Digital polymerase chain reaction-based method for providing information for diagnosing microsatellite instability, and kit therefor

Digital PCR with probes containing reporters and quenchers addresses the limitations of conventional MSI diagnostic methods by enhancing sensitivity and enabling quantitative analysis, providing accurate detection of gene deletions for MSI diagnosis.

WO2025127642A1PCT designated stage expired Publication Date: 2025-06-19SEASUNBIO MATERIALS
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/020074
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-14
Filing Date
2024-12-09
Publication Date
2025-06-19

AI Technical Summary

Technical Problem

Conventional molecular diagnostic methods for microsatellite instability (MSI) lack quantitative analysis, have low sensitivity for short or low-ratio deleted genes, and can misinterpret substitution mutations as deletion mutations.

Method used

The method employs digital polymerase chain reaction (digital PCR) using probes with reporters and quenchers to distinguish complete or incomplete hybridization with microsatellite base repeat regions, leveraging external and internal hydrolysis of polymerase to accurately detect gene deletions.

Benefits of technology

This approach significantly improves the sensitivity for detecting gene deletion mutations and enables quantitative analysis, reducing the risk of misinterpretation and providing accurate information for MSI diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024020074_19062025_PF_FP_ABST
    Figure KR2024020074_19062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a digital polymerase chain reaction-based method for providing information for diagnosing microsatellite instability, and a kit therefor. In the method for providing information for diagnosing microsatellite instability, according to the present invention, a fluorescent signal is produced through the separation of a quencher and a reporter due to external hydrolysis by a polymerase when a probe is fully bound, and, if 5-terminal binding of the probe does not occur due to a deletion mutation, the region between the non-bound site of the 5-terminus and the bound site undergoes internal hydrolysis such that the quencher and reporter are removed together, thereby preventing fluorescence from occurring, and thus whether deletion mutations are present can be analyzed with high sensitivity, and quantitative analysis can be performed by comparing the number of reporter and quencher groups produced in regions without microsatellite instability.
Need to check novelty before this filing date? Find Prior Art

Description

Method for providing information for diagnosing microsatellite instability based on digital polymerase chain reaction and kit therefor

[0001] The present invention relates to a method for providing information for diagnosing microsatellite instability based on digital polymerase chain reaction and a kit therefor.

[0002] Microsatellites are short DNA sequences of six or fewer that are sequentially repeated throughout the human genome, and are scattered with different repetition numbers on each chromosome.

[0003] Microsatellite instability (MSI) refers to the variation in the length of short, repetitive nucleotide sequences that make up microsatellites, resulting in increases or decreases. Microsatellite instability was first identified in patients with hereditary nonpolyposis colorectal cancer syndrome, resulting from mutations in DNA mismatch repair genes or replication abnormalities caused by promoter methylation. It has also been found to exist in other cancers, including sporadic colorectal cancer and sporadic endometrial cancer.

[0004] To date, several molecular diagnostic methods have been developed for the diagnosis of microsatellite instability. The first is a fragment analysis method using multiplex fluorescent PCR amplification and capillary electrophoresis, which determines whether a gene is deleted by measuring the length of the analyzed product after performing capillary electrophoresis after gene amplification. The second is a deletion gene-preferential amplification method, which adds a probe such as PNA that binds to a normal gene and prevents gene amplification to the PCR amplification reaction reagent, thereby suppressing the normal gene and inducing amplification of the deleted gene, and then determining the presence of a deletion mutation by measuring the generation of amplification products.

[0005] Deletion of specific regions of genes like this is known to be an important biomarker for diagnosing and predicting the prognosis of cancer, and the importance of accurate analysis is increasing. However, the molecular diagnostic methods that have been performed so far cannot perform quantitative analysis, and when the deleted gene is short or exists at a low ratio, it shows low sensitivity, and when a substitution mutation, not a deletion, occurs in a region that prevents amplification of the normal gene, it can be misinterpreted as a deletion mutation.

[0006] As a result of efforts to solve the above problems, the present inventors have completed the present invention by confirming that the shortcomings of the above-described molecular diagnostic method can be solved and gene deletion mutations can be determined with significantly improved sensitivity by utilizing external and internal hydrolysis of polymerase.

[0007] The present invention aims to provide a method for accurately diagnosing microsatellite instability by utilizing external and internal hydrolysis of polymerase to accurately determine deletion of a specific region of a gene, and a diagnostic kit using the method.

[0008] One aspect of the present invention relates to a method for providing information for diagnosing microsatellite instability (MSI) using digital polymerase chain reaction (digital PCR), the method comprising the step of analyzing the number of nucleic acids measured in one or more groups selected from the group consisting of: a first group including a reporter and a quencher that distinguish between complete hybridization or incomplete hybridization with a microsatellite base repeat region of a target nucleic acid; and a second group including a reporter and a quencher that completely hybridize with a region of the target nucleic acid where microsatellite instability does not exist and fluoresces.

[0009] In one specific embodiment of the present invention, the complete hybridization or insecure hybridization may be distinguished by the action of an endonuclease or an exonuclease.

[0010] In one specific example of the present invention, the probe including the first group may be composed of a terminal portion consisting of a microsatellite base repeat sequence and a terminal portion including 5 to 24 sequences outside the microsatellite base repeat sequence, and may include the reporter and the quencher in the terminal portion consisting of the microsatellite base repeat sequence.

[0011] In one specific example of the present invention, the probe comprising the second group may complementarily bind to a sequence other than a microsatellite repeat sequence, and may include a reporter and a quencher at the end or inside.

[0012] In one specific embodiment of the present invention, the reporter and the quencher may be spaced apart by 2 to 5 bp.

[0013] In one specific example of the present invention, the reporter and quencher of the first group and the reporter and quencher of the second group may be present in one probe.

[0014] In one specific embodiment of the present invention, the reporter and quencher of the first group and the reporter and quencher of the second group may be present in one amplicon.

[0015] In one specific embodiment of the present invention, the reporter and quencher of the first group and the reporter and quencher of the second group may be present in two independent amplification products.

[0016] In one specific example of the present invention, the reporter may be selected from the group consisting of Cy5 (Cyaninine5), FAM (6-carboxyfluorescein), Texas red, and HEX (2', 4', 5', 7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein).

[0017] In one specific example of the present invention, the quencher may be selected from the group consisting of BHQ1, BHQ2, Dabcyl, and TAMRA (6-carboxytetramethyl-rhodamine).

[0018] In one specific example of the present invention, the probe may be selected from the group consisting of sequence numbers 1 to 7, 11 to 13, and 24 to 33.

[0019] Another aspect of the present invention relates to a kit for detecting base deletions of a target nucleic acid from a method for providing information for diagnosing microsatellite instability (MSI), the kit comprising: a probe comprising one or more reporters and quenchers; and forward primers and reverse primers for the probe.

[0020] In one specific example of the present invention, the probe may be selected from the group consisting of sequence numbers 1 to 7, 11 to 13, and 24 to 33.

[0021] In one specific example of the present invention, the forward primer may be selected from the group consisting of SEQ ID NOs: 14 to 18, and the reverse primer may be selected from the group consisting of SEQ ID NOs: 10 and 19 to 23.

[0022] The information providing method for diagnosing microsatellite instability according to the present invention exhibits a fluorescent signal through separation of a quencher and a reporter by external hydrolysis of a polymerase when the probe is fully bound, and when the 5-terminal binding of the probe is not formed due to a deletion mutation, the quencher and reporter are removed together due to internal hydrolysis between the portion where the 5-terminal binding is not formed and the portion bound, thereby not exhibiting fluorescence, so that the presence of a deletion mutation can be analyzed with high sensitivity, and quantitative analysis can be performed by comparing the number of reporter and quencher groups produced in an area where microsatellite instability does not exist.

[0023] Figure 1 is a schematic diagram of a method for diagnosing microsatellite instability (MSI) by detecting deletions according to the present invention.

[0024] In the oligomer of the above schematic diagram, an example of a detection probe (11) for detecting whether a deletion has occurred at a suspected deletion point (12), a reference probe (14) for preventing false positive or negative results, and a primer set (13) is shown.

[0025] Figure 2 is a schematic diagram of the detection principle of a detection probe according to the length of the deletion. a) When there is no deletion (0 bp deletion), the entire probe binds specifically, and fluorescence is detected by the external hydrolysis (exonuclease) function of the polymerase. b) When the number of deleted bases is less than the number of bases between the reporter and the quencher, the reporter and the quencher are cleaved and separated by the external hydrolysis (exonuclease) function of the polymerase, and fluorescence is detected. c) When the number of deleted bases is more than the number of bases between the reporter and the quencher, when the reporter and the quencher form a flap, the reporter and the quencher are cleaved together by the internal hydrolysis (endonuclease) function of the polymerase, and no fluorescence is detected.

[0026] Figure 3 shows the results of real-time polymerase chain reaction (real-time PCR) performed to confirm the possibility of detecting deletions of synthetic oligomers. a) For a perfectly matched (PM) target sequence, b) an external hydrolysis reaction amplification curve using organic dye F1 and c) a PCR amplification curve using EvaGreen, a reference intercalating dye, and d) For a 3 bp deleted target sequence, e) an external hydrolysis reaction amplification curve using organic dye F1 and f) a PCR amplification curve using EvaGreen, a reference intercalating dye.

[0027] Figure 4 shows the results of performing digital polymerase chain reaction (digital PCR) and confirming the change in detection resolution according to the number of deletions in the synthetic oligomer using the design probe NR24_Taq_09. a) uses Cy5 as a detection probe, and b) uses EvaGreen as a reference fluorescence, and the measurement results for perfect match, 2 bp deletion, 3 bp deletion, 4 bp deletion, and 5 bp deletion are shown from the left, respectively.

[0028] Figure 5 shows the results of comparing the detection resolution of deletions (0 to 5 bp) of synthesized oligomers according to probe design by performing digital polymerase chain reaction.

[0029] Figure 6 is a schematic diagram of a probe comprising multiple fluorescence-quencher groups for simultaneously detecting the amount of an amplification product and whether or not it is deleted using a single probe. In the oligomer of the schematic diagram, an example of a probe and primer set (63) structure is shown, which includes a detection probe (61) for detecting whether or not a deletion has occurred at a suspected deletion site (62) and a reference probe that binds gene-specifically to a non-deletion site to confirm the amplification product.

[0030] Figure 7 is a schematic diagram of the detection principle according to the deletion length of a probe containing multiple fluorescence-quencher groups.

[0031] Figure 8 shows the results of confirming MSI for cell lines ((1) HeLa MSS, (2) SNU638 MSI) and clinical samples ((3) MSS normal, (4) MSS tumor, (5) MSI normal, and (6) MSI tumor) using a probe containing multiple fluorescence-quencher groups.

[0032] Figure 9 shows the results of analyzing the correlation by confirming the change in normal and deletion detection ratios for HeLa MSS, 1% deletion MSI, 5% deletion MSI, 10% deletion MSI, 50% deletion MSI, SNU638 MSI, and negative control groups using a detection probe (Cy5) and reference probe (FAM) to which the present invention is applied.

[0033] Figure 10 shows the results of confirming whether MSI was present in cell lines (HeLa MSS, SNU638 MSI) by constructing a detection probe (Cy5) and reference probe (FAM, HEX, TAMRA) applying the present invention to five types of MSI markers (BAT25, BAT26, NR21, NR24, NR27).

[0034] Figure 11 shows the results of confirming the presence or absence of MSI in clinical samples (normal tissue, cancer tissue) of 8 patients with endometrial cancer using a probe to which the present invention is applied. The X-axis represents the reference probe positive concentration, the Y-axis represents the MSS positive concentration, and multiple markers are represented as a group in a distribution diagram (cancer tissue = empty circle, normal tissue = black circle).

[0035] The method for providing information for diagnosing microsatellite instability based on digital polymerase chain reaction of the present invention and the kit therefor are described in detail with reference to the attached table or drawings.

[0036] If drawings are included, they are provided as examples to ensure that the spirit of the present invention is fully conveyed to those skilled in the art. Therefore, the present invention is not limited to the drawings presented and may be embodied in other forms, and the drawings may be exaggerated to clarify the spirit of the present invention.

[0037] While terms such as "first" and "second" may be used to describe various components, these components should not be limited by these terms. These terms are used solely to distinguish one component from another. For example, without departing from the scope of the present invention, a first component could be referred to as a second component, and similarly, a second component could also be referred to as a first component.

[0038] In this case, if there is no other definition for the technical and scientific terms used, they have the meaning commonly understood by a person of ordinary skill in the technical field to which this invention belongs, and the description of well-known functions and configurations that may unnecessarily obscure the gist of the present invention are omitted in the following description and attached drawings. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning they have in the context of the relevant technology, and shall not be interpreted in an ideal or excessively formal meaning unless explicitly defined in this application.

[0039] Additionally, the singular forms used in the specification of the present invention may be intended to include the plural forms as well, unless the context specifically indicates otherwise.

[0040] In addition, units used in the specification of the present invention without special mention are based on weight, and for example, units of % or ratio mean weight% or weight ratio.

[0041] Furthermore, in the specification of the present invention, the expression “comprises” is an open description equivalent to expressions such as “includes,” “contains,” “has,” or “is characterized by,” and does not exclude additional unrecited elements, materials, or processes. Furthermore, the expression “consists substantially of…” means that other unrecited elements, materials, or processes may be present together with the specified elements, materials, or processes in an amount that does not significantly affect at least one basic and novel technical idea of ​​the invention to an unacceptable degree. Furthermore, the expression “consists of” means that only the recited elements, materials, or processes are present.

[0042] As used herein, “and / or” refers to and includes any and all possible combinations of one or more of the associated listed items, as well as, when interpreted in the alternative (“or”), the lack of a combination.

[0043] "Substantially" or "essentially" means almost entirely or completely, for example, greater than 95% of some given amount. In some embodiments, "substantially" or "essentially" means 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9%.

[0044] The terms “acceptable,” “effective,” or “sufficient” when used to describe the selection of any ingredient, range, dosage form, etc. disclosed herein mean that the ingredient, range, dosage form, etc. is suitable for the purpose disclosed.

[0045] In some embodiments, the terms "first," "second," "third," "fourth," or similar terms in the component names are used to distinguish and identify more than one component that shares a particular identity. For example, "first RNA" and "second RNA" are used to distinguish two RNAs.

[0046] Also, in the present specification, the terms "polynucleotide," "nucleic acid," and "oligonucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs thereof. A polynucleotide may have any three-dimensional structure and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: genes or gene fragments (e.g., probes, primers, ESTs, or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may include modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polynucleotide. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may be further modified after polymerization, for example, by conjugation with a labeling component. This term also refers to both double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of the present disclosure that is a polynucleotide includes both a double-stranded form and each of the two complementary single-stranded forms known or predicted to constitute a double-stranded form.

[0047] As used herein, the term "RNA" refers to its generally accepted meaning in the art. Generally, the term RNA refers to a polynucleotide comprising at least one ribofuranoside moiety. The term can include double-stranded RNA, single-stranded RNA, isolated RNA, such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as RNA with additions, deletions, substitutions, and / or alterations of one or more nucleotides. Such alterations can include, for example, the addition of non-nucleotide material to one or more nucleotides of the RNA. The nucleotides in a nucleic acid molecule can also include non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. Such altered RNA can be referred to as an analog or an analog of naturally occurring RNA. In some embodiments, the RNA can be, but is not limited to, messenger RNA (mRNA) or siRNA.

[0048] As used herein, the term "messenger RNA" (mRNA) refers to any polynucleotide that encodes (at least one) polypeptide (a naturally occurring, non-naturally occurring, or modified polymer of amino acids) and is capable of producing the encoded polypeptide in vitro, in vivo, or in situ or ex vivo. In some embodiments, an mRNA as disclosed herein comprises, consists essentially of, or additionally consists of at least one coding region, a 5' untranslated region (UTR), a 3' UTR, a 5' cap, and a poly-A tail.

[0049] The present invention will be described in detail below.

[0050] One aspect of the present invention relates to a method for providing information for diagnosing microsatellite instability (MSI) using digital polymerase chain reaction (digital PCR), the method comprising the step of analyzing the number of nucleic acids measured in one or more groups selected from the group consisting of: a first group including a reporter and a quencher that distinguish between complete hybridization or incomplete hybridization with a microsatellite base repeat region of a target nucleic acid; and a second group including a reporter and a quencher that completely hybridize with a region of the target nucleic acid where microsatellite instability does not exist and fluoresces.

[0051] MSI is generally divided into two types according to international standards. The National Cancer Institute (NCI) in the United States proposed five microsatellite markers (BAT-25, BAT-26, D2S123, D17S250, D5S346) consisting of two mononucleotides and three dinucleotides in 1997. If instability is shown in two or more markers, it is called high-level MSI (MSI-H). If microsatellite instability is shown in more than 40% of the measured microsatellite markers, it is also called replication error positive (RER+). If instability is shown in only one marker, it is called low-level MSI (MSI-L). If microsatellite instability is shown in less than 40% of the measured microsatellite markers, it is called low-level MSI (MSI-L). The absence of microsatellite instability was defined as microsatellite stable (MSS) (Boland et al., Cancer Res., 58:5248-57, 1998; Kim Deok-woo, Journal of Genetic Medicine 7:24-36, 2010).

[0052] The 'base mutation' of the present invention refers to a mutation in the base sequence of a target nucleic acid or a nucleic acid to be analyzed, and may include not only a single nucleotide polymorphism (SNP) but also a mutation caused by substitution, deletion or insertion of a base. For example, the probe of the present invention can analyze a mutation caused by deletion of 2 or more, preferably 3 or more, more preferably 5 or more, specifically, 2 to 27, preferably 3 to 27, and even more preferably 5 to 27 bases of a target nucleic acid or a nucleic acid to be analyzed through a digital polymerase chain reaction measurement result, but is not limited thereto.

[0053] The difference in fluorescence due to complete or insecure hybridization can be distinguished by the action of endonuclease or exonuclease.

[0054] The term "hybridization" in the present invention refers to the reaction between complementary single-stranded nucleic acids to form a double-stranded nucleic acid. Hybridization can occur when the complementarity between the two nucleic acid strands is complete (a perfect match), or it can occur even when some mismatched bases exist. The degree of complementarity required for hybridization may vary depending on the hybridization conditions, including, but not limited to, temperature.

[0055] The probe including the first group may be composed of a terminal portion consisting of a microsatellite base repeat sequence and a terminal portion including 5 to 20 sequences outside the microsatellite base repeat sequence, and may include the reporter and the quencher in the terminal portion consisting of the microsatellite base repeat sequence.

[0056] The probe comprising the second group may complementarily bind to a sequence other than the microsatellite repeat sequence and may include a reporter and a quencher at the end or inside.

[0057] The 'target nucleic acid' of the present invention refers to a nucleic acid sequence (including SNP) of a genotype to be detected / discerned, and includes a specific portion of the nucleic acid sequence of a 'target gene' that encodes a protein having a physiological or biochemical function, and is annealed or hybridized with a primer or probe under hybridization, annealing, or amplification conditions. The 'target nucleic acid' is not different from the terms 'target nucleic acid', 'synthetic DNA', or 'artificial synthetic oligo' used herein, and are used interchangeably herein.

[0058] In the present invention, the target nucleic acid is DNA or RNA, and the molecule may be double-stranded or single-stranded. If the starting material is double-stranded, it is preferable to convert the two strands into a single strand or a partially single-stranded form. Known methods for separating the strands include, but are not limited to, heat, alkali, formamide, urea, and glycoxal treatment, enzymatic methods (e.g., helicase action), and binding proteins. For example, strand separation can be achieved by heat treatment at a temperature of 80 to 105°C. A general method for the above-described treatment is disclosed in Joseph Sambrook et al., Molecular Cloning, 2001.

[0059] The first reporter and the first quencher may be spaced apart by 2 to 5 bp.

[0060] In one specific embodiment of the present invention, the reporter may be connected to the 5'-end or 3'-end of the probe, and the quencher may be located within the probe sequence and separated from the reporter.

[0061] In one specific example of the present invention, the reporter and quencher of the first group and the reporter and quencher of the second group may be present in one probe.

[0062] In one specific embodiment of the present invention, the reporter and quencher of the first group and the reporter and quencher of the second group may be present in one amplicon.

[0063] In one specific embodiment of the present invention, the reporter and quencher of the first group and the reporter and quencher of the second group may be present in two independent amplification products.

[0064] The above reporter may be selected from the group consisting of Cy5 (Cyaninine5), FAM (6-carboxyfluorescein), Texas red, and HEX (2', 4', 5', 7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein).

[0065] The above quencher may be selected from the group consisting of BHQ1, BHQ2, Dabcyl and TAMRA (6-carboxytetramethyl-rhodamine).

[0066] The above probe may be selected from the group consisting of sequence numbers 1 to 7, 11 to 13, and 24 to 33.

[0067] In the information providing method for diagnosing microsatellite instability (MSI) according to the present invention, the method for determining microsatellite instability (MSI) and microsatellite stability (MSS) is not particularly limited, but the replication ratio of the following formula 1 is calculated using a target nucleic acid sample obtained from a patient, etc.,

[0068] [Formula 1]

[0069] Copy Ratio = Concentration (MSS probe) / Concentration (reference probe)

[0070] After calculating the difference in the replication ratio for different samples using Equation 2 below,

[0071] [Formula 2]

[0072] Δ(replication ratio) = replication ratio (sample 1) - replication ratio (sample 2)

[0073] For example, the sample 1 may be normal tissue, and the sample 2 may be cancer or tumor tissue, but is not limited thereto.

[0074] If the difference in duplication rate is, for example, 5% or more, preferably 7% or more, even more preferably 10% or more, and more specifically, 5 to 50%, preferably 7 to 40%, and even more specifically, 10 to 30%, it is determined to be a deletion marker, and if there are, for example, 2 or more, preferably 3 or more, and even more specifically, 2 to 20, preferably 3 to 15, and even more specifically, 4 to 10 such deletion markers, it is determined to be microsatellite instability (MSI), and information can be provided to doctors and other relevant persons.

[0075] Another aspect of the present invention relates to a kit for detecting base deletions in target nucleic acids isolated from a specimen sample, comprising a probe comprising one or more reporters and quenchers; and forward and reverse primers for the probe, and from the method for providing information on diagnosing microsatellite instability (MSI) according to one embodiment of the present invention.

[0076] In the present invention, the specimen sample may be derived from a specific tissue or organ of an animal, including a human. Representative examples of the tissue include connective, skin, muscle, or nerve tissue. Representative examples of the organ may include, but are not limited to, the eye, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testis, ovary, uterus, rectum, nervous system, gland, and internal blood vessels.

[0077] The above specimen sample includes any cell, tissue, fluid, or other medium derived from a biological source that can be well analyzed by the present invention, including samples obtained from humans, animals, or food prepared for human or animal consumption. The sample to be analyzed also includes a body fluid sample, including but not limited to sputum, blood, serum, plasma, lymph, breast milk, urine, feces, ocular fluid, saliva, semen, brain extracts (e.g., brain pulverize), spinal fluid, appendix, spleen, and tonsil tissue extracts.

[0078] The above probe may be selected from the group consisting of sequence numbers 1 to 7, 11 to 13, and 24 to 33.

[0079] The forward primer may be selected from the group consisting of SEQ ID NOs: 14 to 18, and the reverse primer may be selected from the group consisting of SEQ ID NOs: 10 and 19 to 23.

[0080] The kit of the present invention may optionally include reagents necessary for performing a target amplification PCR reaction (e.g., a PCR reaction), such as a buffer, a DNA polymerase cofactor, and deoxyribonucleotide-5-triphosphate. Furthermore, the kit may include various polynucleotide molecules, reverse transcriptase, buffers and reagents, and antibodies that inhibit DNA polymerase activity. Furthermore, the optimal amounts of reagents used in a particular reaction can be readily determined by one skilled in the art having learned the disclosure herein. Typically, the kit may be manufactured as a separate package or compartment containing the aforementioned components.

[0081] Hereinafter, the present invention will be described in more detail through examples. These examples are intended only to illustrate the present invention in more detail and are not intended to limit the scope of the present invention.

[0082] [Reagents, Materials, and Experimental Protocols]

[0083] Unless there are special limitations on the reagents used in the present invention, they were purchased from Sigma-Aldrich (MO, USA) and used, and oligomers, primers, probes, etc. were either commissioned to domestic or foreign oligomer synthesis institutions or synthesized directly by the applicant.

[0084] [Example 1] Probe design

[0085] For the high-sensitivity diagnosis of microsatellite instability (MSI), a probe containing both a reporter and a quencher and containing locked nucleic acid (LNA) was designed.

[0086] In the design of the probe as shown in Table 1 below, in order to check whether the performance is improved compared to the existing probe, sequence number 7 was designed, and it was designed to have a specific sequence (a sequence that does not cause microsatellite instability) only at the 3'-end of the microsatellite repeat sequence so that the 5'-end of the probe that binds according to the sequence deletion forms a flap (i.e. sequence numbers 1, 3, 4, 5, and 6). In addition, considering the low binding affinity of repeated adenine (a), it was designed to include a gene-specific region (i.e. 'cac' of sequence number 1) and LNA (sequence numbers 3 and 4). Sequence numbers 9 and 10 correspond to forward and reverse primers.

[0087] Sequence number Name Sequence (5' --> 3') Note 1NR24_Taq_05[Cy5]AAAAA[Q]AAAAAAAAAAAAAAAAAATAGGACTGGGCCCAGGGA[P] Probe (Group 1) 2NR24_Taq_07[Cy5]CACAAAAA[Q]AAAAAAAAAAAAAAAAAATAGGACTGGGCCCAGGGA[P] Probe (Group 1) 3NR24_Taq_09[Cy5]AA[LNA A]AA[Q]AAAAAAAAAAAAAAAAAATAGGACTGGGCCCAGGGA[P] Probe (Group 1) 4NR24_Taq_09_5[Cy5]AA[LNA A][LNA A][LNA A][Q]AAAAAAAAAAAAAAAAAAATAGGACTGGGCCCAGGGA[P]Probe (Group 1)524_Taq_L2[Cy5]AA[LNA A]A[LNA A][Q]AAAAAAAAAAAAAAAAATAGGACTGGGCCCAGGGA[P]Probe (Group 1)624_Taq_L3[Cy5]AA[LNA A]A[LNA A][Q]A[LNA A]AAAAAAAAAAAAAAATAGGACTGGGCCCAGGGA[P]Probe (Group 1)724_Taq_RoGSP[Cy5]CAC[LNA A]AAAA[LNA A]AAAAA[LNA A]AAAAA[LNA A]AAAAA[LNA A]AAAAAT[LNA A]G[Q]Probe (Group 1)824_RefRaq_01[FAM]AGACAGAGTCTCACTCTGTCACCC[BHQ1]Probe (Group 2)9NR24_F01ATATTTAAGGTCTGCCTTAACGTGForward10QNR24_R09TGAGCGGAGATTGTGCCATTGReverse

[0088] 1.1 Confirmation of the Detectability of Deletions in Synthesized Oligomers. Real-time polymerase chain reaction was applied to confirm the detectability of deletions in synthesized oligomers. The results are shown in Figure 3.

[0089] From this, the same amplification amount of the gene was confirmed with reference fluorescence (EvaGreen) (circle indication), and it was confirmed that different fluorescence intensities and Ct were shown depending on the number of deletions (0 bp deletion and 3 bp deletion) confirmed with the deletion detection probe.

[0090] 1.2 Digital PCR performance results according to the length of the fruit

[0091] To confirm the possibility of detecting deletions of the synthesized oligomers, the probe NR24_Taq_09 of Table 1 was applied to the samples of Table 2 below by digital polymerase chain reaction, and the ratio of concentrations (ng / μL) measured by the detection probe (Cy5) and reference fluorescence (EvaGreen) was measured. The results are shown in Table 2 and Fig. 4.

[0092] SampledPCR ResultsTemplate StructureConcentration (ng / μL)Ratio (%) (Cy5 / EvaGreen)Cy5 (+)EvaGreen (+)PMPerfect Match412.700446.40092.45Del 22 bp deletion13.70071.07019.28Del 33 bp deletion2.790242.5001.15Del 44 bp deletion0.957345.5000.28Del 55 bp deletion0.335447.6000.07

[0093] From Figure 4, in digital PCR, it was confirmed that as the number of deleted bases increases, the ratio of detection probes being confirmed as positive compared to the number of reference fluorescence positivity decreases in a method of determining positive (On, positive, +) and negative (off, negative, -) based on the Poisson distribution by binary analysis based on the measured fluorescence intensity.

[0094] 1.3 Comparison of deletion detection resolution of synthesized oligomers according to probe design

[0095] The deletion detection resolution was compared using digital polymerase chain reaction using the probes identified in 1.1 and 1.2 above and the additionally designed probes. The results are shown in Figure 5.

[0096] As a result, compared to 24_Taq_RoGSP, which has a 3-bp unique sequence at both ends of the microsatellite repeat sequence, it was confirmed that the detection resolution according to the number of deletions of probes (24_Taq_L2, NR24_Taq_09_5, 24_Taq_L3) that have a unique sequence (a sequence that does not cause microsatellite instability) only at one end (3') of the microsatellite repeat sequence and contain LNA at the other end was high. Through this, it was confirmed that the detection resolution based on the number of base deletions was improved compared to the existing probe, and that the signal to noise ratio (SNR) was improved (see Fig. 5).

[0097] 1.4 Design of multiple fluorescence-quencher group probes

[0098] To simultaneously detect the amount and deletion of the amplification product using a single probe, a probe containing multiple fluorescence-quencher groups was designed as shown in Table 3 below according to the schematic diagram in Fig. 6.

[0099] SEQ ID NO: Probe sequence (5' --> 3') 11NR24_Taq_09_2[Cy5]aa[LNA a]aa[Q]aaaaaaaaaaaaaaaaaaataggact[i-EBQ]gggcccaggga[FAM-dT][P]12NR24_Taq_09_3[Cy5]aa[LNA a]aa[Q]aaaaaaaaaaaaaaaaaaataggactgggcccaggga[FAM-dT][P]13NR24_Taq_09_4[Cy5]aa[LNA a]aa[Q]aaaaaaaaaa[LNA a]aaaaaaaataggact[Q]gggcccaggga[FAM-dT][P]

[0100] The detection principle of the detection probe according to the length of the deletion is schematically illustrated in Fig. 7. In Fig. 7, a) when there is no deletion (or 0 bp deletion), the entire probe is specifically bound, and both detection (F1) and reference (F2) fluorescence are detected by the external hydrolysis action of the hydrolase, b) when the number of deleted bp is greater than the bp between the reporter and the quencher, when the reporter and the quencher form a flap, the reporter and the quencher are cleaved together and separated by the internal hydrolysis (endonuclease) action of the polymerase, and the detection (F1) fluorescence is not detected, and the reference (F2) fluorescence is detected by the external hydrolysis (exonuclease) function, and c) when the number of deleted bp is less than the bp between the reporter and the quencher, the reporter and the quencher are cleaved and separated by the external hydrolysis (exonuclease) action of the polymerase, and both detection (F1) and reference (F2) fluorescence are detected. Results can be obtained (see Fig. 8).

[0101] [Example 2]

[0102] 2.1 Measurement of changes in MSS detection rate according to MSI ratio

[0103] To measure the detectability according to the change in the content ratio of MSI molecules, the MSI contents were designed to be 0, 1, 5, 10, 50, and 100%, respectively, as in the sample information in [Table 4] below, and then the number of reaction groups with positive detection probe fluorescence and reference probe fluorescence was measured through digital PCR. The results are shown in Table 4 and Fig. 9.

[0104] Analysis results of sample information Sample name Normal gene ratio (%) Deletion gene ratio (%) Cy5 fluorescence positive reaction group number Reference fluorescence positive reaction group Correction gene ratio (%) Deletion gene ratio (%) 1 MSI (0%) 10001,4221,43599.090.912 MSI (1%) 9911,3191,35897.132.873 MSI (5%) 9551,3141,40693.466.544 MSI (10%) 90101,3081,48488.1411.865 MSI (50%) 50507521,60146.9753.036 MSI (100%) 0100851,5945.3394.67

[0105] From this, it was confirmed that as the MSI ratio increases, the number of positive reaction zones of the detection probe (Cy5 fluorescence) increases, and the correlation (R) of the ratio detected through the method of the present invention 2 ) was confirmed to be 0.99 or higher (see Fig. 9).

[0106] [Example 3]

[0107] 3.1 Confirmation of MSI using MSS cell lines and MSI cell lines

[0108] Based on the probe design confirmed in Example 1, probes for five types of microsatellite markers were designed, and instead of EvaGreen, which was used as a reference fluorescence, gene-specific TaqMan probes targeting sites where microsatellite instability does not occur based on fluorescence other than Cy5 (HEX, TAMRA, and FAM) were used, and MSI detection according to primer design was analyzed as shown in Table 5 below. The results are shown in Fig. 10.

[0109] Sequence number Name Sequence (5'--> 3') Note 14NR24_F01ATATTTAAGGTCTGCCTTAACGTG Forward 15NR27_FCCAACGTCTGTGAGATCC Forward 16BAT25_FCGCCTCCAAGAATGTAAG Forward 17BAT26_A_FTTCAGCCAGTATATGAAATTG Forward 18NR21_FAGACACATCCCTTTCAGC Forward 19QNR24_RATTGTGCCATTGCATTCCAA Reverse 20NR27_RGGTTCTGAGTCGATAATACTAGC Reverse 21NQBAT25_RGTTACCACACTTCAAAATGACA Reverse 22BAT26_A_R2GCTTCTTCAGTATATGTCAATG Reverse 23NR21_RCTGGTCACTCGCGTTTAC Reverse 2424_Taq_09[Cy5]AA[LNA A]AA[I-EBQ]AAAAAAAAAAAAAAAAAAATAGGACTGGGCCCAGGGA[P]Probe (Group 1) 2527_Taq_01[Cy5]AA[LNA A]AA[I-EBQ]AAAAAAAAAAAAAAAAAAAAAGCCACAGTGACTTGCTT[P]Probe (Group 1) 2625_A_Taq01[Cy5]AA[LNA A]AA[I-EBQ]AAAAAAAAAAAAAAAAAAAAATCAAA[LNA A]AAACAA[LNA A]ACACAA[LNA A]ACTC[P]Probe (Group 1) 2726_A_Taq01[Cy5]AA[LNA A]AA[I-EBQ]AAAAAAAAAAAAAAAAAAAAAGGGTTAA[LNA A]AATGTTGAATGGTT[P]Probe (Group 1) 2821_Taq01[Cy5]AA[LNA A]AA[I-EBQ]AAAAAAAAAAAAAAAAGGCCAGGGGAGACATACAT[P]Probe (Group 1) 2924_RefRaq_01[FAM]AGACAGAGTCTCACTCTGTCACCC[BHQ1]Probe (Group 2) 3027_RefTaq_01[HEX]CAGTGGTTTGCAAGCATGGT[BHQ1]Probe (Group 2) 3125A_refTaq02[FAM]GAA[LNA C]AGAGCATT[LNA T]TAGAGCCAT[LNAA]GTT[BHQ1]Probe (Group 2) 3226_A_refTaq01[HEX]GAAAAAGGTTAAGGGCTCTGACTGC[BHQ1]Probe (Group 2) 3321_RefRaq01[TAMRA]GGAGTCGCTGGCACAGTTCT[BHQ2]Probe (Group 2)

[0110] From this, the analysis results of all five markers (BAT25, BAT26, NR21, NR24, and NR27) confirmed that (1) in the microsatellite stable (MSS) HeLa cell line, the number of Cy5 fluorescence positives was similar to the number of reference fluorescence positives, and (2) in the microsatellite unstable (MSI) SNU638 cell line, the number of Cy5 fluorescence positives was absent or present at a low ratio compared to the number of reference fluorescence positives (see Figure 7).

[0111] 3.2 Confirmation of MSI using clinical samples

[0112] Using the primer and probe configuration identified in 3.1 above, tests were conducted on tissue samples (cancer tissue, normal tissue) of endometrial cancer patients, and the presence or absence of MSI was determined by analyzing the ratio of MSI molecules by marker in the tissue (number of deleted genes / number of normal genes).

[0113] The results are shown in Table 6, Table 7, Table 8 and Figure 11.

[0114] Specimen number Marker Lightness Tissue Normal tissue Cy5 concentration (ng / μL) Reference fluorescence concentration (ng / μL) Cy5 concentration (ng / μL) Reference fluorescence concentration (ng / μL) EM70 BAT25 114.1116.087.888.6 BAT26 127.7129.271.271.2 NR27 158.9159.3128.7132.4 NR21 138.4138.8139.4140.9 EM71 BAT25 162.1243.9132.4132.8 BAT26 134.7223.3103.7104.4 NR27 181.4332.4183.4184.9 NR21 201.6261.3 128.6129.4EM72BAT25188.3209.0260.0262.3BAT26180.3217.3265.7243.0NR27256.1295.4323.5325.6NR21206.3233 .8305.7308.9EM73BAT2539.239.6134.0133.7BAT2633.833.1128.7128.7NR2744.645.0193.2194.4NR2144.644.6182. 5183.6EM74BAT25475.6473.091.692.7BAT26390.4388.891.185.8NR27520.2522.3138.8141.1NR21458.6461.5138.81 39.6EM75BAT2526.231.029.929.8BAT26125.1162.7135.0133.9NR27150.8206.0190.8193.5NR21167.3174.9169.1169 .5EM76BAT2588.391.6152.0153.8BAT2683.087.4109.7110.1NR27128.0131.0178.8180.4NR21123.1125.0158.9160.0 EM77BAT25119.2120.0115.3116.1BAT26124.2124.289.283.6NR27174.3176.9129.0130.1NR21172.7175.7108.3109.1

[0115] Table 6 shows the results of the concentration (ng / μL) of genes obtained by analyzing the reaction zones in which the detection probe and reference probe were positive according to digital polymerase chain reaction. Using the results obtained therefrom, the ratio of the Cy5 concentration (detection probe) and the reference probe concentration was derived using Equation 1 below, and the results are shown in Table 7.

[0116] [Formula 1]

[0117] Copy Ratio = Concentration (MSS probe) / Concentration (reference probe)

[0118] Specimen number Marker Lightness Tissue Normal Tissue EM70 BAT250.980.99 BAT260.991.00 NR271.000.97 NR211.000.99 EM71 BAT250.661.00 BAT260.600.99 NR270.550.99 NR210.770.99 EM72 BAT250.900.99 BAT260.831.09 NR270.870.99 NR210.880.99 EM73 BAT250.991.00 BAT261.021.00 NR270.990.99 NR211.000.9 9EM74BAT251.010.99BAT261.001.06NR271.000.98NR210.990.99EM75BAT250.841.00BAT260.771.01NR270.730.99NR210.961.0 0EM76BAT250.960.99BAT260.951.00NR270.980.99NR210.980.99EM77BAT250.990.99BAT261.001.07NR270.990.99NR210.980.99

[0119] The difference in the ratio of the Cy5 concentration, which is a detection probe for cancer tissue and normal tissue, and the reference probe concentration according to the patient and marker was derived using Equation 2 below, and markers showing a difference of 5% or more were determined to be deletion markers, and patients with two or more such deletion markers were determined to have microsatellite instability (MSI) (see Table 8).

[0120] [Formula 2]

[0121] Δ(replication rate) = replication rate (normal tissue) - replication rate (cancer tissue)

[0122] Specimen number Marker name Ratio difference (cancer tissue - normal tissue) Judgment EM70 BAT 250.01 MSSBAT 260.01 NR 27-0.03 NR 21-0.01 EM71 BAT 250.33 MSIBAT 260.39 NR 270.45 NR 210.22 EM72 BAT 250.09 MSIBAT 260.26 NR 270.13 NR 210.11 EM73 BAT 250.01 MSSBAT 26-0.02 NR 270.00 NR 21- 0.01EM74BAT25-0.02MSSBAT260.06NR27-0.01NR210.00EM75BAT250.16MSIBAT260.24NR270.25NR210 .04EM76BAT250.02MSSBAT260.05NR270.01NR210.01EM77BAT250.00MSSBAT260.07NR270.01NR210.01

[0123] In addition, the Cy5 concentration and reference fluorescence concentration obtained from Table 6 were analyzed in a two-dimensional distribution graph, and in the case of patient samples confirmed by MSS, the slope was distributed close to 1, and the correlation (R 2 ) was 0.98 or higher, while it was confirmed that patient samples identified as MSI showed a low correlation with a slope deviating from 1 (see Fig. 11). While specific portions of the present invention have been described in detail above, it will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and that the scope of the present invention is not limited thereby. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

[0124]

[0125] The present invention is a result of the following national research and development project.

[0126] ① Assignment ID: 2710002588

[0127] ② Assignment Number: RS-2023-00255775

[0128] ③ Ministry name: Ministry of Science and ICT

[0129] ④ Research management specialized organization: Inter-ministerial Full-cycle Medical Device Research and Development Project Group

[0130] ⑤ Research Project Name: Inter-Ministry Full-cycle Medical Device Research and Development Project (R&D)

[0131] ⑥ Research Project Name: Development of a High-Sensitivity MSI Diagnostic System

[0132] ⑦ Organizer: Seesun Biomaterials Co., Ltd.

[0133] ⑧ Research Period: April 1, 2023 - December 31, 2025

Claims

1. A method for providing information for diagnosing microsatellite instability (MSI) using digital polymerase chain reaction (digital PCR), wherein the method for providing information is: A first group comprising a reporter and a quencher that distinguish complete or incomplete hybridization with the microsatellite repeat region of the target nucleic acid; and A second group comprising a reporter and a quencher that completely hybridize to a region of the target nucleic acid where microsatellite instability does not exist and fluoresces; A method for providing information for diagnosing microsatellite instability (MSI), comprising the step of analyzing the number of nucleic acids measured in one or more groups selected from the group consisting of:

2. In paragraph 1, A method for providing information for diagnosing microsatellite instability (MSI), wherein the above complete hybridization or unstable hybridization is distinguished by the action of endonuclease or exonuclease.

3. In paragraph 1, The probe comprising the first group is composed of a terminal comprising a microsatellite base repeat sequence and a terminal comprising 5 to 20 sequences outside the microsatellite base repeat sequence, A method for providing information for diagnosing microsatellite instability (MSI), comprising a reporter and a quencher at a terminal portion consisting of the above microsatellite base repeat sequence.

4. In paragraph 1, A method for providing information for diagnosing microsatellite instability (MSI), wherein the probe comprising the second group complementarily binds to a sequence other than a microsatellite repeat sequence and includes a reporter and a quencher at the end or inside.

5. In paragraph 3, A method for providing information for diagnosing microsatellite instability (MSI), wherein the reporter and quencher are separated by 2 to 5 bp.

6. In paragraph 1, A method for providing information for diagnosing microsatellite instability (MSI), wherein the reporter and quencher of the first group and the reporter and quencher of the second group are present in one probe.

7. In paragraph 1, A method for providing information for diagnosing microsatellite instability (MSI), wherein the reporter and quencher of the first group and the reporter and quencher of the second group are present in one amplicon.

8. In paragraph 1, A method for providing information for diagnosing microsatellite instability (MSI), wherein the reporter and quencher of the first group and the reporter and quencher of the second group are present in two independent amplification products.

9. In paragraph 1, A method for providing information for diagnosing microsatellite instability (MSI), wherein the reporter is selected from the group consisting of Cy5 (Cyaninine5), FAM (6-carboxyfluorescein), Texas red, and HEX (2', 4', 5', 7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein).

10. In paragraph 1, A method for providing information for diagnosing microsatellite instability (MSI), wherein the quencher is selected from the group consisting of BHQ1, BHQ2, Dabcyl and TAMRA (6-carboxytetramethyl-rhodamine).

11. In paragraph 1, A method for providing information for diagnosing microsatellite instability (MSI), wherein the probe is selected from the group consisting of sequence numbers 1 to 7, 11 to 13, and 24 to 33.

12. A probe comprising one or more reporters and quenchers; and Containing a forward primer and a reverse primer for the above probe; A method for providing information for diagnosing microsatellite instability (MSI) according to any one of claims 1 to 10. A kit for detecting base deletion of a target nucleic acid.

13. In paragraph 12, The kit wherein the above probe is selected from the group consisting of sequence numbers 1 to 7, 11 to 13 and 24 to 33 14. In paragraph 12, The above forward primer is selected from the group consisting of sequence numbers 14 to 18, A kit wherein the reverse primer is selected from the group consisting of sequence numbers 10 and 19 to 23.

Citation Information

Patent Citations

  • Biomarker group for detecting microsatellite instability in cancer as well as detection kit and application of biomarker group

    CN116479128A

  • Melting Curve Analysis Using bifunctional PNA probe for Microsatellite Instability (MSI) Diagnosis, and Method and Kit of Microsatellite Instability Diagnosis Using the Same

    KR101969971B1

  • Spiral spring for a horological movement

    KR1020220129480A

  • Electronic device for providing internet of things service and operating method thereof

    KR1020230115194A

  • Sidewalk Block Structure

    KR102480590B1