that does not comprise the heterologous polynucleotide.

Images