Microorganism having enhanced activity of acetohydroxy acid synthase large subunit and uses thereof

Abstract

The present invention provides a modified acetohydroxy acid synthase large subunit, and a microorganism into which the modified acetohydroxy acid synthase large subunit is introduced exhibits excellent valine productivity.

Description

Microorganisms with enhanced activity of acetohydroxy acid synthase large subunit and uses thereof

[0001] Cross-citation with related application(s)

[0002] This disclosure claims the benefit of priority to Republic of Korea Patent Application No. 10-2023-0181939, dated December 14, 2023, the entire contents of which are incorporated herein by reference.

[0003] The present disclosure relates to a microorganism having enhanced activity of the large subunit of acetohydroxy acid synthase and its use.

[0004]

[0005] L-amino acids are the basic structural units of proteins and are used as important materials for pharmaceutical raw materials, food additives, animal feed, nutritional supplements, pesticides, and disinfectants. In particular, branched-chain amino acids (BCAAs) are a general term for the essential amino acids L-valine, L-leucine, and L-isoleucine. These branched-chain amino acids are known to have antioxidant effects and directly promote protein synthesis in muscle cells.

[0006] Meanwhile, production of branched-chain amino acids using microorganisms is mainly carried out through microorganisms of the genus Corynebacterium, but the production of branched-chain amino acids using the above microorganisms has the problem that it is not easy to mass-produce them industrially.

[0007]

[0008] [Prior Art Literature]

[0009] [Patent Document]

[0010] (Patent Document 1) US Registered Patent US 8465962 B2

[0011]

[0012] The purpose of the present application is to provide a polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.

[0013] Another object of the present application is to provide a polynucleotide encoding the polypeptide.

[0014] Another object of the present application is to provide a recombinant vector comprising the polynucleotide.

[0015] Another object of the present application is to provide a microorganism comprising at least one selected from the group consisting of the above polypeptide, polynucleotide and recombinant vector.

[0016] Another object of the present application is to provide a composition for producing valine comprising the above microorganism.

[0017] Another object of the present application is to provide a method for producing valine, comprising a step of culturing the microorganism in a medium.

[0018] Another object of the present application is to provide a method for increasing valine production, comprising the step of culturing the microorganism in a medium.

[0019]

[0020] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions described below. In addition, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly explain the level of the technical field to which the present invention pertains and the contents of the present invention. Furthermore, those skilled in the art will recognize or be able to identify numerous equivalents to the specific embodiments of the present application described in this application using only routine experimentation. Furthermore, such equivalents are intended to be encompassed by this application.

[0021]

[0022] The present application is described in more detail below.

[0023]

[0024] polypeptide

[0025] The present disclosure confirms that a microorganism into which a mutant acetohydroxy acid synthase large subunit has been introduced has increased valine production ability compared to a microorganism before modification, and thus provides a mutant acetohydroxy acid synthase large subunit and a microorganism including the same.

[0026] One aspect provides a polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.

[0027] The above polypeptide may be a polypeptide having the enzymatic activity of acetohydroxy acid synthase large subunit. The acetohydroxy acid synthase large subunit may have an enzymatic activity (e.g., EC: 2.2.1.6) that converts pyruvate into (2S)-2-acetolactate. The (2S)-2-acetolactate is a substance corresponding to a precursor of valine in the valine biosynthetic pathway.

[0028] The above acetohydroxy acid synthase large subunit may be derived from a microorganism of the genus Corynebacterium, such as, but not limited to, Corynebacterium glutamicum.

[0029] In one example, the acetohydroxy acid synthase large subunit may be represented by the amino acid sequence of SEQ ID NO: 1, and the amino acid sequence may be obtained from a known database (e.g., NCBI Reference Sequence: WP_003861427.1).

[0030] The above polypeptide may be a polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.

[0031] The above other amino acid may be an amino acid other than histidine, which is the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1, namely arginine, proline, asparagine, lysine, aspartic acid, glutamic acid, serine, threonine, glutamine, cysteine, glycine, alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, or tryptophan.

[0032] In one example, the polypeptide may be a polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with arginine, proline, asparagine, lysine, aspartic acid, glutamic acid, serine, threonine, glutamine, cysteine, glycine, alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, or tryptophan.

[0033] In one example, the polypeptide may be a polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with arginine, proline, or asparagine.

[0034] In one example, the polypeptide has an amino acid sequence of SEQ ID NO: 1 that is at least 99.84%, 99.68%, 99.52%, 99.36%, 99.2%, 99.04%, 98.88%, 98.72%, 98.56%, 98.4%, 98.24%, 98.08%, 97.92%, 97.44%, 97.28%, 97.12%, 96.96%, 96.81%, 96.5%, 96%, 95.5%, 95%, 94.5%, 94%, 93.5%, 93%, 92.5%, A polypeptide comprising an amino acid sequence having a homology or identity of at least 92%, at least 91.5%, at least 91%, at least 90.5%, at least 90%, at least 89%, at least 88%, at least 87%, at least 86%, at least 85%, at least 84%, at least 83%, at least 82%, at least 81%, at least 80%, at least 79%, at least 78%, at least 77%, at least 76%, at least 75%, at least 74%, at least 73%, at least 72%, at least 71%, or at least 70%, and wherein the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.

[0035] In one example, the polypeptide may be a polypeptide comprising the amino acid sequence of SEQ ID NO: 1, and in which the amino acid at the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is replaced with a different amino acid.

[0036] In one example, the polypeptide may be a polypeptide comprising an amino acid sequence of SEQ ID NO: 1, and wherein the 150th amino acid residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with arginine, proline, asparagine, lysine, aspartic acid, glutamic acid, serine, threonine, glutamine, cysteine, glycine, alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, or tryptophan.

[0037] In one example, the polypeptide may be a polypeptide comprising an amino acid sequence of SEQ ID NO: 1, and wherein the amino acid at the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with arginine, proline, or asparagine.

[0038] In one specific example, the polypeptide may comprise or consist of any one amino acid sequence selected from the group consisting of amino acid sequences of SEQ ID NO: 3, SEQ ID NO: 13, and SEQ ID NO: 14, but is not limited thereto.

[0039] In one example, the polypeptide comprises at least 99.84% or more, 99.68% or more, 99.52% or more, 99.36% or more, 99.2% or more, 99.04% or more, 98.88% or more, 98.72% or more, 98.56% or more, 98.4% or more, 98.24% or more, 98.08% or more, 97.92% or more, 97.44% or more, 97.28% or more, 97.12% or more, 96.96% or more, 96.81% or more, 96.5% or more, 96% or more, 95.5% or more, 95% or more, 94.5% or more, 94% or more, An amino acid sequence having a homology or identity of 93.5% or more, 93% or more, 92.5% or more, 92% or more, 91.5% or more, 91% or more, 90.5% or more, 90% or more, 89% or more, 88% or more, 87% or more, 86% or more, 85% or more, 84% or more, 83% or more, 82% or more, 81% or more, 80% or more, 79% or more, 78% or more, 77% or more, 76% or more, 75% or more, 74% or more, 73% or more, 72% or more, 71% or more, or 70% or more may be a polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.

[0040] If the polypeptide above contains a mutation in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, it is obvious that the polypeptide of the present disclosure can be included even if amino acid residues other than the amino acid corresponding to the 150th residue are deleted, modified, substituted or added, as long as they exhibit acetohydroxy acid synthase large subunit activity. For example, it may have a case in which the polypeptide has a sequence addition or deletion that does not alter the activity of the polypeptide, a naturally occurring mutation, a silent mutation or a conservative substitution at the N-terminus, C-terminus and / or within the amino acid sequence of the polypeptide.

[0041] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid with similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0042] The polypeptide may have an activity that increases acetohydroxy acid synthase large subunit activity and / or valine production ability of a microorganism. The acetohydroxy acid synthase large subunit activity may refer to an enzyme activity (e.g., EC: 2.2.1.6) that converts pyruvate to (2S)-2-acetolactate, as described above.

[0043] As used herein, the term "variant polypeptide" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant polypeptide before the mutation, but retaining functions or properties. Such variant polypeptides can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant polypeptide may be increased, unchanged, or decreased compared to the polypeptide before the mutation. Additionally, some variant polypeptides may include variant polypeptides in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variant polypeptides may include variant polypeptides in which portions are deleted from the N- and / or C-terminus of the mature protein. The term "variant polypeptide" may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, variant, etc.), and is not limited thereto as long as the term is used in the meaning of mutation. In addition, the variant polypeptide may include deletion or addition of amino acids that have minimal effect on the characteristics and secondary structure of the polypeptide. For example, a signal (or leader) sequence involved in protein translocation co-translationally or post-translationally may be conjugated to the N-terminus of the variant polypeptide.Additionally, the above mutant polypeptides may be conjugated with other sequences or linkers to enable identification, purification, or synthesis.

[0044] For the purpose of the present disclosure, the mutant polypeptide may be a polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.

[0045] The above mutant polypeptide may have increased activity in increasing acetohydroxy acid synthase large subunit activity and / or valine production ability of a microorganism compared to a polypeptide before mutation (e.g., a polypeptide comprising the amino acid sequence of SEQ ID NO: 1).

[0046]

[0047] polynucleotide

[0048] Another aspect provides a polynucleotide encoding the polypeptide.

[0049] In the present disclosure, the term "polynucleotide" may mean a DNA or RNA strand of a certain length or longer, which is a polymer of nucleotides in which nucleotide units (monomers) are linked in a long chain shape by covalent bonds.

[0050] The polynucleotide may be a polynucleotide encoding a polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid. In one example, the polynucleotide may be a polynucleotide in which a codon encoding histidine, an amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1, is replaced with a codon encoding another amino acid, i.e., arginine, proline, asparagine, lysine, aspartic acid, glutamic acid, serine, threonine, glutamine, cysteine, glycine, alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, or tryptophan. In one example, the polynucleotide may be a polynucleotide in which a codon encoding an amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with a codon encoding arginine, proline, or asparagine.

[0051] It is well known in the art that the codon encoding each amino acid comprises a polynucleotide sequence. Various modifications can be made to the codon without altering the amino acid sequence of the polypeptide, taking into account codon degeneracy or preferred codons in the organism intended to express the polypeptide.

[0052] In one example, the polynucleotide may encode a polypeptide in which the amino acid at the 150th residue from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is replaced with a different amino acid. The polynucleotide may be a polynucleotide in which the codon corresponding to the 448th to 450th positions from the 5' end in the polynucleotide sequence of SEQ ID NO: 2 is replaced with a codon encoding a different amino acid.

[0053] In one example, the polynucleotide may be a polynucleotide encoding a polypeptide comprising any one amino acid sequence selected from the group consisting of amino acid sequences of SEQ ID NO: 3, SEQ ID NO: 13, and SEQ ID NO: 14.

[0054] In one specific example, the polynucleotide may comprise or consist of any one nucleic acid sequence selected from the group consisting of the nucleic acid sequences of SEQ ID NO: 4, SEQ ID NO: 19, and SEQ ID NO: 20.

[0055] The polynucleotide of the present disclosure may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present disclosure. The term “stringent conditions” refers to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, among polynucleotides having high homology or identity, at least 99.84% or more, 99.68% or more, 99.52% or more, 99.36% or more, 99.2% or more, 99.04% or more, 98.88% or more, 98.72% or more, 98.56% or more, 98.4% or more, 98.24% or more, 98.08% or more, 97.92% or more, 97.44% or more, 97.28% or more, 97.12% or more, 96.96% or more, 96.81% or more, 96.5% or more, 96% or more, 95.5% or more, 95% or more, 94.5% or more, 94% or more, 93.5% or more, 93% or more, 92.5% or more, 92% or more, 91.5% or more, 91% or more, 90.Conditions under which polynucleotides having a homology or identity of 5% or more, 90% or more, 89% or more, 88% or more, 87% or more, 86% or more, 85% or more, 84% or more, 83% or more, 82% or more, 81% or more, 80% or more, 79% or more, 78% or more, 77% or more, 76% or more, 75% or more, 74% or more, 73% or more, 72% or more, 71% or more, or 70% or more hybridize with each other, and polynucleotides having a lower homology or identity do not hybridize with each other, or washing conditions of a typical southern hybridization, such as 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, and more specifically 68°C, 0.1×SSC, Conditions for washing once, specifically two to three times, at a salt concentration and temperature equivalent to 0.1% SDS can be listed.

[0056] Hybridization requires that two nucleotide sequences be complementary, but hybridized polynucleotides may contain some mismatches between bases, depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present disclosure may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0057] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present disclosure can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.

[0058] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).

[0059]

[0060] In this specification, the phrase "a polynucleotide (which may be used interchangeably with a "gene") or a polypeptide (which may be used interchangeably with a "protein") "contains or consists of or is expressed by a specific nucleic acid sequence or amino acid sequence" may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence or amino acid sequence, and may be interpreted as including (or not excluding) a "substantially equivalent sequence" in which a non-significant mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence or amino acid sequence to the extent that the original function and / or the desired function of the polynucleotide or polypeptide is maintained.

[0061] As used herein, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0062] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0063] Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0064] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or in, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a coding sequence matrix, as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, and (3) a binary comparison matrix, containing values ​​of 1 for identity and 0 for non-identity, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0065] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may determine a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0066] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it with a query sequence (also referred to as a “reference sequence”).

[0067] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.

[0068]

[0069] Another aspect provides a vector comprising the polynucleotide. The vector may be an insertion vector or an expression vector.

[0070] As used herein, the term "vector" refers to a DNA construct for delivering a target polynucleotide into a suitable host or host cell. For example, it may include, but is not limited to, a nucleic acid sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host cell. The control sequence may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence for regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may remain independent of the genome (genome) of the host cell, or may be integrated into the genome of the host cell. For example, the target polynucleotide may be integrated into a chromosome via an insertion vector. Insertion of the polynucleotide into a chromosome can be accomplished by any method known in the art, for example, but not limited to, homologous recombination.

[0071] The vector usable in this specification is not particularly limited as long as it is replicable in a host cell, and may be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc. in a natural or recombinant state. For example, as the vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc. can be used as a phage vector or a cosmid vector, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc. can be used as a plasmid vector. Specifically, examples thereof include, but are not limited to, pDC24 (SEQ ID NO: 21), pDCM2, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC vectors.

[0072] The above vector may further comprise a selection marker to determine whether the vector has been introduced into a transformed cell or has been integrated into the genome of the transformed cell. The selection marker is used to determine whether the vector-transformed cell or the polynucleotide has been integrated, and may be selected from genes that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or surface protein expression. In an environment treated with a selective agent, only cells expressing the selection marker will survive or exhibit other phenotypic characteristics, thereby enabling the selection of transformed cells.

[0073] Expression of the above polypeptide in a microorganism can be performed by introducing a polynucleotide encoding the above polypeptide, or a vector containing the polynucleotide, into a host cell and culturing a recombinant cell (e.g., a microorganism) containing the same.

[0074] The introduction of a polynucleotide encoding the polypeptide or a vector containing the polynucleotide into a microorganism can be performed by a person skilled in the art by appropriately selecting a known transformation method. As used herein, the term "transformation" refers to changing the genetic characteristics of a host cell (microorganism) by introducing a target polynucleotide or a vector containing the polynucleotide into the host cell (microorganism). The transformed polynucleotide may be positioned by insertion into the chromosome of the host cell or may be positioned extrachromosomally. The polynucleotide may be introduced in an appropriate form depending on the purpose of introduction. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include expression control elements such as a promoter, a transcription termination signal, a ribosome binding site, and / or a translation termination signal that are operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of autonomous replication. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell. The term "operably linked" as used herein may mean that the polynucleotide is functionally linked to an expression control element (e.g., a promoter) so that transcriptional regulation (e.g., transcription initiation) of the polynucleotide can be performed. Operable linkage can be performed using genetic recombination techniques known in the art.

[0075] The method for transforming the above polynucleotide into a host cell can be performed by any method for introducing a nucleic acid into a cell (microorganism), and can be performed by appropriately selecting a transformation technique known in the art depending on the host cell. Examples of the known transformation methods include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) precipitation, DEAE-dextran, cationic liposome, lipofection, and lithium acetate-DMSO.

[0076]

[0077] A polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of the above sequence number 1 is replaced with another amino acid may have enhanced activity of the large subunit of acetohydroxy acid synthase.

[0078] As used herein, the term “enhancement” of polypeptide activity means that the activity of a polypeptide is increased compared to the intrinsic activity within a host cell (microorganism). The term “enhancement” may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an enhanced activity compared to the intrinsic activity or the activity before modification. The term “intrinsic activity” refers to the activity of a specific polypeptide that a parent strain or unmodified microorganism originally possessed before the trait change, when the trait change is caused by genetic mutation due to natural or artificial factors. This may be used interchangeably with “activity before modification.” “Enhanced,” “upregulated,” “overexpressed,” or “increased” the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of a particular polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0079] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.

[0080] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but are not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0081] Specifically, the enhancement of the polypeptide of the present disclosure is

[0082] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0083] 2) Replacing the gene expression control region on the chromosome that codes for a polypeptide with a highly active sequence;

[0084] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0085] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0086] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0087] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0088] 7) Codon optimization of polynucleotides encoding polypeptides;

[0089] 8) Analyzing the tertiary structure of the polypeptide and selecting the exposed portion to modify or chemically modify; or

[0090] 9) It may be a combination of two or more of the above 1) to 8), but is not particularly limited thereto.

[0091] More specifically,

[0092] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0093] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0094] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0095] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0096] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not chromosomal insertion has occurred. The selection marker is as described above.

[0097] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0098] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0099] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0100] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microorganism, or an increase in the amount of a product produced from the polypeptide.

[0101]

[0102] microorganism

[0103] Another aspect provides a microorganism comprising at least one (e.g., at least one, at least two, or one, two, or three) selected from the group consisting of the polypeptide, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide.

[0104] As used herein, the term "microorganism (or strain)" may encompass both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification. The microorganism may be a microorganism whose specific mechanism has been enhanced or weakened, such as by the insertion of an external gene or the enhancement or weakening of the activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product (e.g., valine). The terms "microorganism," "strain," "host," and "host cell" may be used interchangeably in the present disclosure.

[0105] The microorganism (or strain, recombinant cell) of the present disclosure may be a microorganism having enhanced enzyme activity of the large subunit of acetohydroxy acid synthase, having valine production ability (or production amount), or having enhanced (or increased) valine production ability. The valine may be L-valine.

[0106] For example, the microorganism of the present disclosure may be a microorganism that is naturally incapable of producing valine, or a microorganism that has valine producing ability, and is provided with or has enhanced valine producing ability by introducing at least one member selected from the group consisting of the polypeptide, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide, but is not limited thereto.

[0107] The fact that the above microorganism has enhanced valine production ability or valine production ability may mean that the microorganism has enhanced valine production ability compared to a non-modified microorganism, a cell before recombination, a parent strain, or a wild-type strain, or that the microorganism has been granted valine production ability unlike a non-modified microorganism, a cell before recombination, a parent strain, or a wild-type strain that does not have valine production ability.

[0108] In the present disclosure, the term "unmodified microorganism" does not exclude a strain that contains a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by a genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain into which the mutant polypeptide of the present disclosure or a polynucleotide encoding the mutant polypeptide is not introduced, or before it is introduced. The term "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmutated strain," "unmodified microorganism," or "reference microorganism."

[0109] The above microorganism (or strain, recombinant cell) may additionally include a mutation that increases valine production, and the location of the mutation and / or the type of gene and / or protein that is the target of the mutation may be included without limitation as long as it increases valine production. The above recombinant cell may be used without limitation as long as it is a cell capable of transformation.

[0110] In one example, the microorganism of the present disclosure may further comprise an A42V variant of the Acetolactate synthase isozyme 1 small subunit (IlvN) protein or a nucleotide encoding the same (see Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467).

[0111] In one example, the target strain for comparing whether the valine production ability is increased may be, but is not limited to, a microorganism of the genus Corynebacterium, Corynebacterium glutamicum, for example, a wild-type Corynebacterium glutamicum ATCC14067 strain, a Corynebacterium glutamicum CA08-0072 strain (KCCM11201P, US 8465962 B), a microorganism in which the ilvN A42V mutation is introduced into the Corynebacterium glutamicum ATCC14067 strain (ilvN(A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467).

[0112] The above microorganism may be a microorganism of the genus Corynebacterium (Corynebacterium sp.). The above-mentioned Corynebacterium genus microorganisms are Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium pollutisoli, and Corynebacterium imitans. The microorganism may be one or more species selected from the group consisting of, but is not limited to, Corynebacterium imitans, Corynebacterium testudinoris, and Corynebacterium flavescens.

[0113] For example, the microorganism with improved valine production ability is newly granted valine production ability by about 3% or more, about 4% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 11% or more, about 12% or more, about 13% or more, about 14% or more, about 15% or more, about 16% or more, about 17% or more, about 18% or more, about 19% or more, about 20% or more, about 21% or more, about 22% or more, about 23% or more, about 24% or more, about 25% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% It may be increased by, but is not limited to, about 150% or more, about 200% or more, about 250% or more, about 300% or more, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, about 1,000% or more, about 1,500% or more, about 2,000% or more, about 2,500% or more, or about 3,000% or more.

[0114] As another example, the microorganism with improved valine production ability has a valine production ability of about 1.03 times or more, about 1.04 times or more, about 1.05 times or more, about 1.06 times or more, about 1.07 times or more, about 1.08 times or more, about 1.9 times or more, about 1.1 times or more, about 1.2 times or more, about 1.3 times or more, about 1.4 times or more, about 1.5 times or more, about 1.6 times or more, about 1.7 times or more, about 1.8 times or more, about 1.9 times or more, about 2 times or more, about 2.5 times or more, about 3 times or more, about 4 times or more, about 5 times or more, about 6 times or more, about 7 times or more, about 8 times or more, about 9 times or more, about 10 times or more, about 15 times or more, about 20 times or more, or about It may be 25 times or more, or about 30 times or more (the upper limit is not particularly limited, for example, it may be about 1,000 times or less), but is not limited thereto.

[0115] As another example, the microorganism with improved valine production ability has a valine production ability of about 0.1 g / L or more, about 0.2 g / L or more, about 0.3 g / L or more, about 0.4 g / L or more, about 0.5 g / L or more, about 0.6 g / L or more, about 0.7 g / L or more, about 0.8 g / L or more, about 0.9 g / L or more, about 1 g / L or more, about 1.1 g / L or more, about 1.2 g / L or more, about 1.3 g / L or more, about 1.4 g / L or more, about 1.5 g / L or more, about 1.6 g / L or more, about 1.7 g / L or more, about 1.8 g / L or more, about 1.9 g / L or more, about 2.0 g / L or more, about 2.5 g / L or more, or about It may be 3 g / L or more, about 3.5 g / L or more, about 4 g / L or more, about 4.1 g / L or more, about 4.2 g / L or more, about 4.3 g / L or more, about 4.4 g / L or more, about 4.5 g / L or more, about 4.6 g / L or more, about 4.7 g / L or more, about 4.8 g / L or more, about 4.9 g / L or more, about 5 g / L or more, about 5.5 g / L or more, about 6 g / L or more, about 7 g / L or more, about 8 g / L or more, about 9 g / L or more, about 10 g / L or more, about 15 g / L or more, about 20 g / L or more, about 25 g / L or more, about 30 g / L or more (the upper limit is not particularly limited, and may be, for example, about 100 g / L or less), but is not limited thereto.

[0116] The term “about” above includes all ranges including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all ranges of values ​​equal to or similar to the value following the term “about,” but is not limited thereto.

[0117]

[0118] Composition for producing valine and method for producing valine

[0119] Another aspect provides a composition for producing valine comprising the microorganism, a medium in which the microorganism is cultured, or a combination thereof.

[0120] Another aspect provides for the use of the above microorganisms in the production of varnish.

[0121] The composition of the present disclosure may further comprise any suitable excipient commonly used in compositions for producing valine, including but not limited to preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0122] Another aspect provides a method for producing (or preparing) valine, comprising the step of culturing the microorganism in a medium.

[0123] Another aspect provides a method for increasing valine production, comprising the step of culturing the microorganism in a medium.

[0124] The method for producing valine or increasing valine production of the present disclosure may include a step of culturing the microorganism in a medium.

[0125] In the present disclosure, "cultivation" refers to growing the microorganism, such as a Corynebacterium glutamicum strain, under appropriately controlled environmental conditions. The culturing process can be performed using any suitable medium and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0126] In the present disclosure, "medium" means a material containing nutrients as a main component necessary for culturing the microorganism, for example, a Corynebacterium glutamicum strain, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of the present disclosure may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of the present disclosure may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid, and / or vitamin.

[0127] Specifically, culture media for the above microorganisms, such as strains of the genus Corynebacterium, can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.Corynebacterium, USA, 1981)].

[0128] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses (e.g., blackstrap molasses), rice bran, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0129] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0130] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0131] In addition, during the cultivation of the above microorganism, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas can be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas can be injected without gas injection, but is not limited thereto.

[0132] In the culture of the present disclosure, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0133] The valine produced by the culture of the present disclosure may be secreted into the medium or remain within the cells.

[0134] The method for producing valine or increasing valine production of the present disclosure may additionally include a step of preparing the microorganism, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, prior to the culturing step.

[0135] The method for producing valine or increasing valine production of the present disclosure may further include a step of recovering valine from a culture medium (a culture medium in which culture is performed) or a microorganism (e.g., a strain of the genus Corynebacterium). The recovering step may be additionally included after the culturing step.

[0136] The above recovery may be performed by collecting the desired valine using a suitable method known in the art according to the culture method of the microorganism of the present disclosure, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallizing protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the desired valine may be recovered from the medium or microorganism using a suitable method known in the art.

[0137] Additionally, the method for producing valine or increasing valine production of the present disclosure may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the method for producing valine or increasing valine production of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0138]

[0139] The present disclosure provides a mutant acetohydroxy acid synthase large subunit, and a microorganism into which the mutant acetohydroxy acid synthase large subunit has been introduced has excellent valine production ability.

[0140]

[0141] The present invention will be described in more detail below with reference to the following examples. However, these examples are provided solely to illustrate the present invention, and the scope of the present invention is not limited by these examples.

[0142]

[0143] Example 1. Selection of mutant strains with increased valine production through artificial mutation.

[0144] Example 1-1. Induction of artificial mutations using gamma ray irradiation

[0145] To select mutant strains with increased valine production, microbial mutations were induced using the following method. Gamma irradiation, a physical method, was used to induce mutations.

[0146] To obtain a highly L-valine-producing microorganism, a gamma-irradiation-based mutant library was constructed using the KCCM11201P (US 8465962 B) strain, and L-valine highly-producing mutants were screened. For gamma-irradiation of the KCCM11201P strain, a 500 mL flask containing 50 mL of seed medium was cultured in a shaking incubator at 30°C for 24 hours to obtain a culture solution with an absorbance 562 nm value of 7.84. The culture solution was then diluted using the seed medium to an absorbance 562 nm value of 6.10. 30 mL of the diluted solution was irradiated with gamma rays for 1 hour using a high-level gamma-irradiation device at the Advanced Radiation Research Laboratory of the Korea Atomic Energy Research Institute, and 100 μl of the irradiation solution was spread on the activation medium of 100 90x15 mm petri dishes. A total of 40,000 individual colonies were obtained by culturing the petri dishes in a 30 ℃ incubator for 48 hours. To ensure mutant stability, all individual colonies generated in all petri dishes were recovered, suspended in a 20% glycerol solution, and then aliquoted into 1.5 mL microtubes (1 mL each) and stored in an ultra-low temperature freezer at -80 ℃.

[0147]

[0148] Example 1-2. Evaluation of fermentation activity of mutant strains and strain selection

[0149] When screening for high-productivity L-valine mutants, a 20% glycerol suspension taken out of the ultra-low temperature freezer and thawed at room temperature was diluted with saline for 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5After serial dilution, 100 μl of the diluted solution corresponding to each dilution factor was spread on the activation medium, and reactivated in the form of individual colonies through 24 h of culture in a 30 ℃ stationary incubator. The reactivated individual colonies were inoculated into a 96 Deep Well Plate, in which 350 μl of the production medium corresponding to a filling rate of 17% was dispensed per well, using a Colony Picker (Molecular Devices, Qpix420) facility. The KCCM11201P strain that was not irradiated with gamma rays was inoculated into four wells per plate to serve as a control for screening high-L-valine producing mutants. The 96 Deep Well Plates inoculated with the control strain and the mutants were sealed using a Gas permeable seal mark2 (Azenta) and cultured in a shaking incubator (Infors-HT, Multitron) at 30 °C and 1,000 rpm for 48 h. The 96 Deep Well Plate cultured for 48 hours was centrifuged for 20 minutes at 15°C and 4,000 rpm in a centrifuge (Eppendorf, Centrifuge 5810R). The culture supernatant with the separated cells was transferred to a 96-Well Black Polystyrene Microplate (Corning) using a liquid handler (Beckman Coulter, Biomek i5) for NIR Spectrometry analysis. Afterwards, it was applied to a self-made NIR Spectrometer to obtain an individual analysis spectrum for each well, and 21 strains with excellent L-valine concentrations were initially selected among 10,304 mutant strains. After that, the 21 strains selected (C1 to C21) were cultured in the same manner as above, and the concentration of L-valine was analyzed. The analyzed concentrations of L-valine are shown in Table 1 below.

[0150] [Nutrient medium (pH 7.2)]

[0151] 10g glucose, 5g meat extract, 10g polypeptone, 2.5g sodium chloride, 5g yeast extract, 20g agar, 2g urea (per 1 liter of distilled water)

[0152] [Production medium (pH 7.0)]

[0153] Glucose 100 g, ammonium sulfate 40 g, soy protein 2.5 g, corn steep solids 5 g, urea 3 g, potassium phosphate dibasic 1 g, magnesium sulfate heptahydrate 0.5 g, biotin 100 μg, thiamine-HCl 1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, calcium carbonate 30 g (based on 1 liter of distilled water)

[0154] Strain name L-valine (g / L) Control group KCCM11201P2.5 Experimental group C12.5 C22.9 C32.3 C42.6 C52.3 C61.9 C72.2 C83.0 C94.2 C103.1 C113.6 C123.2 C133.5 C142.8 C152.2 C163.3 C172.2 C182.5 C192.7 C202.4 C213.0

[0155] Referring to Table 1 above, the C9 strain with the greatest increase in valine production compared to the control strain KCCM11201P was selected.

[0156]

[0157] Example 2. Mutation confirmation through gene sequencing

[0158] The major genes of the above strains were sequenced and compared with those of the KCCM11201P strain and the Corynebacterium glutamicum ATCC14067 wild-type strain. As a result, it was confirmed that the strain with increased valine production contained a base sequence mutation at a specific location in the ilvB gene ORF (open reading frame) region. Specifically, it was confirmed that the C9 strain with the greatest increase in valine production had one mutation introduced into the base sequence located 449 bp upstream from the start codon of the ilvB gene, changing the existing CAC (SEQ ID NO: 2) to CGC (SEQ ID NO: 4), and the 150th amino acid histidine (SEQ ID NO: 1) was substituted with arginine (SEQ ID NO: 3).

[0159] As a result of analyzing the mutation region of sequence number 3, it was confirmed that it affects the effector binding domain of the valine biosynthetic enzyme, and it was expected that the activity of the corresponding protein would be enhanced. In the following examples, it was attempted to determine whether the application of the H150R mutation inserted into a specific position of the ORF in the ilvB gene affects the valine production ability of a Corynebacterium microorganism. In addition, it was attempted to determine whether the substitution of an amino acid other than arginine for the mutation at position 150 of the histidine amino acid affects the valine production ability of a Corynebacterium microorganism.

[0160]

[0161] Example 3. Production of KCCM11201P strain with ilvB mutation and confirmation of valine production ability.

[0162] Example 3-1. Production of a strain with an ilvB mutation introduced into Corynebacterium glutamicum KCCM11201P strain and evaluation of L-valine production ability.

[0163] In order to insert the ilvB (H150R) mutant represented by SEQ ID NO: 3 into Corynebacterium glutamicum KCCM11201P, a vector containing the target mutation was constructed. Specifically, the genomic DNA of the C9 strain was extracted according to the protocol provided in the G-spin Total DNA Extraction Mini Kit (Intron, Cat. No. 17045), and PCR was performed using the genomic DNA as a template. The PCR conditions were as follows: denaturation at 94°C for 5 minutes; 25 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 150 seconds; and polymerization was performed at 72°C for 7 minutes. An 808 bp PCR product (hereinafter referred to as “mutation introduction fragment 1”) was obtained using the primer pair of SEQ ID NO: 5 and SEQ ID NO: 6.

[0164] The above-obtained mutant fragment 1 was ligated to the pDC24 vector (SEQ ID NO: 21, Table 2) treated with the restriction enzyme SmaI (New England Biolabs, Beverly, MA) using an Infusion Cloning Kit (Takara Bio Inc., Otsu, Japan), and then transformed into Escherichia coli DH5α (INVITROGEN). After transforming the constructed gene into E. coli DH5α, it was selected on LB medium containing kanamycin, and DNA was obtained using a DNA-spin plasmid DNA purification kit (iNtRON), thereby preparing vector pDC24-ilvB (H150R) containing the above-obtained mutant fragment 1.

[0165]

[0166]

[0167]

[0168] Primer base sequence SEQ ID NO: 5AGCAACCGGCTACGCGCAGGTTACT SEQ ID NO: 6AACCTCAACCTGCTTGATCTTGCC

[0169] The above pDC24-ilvB(H150R) was transformed into Corynebacterium glutamicum KCCM11201P by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The strain in which the vector was inserted into the chromosome by recombination of the homologous sequence was selected on a medium containing 25 mg / l of kanamycin. After completing the second recombination, the strain in which histidine was substituted with arginine at amino acid position 150 of sequence number 1 in the ORF of the ilvB gene on the chromosome was confirmed through PCR using the primer pair of sequence numbers 5 and 6 for the above Corynebacterium glutamicum transformant. The above recombinant strain was named Corynebacterium glutamicum KCCM11201P::ilvB(H150R).

[0170] To compare the valine production capacity of Corynebacterium glutamicum KCCM11201P and KCCM11201P::ilvB(H150R), valine-producing strains, a flask assay was performed. Each strain was subcultured in nutrient medium, inoculated into a 250-ml corner-baffle flask containing 25 ml of production medium, and cultured at 30°C for 72 hours with shaking at 200 rpm. The concentration of L-valine was then analyzed using HPLC, and the analyzed L-valine concentrations are shown in Table 4 below.

[0171] [Nutrient medium (pH 7.2)]

[0172] Glucose 10 g, meat extract 5 g, polypeptone 10 g, sodium chloride 2.5 g, yeast extract 5 g, agar 20 g, urea 2 g (per 1 liter of distilled water)

[0173] [Production medium (pH 7.0)]

[0174] Glucose 100 g, ammonium sulfate 40 g, soy protein 2.5 g, corn steep solids 5 g, urea 3 g, potassium phosphate dibasic 1 g, magnesium sulfate heptahydrate 0.5 g, biotin 100 μg, thiamine-HCl 1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, calcium carbonate 30 g (based on 1 liter of distilled water)

[0175] KCCM11201P and KCCM11201P:: ilvB (H150R) L-valine producing strain L-valine (g / L) Batch 1 Batch 2 Batch 3 Average KCCM11201P 2.8 2.6 2.7 2.7 KCCM11201P::ilvB (H150R) 3.3 3.1 3.3 3.2

[0176] As a result, it was confirmed that the L-valine production ability of the KCCM11201P::ilvB(H150R) strain increased by 19% compared to the control group (KCCM11201P).

[0177]

[0178] Example 3-2: Production of a strain with an ilvN mutation introduced into Corynebacterium glutamicum CJ7V strain and evaluation of L-valine production ability.

[0179] In order to determine whether the effect of increasing L-valine production was also present in other strains of Corynebacterium glutamicum that produce L-valine, a strain with improved L-valine production was created by introducing a mutation [ilvN(A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467] into the wild strain Corynebacterium glutamicum ATCC14067.

[0180] Specifically, genomic DNA of Corynebacterium glutamicum wild type ATCC14067 strain was extracted using a G-spin Total DNA Extraction Mini Kit (Intron, Cat. No. 17045) according to the protocol provided in the kit. PCR was performed using the genomic DNA as a template. To construct a vector introducing the A42V mutation into the ilvN gene, gene fragments (A, B) were obtained using primer pairs of SEQ ID NOs: 7 and 8 and primer pairs of SEQ ID NOs: 9 and 10, respectively. PCR conditions were as follows: denaturation at 94°C for 5 minutes; 25 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 60 seconds; and polymerization at 72°C for 7 minutes.

[0181] As a result, polynucleotides of 528 bp and 509 bp, respectively, were obtained for fragments A and B. Overlapping PCR was performed using the two fragments as templates and the primer pair of sequence numbers 6 and 9, to obtain a 1010 bp PCR product (hereinafter referred to as "mutation-introduced fragment 2").

[0182] The above-obtained mutant fragment 2 was treated with the restriction enzyme SmaI (New England Biolabs, Beverly, MA), and then ligated with the pDC24 vector treated with the same restriction enzyme using T4 ligase (New England Biolabs, Beverly, MA). The constructed gene was transformed into E. coli DH5α, which was then selected on LB medium containing kanamycin, and DNA was obtained using a DNA-spin plasmid DNA purification kit (iNtRON). The vector for the purpose of introducing the A42V mutation of the ilvN gene was named pDC24-ilvN (A42V).

[0183] Primer base sequence SEQ ID NO: 7cggggatcccccgggAGGACGGTACTCAAATACTAAACTTCSEQ ID NO: 8TGCCGAGTGTTTCGGTCTTTACAGACACGAGGGACACGSEQ ID NO: 9TGTCTGTAAAGACCGAAACACTCGGCATCAASEQ ID NO: 10cggggatcccccgggGACAACTACATTATTATTATACCACA

[0184] Thereafter, the pDC24-ilvN(A42V) was transformed into the wild-type Corynebacterium glutamicum ATCC14067 by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The strain in which the vector was inserted into the chromosome by recombination of the homologous sequence was selected on a medium containing 25 mg / l of kanamycin. Afterwards, the gene fragment was amplified by PCR using the primer pair of SEQ ID NO: 6 and SEQ ID NO: 9 for the above Corynebacterium glutamicum transformant that completed the second recombination, and the mutant insertion strain was confirmed through gene sequence analysis. The recombinant strain was named Corynebacterium glutamicum CJ7V.

[0185] Finally, a strain was constructed by transforming the above-mentioned Corynebacterium glutamicum CJ7V with a vector in the same manner as in Example 3-1, and was named Corynebacterium glutamicum CJ7V::ilvB (H150R). In order to compare the L-valine production ability of the constructed strain, it was cultured in the same manner as in Example 3-1, and the concentration of L-valine was analyzed. The analyzed concentration of L-valine is shown in Table 6 below.

[0186] CJ7V, CJ7V:: ilvB (H150R) L-valine producing strain L-valine (g / L) Batch 1 Batch 2 Batch 3 Average CJ7V 2.4 2.2 2.1 2.2 CJ7V::ilvB (H150R) 2.9 2.8 2.8 2.6

[0187] As a result, it was confirmed that the L-valine production ability of the CJ7V::ilvB(H150R) strain increased by 18% compared to CJ7V.

[0188]

[0189] Example 3-3: Production of a strain with an ilvB mutation introduced into Corynebacterium glutamicum CJ8V strain and evaluation of L-valine production ability.

[0190] To determine whether the effect of increasing L-valine production was also observed in other strains of Corynebacterium glutamicum that produce L-valine, a strain with improved L-valine production was created by introducing a mutation [ilvN(A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467] into Corynebacterium glutamicum ATCC13869.

[0191] Specifically, in Example 3-2, the constructed vector pDC24-ilvN (A42V) was transformed into the wild-type Corynebacterium glutamicum ATCC13869 strain to induce homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The strain in which the vector was inserted into the chromosome by recombination of the homologous sequence was selected on a medium containing 25 mg / l kanamycin. The selected Corynebacterium glutamicum transformant was subjected to PCR using a primer pair of sequence numbers 11 and 12 to amplify a gene fragment, and gene sequence analysis confirmed that the mutation had been properly introduced. The recombinant strain was named Corynebacterium glutamicum CJ8V. The sequences of the primers used in this example are shown in Table 7 below.

[0192] Primer base sequence SEQ ID NO: 11CCGCGTCACCAAAGCGGA SEQ ID NO: 12TTAGATCTTGGCCGGAGCCA

[0193] Finally, a strain was constructed by transforming the above-mentioned Corynebacterium glutamicum CJ8V with a vector in the same manner as in Example 3-1, and was named Corynebacterium glutamicum CJ8V::ilvB (H150R). In order to compare the L-valine production ability of the constructed strain, it was cultured in the same manner as in Example 3-1, and the concentration of L-valine was analyzed. The analyzed concentration of L-valine is shown in Table 8 below.

[0194] CJ8V, CJ8V:: ilvB (H150R) L-valine producing strain L-valine (g / L) Batch 1 Batch 2 Batch 3 Average CJ8V 2.0 1.8 1.8 1.9 CJ8V::ilvB (H150R) 2.4 2.3 2.2 2.3

[0195] As a result, it was confirmed that the L-valine production ability of the CJ8V::ilvB(H150R) strain increased by 21% compared to CJ8V.

[0196]

[0197] Example 4. Creation of KCCM11201P strain with amino acid substitution mutations other than H150R and confirmation of valine production ability.

[0198] To confirm that the substitution mutation at the 150th amino acid of the ilvB protein of sequence number 1 is an important position for improving valine production, the following experiment was performed. In order to mutate the 150th amino acid of ilvB, histidine, to an amino acid other than arginine, Site-Directed Mutagenesis was performed using pDC24-ilvB (H150R) used in Example 3-1 as a template. Site-Directed mutagenesis was performed using the following method.

[0199] Site-Direction Mutagenesis PCR Composition Unit (μl)10X pfu-

[0200] Site-Direction Mutagenesis PCR cycleCycleTemperatureTime195 ℃1 min1895 ℃50 sec60 ℃50 sec68 ℃9 min168 ℃7 min

[0201] In order to substitute histidine, the 150th amino acid of ilvB, with an amino acid other than arginine, such as proline (P) (SEQ ID NO: 13) or asparagine (N) (SEQ ID NO: 14), a PCR mixture as shown in Table 9 was created using each mutagenic primer set shown in Table 11 below, and PCR was performed with the cycles shown in Table 10 above. After PCR was completed, the pDC24_ilvB mutant plasmid was transformed into E. coli DH5α using an Infusion Cloning Kit (Takara Bio Inc., Otsu, Japan), and it was confirmed through sequencing that it had been replaced with each mutation shown in Table 11 below.

[0202] Mutagenic primer set for constructing a plasmid with a 150th amino acid mutation in the ilvB amino acid sequence. Mutant ilvB plasmid sequence number (5'-3') pDC24_ilvB (H150P) 15TGACCAAGcctAACTTCATGGTCACCGA 16ATGAAGTTaggCTTGGTCACTGGCATGG pDC24_ilvB (H150N) 17TGACCAAGaatAACTTCATGGTCACCGA 18ATGAAGTTattCTTGGTCACTGGCATGG

[0203] As shown in Table 11 above, the pDC24_ilvB (H150P) and pDC24_ilvB (H150N) vectors were constructed and transformed into KCCM11201P by electroporation, and then 18 strains with the mutant ilvB gene inserted into the chromosome were obtained through a second crossover process. The genetic manipulation was confirmed through PCR using primers of SEQ ID NOs: 5 and 6, which can amplify the external regions of the upstream and downstream regions of the homologous recombination region where the gene was inserted, and genome sequencing.

[0204] The transformed strains thus obtained were named KCCM11201P::ilvB(H150P) and KCCM11201P::ilvB(H150N), respectively.

[0205] In order to confirm the valine production amount of the KCCM11201P::ilvB(H150R), KCCM11201P::ilvB(H150P), and KCCM11201P::ilvB(H150N) strains created in Example 3-1, the strains were cultured in the same manner as in Example 3-1 and the concentration of L-valine was analyzed. The concentration of L-valine analyzed is shown in Table 12 below.

[0206] L-valine production ability of strains with mutated amino acid 150 of ilvB amino acid sequence Strain name L-valine (g / L) Increase compared to control group Control group KCCM11201P 2.5 - Experimental group KCCM11201P::ilvB (H150R) 3.1 2 4.00% KCCM11201P::ilvB (H150P) 2.7 8.33% KCCM11201P::ilvB (H150N) 2.6 4.00%

[0207] As can be confirmed in Table 12 above, it was confirmed that the microorganism into which a genetic mutation was introduced in which the 150th amino acid of ilvB was substituted with another amino acid increased the production of valine compared to the control group (KCCM11201P).

[0208]

[0209] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering the technical concept or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present disclosure should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the claims described below, and their equivalent concepts, rather than the detailed description above.

Claims

1. A polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of sequence number 1 is replaced with another amino acid.

2. A polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of sequence number 1 in paragraph 1 is substituted with arginine, proline, asparagine, lysine, aspartic acid, glutamic acid, serine, threonine, glutamine, cysteine, glycine, alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, or tryptophan.

3. A polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of sequence number 1 in paragraph 1 is substituted with arginine, proline or asparagine.

4. A polypeptide according to claim 1, wherein the polypeptide has acetohydroxy acid synthase large subunit activity.

5. In the first paragraph, the polypeptide comprises an amino acid sequence having 90% or more homology with the amino acid sequence of SEQ ID NO: 1, and a polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is replaced with a different amino acid.

6. A polypeptide according to claim 1, wherein the polypeptide comprises an amino acid sequence of SEQ ID NO: 3, SEQ ID NO: 13, or SEQ ID NO:

14.

7. A polynucleotide encoding a polypeptide according to any one of claims 1 to 6.

8. A microorganism producing valine, comprising at least one selected from the group consisting of a polypeptide in which the amino acid corresponding to the 150th residue from the N-terminus in the amino acid sequence of sequence number 1 is replaced with another amino acid; a polynucleotide encoding the polypeptide; and a recombinant vector comprising the polynucleotide.

9. In paragraph 8, the microorganism is a microorganism with increased valine production ability.

10. In paragraph 8, the microorganism is a microorganism of the genus Corynebacterium.

11. In paragraph 10, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

12. A composition for producing valine, comprising a microorganism according to any one of claims 8 to 11.

13. A method for producing valine, comprising a step of culturing a microorganism according to any one of claims 8 to 11 in a medium.

14. A method for producing valine, comprising, in claim 13, additionally, after the culturing step, a step of recovering valine from the cultured microorganism, the medium, or both.

15. A method for increasing valine production, comprising the step of culturing a microorganism according to any one of claims 8 to 11 in a medium.

Images