Microorganism with enhanced activity of phosphotransacetylase and acetate kinase operon and uses thereof

By enhancing the activity of the pta-ackA operon in microorganisms through promoter replacement and increased copy number, the challenges of low valine production in existing microbial processes are addressed, resulting in improved yields and efficiency.

WO2025127540A1PCT designated stage expired Publication Date: 2025-06-19CJ CHEILJEDANG CORP
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/019194
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-14
Filing Date
2024-11-28
Publication Date
2025-06-19

AI Technical Summary

Technical Problem

Current methods for producing branched-chain amino acids, particularly L-valine, using microorganisms face challenges in achieving high yields on an industrial scale due to limitations in the activity of phosphotransacetylase and acetate kinase operons.

Method used

Enhancing the activity of the phosphotransacetylase (pta) and acetate kinase (ackA) operon in microorganisms by using a stronger promoter and increasing the intracellular copy number of the pta-ackA operon, thereby improving valine production.

Benefits of technology

The enhanced activity of the pta-ackA operon leads to increased valine production and sugar consumption rates, making the process more efficient and suitable for industrial-scale production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTKR2024019194-APPB-IMG-000001
    Figure PCTKR2024019194-APPB-IMG-000001
  • Figure PCTKR2024019194-APPB-IMG-000002
    Figure PCTKR2024019194-APPB-IMG-000002
  • Figure PCTKR2024019194-APPB-IMG-000003
    Figure PCTKR2024019194-APPB-IMG-000003
Patent Text Reader

Abstract

The present disclosure provides a microorganism with enhanced activity of phosphotransacetylase and acetate kinase operon, a gene expression cassette comprising a strong promoter and a pta-ackA operon, a method for producing valine using the microorganism of the present disclosure, and a method for increasing valine production.
Need to check novelty before this filing date? Find Prior Art

Description

Microorganisms with enhanced activity of phosphotransacetylase and acetic acid kinase operons and uses thereof

[0001] Cross-citation with related application(s)

[0002] This disclosure claims the benefit of priority to Republic of Korea Patent Application No. 10-2023-0181938, dated December 14, 2023, the entire contents of which are incorporated herein by reference.

[0003] The present disclosure relates to a microorganism having enhanced activity of phosphotransacetylase and acetyl phosphatase operons and uses thereof.

[0004]

[0005] L-amino acids are the basic structural units of proteins and are used as important materials for pharmaceutical raw materials, food additives, animal feed, nutritional supplements, pesticides, and disinfectants. In particular, branched-chain amino acids (BCAAs) are a general term for the essential amino acids L-valine, L-leucine, and L-isoleucine. These branched-chain amino acids are known to have antioxidant effects and directly promote protein synthesis in muscle cells.

[0006] Meanwhile, the production of branched-chain amino acids using microorganisms is mainly accomplished through microorganisms of the genus Escherichia or the genus Corynebacterium, and in the case of L-valine, it is known that it is biosynthesized from pyruvate through several steps using 2-oxoisovalerate as a precursor, but it is not easy to mass-produce L-valine using microorganisms on an industrial scale.

[0007] Therefore, research is still needed to effectively increase L-valine production.

[0008]

[0009] [Prior Art Literature]

[0010] [Patent Document]

[0011] (Patent Document 1) U.S. Patent Publication No. US 2020-0362374 A1

[0012]

[0013] One object of the present application is to provide a microorganism having enhanced activity of the phosphotransacetylase (Pta) and acetate kinase (ackA) operon (pta-ackA operon).

[0014] Another object of the present application is to provide a gene expression cassette comprising a promoter and a structural gene of the pta-ackA operon operably linked to the promoter.

[0015] Another object of the present application is to provide a method for producing valine, comprising a step of culturing the microorganism in a medium.

[0016] Another object of the present application is to provide a method for increasing valine production, comprising the step of culturing the microorganism in a medium.

[0017] Another object of the present application is to provide a composition for producing valine, comprising at least one selected from the group consisting of the above microorganism and a medium in which the above microorganism is cultured.

[0018]

[0019] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly explain the level of the technical field to which the present invention pertains and the contents of the present invention.

[0020]

[0021] In the present disclosure, it was confirmed that the valine productivity and yield increased as a result of enhancing the activity of the phosphotransacetylase (pta) and acetate kinase (ackA) operon (pta-ackA operon) (hereinafter referred to as “pta-ackA operon”) of a microorganism producing valine, and thus a promoter for enhancing the pta-ackA operon and a microorganism producing valine with enhanced activity of the pta-ackA operon are provided.

[0022] In the present disclosure, the pta-ackA operon may comprise a pta-ackA structural gene and a promoter operably linked thereto.

[0023] As used herein, the term "promoter" refers to a non-translated polynucleotide sequence upstream of a coding region that contains a binding site for RNA polymerase and has transcription initiation activity into mRNA of a target gene, i.e., a DNA region to which RNA polymerase binds to initiate transcription of the target gene. The promoter may be located 5' to the mRNA transcription initiation site.

[0024] The structural gene of the pta-ackA operon may include a gene (e.g., a nucleic acid sequence of SEQ ID NO: 2) encoding a pta protein (phosphotransacetylase; e.g., an amino acid sequence of SEQ ID NO: 1) and a gene (e.g., a nucleic acid sequence of SEQ ID NO: 4) encoding an ackA protein (acetyl phosphatase; e.g., an amino acid sequence of SEQ ID NO: 3). The gene encoding the pta protein and the gene encoding the ackA protein may be linked regardless of the order. In one example, the structural gene of the pta-ackA operon may include a nucleic acid sequence of SEQ ID NO: 31.

[0025] The above pta protein may be derived from a microorganism of the genus Corynebacterium, for example, may be derived from Corynebacterium glutamicum (Sequence ID: WP_003862872.1). The above pta protein may have phosphotransacetylase activity. The sequence of the pta protein or the gene encoding it can be obtained from a known database (NCBI), etc. The above pta protein may have a homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.2% or more, 98.4% or more, 98.6% or more, 98.8% or more, 98.9% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more with the amino acid sequence of SEQ ID NO: 1, or may include the above amino acid sequence, or may consist of the above amino acid sequence. The gene encoding the above pta protein may have a homology or identity of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.2%, at least 98.4%, at least 98.6%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% with the nucleic acid sequence of SEQ ID NO: 2, or may comprise the nucleic acid sequence, or may consist of the nucleic acid sequence.

[0026] The above ackA protein may be derived from a microorganism of the genus Corynebacterium, for example, may be derived from Corynebacterium glutamicum (Sequence ID: WP_003862874.1). The above ackA protein may have acetylase activity. The above ackA protein may have phosphotransacetylase activity. The sequence of the above ackA protein or the gene encoding it can be obtained from a known database (NCBI), etc. The above ackA protein may have a homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.2% or more, 98.4% or more, 98.6% or more, 98.8% or more, 98.9% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more with the amino acid sequence of SEQ ID NO: 3, or may include the amino acid sequence, or may consist of the amino acid sequence. The gene encoding the above ackA protein may have a homology or identity of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.2%, at least 98.4%, at least 98.6%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% with the nucleic acid sequence of SEQ ID NO: 4, or may comprise the nucleic acid sequence, or may consist of the nucleic acid sequence.

[0027] Additionally, if the amino acid sequence exhibits an effect corresponding to the aromatic amino acid transporter having such homology or identity, variants having an amino acid sequence in which some of the sequences are deleted, modified, substituted, conservatively substituted, or added may also be included in the aromatic amino acid transporter. For example, the amino acid sequence may have sequence additions or deletions, naturally occurring mutations, silent mutations, or conservative substitutions that do not alter aromatic amino acid transporter activity at the N-terminus, C-terminus, and / or within the amino acid sequence.

[0028] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid with similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0029]

[0030] In the present disclosure, the phrase "a polynucleotide or polypeptide has, includes, consists of, or consists essentially of a specific nucleic acid sequence (base sequence) or amino acid sequence" may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence or amino acid sequence, and may be interpreted as including (or not excluding) a "substantially equivalent sequence" in which a mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence or amino acid sequence within the scope of maintaining the original function and / or desired function of the polynucleotide or polypeptide. In one example, a polynucleotide or polypeptide “has, includes, consists of, or consists essentially of a particular nucleic acid sequence (base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide (i) essentially includes the particular nucleic acid sequence or amino acid sequence, or (ii) consists of or essentially includes a nucleic acid sequence or amino acid sequence that has at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% homology or identity with the particular nucleic acid sequence or amino acid sequence and maintains its original function and / or desired function.

[0031] In this disclosure, 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0032] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0033] Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0034] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0035]

[0036] One aspect provides a microorganism having enhanced activity of the pta-ackA operon. The microorganism having enhanced activity of the pta-ackA operon may have one or more characteristics selected from the group consisting of (i) increased valine production capacity; and (ii) increased sugar consumption rate, compared to a parent strain or wild-type microorganism having non-enhanced activity.

[0037] The above-mentioned enhancement of the activity of the pta-ackA operon may mean that the activity of the operon is increased compared to the intrinsic activity. The above-mentioned enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an enhanced activity compared to the intrinsic activity or the activity before modification. The above-mentioned “intrinsic activity” refers to the activity of a specific operon that the parent strain or unmodified microorganism originally had before the trait change when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification.” The phrase “enhancement”, “upregulation”, “overexpression” or “increase” of the activity of an operon compared to its intrinsic activity may mean an increase in the activity of a specific operon that the parent strain or unmodified microorganism originally had before the transformation, for example, an increase in the expression of a structural gene of the operon. Whether the activity of the operon is enhanced can be confirmed by methods commonly known in the art, such as an increase in the amount of mRNA transcription of a structural gene included in the operon (for example, the level of mRNA of the pta gene and / or the mRNA level of the ackA gene), the amount of expression of a polypeptide encoded by the structural gene (for example, the level of pta protein and / or ackA protein), the degree of activity of the polypeptide, the degree of increase in the amount of a product excreted from the polypeptide (for example, the production of valine), etc.

[0038] Strengthening the activity of the above operon can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target operon can be strengthened compared to the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but are not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0039] Specifically, the activity enhancement of the pta-ackA operon may be a combination of one or more selected from 1) to 8) below, but is not limited thereto.

[0040] 1) Replacing the gene expression control region of the pta-ackA operon with a highly active sequence;

[0041] 2) Increased intracellular copy number of the pta-ackA operon;

[0042] 3) Modification of the base sequence coding for the initiation codon or 5'-UTR region of the structural gene of the pta-ackA operon;

[0043] 4) Modification of the amino acid sequence such that the activity of the pta protein and / or ackA protein is enhanced;

[0044] 5) Modification of the polynucleotide sequence of the gene encoding the pta protein and / or the gene encoding the ackA protein so as to enhance the activity of the pta protein and / or the ackA protein (e.g., modification of the polynucleotide sequence of the gene so as to encode a polypeptide modified so as to enhance the activity of the pta protein and / or the ackA protein);

[0045] 6) Introduction of a foreign polypeptide exhibiting the activity of pta protein and / or ackA protein and / or a foreign polynucleotide encoding said foreign polypeptide;

[0046] 7) Codon optimization of the genes encoding pta protein and / or ackA protein; and

[0047] 8) Analysis of the tertiary structure of the pta protein and / or ackA protein to select exposed sites for modification or chemical modification;

[0048]

[0049] The above 1) replacement of the gene expression control region of the pta-ackA operon with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. For example, replacing the gene expression control region of the pta-ackA operon with a sequence having strong activity may be replacing the original promoter with a strong promoter.

[0050] The microorganism in which the activity of the above pta-ackA operon is enhanced may be one in which the activity of the pta-ackA operon is enhanced by operable linkage of a strong promoter to the pta-ackA structural gene. Operable linkage of the strong promoter to the pta-ackA structural gene as described above may mean replacing (substituting) the promoter of the original pta-ackA operon with a strong promoter, or positioning the strong promoter in front of the pta-ackA structural gene so that the expression of the pta-ackA structural gene can be regulated by the strong promoter. The promoter of the original pta-ackA operon may refer to a promoter that is operably linked to the pta-ackA operon within the chromosome of a wild-type microorganism. In one example, the original promoter may be a promoter linked to the pta gene.

[0051] Additionally, enhancing the activity of the pta-ackA operon may include enhancing the expression of the pta gene or the ackA gene alone. In one example, a microorganism with enhanced activity of the pta-ackA operon may have a strong promoter operably linked to the pta gene, and / or a strong promoter linked to the ackA gene.

[0052] The term "operably linked" as used herein means that the promoter of the present application is functionally linked to a gene sequence such that it initiates and mediates transcription of the target gene (e.g., the pta-ackA structural gene, the pta gene, or the ackA gene). The operable linkage can be produced using genetic recombination techniques known in the art of the present application, and site-specific DNA cleavage and ligation can be produced using cleavage and ligation enzymes known in the art of the present application.

[0053] The strong promoter may be a promoter of a microbial endogenous gene or a foreign gene. In one example, the strong promoter may be derived from a microorganism of the genus Corynebacterium. In one specific example, the strong promoter may be derived from Corynebacterium glutamicum.

[0054] In one example, the strong promoter may be, but is not limited to, PctaE (promoter of ctaE gene), Ppyk (promoter of pyk gene), PpfkA (promoter of pfkA gene), Pald (promoter of ald gene), CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent No. US 10584338 B2), O2 promoter (US Patent No. US 10273491 B2), tkt promoter, yccA promoter, etc.

[0055] The above ctaE gene may be a gene encoding cytochrome c oxidase subunit 3. In one example, the promoter of the ctaE gene may include the nucleic acid sequence of SEQ ID NO: 5 or may be composed of the nucleic acid sequence of SEQ ID NO: 5.

[0056] The above pyk gene may be a gene encoding pyruvate kinase. In one example, the promoter of the pyk gene may include the nucleic acid sequence of SEQ ID NO: 6 or may be composed of the nucleic acid sequence of SEQ ID NO: 6.

[0057] The above pfkA gene may be a gene encoding ATP-dependent 6-phosphofructokinase isozyme 1. In one example, the promoter of the pfkA gene may include the nucleic acid sequence of SEQ ID NO: 7 or may be composed of the nucleic acid sequence of SEQ ID NO: 7.

[0058] The above ald gene may be a gene encoding acetaldehyde dehydrogenase. In one example, the promoter of the ald gene may include the nucleic acid sequence of SEQ ID NO: 32 or may be composed of the nucleic acid sequence of SEQ ID NO: 32.

[0059] The increase in the intracellular copy number of the above 2) pta-ackA operon may be achieved by introducing into a microorganism (host cell) a vector capable of replicating and functioning independently of a host, to which the pta-ackA operon is operably linked. Alternatively, the pta-ackA operon may be achieved by introducing one copy or two or more copies into a chromosome within a microorganism (host cell). The introduction of the pta-ackA operon into the chromosome may be performed by introducing into the host cell a vector capable of inserting the gene into the chromosome within the host cell, but is not limited thereto.

[0060] The increase in the intracellular copy number of the pta-ackA operon may be achieved by introducing into the host cell a vector that is operably linked to the pta gene or the ackA gene and that can replicate and function independently of the host. Alternatively, the increase may be achieved by introducing one copy or two or more copies of the pta gene or the ackA gene into the chromosome of the host cell. The introduction of the pta gene or the ackA gene into the chromosome may be performed by introducing into the host cell a vector capable of inserting the gene into the chromosome of the host cell, but is not limited thereto.

[0061] The above pta-ackA operon, pta gene or ackA gene may be operably linked to a promoter.

[0062] The above promoter may be at least one selected from the group consisting of the promoter of the original pta-ackA operon and a strong promoter different from the original promoter.

[0063] The promoter and strong promoter of the original pta-ackA operon are as described above.

[0064] The above pta-ackA operon, pta gene, or ackA gene may be inserted into a location that does not affect the expression of other genes of the host cell, such as a genomic safe harbor. In one example, the safe harbor gene site may be a site between the NCgl2195 gene and the NCgl2196 gene of Corynebacterium glutamicum, or a site between the NCgl0866 gene and the NCgl0867 gene of Corynebacterium glutamicum.

[0065] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0066] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not the chromosome has been inserted.

[0067] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0068] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0069] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0070] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0071] In one specific example, the enhancement may be (i) replacement of the promoter of the pta-ackA operon with a strong promoter, (ii) increasing the copy number of the pta-ackA operon, or (iii) a combination thereof.

[0072]

[0073] Modification of part or all of a gene for enhancing the activity of the pta-ackA operon in the microorganism of the present application may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosomal integration into the microorganism or genome editing using engineered nuclease (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation. The method for modifying part or all of the gene may include a method using DNA recombination technology. For example, a nucleotide sequence or vector including a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene. The injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.

[0074]

[0075] The microorganism of the present application may be a microorganism with enhanced activity of the pta-ackA operon, or a microorganism genetically modified via a vector to enhance the activity of the pta-ackA operon (e.g., a recombinant microorganism), but is not limited thereto. The microorganism (or strain, recombinant cell) of the present application may be a microorganism with enhanced activity of the pta-ackA operon, thereby having valine production ability or enhanced valine production ability (or production amount).

[0076] The microorganism of the present application may be a microorganism that naturally has valine production ability, or a microorganism that has valine production ability conferred or enhanced upon a parent strain that does not have valine production ability, but is not limited thereto. The microorganism may be a microorganism that has valine production ability or has increased valine production ability. The microorganism may be a microorganism that does not have valine production ability, or a microorganism that has valine production ability conferred or has valine production ability enhanced by introducing the pta-ackA operon to a microorganism that does have valine production ability, but is not limited thereto.

[0077] The fact that the above microorganism has valine production ability or has improved valine production ability may mean that the microorganism is endowed with valine production ability, unlike a non-modified microorganism, a cell before recombination, a parent strain, and / or a wild-type strain that does not have valine production ability, or that the valine production ability is increased compared to a non-modified microorganism, a cell before recombination, a parent strain, and / or a wild-type strain.

[0078] For example, a microorganism with enhanced activity of the pta-ackA operon may have increased valine production capacity compared to a microorganism before introduction, i.e., an identical, unmodified microorganism. In the present disclosure, the term "unmodified microorganism" does not exclude a strain containing a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation due to natural or artificial factors. For example, the unmodified microorganism may refer to a microorganism in which the activity of the pta-ackA operon is not enhanced, or before the activity of the pta-ackA operon is enhanced. The term "unmodified microorganism" may be used interchangeably with "pre-modified strain", "pre-modified microorganism", "unmodified strain", "unmodified microorganism", or "reference microorganism".

[0079] The above microorganism (or strain, recombinant cell) may additionally include a mutation that increases valine production, and the location of the mutation and / or the type of gene and / or protein that is the target of the mutation may be included without limitation as long as it increases valine production. The above recombinant cell may be used without limitation as long as it is a cell capable of transformation.

[0080] In one example, the microorganism of the present disclosure may further comprise an A42V variant of the Acetolactate synthase isozyme 1 small subunit (IlvN) protein or a nucleotide encoding the same (see Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467).

[0081] In one example, the non-modified microorganism, which is a target strain for comparing whether the valine production ability is increased, may be, but is not limited to, a strain in which the A42V mutation in the acetolactate synthase isozyme 1 small subunit (IlvN) protein is introduced in Corynebacterium glutamicum ATCC13032 strain, Corynebacterium glutamicum KCCM11201P (US Registered Publication No. US 8465962 B), and Corynebacterium glutamicum ATCC14067, thereby improving the valine production ability [ilvN (A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467; US Registered Patent Publication No. US 11180784 B2].

[0082]

[0083] For example, the microorganism (or strain, recombinant cell) with improved (increased) valine production ability (or production amount, yield) has a valine production ability of 1% or more, 2% or more, 3% or more, 4% or more, 5% or more, 6% or more, 7% or more, 8% or more, 9% or more, 10% or more, 11% or more, 12% or more, 13% or more, 14% or more, 15% or more, 16% or more, 17% or more, 18% or more, 19% or more, 20% or more, 21% or more, 22% or more, 23% or more, 24% or more, 25% or more, 26% or more, 27% or more, 28% or more, 29% or more, 30% or more, 31% or more, 32% or more, 33% or more, It may be increased by 34% or more or 35% or more (the upper limit is not particularly limited, and may be, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, about 40% or less, or about 35% or less), but is not limited thereto.

[0084] In another example, the microorganism (or strain, recombinant cell) with improved (increased) valine productivity (or production, yield) may have an increased valine productivity of about 1.05 times or more, about 1.1 times or more, about 1.15 times or more, about 1.2 times or more, about 1.25 times or more, or about 1.3 times or more, compared to the parent strain before mutation or the unmodified microorganism, but is not limited thereto. The term “about” includes all of ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all of the values ​​in the range equivalent to or similar to the value following the term “about,” but is not limited thereto.

[0085]

[0086] The above microorganism may be a microorganism of the genus Corynebacterium.

[0087] The above-mentioned Corynebacterium genus microorganisms are Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, and Corynebacterium pollutisoli. It consists of Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium alkanolyticum, Corynebacterium lilium, Corynebacterium melassecola, Corynebacterium thermoaminogenes, Corynebacterium herculis and Corynebacterium flavescens. There may be one or more types selected from the military, but they are not limited thereto.

[0088]

[0089] Another aspect provides a gene expression cassette comprising the promoter and a structural gene of the pta-ackA operon operably linked to the promoter.

[0090] As used herein, the term "gene expression cassette" may refer to a unit cassette that includes a promoter and a target gene, and is capable of expressing the target gene operably linked downstream of the promoter. Various factors that can assist in the efficient expression of the target gene may be included inside or outside of such a gene expression cassette. The gene expression cassette may typically include, but is not limited to, a transcription termination signal, a ribosome binding site, and a translation termination signal in addition to a promoter operably linked to the target gene.

[0091] The above "target gene" refers to a gene whose expression is to be controlled by the promoter sequence of the present application for the purposes of the present application. The protein encoded by the target gene may be referred to as the "target protein," and the gene encoding the "target protein" may be referred to as the "target gene."

[0092] In one example, the target gene may refer to a structural gene of the pta-ackA operon to be expressed through the promoter.

[0093] The structural genes of the above pta-ackA operon may include a gene encoding a pta protein (SEQ ID NO: 2) and a gene encoding an ackA protein (SEQ ID NO: 4). The structural genes of the above pta-ackA operon may include a nucleic acid sequence of SEQ ID NO: 31.

[0094] The above promoter may be at least one selected from the group consisting of the promoter of the ctaE gene described above, the promoter of the pyk gene, and the promoter of the pfkA gene, but is not limited thereto.

[0095] The above promoter may be derived from a microorganism of the genus Corynebacterium as described above, for example, from Corynebacterium glutamicum.

[0096] In one example, the promoter may be at least one selected from the group consisting of a promoter of the ctaE gene (SEQ ID NO: 5), a promoter of the pyk gene (SEQ ID NO: 6), and a promoter of the pfkA gene (SEQ ID NO: 7), but is not limited thereto.

[0097] The term "operably linked" as used herein means that the promoter of the present application is functionally linked to a gene sequence so as to initiate and mediate transcription of the target gene (e.g., a structural gene of the pta-ackA operon). The operable linkage can be produced using genetic recombination techniques known in the art of the present application, and site-specific DNA cleavage and ligation can be produced using cleavage and ligation enzymes known in the art of the present application.

[0098] In one example, the gene expression cassette comprises at least one promoter selected from the group consisting of a promoter of a pyk gene, a promoter of a ctaE gene, and a promoter of a pfkA gene; and

[0099] It may include a structural gene of the pta-ackA operon operably linked to the above promoter.

[0100]

[0101] Another aspect provides a composition for producing valine, comprising at least one selected from the group consisting of the above microorganism and a medium in which the above microorganism is cultured. The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing valine, and such excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents, but are not limited thereto.

[0102] In the composition of the present application, the microorganism (strain), medium, and valine, etc. are as described in the other aspects above.

[0103] Another aspect provides a use for producing valine by using at least one selected from the group consisting of the above microorganism, the above microorganism, and a medium in which the above microorganism is cultured.

[0104]

[0105] Another aspect provides a method for producing valine, comprising the step of culturing the microorganism in a medium.

[0106] Another aspect provides a method for increasing valine production, comprising the step of culturing the microorganism in a medium.

[0107] The above microorganisms and valine are as described above.

[0108] In the present disclosure, "cultivation" may refer to growing the microorganism of the present application (e.g., a Corynebacterium glutamicum strain) under appropriately controlled environmental conditions. The culturing process of the present application may be performed according to appropriate media and culture conditions known in the art. Such culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0109] In the present disclosure, "medium" means a substance containing nutrients as a main component necessary for culturing the microorganism of the present application (e.g., Corynebacterium glutamicum strain), and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of the present application may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of the present application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0110] For example, culture media for strains of the spp. Corynebacterium can be found in the "Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981).

[0111] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0112] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0113] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0114] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0115] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0116] The valine produced by the culture of the present invention may be secreted into the medium or remain within the cells.

[0117]

[0118] The method for producing valine or increasing valine production of the present application may additionally include a step of preparing a microorganism (strain) of the present application, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, prior to the culturing step.

[0119] The method for producing valine or increasing valine production of the present application may further include a step of recovering valine from the culture medium (the medium in which the culture is performed) or the microorganism (Corynebacterium spp. strain) according to the above-described cultivation. The recovering step may be additionally included after the above-described culturing step.

[0120] The above recovery may be performed by collecting the target valine using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target valine may be recovered from the medium or microorganism using a suitable method known in the art.

[0121] Additionally, the valine production method or method for increasing valine production of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, if the valine production method or method for increasing valine production of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0122]

[0123] The microorganism with enhanced activity of the phosphotransacetylase and acetic acid kinase operons of the present application has excellent valine production ability and can be efficiently utilized for mass production of valine.

[0124]

[0125] Example 1. Construction of a plasmid for enhancing Pta-ackA

[0126] A plasmid that enhances the activity of the phosphotransacetylase and acetate kinase operon (pta-ackA operon) was constructed by strengthening the activity through promoter replacement and inserting additional genes into the chromosome based on the valine-producing strain Corynebacterium glutamicum KCCM11201P (US Registered Publication No. US 8465962 B).

[0127]

[0128] Example 1-1. Construction of a plasmid for promoter replacement

[0129] In order to enhance the activity of the phosphotransacetylase and acetate kinase operon (pta-ackA operon), we selected a promoter stronger than the expression of the endogenous pta-ackA operon and attempted to enhance it. To this end, we constructed a plasmid that enhances pta-ackA activity by replacing Ppta (wild-type promoter of the pta gene) located in front of the operon with Ppyk (promoter of the pyk gene), PctaE (promoter of the ctaE gene), or PpfkA (promoter of the pfkA gene).

[0130] The amino acid sequences of phosphotransacetylase (Pta) and acetate kinase (ackA), the nucleic acid sequences of the genes encoding them, and the nucleic acid sequences of each promoter (PctaE, Ppyk, PpfkA) are shown in Table 1 below.

[0131] Specifically, to construct pta-ackA operon-enhanced strains having PctaE, Ppyk, or PpfkA promoters, each fragment was obtained through PCR using the chromosome of Corynebacterium glutamicum KCCM11201P (US 8465962 B), a valine-producing strain, as a template. PfuUltraTM high-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and these denaturation, annealing, and polymerization conditions were repeated 28 times.

[0132] As a result, a 606 bp DNA fragment at the 5' upper side of autologous Ppta was obtained using the primers of SEQ ID NO: 8 and SEQ ID NO: 9, and a 600 bp DNA fragment at the 3' lower side of autologous Ppta was obtained using the primers of SEQ ID NO: 10 and SEQ ID NO: 11. In addition, a 369 bp fragment of PctaE (SEQ ID NO: 5), a 490 bp fragment of Ppyk (SEQ ID NO: 6), and a 500 bp fragment of PpfkA (SEQ ID NO: 7) were obtained using the primers of SEQ ID NO: 12 and SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15, and SEQ ID NO: 16 and SEQ ID NO: 17, respectively. The primer sequences used to perform each of the above PCRs using the amplified promoter and the DNA fragments at the upper and lower sides of Ppta as templates are as shown in Table 2 below.

[0133]

[0134]

[0135]

[0136]

[0137] Sequence number name sequence 8PrimergctcggtacccggggatccCGTCCGTGTCGGATTTCATCA9PrimerctcgagACATCGCCTTTCTAGTTTCAGCC10PrimerATGTCTGACACACCG ACCTCAGCT11PrimercctgcaggtcgactctagaAGTGTTAAGGTGCAGGCCAAG12PrimerAAAGGCGATGTctcgagCATGAATCGCATTAAGCTGCAAAAAC13Prim erTCGGTGTGTCAGACATGCTATCTAGTATGGCTGTTTGGTTG14PrimerAAAGGCGATGTctcgagCTCTACGTAGCTGGTTACACCTT15PrimerTCGGTGTGTCAGACATGCCCATAAGCCTAGTACGTCAT16PrimerAAAGGCGATGTctcgagTTCTTGGCAAGTGGGTGGGA17PrimerTCGGTGTGTCAGACATATTAAACCCATCACAACACCCGC

[0138]

[0139] PCR was performed using the amplified promoter fragments and the DNA fragments upstream and downstream of Ppta as templates with primers of SEQ ID NO: 8 and SEQ ID NO: 11. The PCR conditions were denaturation at 95°C for 5 minutes, followed by 28 cycles of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.

[0140] As a result, DNA fragments containing the desired promoter sequences were amplified between the sequences upstream and downstream of the Ppta promoter for replacement of the self-Ppta promoter with each promoter. The amplified products were purified using a PCR purification kit (PCR Purification kit, QUIAGEN) and used as insert DNA fragments for vector construction.

[0141] The amplified DNA fragments and pDC24 vector (SEQ ID NO: 33, Table 3) treated with BamHI and XbaI (New England Biolabs, Berverly, MA) were cloned using the infusion cloning kit from TaKaRa according to the provided manual to construct the vectors pDC24_△Pn_pta::PctaE_pta, pDC24_△Pn_pta::Ppyk_pta, and pDC24_△Pn_pta::PpfkA_pta for Corynebacterium glutamicum KCCM11201P self-Ppta replacement.

[0142]

[0143]

[0144]

[0145] Example 1-2. Construction of plasmids for gene insertion

[0146] In order to strengthen the target gene by additionally inserting the pta-ackA operon into the Corynebacterium glutamicum KCCM11201P chromosome, an intergenic site that does not encode genetic information in the KCCM11201P genome was used as an insertion site to eliminate the influence of gene deletion. The non-coding region between NCgl2195 and NCgl2196 (hereinafter referred to as NCgl2195down) was selected. At this time, the PctaE promoter, which is stronger than the expression of the autologous promoter or the endogenous pta-ackA operon, was used, and all template chromosomes for the experiments were used for PCR using the KCCM11201P genome. PfuUltraTM high-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were as follows: denaturation at 95 °C for 30 s; extension at 55 °C for 30 s; and 72 ℃ 1 minute polymerization reaction, and denaturation, annealing, and polymerization reaction under these conditions were repeated 28 times.

[0147] Using primers of SEQ ID NO: 18 and SEQ ID NO: 19, a 1200 bp fragment of the 5' upper part of NCgl2195down was obtained, using primers of SEQ ID NO: 20 and SEQ ID NO: 21, a 1157 bp fragment of the 3' lower part of NCgl2195down was obtained, using primers of SEQ ID NO: 22 and SEQ ID NO: 23, a 3079 bp fragment of Pn_pta-ackA, which is the entire operon from its own promoter, was obtained, using primers of SEQ ID NO: 24 and SEQ ID NO: 25, a 369 bp fragment of the PctaE promoter part, and using primers of SEQ ID NO: 26 and SEQ ID NO: 23, a 2579 bp fragment of the pta-ackA operon ORF part was obtained, respectively. The primer sequences used to perform each of the above PCRs are as shown in Table 4 below.

[0148] SEQ ID NO: Name Sequence 18PrimergctcggtacccggggatccCGATCCATGCTGGTAGAAATCA19PrimerGTTCAAGTTTGCTGCCATCCCAGGT20PrimerTTGGCTCAAATTAGTGCCGAAGGCGA21PrimercctgcaggtcgactctagaCATGCAATGGTAGACGCTCAG22PrimerTGGCAGCAAACTTGAACTCCTT AAAGGGGTTTTAAAAAATGTGG23PrimerTCGGCACTAATTTGAGCCAACTAAGCGAACTTCACCGCGTA24PrimerTGGCAGCAAACTTGAACCATGAATCGCATTAAGCTGCAAAAA25PrimerAGGTCGGTGTGTCAGACATGCTATCTAGTATGGCTGTTTTGGT26PrimerATGTCTGACACACCGACCTCAGCT

[0149] For the production of gene insertion fragments using a self-promoter, PCR was performed using the NCgl2195down upstream and downstream fragments and the 3079 bp fragment of Pn_pta-ackA, which is the entire operon from the self-promoter, as templates with primers of SEQ ID NO: 18 and SEQ ID NO: 21. For the production of gene insertion fragments using the ctaE promoter, PCR was performed using the NCgl2195down upstream and downstream fragments, the PctaE promoter fragment, and the 2579 bp fragment of the pta-ackA operon ORF as templates with primers of SEQ ID NO: 18 and SEQ ID NO: 21. The PCR conditions were denaturation at 95°C for 5 minutes, followed by 28 cycles of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 2 minutes, and then polymerization was performed at 72°C for 5 minutes.

[0150] The vectors pDC24_△NCgl2195down::Pn_pta-ackA and pDC24_△NCgl2195down::PctaE_pta-ackA for additional insertion of the Corynebacterium glutamicum KCCM11201P pta-ackA operon were constructed by cloning the amplified DNA fragment and the pDC24 vector treated with BamHI and XbaI (New England Biolabs, Berverly, MA) using the infusion cloning kit from TaKaRa according to the provided manual.

[0151]

[0152] Example 2. Production of a strain with enhanced activity of the phosphotransacetylase and acetate kinase operon (pta-ackA operon) and confirmation of L-valine production ability.

[0153]

[0154] Example 2-1. Production of promoter replacement strains

[0155] The pDC24_△Pn_pta::PctaE_pta, pDC24_△Pn_pta::Ppyk_pta, and pDC24_△Pn_pta::PpfkA_pta vectors constructed in Example 1-1 were transformed into Corynebacterium glutamicum KCCM11201P by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The strain in which the vector was inserted into the chromosome by recombination of the homologous sequence was selected on a medium containing 25 mg / l of kanamycin. Afterwards, the above-mentioned Corynebacterium glutamicum transformant that completed the second recombination was subjected to PCR using the primers of SEQ ID NO: 8 and SEQ ID NO: 11, and the base sequence was confirmed to confirm whether the promoter was replaced. The strains in which the promoter of the pta gene was replaced from the parent strain KCCM11201P on the chromosome were named Corynebacterium glutamicum KCCM11201P_△Pn_pta::PctaE_pta, KCCM11201P_△Pn_pta::Ppyk_pta, and KCCM11201P_△Pn_pta::PpfkA_pta, respectively.

[0156]

[0157] Example 2-2. Confirmation of L-valine production ability of promoter replacement strain

[0158] To compare the valine production ability of Corynebacterium glutamicum KCCM11201P, a valine-producing strain, and four strains prepared in Example 2-1, KCCM11201P_△Pn_pta::PctaE_pta, KCCM11201P_△Pn_pta::Ppyk_pta, and KCCM11201P_△Pn_pta::PpfkA_pta, a flask assay was performed. After subculturing each strain in nutrient medium, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and cultured at 30°C for 72 hours with shaking at 200 rpm. The final OD, valine production yield, and relative sugar consumption rate of each strain were measured and are shown in Table 5 below.

[0159] [Nutrient medium (pH 7.2)]

[0160] Glucose 10 g, meat extract 5 g, polypeptone 10 g, sodium chloride 2.5 g, yeast extract 5 g, agar 20 g, urea 2 g (per 1 liter of distilled water)

[0161] [Production medium (pH 7.0)]

[0162] Glucose 100 g, ammonium sulfate 40 g, soy protein 2.5 g, corn steep solids 5 g, urea 3 g, potassium phosphate dibasic 1 g, magnesium sulfate heptahydrate 0.5 g, biotin 100 μg, thiamine-HCl 1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, calcium carbonate 30 g (based on 1 liter of distilled water)

[0163] Strain FN OD Valine yield Valine yield increase (compared to parent strain) Relative sugar consumption rate (compared to parent strain) 562 nm %%% KCCM11201P 7 1.8 2.7 100 100 KCCM11201P_△Pn_pta::PctaE_pta 7 0.43 5 129 63 109 KCCM11201P_△Pn_pta::Ppyk_pta 6 7.83 3 122 22 104 KCCM11201P_△Pn_pta::PpfkA_pta 6 9.9 3.0 111 11104

[0164] As shown in Table 5, when the self-promoter was replaced to enhance the expression of the pta-ackA operon, the relative sugar consumption rate was superior to that of the parent strain (KCCM11201P), and the yield did not decrease, confirming the effect of enhancing valine productivity through enhanced expression of the pta-ackA operon.

[0165]

[0166] Example 2-3. Production of strains with additional gene insertion

[0167] In order to confirm the effect of improving valine productivity when the pta-ackA operon expression was enhanced by promoter replacement, and to confirm the enhancement effect through additional insertion of the pta-ackA operon into the chromosome, additional insertion into the ctaE promoter and its own promoter, which were most effective in Example 2-2, was performed. The pDC24_△NCgl2195down::Pn_pta-ackA, pDC24_△NCgl2195down::PctaE_pta-ackA vectors constructed in Example 1-2 were transformed into Corynebacterium glutamicum KCCM11201P by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The strain in which the vector was inserted into the chromosome by recombination of homologous sequences was selected on a medium containing 25 mg / l of kanamycin. After the secondary recombination was completed, the above-mentioned Corynebacterium glutamicum transformant was subjected to PCR using primers of SEQ ID NO: 18 and SEQ ID NO: 21, and the base sequence was confirmed to confirm whether the promoter was replaced. The strains in which the pta-ackA operon was additionally inserted from the parent strain KCCM11201P on the chromosome were named Corynebacterium glutamicum KCCM11201P_△NCgl2195down::Pn_pta-ackA and KCCM11201P_△NCgl2195down::PctaE_pta-ackA, respectively.

[0168]

[0169] Example 2-4. Confirmation of L-valine production ability of strain with additional gene insertion

[0170] To compare the valine production capacity of Corynebacterium glutamicum KCCM11201P, a valine-producing strain, and two strains produced in Example 2-3, KCCM11201P_△NCgl2195down::Pn_pta-ackA and KCCM11201P_△NCgl2195down::PctaE_pta-ackA, a flask evaluation was performed as in Example 2-2. The final OD, valine production yield, and relative sugar consumption rate of each strain were measured and are shown in Table 6 below.

[0171] Strain FN OD Valine yield Valine yield increase (compared to parent strain) Relative sugar consumption rate (compared to parent strain) 562 nm %%% KCCM11201P 7 1.9 2.7 100 100 KCCM11201P_△NCgl2195 down::Pn_pta-ackA 7 2.22 8 103.70 102 KCCM11201P_△NCgl2195 down::PctaE_pta-ackA 6 9.7 3.3 122.22 107

[0172] As shown in Table 6, when the pta-ackA gene was additionally inserted to enhance the expression of the pta-ackA operon, it was confirmed that the relative sugar consumption rate and valine yield increased compared to the parent strain (KCCM11201P).

[0173]

[0174] Example 2-5. Evaluation of valine production capacity of Corynebacterium glutamicum CJ7V strain.

[0175] To determine whether the effect of strengthening the Pta-ackA operon also increases valine production in other strains of Corynebacterium glutamicum that produce valine, a strain with improved valine production was constructed by introducing a mutation [ilvN (A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467] into the acetolactate synthase isozyme 1 small subunit (IlvN) protein of wild-type Corynebacterium glutamicum ATCC14067.

[0176] Specifically, to construct a vector introducing the A42V mutation into the ilvN gene, genomic DNA of the wild-type Corynebacterium glutamicum ATCC14067 strain was extracted using a G-spin Total DNA Extraction Mini Kit (Intron, Cat. No. 17045) according to the manufacturer's protocol. Using the genomic DNA as a template, PCR was performed using primer pairs of SEQ ID NOs: 27 and 28 and primer pairs of SEQ ID NOs: 29 and 30 to obtain gene fragments A and B, respectively. The PCR conditions were denaturation at 94°C for 5 minutes; 28 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 60 seconds; and polymerization was performed at 72°C for 7 minutes. As a result, 528 bp gene fragment A and 509 bp gene fragment B were obtained. Overlapping PCR was performed using the obtained gene fragments A and B as templates and the primer pair of SEQ ID NO: 27 and SEQ ID NO: 30. As a result, a 1010 bp PCR product (hereinafter referred to as "mutation introduction fragment 2") was obtained.

[0177] The mutation fragment 2 obtained above was treated with the restriction enzyme SmaI, ligated with the pDC24 vector treated with the same restriction enzyme, and transformed into E. coli DH5α strain (INVITROGEN, DH5a competent cell) by electroporation to induce homologous recombination on the chromosome. The strain in which the vector was inserted into the chromosome by recombination of homologous sequences was selected on LB medium containing kanamycin. DNA was obtained from the selected E. coli transformant using a DNA-spin plasmid DNA purification kit according to the manufacturer's protocol, thereby constructing the pDC24-ilvN(A42V) vector for introducing the A42V mutation of the ilvN gene, which includes the mutation fragment 2.

[0178] The primer sequences used here are as shown in Table 7 below.

[0179] Sequence number name sequence (5' -> 3') 27primercggggatcccccgggAGGACGGTACTCAAATACTAAAACTTC28primerTGCCGAGTGTTTCGGTCTTTACAGACACGAGGGACACG29primerTGTCTGTAAAGACCGAAACACTCGGCATCAA30primercggggatcccccgggGACAACTACATTATTATTATACCACA

[0180] The pDC24-ilvN (A42V) vector constructed above was transformed into wild-type Corynebacterium glutamicum ATCC14067 by homologous recombination on the chromosome. The strain in which the vector was inserted into the chromosome by recombination of homologous sequences was selected on a medium containing 25 mg / l kanamycin. After that, PCR was performed using the primer pair of SEQ ID NO: 27 and SEQ ID NO: 30 for the above Corynebacterium glutamicum transformant that completed the second recombination to amplify the gene fragment, and the strain in which the A42V mutation was introduced into the ilvN gene was confirmed through gene sequence analysis. The recombinant strain was named Corynebacterium glutamicum CJ7V.

[0181] Finally, the pDC24-△Pn_pta::PctaE_pta, pDC24-△NCgl2195down::PctaE_pta-ackA vectors were transformed into Corynebacterium glutamicum CJ7V in the same manner as in Examples 2-1 and 2-3. The recombinant strains were named Corynebacterium glutamicum CJ7V-△Pn_pta::PctaE_pta, CJ7V-△NCgl2195down::PctaE_pta-ackA.

[0182] The L-valine production ability of the parent strain CJ7V and the CJ7V-△Pn_pta::PctaE_pta, CJ7V-△NCgl2195down::PctaE_pta-ackA strains was evaluated using the same method as in Example 2-2, and is shown in Table 8 below.

[0183] Strain FN OD Valine yield Valine yield increase (compared to parent strain) Relative sugar consumption rate (compared to parent strain) 562 nm %%% CJ7V 137.32.2 100 100 CJ7V-△Pn_pta::PctaE_pta 123.92.7 122.73 108 CJ7V-△NCgl 2195 down::PctaE_pta-ackA 128.42.6 118.18 106

[0184] As a result, it was reconfirmed that strengthening the pta-ackA operon of Corynebacterium glutamicum, which produces valine, increases the sugar consumption rate and valine yield.

[0185]

[0186] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present application should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the claims described below, and their equivalent concepts, rather than the detailed description above.

Claims

1. Microorganisms with enhanced activity of the phosphotransacetylase and acetyl phosphatase operon (pta-ackA operon).

2. A microorganism in the first paragraph, wherein the strengthening is (i) replacement of the promoter of the pta-ackA operon with a strong promoter, (ii) increase in the copy number of the pta-ackA operon, or (iii) a combination thereof.

3. A microorganism according to claim 2, wherein the strong promoter is at least one selected from the group consisting of a promoter of the pyk gene, a promoter of the ctaE gene, and a promoter of the pfkA gene.

4. A microorganism in the second paragraph, wherein the promoter of the pta-ackA operon is replaced with a promoter comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO:

7.

5. A microorganism according to claim 1, wherein the pta-ackA operon comprises a nucleic acid sequence of sequence number 2 and a nucleic acid sequence of sequence number 4.

6. A microorganism having increased valine production ability in the first paragraph.

7. In paragraph 1, the microorganism is a microorganism of the genus Corynebacterium.

8. In paragraph 7, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum. 9.(a) at least one promoter selected from the group consisting of a promoter of the pyk gene, a promoter of the ctaE gene, and a promoter of the pfkA gene; and (b) a gene expression cassette comprising a structural gene of the pta-ackA operon operably linked to the promoter.

10. A method for producing valine, comprising the step of culturing the microorganism of clause 1 in a medium.

11. A method for producing valine, further comprising a step of recovering valine from a medium or microorganism according to the culture in accordance with paragraph 10.

12. A method for increasing valine production, comprising the step of culturing the microorganism of clause 1 in a medium.

Citation Information

Patent Citations

  • Promoter and uses thereof

    US10273491B2

  • Promoter and use thereof

    US10584338B2

  • Microorganism of the genus Corynebacterium producing L-amino acids and a method for producing L-amino acids using the same

    US11180784B2

  • A microorganism of the genus corynebacterium producing l-amino acids and a method for producing l-amino acids using the same

    US20200362374A1

  • Promoter sequences from Corynebacterium ammoniagenes

    US7662943B2