Methods of modulating expression of UBE3a gene
By administering an antisense oligomer encoded in a vector to reduce UBE3A mRNA levels in the central nervous system, the method effectively addresses the challenge of UBE3A protein overexpression, offering a treatment for associated disorders.
Patent Information
- Application Number
- PCT/US2024/059763
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-13
- Filing Date
- 2024-12-12
- Publication Date
- 2025-06-19
AI Technical Summary
Current methods are inadequate for effectively reducing the expression of the UBE3A protein in the central nervous system, which is associated with conditions such as Dupl5q syndrome, autism spectrum disorder, epilepsy, and intellectual disability.
Administration of an agent or vector encoding an antisense oligomer with at least 80% sequence identity to specific sequences, which reduces the level of processed mRNA encoding the UBE3A protein in the central nervous system.
The method achieves a significant decrease in UBE3A protein levels in the central nervous system, ranging from 10% to 99%, thereby potentially treating or reducing the likelihood of developing associated diseases or conditions.
Smart Images

Figure US2024059763_19062025_PF_FP_ABST
Abstract
Description
METHODS OF MODULATING EXPRESSION OF UBE3A GENECROSS REFERENCE
[0001] This application claims benefit of United States Provisional Patent Application No.63 / 609,703 filed December 13, 2023, which is incorporated herein by reference in its entirety.SUMMARY
[0002] Provided herein, in some aspects, is a method of reducing expression of a UBE3A protein in a mammalian subject, the method comprising administering to the mammalian subject an agent or a vector encoding the agent, thereby reducing a level of a processed mRNA encoding the UBE3A protein in at least a portion of the central nervous system of the subject, wherein the agent comprises an antisense oligomer with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0003] In some embodiments, the level of the processed mRNA encoding the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
[0004] In some embodiments, the level of the processed mRNA encoding the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
[0005] In some embodiments, the method reduces a level of the UBE3A protein in the at least a portion of the central nervous system of the subject.
[0006] In some embodiments, the level of the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
[0007] In some embodiments, the level of the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
[0008] In some embodiments, the at least a portion of the central nervous system of the subject comprises at least a portion of the spinal cord, brain, hippocampus, lumbar spinal cord, cervical spinal cord, thoracic spinal cord, prefrontal cortex, striatum, temporal cortex, cerebellum, pons, thalamus, or medulla.
[0009] In some embodiments, the method comprises administering the agent or the vector to the subject by intracerebroventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, intra cistema magna injection, subcutaneous injection, oral administration, synovial injection, intravitreal administration, subretinal injection, topical application, implantation, or intravenous injection.
[0010] In some embodiments, the method comprises administering the agent or the vector to the subject by intrathecal injection or intra cistema magna injection.
[0011] In some embodiments, the antisense oligomer comprises a backbone modification, a modified sugar moiety or a combination thereof.
[0012] In some embodiments, the antisense oligomer comprises a phosphorothioate linkage or a phosphorodiamidate linkage.
[0013] In some embodiments, the antisense oligomer comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2’-O-methyl moiety, a 2’-Fluoro moiety, a 2’-O- methoxy ethyl moiety, or a 2’-NMA moiety.
[0014] In some embodiments, the antisense oligomer comprises at least one modified sugar moiety.
[0015] In some embodiments, the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at a 5 ’ end of the antisense oligomer.
[0016] In some embodiments, the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at a 5’ end of the antisense oligomer.
[0017] In some embodiments, the antisense oligomer comprises one, two, three, four, five, or six 2’- O-methoxyethyl modified nucleosides at a 5 ’ end of the antisense oligomer.
[0018] In some embodiments, the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at a 3 ’ end of the antisense oligomer.
[0019] In some embodiments, the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at a 3’ end of the antisense oligomer.
[0020] In some embodiments, the antisense oligomer comprises one, two, three, four, five, or six 2’- O-methoxyethyl modified nucleosides at a 3 ’ end of the antisense oligomer.
[0021] In some embodiments, the antisense oligomer comprises three, four, five, or six 2’-O- methoxyethyl modified nucleosides at a 5’ end of the antisense oligomer; three, four, five, or six 2’-O- methoxyethyl modified nucleosides at a 3’ end of the antisense oligomer; and a phosphorothioate linkage between any two neighboring nucleosides of the antisense oligomer.
[0022] In some embodiments, the antisense oligomer comprises: a 5’ region consisting of three, four, five, or six linked nucleosides; a central region consisting of eight, nine, ten, eleven, or twelve linked nucleosides; and a 3’ region consisting of three, four, five, or six linked nucleosides; wherein each of the three, four, five, or six linked nucleosides in the 5’ region and each of three, four, five, or six linked nucleosides in the 3’ region comprise a modified sugar moiety, and wherein each of the eight, nine, ten, eleven, or twelve linked nucleosides in the central region is a deoxyribonucleoside.
[0023] In some embodiments, each cytosine in the ribonucleoside in the antisense oligomer is methylated.
[0024] In some embodiments, each cytosine in the deoxyribonucleoside in the antisense oligomer is unmethylated.
[0025] In some embodiments, in the antisense oligomer, each cytosine in the ribonucleoside is methylated and each cytosine in the deoxyribonucleoside is unmethylated.
[0026] In some embodiments, the antisense oligomer is from 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 15 to 50 nucleobases, 15 to 40 nucleobases, 15 to 35 nucleobases, 15 to 30 nucleobases, 15 to 25 nucleobases, 15 to 20 nucleobases, 15 to 19 nucleobases, 15 to 18 nucleobases, 15 to 16 nucleobases, 16 to 20 nucleobases, 16 to 19 nucleobases, 16 to 18 nucleobases, 17 to 20 nucleobases, 17 to 19 nucleobases, or 18 to 20 nucleobases in length.
[0027] In some embodiments, the antisense oligomer is a modified oligonucleotide comprising the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
[0028] In some embodiments, the antisense oligomer is a modified oligonucleotide consisting of the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
[0029] In some embodiments, the vector comprises a viral vector encoding the agent.
[0030] In some embodiments, the viral vector comprises an adenoviral vector, adeno-associated viral (AAV) vector, lentiviral vector, Herpes Simplex Virus (HSV) viral vector, or retroviral vector.
[0031] In some embodiments, the genome of the subject has a duplication of chromosome 15q 11.2- q!3.1.
[0032] In some aspects, provided herein is a method of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof by reducing expression of a UBE3A protein in at least a portion of the central nervous system of the subject, the method comprising administering to the subject a pharmaceutical composition comprising an agent or a vector encoding the agent, wherein the agent comprises an antisense oligomer at an amount of about 1 pg to about 50 pg, about 2 pg to about 20 pg, about 5 pg to about 15 pg, about 8 pg to about 12 pg, about 0.5 pg to about 25 pg, about 1 pg to about 15 pg, about 2 pg to about 10 pg, or about 4 pg to about 8 pg, wherein the antisense oligomer with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0033] In some aspects, provided herein is a method of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof by reducing expression of a UBE3A protein in at least a portion of the central nervous system of the subject, comprising administering to the subject a pharmaceutical composition comprising an agent or a vector encoding the agent, wherein the agent comprises an antisense oligomer with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0034] In some embodiments, the disease or condition is associated with overexpression or gain-of- fiinction mutation in a UBE3A gene encoding the UBE3A protein.
[0035] In some embodiments, the genome of the subject has at least one excessive copy of a UBE3A gene encoding the UBE3A protein.
[0036] In some embodiments, the genome of the subject has a duplication of a genomic region encompassing a UBE3A gene encoding the UBE3A protein.
[0037] In some embodiments, the genome of the subject has a duplication of chromosome 15q 11.2- ql3.1.
[0038] In some embodiments, the disease or condition comprises Dupl5q syndrome, autism spectrum disorder, epilepsy, or intellectual disability.
[0039] In some embodiments, the subject is at most 18 years old.
[0040] In some embodiments, the subject is at least 1 month old.
[0041] In some embodiments, the subject is from 1 month to 6 months old, from 6 months to 1 year old, or from 1 to 18, from 2 to 18, from 3 to 18, from 4 to 18, from 5 to 18, from 6 to 18, from 7 to 18, from 8 to 18, from 9 to 18, from 10 to 18, from 11 to 18, from 12 to 18, from 13 to 18, from 14 to 18, from 15 to 18, from 16 to 18, or from 17 to 18 years old.
[0042] In some embodiments, the subject is a fetus, an embryo, or a child.
[0043] In some embodiments, the method comprises administering the pharmaceutical composition to the subject by intracerebroventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, intra cistema magna injection, subcutaneous injection, oral administration, synovial injection, intravitreal administration, subretinal injection, topical application, implantation, or intravenous injection.
[0044] In some embodiments, the method comprises administering the pharmaceutical composition to the subject by intrathecal injection
[0045] In some embodiments, the method comprises administering the pharmaceutical composition to the subject by intracerebroventricular injection or intra cistema magna injection.
[0046] In some embodiments, the method treats the disease or condition.
[0047] In some embodiments, the level of the processed mRNA encoding the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
[0048] In some embodiments, the level of the processed mRNA encoding the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
[0049] In some embodiments, the method reduces a level of the UBE3A protein in the at least a portion of the central nervous system of the subject.
[0050] In some embodiments, the level of the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
[0051] In some embodiments, the level of the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about95%, or at least about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
[0052] In some embodiments, the at least a portion of the central nervous system of the subject comprises at least a portion of the spinal cord, brain, hippocampus, lumbar spinal cord, cervical spinal cord, thoracic spinal cord, prefrontal cortex, striatum, temporal cortex, cerebellum, pons, thalamus, or medulla.
[0053] In some embodiments, the antisense oligomer comprises a backbone modification, a modified sugar moiety or a combination thereof.
[0054] In some embodiments, the antisense oligomer comprises a phosphorothioate linkage or a phosphorodiamidate linkage.
[0055] In some embodiments, the antisense oligomer comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2’-O-methyl moiety, a 2’-Fluoro moiety, a 2’-O- methoxy ethyl moiety, or a 2’-NMA moiety.
[0056] In some embodiments, the antisense oligomer comprises at least one modified sugar moiety.
[0057] In some embodiments, the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at a 5 ’ end of the antisense oligomer.
[0058] In some embodiments, the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at a 5’ end of the antisense oligomer.
[0059] In some embodiments, the antisense oligomer comprises one, two, three, four, five, or six 2’- O-methoxyethyl modified nucleosides at a 5 ’ end of the antisense oligomer.
[0060] In some embodiments, the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at a 3 ’ end of the antisense oligomer.
[0061] In some embodiments, the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at a 3’ end of the antisense oligomer.
[0062] In some embodiments, the antisense oligomer comprises one, two, three, four, five, or six 2’- O-methoxyethyl modified nucleosides at a 3 ’ end of the antisense oligomer.
[0063] In some embodiments, the antisense oligomer comprises three, four, five, or six 2’-O- methoxyethyl modified nucleosides at a 5’ end of the antisense oligomer; three, four, five, or six 2’-O- methoxyethyl modified nucleosides at a 3’ end of the antisense oligomer; and a phosphorothioate linkage between any two neighboring nucleosides of the antisense oligomer.
[0064] In some embodiments, the antisense oligomer comprises: a 5’ region consisting of three, four, five, or six linked nucleosides; a central region consisting of eight, nine, ten, eleven, or twelve linked nucleosides; and a 3’ region consisting of three, four, five, or six linked nucleosides; wherein each of the three, four, five, or six linked nucleosides in the 5’ region and each of three, four, five, or six linked nucleosides in the 3’ region comprise a modified sugar moiety, and wherein each of the eight, nine, ten, eleven, or twelve linked nucleosides in the central region is a deoxyribonucleoside.
[0065] In some embodiments, each cytosine in the ribonucleoside in the antisense oligomer is methylated.
[0066] In some embodiments, each cytosine in the deoxyribonucleoside in the antisense oligomer is unmethylated.
[0067] In some embodiments, in the antisense oligomer, each cytosine in the ribonucleoside is methylated and each cytosine in the deoxyribonucleoside is unmethylated.
[0068] In some embodiments, the antisense oligomer is from 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 12 to 50 nucleobases,12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 15 to 50 nucleobases, 15 to 40 nucleobases, 15 to 35 nucleobases, 15 to 30 nucleobases, 15 to 25 nucleobases, 15 to 20 nucleobases, 15 to 19 nucleobases, 15 to 18 nucleobases, 15 to 16 nucleobases, 16 to 20 nucleobases, 16 to 19 nucleobases, 16 to 18 nucleobases, 17 to 20 nucleobases, 17 to 19 nucleobases, or 18 to 20 nucleobases in length.
[0069] In some embodiments, the antisense oligomer is a modified oligonucleotide comprising the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
[0070] In some embodiments, the antisense oligomer is a modified oligonucleotide consisting of the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
[0071] In some embodiments, the method comprises administering about 1 pg to about 50 pg, about 2 pg to about 20 pg, about 5 pg to about 15 pg, about 8 pg to about 12 pg, about 0.5 pg to about 25 pg, about 1 pg to about 15 pg, about 2 pg to about 10 pg, or about 4 pg to about 8 pg of the antisense oligomer to the subject.
[0072] In some embodiments, the method comprises administering about 5 pg, about 6 pg, about 7 pg, about 8 pg, about 9 pg, about 10 pg, about 11 pg, about 12 pg, about 13 pg, about 14 pg, about 15 pg, about 16 pg, about 17 pg, about 18 pg, about 19 pg, about 20 pg, about 21 pg, about 22 pg, about 23 pg, about 24 pg, about 25 pg, about 26 pg, about 27 pg, about 28 pg, about 29 pg, or about 30 pg of the antisense oligomer to the subject.
[0073] In some embodiments, the method comprises administering the vector to the subject, and wherein the vector comprises a viral vector encoding the agent.
[0074] In some embodiments, the viral vector comprises an adenoviral vector, adeno-associated viral (AAV) vector, lentiviral vector, Herpes Simplex Virus (HSV) viral vector, or retroviral vector.
[0075] In some aspects, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient, carrier, or diluent.
[0076] In some aspects, the pharmaceutical composition is a liquid composition.
[0077] In some aspects, the pharmaceutical composition comprises from 0.1 ml to 50 ml of a diluent, and wherein the compound is solubilized or diluted in the diluent.
[0078] In some embodiments, the pharmaceutical composition comprises about 40 pl, 50 pl, 60 pl, 70 pl, 0.1 ml, 0.5 ml, 1 ml, 2 ml, 2.5 ml, 3 ml, 4 ml, 5 ml, 6 ml, 7 ml, 8 ml, 9 ml, 10 ml, 11 ml, 12 ml,13 ml, 14 ml, 15 ml, 16 ml, 17 ml, 18 ml, 19 ml, 20 ml, 25 ml, 30 ml, 35 ml, 40 ml, 45 ml, 50 ml, or
[0079] In some embodiments, the pharmaceutical composition comprises about 40 pl to 70 pl of the diluent, 1 ml to 5 ml of the diluent, 1 ml to 20 ml of the diluent, 2 ml to 10 ml of the diluent, or 10 ml to 80 ml of the diluent.
[0080] In some embodiments, the diluent comprises a cerebral spinal fluid (CSF) sample from the subject or an artificial cerebral spinal fluid (aCSF) solution.
[0081] In some embodiments, the method ameliorates one or more symptoms of the disease or condition.
[0082] In some embodiments, the one or more symptoms comprise motor delays, intellectual disability, delayed speech and language development, seizures, behavioral difficulties (e.g., hyperactivity, emotional instability, anxiety, frustration, tantrums), ear infections, hearing loss, epilepsy, higher probability of sudden unexpected death in epilepsy (SUDEP), low muscle tone (e.g., hypotonia), ataxic gate (e.g., wide-based, clumsy gate), delays in development of motor skills (e.g., sitting or walking), difficulties with social interaction, and any combination thereof.
[0083] Provided herein, in some aspects, is use of a pharmaceutical composition comprising an antisense oligomer targeted to UBE3A in the manufacture of a medicament for the treatment of a disease or disorder in a subject in need thereof, wherein pharmaceutical composition comprises the antisense oligomer at an amount of about 1 pg to about 50 pg, about 2 pg to about 20 pg, about 5 pg to about 15 pg, about 8 pg to about 12 pg, about 0.5 pg to about 25 pg, about 1 pg to about 15 pg, about 2 pg to about 10 pg, or about 4 pg to about 8 pg, and wherein the antisense oligomer with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92. In some embodiments, the antisense oligomer is a modified oligonucleotide comprising the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247. In some embodiments, the disease or condition comprises Dupl5q syndrome.INCORPORATION BY REFERENCE
[0084] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS
[0085] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:
[0086] FIGS. 1A-1D show concentration response curves (CRCs) for each of 22 exemplary ASOs according to some embodiments of the present disclosure, as measured by percentage knockdown of human UBE3A gene in the cells treated with respective ASOs.
[0087] FIGS. 2A-2B are histograms illustrating the effect of various controls on UBE3A mRNA knockdown.
[0088] FIGS. 3A-3B are histograms showing the effect of exemplary ASOs at two different concentrations (6.3 pM and 20 pM, respectively) on the knockdown of UBE3A mRNA level on treatment Day 7, treatment Day 10, and treatment Day 14.
[0089] FIGS. 3C-3D are histograms illustrating the effect of test ASOs at two different concentrations (6.3 pM and 20 pM, respectively) on the reduction of UBE3A protein expression on treatment Day 7, treatment Day 10, and treatment Day 14.
[0090] FIGS. 4A-4D are histograms illustrating the fold changes in mRNA and protein expression in F-Dup and Corrected neuron cells. FIG. 4A illustrates the relative UBE3A mRNA expression on differentiation day 11 of F-Dup and Corrected neuronal cells (normalized to Corrected neuronal cells). FIG. 4B illustrates the relative UBE3A protein expression on differentiation Day 11 of F-Dup and Corrected neuronal cells (normalized to Corrected neuronal cells). FIG. 4C illustrates the relative UBE3A mRNA expression on differentiation day 22 of the F-Dup and Corrected neuronal cells (normalized to Corrected neuronal cells). FIG. 4D illustrates the relative UBE3A protein expression on differentiation day 22 of F-Dup and Corrected neuronal cells (normalized to Corrected neuronal cells).
[0091] FIGS. 5A-5B illustrate the UBE3A protein expression levels on ASO treatment days 7 and 10 at 6.3 pM (FIG. 5A) and 20 pM (FIG. 5B) of the exemplary ASOs on F-Dup neurons on treatment Day 7, treatment Day 10, and treatment Day 14.
[0092] FIG. 6 is a graphical representation of the timeline for time neuronal cells spent in culture, duration of ASO treatment, and duration of wash-out culture media.
[0093] FIG. 7 is a schematic portraying the overview of the study design showing timepoints clinical observations and neurological scoring.
[0094] FIG. 8 is a line chart representative of the body weight (g) development of the mice for the duration of the study upon treatment with the various ASO candidates. Genders were pooled. Data are presented as group mean ± SEM.
[0095] FIGS. 9A-9K are histograms illustrating mice weight over the course of the study when they have been treated with the various ASO candidates. Genders were pooled. Data are presented as group mean ± SEM. Groups size: n=6 / group (3 males & 3 females).
[0096] FIGS. 10A-10C are heatmaps illustrating the scores of the mice assigned during functional observation of mice body position. Data are presented as heatmaps showing number of animals over observational attributes per group. Genders were pooled. Heatmaps show the body position scores before treatment with the ASOs (FIG. 10A), on Day 15 of treatment with the ASO candidates (FIG. 10B), and on Day 29 of treatment with the ASO candidates (FIG. 10C). (Sitting or standing): The animal is in a normal position, sitting or standing. (Sleeps): The animal sleeps on its side or in proneposition. (Reaching): The animal is rearing (standing on its hind limbs). Higher score correlates to more occurrence within a single group.
[0097] FIGS. 11A-11C are heatmaps illustrating the assigned scores of the mice during functional observation of mice body position. Data are presented as heatmaps showing group mean score over observational attributes. Genders were pooled. Heatmaps show the body position scores before treatment with the ASOs (FIG. HA), on Day 15 of treatment with the ASO candidates (FIG. 11B), and on Day 29 of treatment with the ASO candidates (FIG. 11C). A higher score correlates with more severe imparities or more occurrence of impairments within a single group.
[0098] FIG. 12 is a graphical representation of the placement of different UBE3A QuantiGene probe sets along the transcript. All probe sets gave similar results, especially for the lumbar spinal cord samples, although differing to some extent in the fluorescence signal levels obtained (also due to assay chemistry). The housekeeping gene limbs vs. Hprt) stability and expression levels were also considered, and the normalized expression data of UBE3A are presented correcting to the geomean of both. However, housekeeping gene data are also presented separately to help assess the levels and variability. Image was created with SnapGene Viewer 6.0.2.
[0099] FIGS. 13A-13C are histograms representing the levels of rat ubiquitin protein ligase E3A (UBE3A) expression in lumbar spinal cord of the mice. Genders were pooled. Data are presented as group mean ± SEM. Groups size: n=6 / group (3 males & 3 females). Statistical significances: * p < 0.05, ** p < 0.01, *** p < 0.001 vs. Group 1 (one-way ANOVA, Dunnett's multiple comparisons test). The numbers behind the probe set name indicate the region / placement in nucleotides of the assay probe set: FIG. 13A is a histogram for UBE3A_probe 1 685-1629 (25), FIG. 13B is a histogram for UBE3A_probel_2290-2760 (56), FIG. 13C is a histogram for UBE3A_probel_4239- 5159 (20). The numbers inside or below the columns, “1”-“11,” denote Group 1 to Group 11, respectively, as indicated on the side of the graphs.
[0100] FIGS. 14A-14F are histograms representing the levels of housekeeping gene expression (Hmbs and Hprtl) in lumbar spinal cord of the mice. Genders were pooled. Data are presented as group mean ± SEM. Groups size: n=6 / group (3 males & 3 females). Housekeeper gene expression is presented in three ways: as net MFI values (FIG. 14A-14B), as expression normalized to their geomean (FIG. 14C-14D), and as expression normalized to each gene (FIG. 14E-14F). A small seeming drift in the net MFI value means did not produce statistical differences between groups. The numbers inside or below the columns, “1”-“11,” denote Group 1 to Group 11, respectively, as indicated on the side of the graphs.
[0101] FIGS. 15A-15C are histograms representing the levels of rat ubiquitin protein ligase E3A (UBE3A) expression in the cortex of the mice. Genders were pooled. Data are presented as group mean ± SEM. Groups size: n=6 / group (3 males & 3 females). Statistical significances: * p < 0.05 vs. Group 1 (one-way ANOVA, Dunnett's multiple comparisons test). The numbers behind the probe set name indicate the region / placement in nucleotides of the assay probe set: FIG. 15A is a histogram forUBE3A_probel_685-1629 (25), FIG. 15B is a histogram for UBE3A_probel_2290-2760 (56), FIG. 15C is a histogram for UBE3A_probel_4239-5159 (20). The numbers inside or below the columns, “1”-“11,” denote Group 1 to Group 11, respectively, as indicated on the side of the graphs.
[0102] FIGS. 16A-16F are histograms representing the expression of housekeeping genes (Hmbs and Hprtl) in the cortex. Genders were pooled. Data are presented as group mean ± SEM. Groups size: n=6 / group (3 males & 3 females). Housekeeper gene expression is presented in three ways: as net MFI values (FIG. 16A-16B), as expression normalized to their geomean (FIG. 16C-16D), and as expression normalized to each gene (FIG. 16E-16F). The numbers inside or below the columns, “1”- “11,” denote Group 1 to Group 11, respectively, as indicated on the side of the graphs.
[0103] FIGS. 17A-17C are histograms representing expression of rat ubiquitin protein ligase E3A (UBE3A) in the striatum. Genders were pooled. Data are presented as group mean ± SEM. Groups size: n=6 / group (3 males & 3 females). No statistical significances vs. Group 1 (one-way ANOVA, Dunnett's multiple comparisons test). The numbers behind the probe set name indicate the region / placement in nucleotides of the assay probe set: FIG. 17A is a histogram for UBE3A_probel_685-1629 (25), FIG. 17B is a histogram for UBE3A_probel_2290-2760 (56), FIG. 17C is a histogram for UBE3A_probel_4239-5159 (20). The numbers inside or below the columns, “1”-“11,” denote Group 1 to Group 11, respectively, as indicated on the side of the graphs.
[0104] FIGS. 18A-18F are histograms representing the expression of housekeeping genes in the striatum. Genders were pooled. Data are presented as group mean ± SEM. Groups size: n=6 / group (3 males & 3 females). Housekeeper gene expression is presented in three ways: as net MFI values (FIG. 18A-18B), as expression normalized to their geomean (FIG. 18C-18D), and as expression normalized to each gene (FIG. 18E-18F). The numbers inside or below the columns, “1”-“11,” denote Group 1 to Group 11, respectively, as indicated on the side of the graphs.
[0105] FIGS. 19A-19B are microscopy images if immunostained ioGlutamatergic neurons. Cells were stained with DAPI for gross cellular morphology (FIGS. 19A and 19B, first panels), and also stained positively for neuronal markers vGLUTl, 3-tubulin (FIG. 19A, second and third panels), and MAP2 (FIG 19B, second panel).
[0106] FIGS. 20A-20L are scatterplots illustrating relative UBE3A gene expression in ioGlutamatergic neurons after treatment with individual ASOs dosed at various concentrations (0.01 pM, 0.03 pM, 0.08 pM, 0.25 pM, 0.74 pM, 2.22 pM, 6.67 pM, and 20.0 pM). ASO dose-response data can be seen for ASOs with SEQ ID NO: 69 (FIG. 20A, left), SEQ ID NO: 70 (FIG. 20A, right), SEQ ID NO: 72 (FIG. 20B, left), SEQ ID NO: 71 (FIG. 20B, right), SEQ ID NO: 73 (FIG. 20C, left), SEQ ID NO: 74 (FIG. 20C, right), SEQ ID NO: 75 (FIG. 20D, left), SEQ ID NO: 76 (FIG. 20D, right), SEQ ID NO: 77 (FIG. 20E, left), SEQ ID NO: 78 (FIG. 20E, right), SEQ ID NO: 79 (FIG. 20F, left), SEQ ID NO: 80 (FIG. 20F, nght), SEQ ID NO: 82 (FIG. 20G, left), SEQ ID NO: 81 (FIG. 20G, right), SEQ ID NO: 84 (FIG. 20H, left), SEQ ID NO: 83 (FIG. 20H, right), SEQ ID NO: 85 (FIG. 201, left), SEQ ID NO: 86 (FIG. 201, right), SEQ ID NO: 88 (FIG. 20J, left), SEQ IDNO: 87 (FIG. 20J, right), SEQ ID NO: 29 (FIG. 20K, left), SEQ ID NO: 31 (FIG. 20K, right), SEQ ID NO: 4 (FIG. 20L, left), and SEQ ID NO: 5 (FIG. 20L, right).
[0107] FIGS. 21A-21B are scatterplots illustrating relative UBE3A gene expression in ioGlutamatergic neurons after treatment with control ASOs P0S1 (FIG. 21A, left), scrPl (FIG. 21A, right), P0S2 (FIG. 21B, left), and NEAT1 (FIG. 21B, right) at various concentrations (0.01 pM, 0.03 pM, 0.08 pM, 0.25 pM, 0.74 pM, 2.22 pM, 6.67 pM, and 20.0 pM). FIG. 21C is a scatterplot illustrating relative NEAT1 gene expression in ioGlutamatergic neurons after treatment with control ASOs POS2 (FIG. 21C, left) and NEAT1 (FIG. 21C, right) at various concentrations (0.01 pM, 0.03 pM, 0.08 pM, 0.25 pM, 0.74 pM, 2.22 pM, 6.67 pM, and 20.0 pM).
[0108] FIG. 22 is a schematic of the study design presented in Example 6. Sprague-Dawley male and female rats were dosed twice with the same dose of ASO, with the first dose given at Day 1 and the second dose given at Day 15. Clinical observations were made on study days 1,2, 15, and 16.
[0109] FIG. 23 illustrates the placement of three different UBE3A QuantiGene probe sets (design 1, design 2, and design 3) along the Rattus norvegicus UBE3A transcript.
[0110] FIGS. 24A-24C are histograms illustrating multifluorescence intensity (MFI) data of the three probes from FIG. 23 that have been normalized to MFI of the vehicle control in the lumbar spinal cord of Sprague -Dawley rats (pooled genders) treated with ASO with SEQ ID NO: 17. FIG. 24A is ahistogram of MFI data of UBE3A Probe 1 (UBE3A_probel_685-1629), FIG. 24B is a histogram of MFI data of UBE3A Probe 2 (UBE3A_probe2 2290-2760), and FIG. 24C is a histogram of MFI data of UBE3A Probe 3 (UBE3A_probe3_4239-5159).
[0111] FIGS. 25A-25C are histograms illustrating multifluorescence intensity (MFI) data of the three probes from FIG. 23 that have been normalized to MFI of the vehicle control in the cervical spinal cord of Sprague -Dawley rats (pooled genders) treated with ASO with SEQ ID NO: 17. FIG. 25A is ahistogram of MFI data of UBE3A Probe 1 (UBE3A_probel_685-1629), FIG. 25B is a histogram of MFI data of UBE3A Probe 2 (UBE3A_probe2_2290-2760), and FIG. 25C is a histogram of MFI data of UBE3A Probe 3 (UBE3A_probe3_4239-5159).
[0112] FIGS. 26A-26C are histograms illustrating multifluorescence intensity (MFI) data of the three probes from FIG. 23 that have been normalized to MFI of the vehicle control in the prefrontal cortex of Sprague-Dawley rats (pooled genders) treated with ASO with SEQ ID NO: 17. FIG. 26A is a histogram of MFI data of UBE3A Probe 1 (UBE3A_probel_685-1629), FIG. 26B is a histogram of MFI data of UBE3 A Probe 2 (UBE3A_probe2_2290-2760), and FIG. 26C is a histogram of MFI data of UBE3A Probe 3 (UBE3A_probe3_4239-5159).
[0113] FIGS. 27A-27C are histograms illustrating multifluorescence intensity (MFI) data of the three probes from FIG. 23 that have been normalized to MFI of the vehicle control in the striatum of Sprague -Dawley rats (pooled genders) treated with ASO with SEQ ID NO: 17. FIG. 27A is a histogram ofMFI data of UBE3A Probe 1 (UBE3A_probel_685-1629), FIG. 27B is a histogram ofMFI data of UBE3A Probe 2 (UBE3A_probe2_2290-2760), and FIG. 27C is a histogram of MFI data of UBE3A Probe 3 (UBE3A_probe3_4239-5159).
[0114] FIGS. 28A-28C are histograms illustrating multifluorescence intensity (MFI) data of the three probes from FIG. 23 that have been normalized to MFI of the vehicle control in the temporal cortex of Sprague-Dawley rats (pooled genders) treated with ASO with SEQ ID NO: 17. FIG. 28A is a histogram of MFI data of UBE3A Probe 1 (UBE3A_probel_685-1629), FIG. 28B is a histogram of MFI data of UBE3 A Probe 2 (UBE3A_probe2_2290-2760), and FIG. 28C is a histogram of MFI data of UBE3A Probe 3 (UBE3A_probe3_4239-5159).
[0115] FIGS. 29A-29C are histograms illustrating multifluorescence intensity (MFI) data of the three probes from FIG. 23 that have been normalized to MFI of the vehicle control in the thoracic spinal cord of Sprague -Dawley rats (pooled genders) treated with ASO with SEQ ID NO: 17. FIG. 29A is ahistogram of MFI data of UBE3A Probe 1 (UBE3A_probel_685-1629), FIG. 29B is a histogram of MFI data of UBE3A Probe 2 (UBE3A_probe2_2290-2760), and FIG. 29C is a histogram of MFI data of UBE3A Probe 3 (UBE3A_probe3_4239-5159).
[0116] FIGS. 30A-30C are histograms illustrating multifluorescence intensity (MFI) data of the three probes from FIG. 23 that have been normalized to MFI of the vehicle control in the cerebellum of Sprague-Dawley rats (pooled genders) treated with ASO with SEQ ID NO: 17. FIG. 30A is a histogram ofMFI data of UBE3A Probe 1 (UBE3A_probel_685-1629), FIG. 30B is a histogram of MFI data of UBE3 A Probe 2 (UBE3A_probe2 2290-2760), and FIG. 30C is a histogram ofMFI data of UBE3A Probe 3 (UBE3A_probe3_4239-5159).
[0117] FIGS. 31A-31C are histograms illustrating multifluorescence intensity (MFI) data of the three probes from FIG. 23 that have been normalized to MFI of the vehicle control in the pons of Sprague -Dawley rats (pooled genders) treated with ASO with SEQ ID NO: 17. FIG. 31A is a histogram ofMFI data of UBE3A Probe 1 (UBE3A_probel_685-1629), FIG. 31B is a histogram of MFI data of UBE3A Probe 2 (UBE3A_probe2_2290-2760), and FIG. 31C is a histogram ofMFI data of UBE3A Probe 3 (UBE3A_probe3_4239-5159).
[0118] FIGS. 32A-32C are histograms illustrating multifluorescence intensity (MFI) data of the three probes from FIG. 23 that have been normalized to MFI of the vehicle control in the hippocampus of Sprague -Dawley rats (pooled genders) treated with ASO with SEQ ID NO: 17. FIG. 32A is ahistogram of MFI data of UBE3A Probe 1 (UBE3A_probel_685-1629), FIG. 32B is a histogram ofMFI data of UBE3A Probe 2 (UBE3A_probe2_2290-2760), and FIG. 32C is a histogram ofMFI data of UBE3A Probe 3 (UBE3A_probe3_4239-5159).
[0119] FIGS. 33A-33C are histograms illustrating multifluorescence intensity (MFI) data of the three probes from FIG. 23 that have been normalized to MFI of the vehicle control in the thalamus of Sprague -Dawley rats (pooled genders) treated with ASO with SEQ ID NO: 17. FIG. 33A is a histogram ofMFI data of UBE3A Probe 1 (UBE3A_probel_685-1629), FIG. 33B is a histogram ofMFI data of UBE3A Probe 2 (UBE3A_probe2_2290-2760), and FIG. 33C is a histogram of MFI data of UBE3A Probe 3 (UBE3A_probe3_4239-5159).
[0120] Data for FIGS. 24A-33C are presented as group mean ± SEM. Groups size: n=6 / group (3 males & 3 females). Statistical significances: **** p < 0.0001 vs. Group 1 (one-way ANOVA, Dunnett's multiple comparisons test). The numbers behind the probe set name indicate the region / placement in nucleotides of the assay probe set. Group 1: Vehicle control (n= 3 males & 3 females); Group 2: ASO with SEQ ID NO: 17, 300 pg / dose (n= 3 males & 3 females); Group 3: ASO with SEQ ID NO: 17, 600 pg / dose (n= 3 males & 3 females); and Group 4: ASO with SEQ ID NO: 17, 1200 pg / dose (n= 3 males & 3 females). Endpoint samples were collected on Day 29 as presented in the schematic of FIG. 22. The numbers inside the columns of FIGS. 24A-33C, “I,” “2,” “3,” and “4,” denote Group 1 (vehicle control), 2 (TAI, 300 pg), 3 (TAI, 600 pg), and 4 (TAI, 1200 pg), respectively.
[0121] FIGS. 34A-34C depict data illustrating dose-dependent knockdown of Ube3a levels in Ube3a+2mice. FIG. 34A is a histogram of qPCR data showing the percentage of Ube3ct levels in tissues when wild-type (WT) and Ube3a2mouse pups were treated with either a vehicle control (“Veh.”), or 2.5 pg, 5 pg, or 10 pg of Compound !? via intracerebroventricular (ICV) injection on postnatal day 1 (Pl). Levels were normalized to housekeeping gene Hprtl ^Hrpt”). FIG. 34B is a histogram of qPCR data showing the percentage of Ube3a levels in tissues when wild-type (WT) and Ube3a+2mouse pups were treated with either a vehicle control (“Veh.”), or 2.5 pg, 5 pg, or 10 pg of Compound !? via intracerebroventricular (ICV) injection on postnatal day 1 (Pl). Levels were normalized to Ribosomal protein L22 gene Rpl22. FIG. 34C is a schematic showing the primers and priming sites for qPCR at a region comprising Exon 5 on isoform 2 and isoform 3 of the UbeSa gene. Exon 5 is in gray to show that it is deleted in mice models for Angelman Syndrome (AS) for comparative reference to Ube3a+2mice models, which do have Exon 5 in the Ube3a gene transcript.
[0122] FIG. 35 is a line chart showing the percentage survival of mice in various control and treatment conditions when they are exposed to flurothyl, a general seizure -inducing compound, once a day over the course of eight days to assess levels of seizure-induced death. Data for wild-type mice treated with vehicle control are represented by the light-gray, dotted line. Data for wild-type mice treated with 10 pg Compound !? are represented by the solid black line. Data for UbeSa2mice treated with vehicle control are represented by the dark-gray, dotted line. Data for Ube3a2mice treated with Compound !? on postnatal day 1 (Pl) are represented by the dark-gray, solid line. The x- axis shows the day of flurothyl exposure, and the y-axis shows the percentage of survival.
[0123] FIG. 36 is a histogram showing an exemplary behavioral effect, floating time when forced to swim, of Uhi?3a2mice treated with either vehicle control (left, white bar) or 10 pg Compound !? (right, black bar). Percentage of floating time is shown on the y-axis.
[0124] FIG. 37A-37C depict data illustrating that there were no behavioral deficits caused by knockdown of Ube3a in wild-type and Ube3a+2mice treated with Compound l?. FIG. 37A is a linechart showing the changes in an exemplary behavioral effect of nest building on mice in various treatment conditions over the course of 5 days. FIG. 37B is a strip chart showing the distribution and comparison of nest building scores on day 4 based on the data from FIG. 37A. The “ns” annotations indicate non-significant statistical comparisons between the groups. FIG. 37C is a line chart showing the changes in an exemplary behavioral effect of rotarod balance on mice in various treatment conditions over the course of 5 days.
[0125] FIG. 38A-38B depict data suggesting that ASO treatment suppressed marble burying behavior in wild-type and Ube3a mice. FIG. 38A is a histogram showing the percentage of marbles buried by wild-type mice treated with a vehicle control (first bar), wild-type mice treated with 10 pg Compound l 7 (second bar), Ube3a+2mice treated with vehicle control (third bar), and Ube3a mice treated with Compound l? (fourth bar). FIG. 38B is a histogram showing the percentage of area obscured by wild-type mice treated with a vehicle control (first bar), wild-type mice treated with 10 pg Compound !? (second bar), Ube3a+2mice treated with vehicle control (third bar), and Ube3a2mice treated with Compound !? (fourth bar). The “ns” annotations indicate non-significant statistical comparisons between the groups.DETAILED DESCRIPTION
[0126] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.Certain Terminology
[0127] Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis.
[0128] Unless otherwise indicated, the following terms have the following meanings:
[0129] In this application, the use of the singular includes the plural unless specifically stated otherwise. It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. In this application, the use of “or” means “and / or” unless stated otherwise. Furthermore, use of the term “including” as well as other forms, such as “include,” “includes,” and “included,” is not limiting. The abbreviation, “e g.,” is derived from the Latin exempli gratia, and is used herein to indicate a nonlimiting example. Thus, the abbreviation “e.g.,” is synonymous with the term “for example.” The abbreviation, “etc ” is derived from the Latin et cetera, and is used herein to indicate a non-limiting list. Thus, the abbreviation “etc.” is synonymous with the term “and other similar things,” or “and so forth.”
[0130] As used herein, ranges and amounts can be expressed as “about” a particular value or range, e.g., ± 15% of a referenced numeral value. About also includes the exact amount. Hence “about 5 pL”means “about 5 pL” and also “5 pL.” Generally, the term “about” includes an amount that would be expected to be within experimental error. The term “about” when used in connection with percentages can mean ± about 1%, about 2%, about 3%, about 4%, or about 5%. Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.”
[0131] “Administering” can mean providing a pharmaceutical agent to an animal, and includes, but is not limited to administering by a medical professional and self-administering. “Amelioration” refers to a lessening, slowing, stopping, or reversing of at least one indicator of the severity of a syndrome or condition. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
[0132] “Animal” can refer to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
[0133] “Antisense oligomer” can mean an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense oligomers include single- stranded and double -stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, and ssRNAs.
[0134] “Antisense inhibition” or “inhibition” can mean reduction of target nucleic acid levels in the presence of an antisense oligomer complementary to a target nucleic acid compared to target nucleic acid levels or in the absence of the antisense oligomer.
[0135] “Antisense mechanisms” can refer to all those mechanisms involving hybridization of a compound with a target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing. An antisense oligomer provided herein can be “antisense” to a target nucleic acid, meaning that the antisense oligomer is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
[0136] “Antisense oligonucleotide” can mean a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid.
[0137] “Base complementarity” can refer to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (e.g., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.
[0138] “Bicyclic sugar” can mean a furanose ring modified by the bridging of two atoms. A bicyclic sugar is a modified sugar.
[0139] “Bicyclic nucleoside” (also “BNA”) can mean a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4’-carbon and the 2’-carbon of the sugar ring.
[0140] “Cap structure” or “terminal cap moiety” can mean chemical modifications, which have been incorporated at either terminus of an antisense oligomer. “cEt” or “constrained ethyl” can mean a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4’-carbon and the 2’- carbon, wherein the bridge has the formula: 4’-CH(CH3)-O-2’
[0141] As used herein the term “comprising” or “comprises” is used in reference to compositions, methods, and respective component(s) thereof, that are essential to the method or composition, yet open to the inclusion of unspecified elements, whether essential or not.
[0142] As used herein the term “consisting essentially of’ refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment.
[0143] The term “consisting of’ refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
[0144] “Constrained ethyl nucleoside” (also cEt nucleoside) can mean a nucleoside comprising a bicyclic sugar moiety comprising a 4’-CH(CH3)-O-2’ bridge.
[0145] “Chimeric antisense oligomer” can mean an antisense oligomer that has at least two chemically distinct regions, each position having a plurality of subunits.
[0146] “Clinically normal level” can mean an expression level within experimental error of a nucleic acid or protein found in a wild-type or normal subject without a mutation in a gene of interest (e.g. , UBE3A gene) or a protein encoded by the gene of interest (e.g., UBE3A protein).
[0147] “Complementarity” can mean the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
[0148] “Contiguous nucleobases” can mean nucleobases immediately adjacent to each other.
[0149] “Diluent” can mean an ingredient in a composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, in drugs that are injected, the diluent may be a liquid, e.g., saline solution.
[0150] “Effective amount” in the context of modulating an activity or of treating or preventing a condition can mean the administration of that amount of pharmaceutical agent to an individual in need of such modulation, treatment, or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual’s medical condition, and other relevant factors.
[0151] “Efficacy” or “potency,” which are used herein interchangeably, can mean the ability to produce a desired effect.
[0152] “Expression” can include all the processes by which a gene’s coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation. “Expression products” can include RNA transcribed from a gene and polypeptides obtained by translation of mRNA transcribed from a gene.
[0153] “Gapmer” can mean a chimeric antisense oligomer in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region can be referred to as a “gap” and the external regions can be referred to as the “wings.”
[0154] “Hybridization” can mean the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligomer and a target nucleic acid. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
[0155] “Individual” can mean a human or non-human animal selected for treatment or therapy. “Individual” is used interchangeably with “subject.”
[0156] “Inhibiting UBE3A” or “inhibiting UBE3A" can mean reducing the level or expression of a UBE3A mRNA and / or UBE3A protein. In certain embodiments, UBE3A mRNA and / or UBE3A protein levels are inhibited in the presence of an antisense oligomer targeting UBE3A, including an antisense oligonucleotide targeting UBE3A, as compared to expression of UBE3A mRNA and / or UBE3A protein levels in the absence of a UBE3A antisense oligomer, such as an antisense oligonucleotide.
[0157] “Inhibiting the expression or activity” can refer to a reduction or blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.
[0158] “Intemucleoside linkage” can refer to the chemical bond between nucleosides.
[0159] “Intra-cistema magna” or “ICM” injection or delivery can refer to injection of an agent or pharmaceutical composition provided herein in the cerebrospinal fluid (CSF)-filled subarachnoid space between the cerebellum and the dorsal side of the medulla oblongata.
[0160] “Linked nucleosides” can refer to adjacent nucleosides linked together by an intemucleoside linkage.
[0161] “UBE3A antisense oligomer” can mean an antisense oligomer targeting UBE3A mRNA.
[0162] “Mismatch” or “non-complementary nucleobase” can refer to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
[0163] “Modified intemucleoside linkage” can refer to a substitution or any change from a naturally occurring intemucleoside bond (i.e., a phosphodiester intemucleoside bond).
[0164] “Modified nucleobase” can refer to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
[0165] “Modified nucleoside” can refer to a nucleoside having, independently, a modified sugar moiety and / or modified nucleobase.
[0166] “Modified nucleotide” can refer to a nucleotide having, independently, a modified sugar moiety, modified intemucleoside linkage, and / or modified nucleobase.
[0167] “Modified antisense oligonucleotide” can refer to an oligonucleotide comprising at least one modified intemucleoside linkage, modified sugar, and / or modified nucleobase.
[0168] “Modified sugar” can refer to substitution and / or any change from a natural sugar moiety.
[0169] As used herein, the term “modulates” refers to an effect including increasing or decreasing a given parameter as those terms are defined herein. For example, the terms “modulate,” “modulates,” “modulating,” and “modulation” can refer to upregulation or downregulation of a gene or a product encoded by a gene (e.g. , mRNA, protein).
[0170] “Monomer” can refer to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified. “Motif means the pattern of unmodified and modified nucleosides in an antisense oligomer.
[0171] “Natural sugar moiety” can refer to a sugar moiety found in DNA (2’-H) or RNA (2’-OH).
[0172] “Naturally occurring intemucleoside linkage” can refer to a 3’ to 5’ phosphodiester linkage.
[0173] “Non-complementary nucleobase” can refer to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
[0174] “Nucleic acid” can refer to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), singlestranded nucleic acids, double -stranded nucleic acids, small interfering ribonucleic acids (siRNA), and micro RNAs (miRNA).
[0175] “Nucleobase” can mean a heterocyclic moiety capable of pairing with a base of another nucleic acid. “Nucleobase complementarity” can refer to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense oligomer that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense oligomer is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair
[0176] “Nucleobase sequence” can refer to the order of contiguous nucleobases independent of any sugar, linkage, and / or nucleobase modification.
[0177] “Nucleoside” can refer to a nucleobase linked to a sugar.
[0178] “Nucleoside mimetic” can include those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as, for example, nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g, non-fiiranose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as, for example, peptide nucleic acids or morpholines (morpholines linked by -N(H)- C(=O)-O- or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system. “Mimetic” can refer to groups that are substituted for a sugar, a nucleobase, and / or intemucleoside linkage. Generally, a mimetic can be used in place of the sugar or sugar-intemucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
[0179] “Nucleotide” can refer to a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
[0180] “Oligomeric compound” or “oligomer,” which are used herein interchangeably, can refer to a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
[0181] “Oligonucleotide” can refer to a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
[0182] “Parenteral administration” can refer to administration through injection (e.g., bolus injection) or infusion. Parenteral administration can include subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal, intracerebroventricular, or intra cistema magna administration.
[0183] “Peptide” can refer to a molecule formed by linking at least two amino acids by amide bonds. Without limitation, as used herein, peptide refers to polypeptides and proteins. Exemplary peptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing.
[0184] “Pharmaceutical agent” can refer to a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide targeted to UBE3A is a pharmaceutical agent.
[0185] “Pharmaceutical composition” can refer to a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition can comprise an antisense oligonucleotide and a sterile aqueous solution.
[0186] “Pharmaceutically acceptable salts” can refer to physiologically and pharmaceutically acceptable salts of a pharmaceutically active ingredient (e.g., an antisense oligomer provided herein),such as salts that retain the desired biological activity of the active ingredient and do not impart undesired toxicological effects thereto.
[0187] “Phosphorothioate linkage” can mean a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified intemucleoside linkage.
[0188] “Portion” can mean a defined number of contiguous (z.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense oligomer.
[0189] “Prevent” or “preventing” can mean delaying or forestalling the onset or development of a disorder or syndrome for a period of time from minutes to days, weeks to months, or indefinitely.
[0190] “Prophylactically effective amount” can mean an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.
[0191] “Ribonucleotide” can mean a nucleotide having a hydroxy at the 2’ position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.
[0192] “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid.
[0193] “Targeting” or “targeted” can mean the process of design and selection of an antisense oligomer that will specifically hybridize to a target nucleic acid and induce a desired effect.
[0194] “Target nucleic acid,” “target RNA,” and “target RNA transcript” and “nucleic acid target” all can mean a nucleic acid capable of being targeted by antisense oligomers. In certain embodiments, the target nucleic acid is a UBE2A nucleic acid.
[0195] “Target region” can mean a portion of a target nucleic acid to which one or more antisense oligomers is targeted.
[0196] “Target segment” can mean the sequence of nucleotides of a target nucleic acid to which an antisense oligomer is targeted. “5’ target site” refers to the 5 ’-most nucleotide of a target segment. “3’ target site” refers to the 3 ’-most nucleotide of a target segment.
[0197] “Therapeutically effective amount” can mean an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
[0198] As used herein, the terms “treat,” “treatment,” “treating,” or “amelioration” refer to therapeutic treatments, wherein the object is to obtain a desired pharmacologic and / or physiologic effect, such as to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with, a disease or disorder. The term “treating” includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder. Treatment is generally “effective” if one or more symptoms or clinical markers are reduced Alternatively, treatment is “effective” if the progression of a disease is reduced or halted. That is, “treatment” includes not just the improvement of symptoms or markers, but also a cessation or at least slowing of progress or worsening of symptoms that would be expected in absence of treatment. Beneficial ordesired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. In some instances, an individual (e g., an individual suspected to be suffering from and / or genetically pre-disposed to a disease or disorder resulting from overexpression of UBE3A, such as, for example, Dupl5q syndrome) is treated prophylactically with a preparation of antisense oligomers described herein and such prophylactic treatment completely or partially prevents a disease or disorder resulting from overexpression of UBE3A, or sign or symptom thereof. In some instances, an individual is treated therapeutically (e.g., when an individual is suffering from a disease or disorder resulting from overexpression of UBE3A, such as, for example, Dupl5q syndrome), such therapeutic treatment causes a partial or complete cure for the disease or disorder and / or reverses an adverse effect attributable to the disease or disorder and / or stabilizes the disease or disorder and / or delays progression of the disease or disorder and / or causes regression of the disease or disorder.
[0199] “Unmodified nucleobases” can mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
[0200] “Unmodified nucleotide” can mean a nucleotide composed of naturally occurring nucleobases, sugar moieties, and intemucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide i.e., -D-ribonucleosides) or a DNA nucleotide (i.e., 0-D- deoxyribonucleoside).
[0201] “Wing segment” can mean a plurality of nucleosides modified to impart to an oligonucleotide properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
[0202] In general, the present disclosure relates to agents (e.g., antisense oligomers, e.g., antisense oligonucleotides), compositions, kits, and methods that relate to modulation of UBE3A level in a mammalian cell. In some cases, the agent provided herein modulates a level of a processed mRNA transcript encoding a UBE3A protein in a mammalian cell. In some cases, provided herein are agents, compositions, kits, and methods that relate to reduction of expression of a UBE3A protein in a mammalian cell where the UBE3A is overexpressed, for instance, in a mammalian cell having duplication, overexpression, or a gain-of-function mutation, of a UBE3A gene that encodes the UBE3A protein.Target Nucleic Acids, Target Regions and Nucleotide Sequences
[0203] Ubiquitin-protein ligase E3A (UBE3A), also known as E6AP ubiquitin-protein ligase (E6AP), is an enzyme involved in targeting proteins for degradation within cells. In human, UBE3A protein is encoded the UBE3A gene. The UBE3A gene is located on the long (q) arm of chromosome 15, 15ql 1.2, between positions 11 and 13. In cells, UBE3A protein can attach ubiquitin to proteins to be degraded by ubiquitin-proteasome degradation mechanism. Upon ubiquitin tagging, proteins canbe recognized and digested by proteasomes. In humans, both copies of the UBE3A gene can be active in most of the body’s tissues. However, in most neurons, only the maternal copy of UBE3A gene is normally active.
[0204] Nucleotide sequences that encode UBE3A include, without limitation, the complement of location 25333728 to 25439056 of GENBANK Accession No. NC_000015.10, orthe complement of location 556325..658147 of GENBANK Accession No. NG_002690.1. Nucleotide sequences that encode UBE3A include, without limitation, those listed in Table 1. Nucleotide sequences that encode UBE3A include, without limitation, those any of the mRNA transcripts listed in Table 2. It is understood that the sequence set forth in each SEQ ID NO in Table 1 and Examples contained herein is independent of any modification to a sugar moiety, an intemucleoside linkage, or a nucleobase. As such, antisense oligomers defined by a SEQ ID NO can comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase.
[0205] In some cases, an agent (e.g., an antisense oligomer) provided herein comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleobases of the sequence set forth in any one of SEQ ID NO: 93-120. In some cases, an agent (e.g., an antisense oligomer) provided herein comprises a polynucleotide sequence that is at least 85%, 90%, 95%, 98%, or 100% complementary to at least 8 contiguous nucleobases of the sequence set forth in any one of SEQ ID NO: 93-120. In some cases, an agent (e.g., an antisense oligomer) provided herein comprises a polynucleotide sequence that is 100% complementary to at least 8 contiguous nucleobases of the sequence set forth in any one of SEQ ID NO: 93-120.
[0206] In some cases, an agent (e.g., an antisense oligomer) provided herein comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleobases of an mRNA transcript listed in Table 2. In some cases, an agent (e.g., an antisense oligomer) provided herein comprises a polynucleotide sequence that is at least 85%, 90%, 95%, 98%, or 100% complementary to at least 8 contiguous nucleobases of an mRNA transcript listed in Table 2. In some cases, an agent (e.g., an antisense oligomer) provided herein comprises a polynucleotide sequence that is 100% complementary to at least 8 contiguous nucleobases of an mRNA transcript listed in Table 2.
[0207] In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region can encompass a 3 ’ UTR, a 5 ’ UTR, an exon, an intron, an exon / intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for UBE3A can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region encompasses the sequence from a 5’ target site of one target segment within the target region to a 3 ’ target site of another target segment within the same target region.
[0208] Targeting can include determination of at least one target segment to which an antisense oligomer hybridizes, such that a desired effect (e.g., degradation of the mRNA transcript that containsthe at least one target segment) occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is a reduction of levels of protein encoded by the target nucleic acid, or a phenotypic change associated with the target nucleic acid.
[0209] A target region can contain one or more target segments. Multiple target segments within a target region can be overlapping Alternatively, they can be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain embodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5’ target sites or 3’ target sites listed herein.
[0210] In some embodiments, hybridization occurs between an antisense oligomer disclosed herein and a UBE3A nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
[0211] Hybridization can occur under varying conditions. Stringent conditions are sequencedependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
[0212] Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense oligomers provided herein are specifically hybridizable with a UBE3A nucleic acid.Table 1. Certain UBE3A Nucleic Acid Sequences that an Agent Provided Herein TargetsTable 2. Certain UBE3A mRNA Transcripts that an Agent Provided Herein Targets* Sequences of the listed transcripts are retrievable by searching the Transcript ID on eiEnsembl (useast.ensembl.org / index.html).Antisense Oligomers
[0213] In some aspects, the agent provided herein is an antisense oligomer. Antisense oligomers provided herein can include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense oligomers, antisense oligonucleotides, and siRNAs.
[0214] In certain embodiments, an antisense oligomer has a nucleobase sequence that, when written in the 5 ’ to 3 ’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is designed to target. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is designed to target.
[0215] In some cases, an agent provided herein comprises an antisense oligomer, and the antisense oligomer comprises a sequence with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92. In some cases, an agent provided herein comprises an antisense oligomer, and the antisense oligomer comprises a sequence with at least 90% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92. In some cases, the antisense oligomer comprises a sequence with 100% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92. In some cases, the antisense oligomer consists of a sequence with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92. In some cases, the antisense oligomer consists of a sequence with at least 90% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92. In some cases, the antisense oligomer consists of a sequence with 100% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0216] In some cases, an agent provided herein comprises an antisense oligomer, and the antisense oligomer comprises the sequence set forth in any one of SEQ ID NO: 1-92, with 0 to 4 nucleic acid substitutions. In some cases, an agent provided herein comprises an antisense oligomer, and the antisense oligomer comprises the sequence set forth in any one of SEQ ID NO: 1-92, with 0 to 3 nucleic acid substitutions. In some cases, an agent provided herein comprises an antisense oligomer, and the antisense oligomer comprises the sequence set forth in any one of SEQ ID NO: 1-92, with 0 to 2 nucleic acid substitutions. In some cases, an agent provided herein comprises an antisense oligomer,and the antisense oligomer comprises the sequence set forth in any one of SEQ ID NO: 1-92, with 0 to 1 nucleic acid substitution.
[0217] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 1. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 1.
[0218] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 2. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 2.
[0219] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 3. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 3.
[0220] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 4. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 4.
[0221] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 5. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 5.
[0222] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 6. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 6.
[0223] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 7. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 7.
[0224] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 8. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 8.
[0225] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 9. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 9.
[0226] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 10. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 10.
[0227] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 11. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 11.
[0228] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 12. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 12.
[0229] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 13. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 13.
[0230] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 14. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 14.
[0231] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 15. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 15.
[0232] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 16. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 16.
[0233] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 17. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 17.
[0234] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 18. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 18.
[0235] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 19. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 19.
[0236] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 20. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 20.
[0237] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 21. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 21.
[0238] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 22. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 22.
[0239] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 23. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 23.
[0240] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 24. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 24.
[0241] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 25. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 25.
[0242] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 26. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 26.
[0243] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 27. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 27.
[0244] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 28. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 28.
[0245] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 29. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 29.
[0246] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 30. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 30.
[0247] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 31. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 31.
[0248] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 32. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 32.
[0249] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 33. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 33.
[0250] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 34. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 34.
[0251] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 35. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 35.
[0252] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 36. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 36.
[0253] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 37. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 37.
[0254] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 38. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 38.
[0255] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 39. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 39.
[0256] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 40. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 40.
[0257] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 41. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 41.
[0258] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 42. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 42.
[0259] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 43. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 43.
[0260] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 44. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 44.
[0261] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 45. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 45.
[0262] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 46. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 46.
[0263] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 47. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 47.
[0264] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 48. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 48.
[0265] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 49. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 49.
[0266] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 50. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 50.
[0267] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 51. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 51.
[0268] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 52. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 52.
[0269] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 53. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 53.
[0270] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 54. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 54.
[0271] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 55. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 55.
[0272] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 56. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 56.
[0273] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 57. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 57.
[0274] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 58. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 58.
[0275] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 59. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 59.
[0276] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 60. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 60.
[0277] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 61. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 61.
[0278] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 62. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 62.
[0279] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 63. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 63.
[0280] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 64. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 64.
[0281] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 65. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 65.
[0282] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 66. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 66.
[0283] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 67. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 67.
[0284] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 68. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 68.
[0285] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 69. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 69.
[0286] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 70. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 70.
[0287] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 71. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 71.
[0288] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 72. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 72.
[0289] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 73. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 73.
[0290] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 74. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 74.
[0291] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 75. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 75.
[0292] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 76. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 76.
[0293] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 77. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 77.
[0294] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 78. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 78.
[0295] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 79. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 79.
[0296] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 80. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 80.
[0297] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 81. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 81.
[0298] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 82. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 82.
[0299] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 83. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 83.
[0300] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 84. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 84.
[0301] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 85. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 85.
[0302] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 86. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 86.
[0303] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 87. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 87.
[0304] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 88. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 88.
[0305] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 89. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 89.
[0306] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 90. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 90.
[0307] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 91. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 91.
[0308] In some cases, an antisense oligomer provided herein comprises a sequence with at least 90%, 92%, 95%, 98%, or 100% sequence identity to the sequence of SEQ ID NO: 92. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 92.
[0309] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:1, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 1, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 1, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 1, with 0 to 1 nucleic acid substitution.
[0310] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:2, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 2, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 2, with 0 to 2 nucleic acidsubstitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 2, with 0 to 1 nucleic acid substitution.
[0311] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:3, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 3, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 3, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 3, with 0 to 1 nucleic acid substitution.
[0312] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:4, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 4, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 4, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 4, with 0 to 1 nucleic acid substitution.
[0313] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:5, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 5, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 5, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 5, with 0 to 1 nucleic acid substitution.
[0314] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:6, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 6, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 6, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 6, with 0 to 1 nucleic acid substitution.
[0315] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:7, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 7, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 7, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 7, with 0 to 1 nucleic acid substitution.
[0316] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:8, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 8, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 8, with 0 to 2 nucleic acidsubstitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 8, with 0 to 1 nucleic acid substitution.
[0317] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:9, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 9, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 9, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 9, with 0 to 1 nucleic acid substitution.
[0318] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:10, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 10, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 10, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 10, with 0 to 1 nucleic acid substitution.
[0319] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:11, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 11, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 11, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 11, with 0 to 1 nucleic acid substitution.
[0320] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:12, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 12, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 12, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 12, with 0 to 1 nucleic acid substitution.
[0321] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:13, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 13, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 13, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 13, with 0 to 1 nucleic acid substitution.
[0322] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:14, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 14, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 14, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 14, with 0 to 1 nucleic acid substitution.
[0323] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:15, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 15, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 15, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 15, with 0 to 1 nucleic acid substitution.
[0324] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:16, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 16, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 16, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 16, with 0 to 1 nucleic acid substitution.
[0325] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:17, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 17, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 17, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 17, with 0 to 1 nucleic acid substitution.
[0326] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:18, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 18, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 18, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 18, with 0 to 1 nucleic acid substitution.
[0327] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:19, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 19, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 19, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 19, with 0 to 1 nucleic acid substitution.
[0328] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:20, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 20, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 20, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 20, with 0 to 1 nucleic acid substitution.
[0329] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:21, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 21, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 21, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 21, with 0 to 1 nucleic acid substitution.
[0330] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:22, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 22, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 22, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 22, with 0 to 1 nucleic acid substitution.
[0331] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:23, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 23, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 23, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 23, with 0 to 1 nucleic acid substitution.
[0332] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:24, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 24, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 24, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 24, with 0 to 1 nucleic acid substitution.
[0333] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:25, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 25, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 25, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 25, with 0 to 1 nucleic acid substitution.
[0334] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:26, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 26, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 26, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 26, with 0 to 1 nucleic acid substitution.
[0335] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:27, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 27, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 27, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 27, with 0 to 1 nucleic acid substitution.
[0336] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:28, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 28, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 28, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 28, with 0 to 1 nucleic acid substitution.
[0337] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:29, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 29, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 29, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 29, with 0 to 1 nucleic acid substitution.
[0338] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:30, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 30, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 30, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 30, with 0 to 1 nucleic acid substitution.
[0339] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:31, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 31, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 31, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 31, with 0 to 1 nucleic acid substitution.
[0340] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:32, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 32, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 32, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 32, with 0 to 1 nucleic acid substitution.
[0341] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:33, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 33, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 33, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 33, with 0 to 1 nucleic acid substitution.
[0342] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:34, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 34, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 34, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 34, with 0 to 1 nucleic acid substitution.
[0343] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:35, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 35, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 35, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 35, with 0 to 1 nucleic acid substitution.
[0344] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:36, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 36, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 36, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 36, with 0 to 1 nucleic acid substitution.
[0345] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:37, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 37, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 37, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 37, with 0 to 1 nucleic acid substitution.
[0346] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:38, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 38, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 38, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 38, with 0 to 1 nucleic acid substitution.
[0347] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:39, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 39, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 39, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 39, with 0 to 1 nucleic acid substitution.
[0348] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:40, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 40, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 40, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 40, with 0 to 1 nucleic acid substitution.
[0349] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:41, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 41, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 41, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 41, with 0 to 1 nucleic acid substitution.
[0350] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:42, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 42, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 42, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 42, with 0 to 1 nucleic acid substitution.
[0351] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:43, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 43, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 43, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 43, with 0 to 1 nucleic acid substitution.
[0352] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:44, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 44, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 44, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 44, with 0 to 1 nucleic acid substitution.
[0353] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:45, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 45, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 45, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 45, with 0 to 1 nucleic acid substitution.
[0354] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:46, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 46, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 46, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 46, with 0 to 1 nucleic acid substitution.
[0355] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:47, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 47, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 47, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 47, with 0 to 1 nucleic acid substitution.
[0356] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:48, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 48, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 48, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 48, with 0 to 1 nucleic acid substitution.
[0357] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:49, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 49, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 49, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 49, with 0 to 1 nucleic acid substitution.
[0358] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:50, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 50, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 50, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 50, with 0 to 1 nucleic acid substitution.
[0359] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:51, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 51, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 51, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 51, with 0 to 1 nucleic acid substitution.
[0360] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:52, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 52, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 52, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 52, with 0 to 1 nucleic acid substitution.
[0361] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:53, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 53, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 53, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 53, with 0 to 1 nucleic acid substitution.
[0362] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:54, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 54, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 54, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 54, with 0 to 1 nucleic acid substitution.
[0363] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:55, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 55, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 55, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 55, with 0 to 1 nucleic acid substitution.
[0364] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:56, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 56, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 56, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 56, with 0 to 1 nucleic acid substitution.
[0365] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:57, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 57, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 57, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 57, with 0 to 1 nucleic acid substitution.
[0366] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:58, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 58, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 58, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 58, with 0 to 1 nucleic acid substitution.
[0367] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:59, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 59, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 59, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 59, with 0 to 1 nucleic acid substitution.
[0368] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:60, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 60, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 60, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 60, with 0 to 1 nucleic acid substitution.
[0369] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:61, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 61, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 61, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 61, with 0 to 1 nucleic acid substitution.
[0370] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:62, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 62, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 62, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 62, with 0 to 1 nucleic acid substitution.
[0371] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:63, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 63, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 63, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 63, with 0 to 1 nucleic acid substitution.
[0372] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:64, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 64, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 64, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 64, with 0 to 1 nucleic acid substitution.
[0373] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:65, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 65, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 65, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 65, with 0 to 1 nucleic acid substitution.
[0374] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:66, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 66, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 66, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 66, with 0 to 1 nucleic acid substitution.
[0375] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:67, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 67, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 67, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 67, with 0 to 1 nucleic acid substitution.
[0376] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:68, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 68, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 68, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 68, with 0 to 1 nucleic acid substitution.
[0377] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:69, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 69, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 69, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 69, with 0 to 1 nucleic acid substitution.
[0378] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:70, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 70, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 70, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 70, with 0 to 1 nucleic acid substitution.
[0379] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:71, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 71, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 71, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 71, with 0 to 1 nucleic acid substitution.
[0380] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:72, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 72, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 72, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 72, with 0 to 1 nucleic acid substitution.
[0381] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:73, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 73, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 73, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 73, with 0 to 1 nucleic acid substitution.
[0382] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:74, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 74, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 74, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 74, with 0 to 1 nucleic acid substitution.
[0383] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:75, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 75, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 75, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 75, with 0 to 1 nucleic acid substitution.
[0384] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:76, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 76, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 76, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 76, with 0 to 1 nucleic acid substitution.
[0385] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:77, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 77, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 77, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 77, with 0 to 1 nucleic acid substitution.
[0386] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:78, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 78, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 78, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 78, with 0 to 1 nucleic acid substitution.
[0387] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:79, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 79, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 79, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 79, with 0 to 1 nucleic acid substitution.
[0388] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:80, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 80, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 80, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 80, with 0 to 1 nucleic acid substitution.
[0389] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:81, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 81, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 81, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 81, with 0 to 1 nucleic acid substitution.
[0390] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:82, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 82, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 82, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 82, with 0 to 1 nucleic acid substitution.
[0391] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:83, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 83, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 83, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 83, with 0 to 1 nucleic acid substitution.
[0392] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:84, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 84, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 84, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 84, with 0 to 1 nucleic acid substitution.
[0393] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:85, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 85, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 85, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 85, with 0 to 1 nucleic acid substitution.
[0394] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:86, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 86, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 86, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 86, with 0 to 1 nucleic acid substitution.
[0395] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:87, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 87, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 87, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 87, with 0 to 1 nucleic acid substitution.
[0396] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:88, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 88, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 88, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 88, with 0 to 1 nucleic acid substitution.
[0397] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:89, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 89, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 89, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 89, with 0 to 1 nucleic acid substitution.
[0398] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:90, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 90, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 90, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 90, with 0 to 1 nucleic acid substitution.
[0399] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:91, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 91, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 91, with 0 to 2 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 91, with 0 to 1 nucleic acid substitution.
[0400] In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO:92, with 0 to 4 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 92, with 0 to 3 nucleic acid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 92, with 0 to 2 nucleicacid substitutions. In some cases, an antisense oligomer provided herein comprises the sequence of SEQ ID NO: 92, with 0 to 1 nucleic acid substitution.
[0401] In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 12 to 30 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 12 to 25 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 12 to 22 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 14 to 20 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 15 to 25 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 18 to 22 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 19 to 21 subunits in length. In certain embodiments, the antisense oligomer is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 30, 18 to 50, 19 to 30, 19 to 50, or 20 to 30 linked subunits in length.
[0402] In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 12 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 13 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 14 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 15 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 16 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 17 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 18 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 19 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 20 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 21 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 22 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 23 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 24 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 25 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 26 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 27 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 28 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 29 subunits in length. In certain embodiments, an antisense oligomer targeted to a target nucleic acid is 30 subunits in length. In certain embodiments, the antisense oligomer targeted to a target nucleic acid is 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linkedsubunits in length, or a range defined by any two of the above values. In certain embodiments the antisense oligomer is an antisense oligonucleotide, and the linked subunits are nucleosides.
[0403] Antisense oligomers provided herein can have nucleotides that mismatch the target sequence. For instance, an antisense oligonucleotide of 25 nucleobases in length can have 8 or 11 mismatch bases near the ends of the antisense oligonucleotides, while still being able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. In some cases, the antisense oligonucleotide provided herein has 12 to 30 subunits in length (e.g., nucleobases), including those with 1 or 3 mismatches.Chemically Modified Antisense Oligomer
[0404] In certain embodiments, antisense oligomers provided herein have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense oligomers properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
[0405] In some cases, provided herein are chimeric antisense oligomers. For instance, chimeric antisense oligomers can contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and / or increased inhibitory activity. A second region of a chimeric antisense oligomer can optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
[0406] In some cases, the antisense oligomers provided herein have a gapmer motif. Antisense oligomers having a gapmer motif can be considered chimeric antisense oligomers. In a gapmer, an internal region having a plurality of nucleotides that supports RNaseH cleavage can be positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment can serve as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer can include 0-D-ribonucleosides, 0-D-deoxyribonucleosides, 2’- modified nucleosides (such 2’-modified nucleosides may include 2’-M0E, and 2’-O-CH3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a 4’-(CH2)n-O-2’ bridge, where n=l or n=2 and 4’-CH2-O-CH2-2’). In certain embodiments, wings include several modified sugar moieties, including, for example, 2’-M0E. In certain embodiments, wings include several modified and unmodified sugar moieties. In certain embodiments, wings include various combinations of 2’-M0E nucleosides and 2’-deoxynucleosides.
[0407] Each distinct region can comprise uniform sugar moieties, variant, or alternating sugar moieties. The wing -gap-wing motif is frequently described as “X-Y-Z”, where “X” represents the length of the 5’ wing, ‘Y” represents the length of the gap, and “Z” represents the length of the 3’wing. “X” and “Z” can comprise uniform, variant, or alternating sugar moieties. In certain embodiments, “X” and “Y” include one or more 2’ -deoxynucleosides. “Y” can comprise 2’- deoxynucleosides. As used herein, a gapmer described as “X-Y-Z” can have a configuration such that the gap is positioned immediately adjacent to each of the 5’ wing and the 3’ wing. Thus, no intervening nucleotides can exist between the 5’ wing and gap, or the gap and the 3’ wing. Any of the antisense oligomers described herein can have a gapmer motif. In certain embodiments, “X” and “Z” are the same; in other cases, they are different.
[0408] In certain cases, gapmers provided herein include, for example, 20-mers having a motif of 5- 10-5 in the form of “X-Y-Z” as described herein. In certain embodiments, gapmers provided herein include, for example, 19-mers having a motif of 5-9-5 in the form of “X-Y-Z” as described herein. In certain embodiments, gapmers provided herein include, for example, 18-mers having a motif of 5-8-5 in the form of “X-Y-Z” as described herein. In certain embodiments, gapmers provided herein include, for example, 18-mers having a motif of 4-8-6 in the form of “X-Y-Z” as described herein. In certain embodiments, gapmers provided herein include, for example, 18-mers having a motif of 6-8-4 in the form of “X-Y-Z” as described herein. In certain embodiments, gapmers provided herein include, for example, 18-mers having a motif of 5-7-6 in the form of “X-Y-Z” as described herein.
[0409] In some cases, the antisense oligomer comprises: a 5’ region consisting of three, four, five, or six linked nucleosides (e.g., “X” part discussed above); a central region consisting of eight, nine, ten, eleven, or twelve linked nucleosides(e.g., “Y” part discussed above); and a 3’ region consisting of three, four, five, or six linked nucleosides (e.g., “Z” part discussed above). In some cases, each of the three, four, five, or six linked nucleosides in the 5’ region and each of three, four, five, or six linked nucleosides in the 3’ region comprise a modified sugar moiety, and each of the eight, nine, ten, eleven, or twelve linked nucleosides in the central region is a deoxyribonucleoside. In some cases, the modified sugar moiety includes a 2’-O-methyl moiety, a 2’-Fluoro moiety, a 2’-O-methoxyethyl moiety, or a 2’-NMA moiety, or any combination thereof. In some cases, one or more the nucleosides in the 5’ region and in the 3’ region further comprise other modification as disclosed herein. In some cases, all the nucleosides in the 5’ region and in the 3’ region further comprise other modification as disclosed herein.Complementarity
[0410] An agent provided herein can have a polynucleotide sequence complementary to a target nucleic acid when a sufficient number of nucleobases in the polynucleotide sequence (for instance antisense oligomer) can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect can occur (e.g., antisense inhibition of a target nucleic acid, such as a UBE3A nucleic acid).
[0411] Non-complementary nucleobases between an agent (e.g., an antisense oligomer) and a target nucleic acid may be tolerated provided that the agent (e.g., antisense oligomer) remains able to specifically hybridize to a target nucleic acid. Moreover, an agent (e.g., antisense oligomer) canhybridize to one or more segments of a target nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch, or hairpin structure).
[0412] In certain embodiments, the agents (e.g., antisense oligomers) provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a UBE3A nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense oligomer with a target nucleic acid can be determined using routine methods, such as using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis ), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
[0413] In certain embodiments, the agents (e.g., antisense oligomers) provided herein, or specified portions thereof, are fully complementary (i.e., 100% complementary) to a target nucleic acid, or specified portion thereof. For example, agents (e.g., antisense oligomers) provided herein can be fully complementary to a UBE3A nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “folly complementary” can mean that each nucleobase of an antisense oligomer is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
[0414] The location of a non-complementary nucleobase can be at the 5 ’ end or 3 ’ end of the antisense oligomer. Alternatively, the non-complementary nucleobase or nucleobases can be at an internal position of the antisense oligomer. When two or more non-complementary nucleobases are present, they can be contiguous (i.e., linked) or non-contiguous. In one embodiment, a non- complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
[0415] In certain embodiments, antisense oligomers provided herein that are, or are up to 1 1, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, or specified portion thereof.
[0416] In certain embodiments, antisense oligomers provided herein that are, or are up to 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, or specified portion thereof.
[0417] The agents (e g., antisense oligomers) provided herein can also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” can refer to a defined number of contiguous i.e., linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an antisense oligomer. Incertain embodiments, the agents (e.g., antisense oligomers) are complementary to at least an 8- nucleobase portion of a target segment. In certain embodiments, the agents (e.g., antisense oligomers) are complementary to at least a 9-nucleobase portion of a target segment. In certain embodiments, the agents (e.g., antisense oligomers) are complementary to at least a 10-nucleobase portion of a target segment. In certain embodiments, the agents (e.g., antisense oligomers) are complementary to at least an 11-nucleobase portion of a target segment. In certain embodiments, the agents (e.g., antisense oligomers) are complementary to at least a 12-nucleobase portion of a target segment. In certain embodiments, the agents (e.g., antisense oligomers) are complementary to at least a 13-nucleobase portion of a target segment. In certain embodiments, the agents (e.g., antisense oligomers) are complementary to at least a 14-nucleobase portion of a target segment. In certain embodiments, the agents (e.g., antisense oligomers) are complementary to at least a 15-nucleobase portion of a target segment. Also contemplated are antisense oligomers that are complementary to at least a 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
[0418] The agents (e.g., antisense oligomers) provided herein can also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or portion thereof. As used herein, an antisense oligomer is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, an RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense oligomers described herein as well as oligomers having non-identical bases relative to the antisense oligomers provided herein also are contemplated. The non-identical bases can be adjacent to each other or dispersed throughout the antisense oligomer. Percent identity of an antisense oligomer is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
[0419] In certain embodiments, the agents (e.g., antisense oligomers), or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more of the agents (e.g., antisense oligomers) or SEQ ID NOs, or a portion thereof, disclosed herein.
[0420] In certain embodiments, a portion of the agent (e.g., antisense oligomer) is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 1 1, 12, 13, 14, 15,16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
[0421] In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16,17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.Modifications
[0422] In some embodiments, an antisense oligomer provided herein can have one or more chemical modifications as compared to a naturally occurring nucleotide (or a native form of the antisense oligomer) that has the same or comparable polynucleotide sequence. Modifications to antisense oligomers encompass substitutions or changes to intemucleoside linkages, sugar moieties, or nucleobases. Modified antisense oligomers can be preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
[0423] Chemically modified nucleosides can be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense oligomers that have such chemically modified nucleosides.
[0424] A nucleoside can be a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside can be a heterocyclic base moiety in native form. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2’, 3’, or 5’ hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the intemucleoside linkages of the oligonucleotide.Modified Internucleoside Linkages
[0425] The naturally occurring intemucleoside linkage of RNA and DNA is a 3’ to 5’ phosphodiester linkage. Antisense oligomers provided herein can have one or more modified, i.e., non-naturally occurring, intemucleoside linkages. Antisense oligomers having one or more modified intemucleotide linkages can have desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
[0426] Oligonucleotides having modified intemucleoside linkages can include intemucleoside linkages that retain a phosphoms atom as well as intemucleoside linkages that do not have a phosphoms atom. Representative phosphoms containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates.
[0427] In certain embodiments, antisense oligomers targeted to a UBE3A nucleic acid comprise one or more modified intemucleoside linkages. In certain embodiments, the modified intemucleoside linkages are interspersed throughout the antisense oligomer. In certain embodiments, the modified intemucleoside linkages are phosphorothioate linkages. In certain embodiments, each intemucleoside linkage of an antisense oligomer is a phosphorothioate intemucleoside linkage.Modified Sugar Moieties
[0428] Antisense oligomers provided herein can contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides can impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense oligomers. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties.
[0429] Examples of chemically modified ribofiiranose rings include without limitation, addition of substitute groups (including 5’ and 2’ substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(RI)(R2) (R, Ri and R2 are each independently H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2 ’-F-5’ -methyl substituted nucleoside (see PCT International Application WO 2008 / 101157 for other disclosed 5’,2’-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2 ’-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5’- substitution of a BNA (see PCT International Application WO 2007 / 134181 wherein LNA is substituted with, for example, a 5’-methyl or a 5’-vinyl group).
[0430] Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5’-vinyl, 5’-methyl (R or S), 4’-S, 2’-F, 2’-OCH3, 2’-OCH2CH3, 2’- OCH2CH2F, 2’-NMA, and 2’-O(CH2)2OCH3substituent groups. The substituent at the 2’ position can also be selected from allyl, amino, azido, thio, O-allyl, O-C1-C10 alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-O-N(Rm)(Rn), O-CH2-C(=O)-N(Rm)(Rn), and O-CH2-C(=O)-N(R / )-(CH2)2-N(Rm)(Rn), where each R / Rmand Rnis, independently, H or substituted or unsubstituted C1-C10 alkyl.
[0431] As used herein, “bicyclic nucleosides” can refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include, without limitation, nucleosides comprising a bridge between the 4’ and the 2’ ribosyl ring atoms. In certain embodiments, antisense oligomers provided herein include one or more bicyclic nucleosides comprising a 4’ to 2’ bridge. Examples of such 4’ to 2’ bridged bicyclic nucleosides, include, but are not limited to, one of those described in U.S. Patent Nos. 7,399,845, 8,278,283, U.S. Patent Application 7,696,345, 7,427,672, 8,278,426, 6,268,490; 6,525, 191; 6,670,461 ; 6,770,748; 6,794,499; 7,034, 133; 7,053,207, 7,399,845, 7,547,684, 7,741,457, and 7,696,345; U.S. Patent Nos.; U.S. Patent Publication No. US2008-0039618; and Chattopadhyaya et al., J. Org. Chem., 2009, 74, 1 18-134); Singh etal., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A. , 2000, 97, 5633-5638; Kumar etal., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc, 2007, 129(26) 8362-8379; Elayadi et al., Curr. Opinion Invest Drugs, 2001, 2, 558-561 ;Braasch et al., Chem. Biol, 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Then, 2001, 3, 239-243. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including, for example, a-L-ribofuranose and p-D-ribofuranose (see PCT internationalapplication PCT / DK98 / 00393, published on March 25, 1999 as WO 99 / 14226). In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, described in US Patent No. 11,129,844.
[0432] The synthesis and preparation of the methyleneoxy (4’-CH2-O-2’) BNA monomers adenine, cytosine, guanine, 5 -methylcytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630).
[0433] As used herein, “4’-2’ bicyclic nucleoside” or “4’ to 2’ bicyclic nucleoside” can refer to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2’ carbon atom and the 4’ carbon atom of the sugar ring.
[0434] As used herein, “monocyclic nucleosides” can refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside is modified or substituted at any position.
[0435] As used herein, “2’-modified sugar” can mean a furanosyl sugar modified at the 2’ position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2’ modifications are selected from substituents including, but not limited to: O[(CH2)nO]mCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nF, O(CH2)nONH2, OCH2C(=O)N(H)CH3and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other 2’- substituent groups can also be selected from: C1-C12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, F, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense oligomer, and other substituents having similar properties. In certain embodiments, modified nucleosides comprise a 2’- MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2’-M0E substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2’- O- methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2’-M0E substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995 , 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
[0436] As used herein, “2’-NMA” can mean a -O-CH2-C(=O)-NH-CH3group in place of the 2’-OH group of a ribosyl sugar moiety. A “2’-NMA sugar moiety” or “2’-NMA moiety” is a sugar moiety with a 2’-O-CH2-C(=O)-NH-CH3group in place of the 2’-OH group of a nbosyl sugar moiety. Unlessotherwise indicated, a 2’-NMA sugar moiety is in the -D configuration. “NMA” can mean O-N- methyl acetamide.
[0437] As used herein, “2’-NMA nucleoside” can mean a nucleoside comprising a 2’-NMA sugar moiety.
[0438] As used herein, “2’-F” can refer to a nucleoside comprising a sugar comprising a fluoro group at the 2’ position.
[0439] As used herein, “2’-OMe” or “2’-OCH3” or “2’-O-methyl” each can refer to a nucleoside comprising a sugar comprising an -OCH3 group at the 2’ position of the sugar ring.
[0440] As used herein, “MOE” or “2’-M0E” or “2 -OCEI2CEI2OCH3’’ or “2’-O-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a -OCH2CH2OCH3 group at the 2’ position of the sugar ring.
[0441] In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA). In certain embodiments, an oligonucleotide comprises a mix of one or more ribonucleosides (RNA) and deoxyribonucleosides (DNA).
[0442] Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense oligomers (see, for example, review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity.
[0443] Methods for the preparations of modified sugars are well known to those skilled in the art.
[0444] In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
[0445] In certain embodiments, antisense oligomers comprise one or more nucleosides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2’-M0E. In certain embodiments, the 2’ -MOE modified nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4’-CH(CH3)-O-2’) bridging group. In certain embodiments, the (4’- CH(CH3)-O-2’) modified nucleosides are arranged throughout the wings of a gapmer motif.
[0446] “5 ’-methylcytosine” can mean a cytosine modified with a methyl group attached to the 5’ position. A 5 ’-methylcytosine is a modified nucleobase.
[0447] “5 ’ -methyluracil” can mean a uracil modified with a methyl group attached to the 5 ’ position. A 5 ’-methyluracil is a modified nucleobase.
[0448] “5 ’ -methylthymine” can mean a thymine modified with a methyl group attached to the 5 ’ position. A 5 ’-methylthymine is a modified nucleobase.
[0449] In some cases, antisense oligomers provided herein comprise ’-methylcytosine, 5’- methyluracil, 5 ’-methylthymine, or a combination thereof. In some cases, each cytosine in the antisense oligomer is methylated, i.e., having a methyl group attached to the 5’ position. In somecases, each uracil in the antisense oligomer is methylated, i.e., having a methyl group attached to the 5’ position. In some cases, the antisense oligomer has 1, 2, 3, 4, 5, 6, 7, 8, or more 5 ’-methylcytosine. In some cases, the antisense oligomer has 1, 2, 3, 4, 5, 6, 7, 8, or more 5 ’-methyluracil. In some cases, the antisense oligomer has both methylcytosine and methyluracil. In some cases, each cytosine ribonucleoside in the antisense oligomer is methylated, i.e., having a methyl group attached to the 5 ’ position. In some cases, each cytosine deoxyribonucleoside in the antisense oligomer is unmethylated, i.e., lacking a methyl group attached to the 5’ position. In some cases, in the antisense oligomer, each cytosine ribonucleoside is methylated and each cytosine deoxyribonucleoside is unmethylated.Pharmaceutical Compositions and Methods of Treatment
[0450] In some aspects, provided herein are pharmaceutical compositions comprising an agent of the present disclosure, e.g., an antisense oligomer, or a vector encoding the agent.
[0451] In some cases, the compositions and methods provided herein relate to a vector encoding an agent provided herein. In some cases, the vector comprises a viral vector encoding the agent. In some cases, the viral vector comprises an adenoviral vector, adeno-associated viral (AAV) vector, lentiviral vector, Herpes Simplex Virus (HSV) viral vector, or retroviral vector.
[0452] Pharmaceutical compositions or formulations comprising the agent, e.g, antisense oligomer, or a vector encoding the agent, of the described compositions and for use in any of the described methods can be prepared according to conventional techniques well known in the pharmaceutical industry and described in the published literature. In some embodiments, a pharmaceutical composition or formulation for treating a subject comprises an effective amount of any antisense oligomer as described herein, or a pharmaceutically acceptable salt, solvate, hydrate or ester thereof. The pharmaceutical formulation comprising an antisense oligomer may further comprise a pharmaceutically acceptable excipient, diluent or carrier.
[0453] Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.
[0454] The terms “pharmaceutically acceptable excipient,” “pharmaceutically acceptable carrier,” and “therapeutically inert excipient” can be used interchangeably and denote any pharmaceutically acceptable ingredient in a pharmaceutical composition having no therapeutic activity and being nontoxic to the subject administered, such as disintegrators, binders, fillers, solvents, buffers, tonicity agents, stabilizers, antioxidants, surfactants, carriers, diluents, excipients, preservatives or lubricants used in formulating pharmaceutical products.
[0455] In some embodiments, the compositions are formulated as suspensions in aqueous, nonaqueous or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension may also contain stabilizers. In some embodiments, a pharmaceuticalformulation or composition of the present invention includes, but is not limited to, a solution, emulsion, microemulsion, foam or liposome-containing formulation (e.g., cationic or noncationic liposomes).
[0456] In some embodiments, a pharmaceutical composition or formulation described herein may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients as appropriate. In some embodiments, liposomes also include sterically stabilized liposomes, e.g., liposomes comprising one or more specialized lipids. These specialized lipids result in liposomes with enhanced circulation lifetimes. In some embodiments, a sterically stabilized liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. In some embodiments, a surfactant is included in the pharmaceutical formulation or compositions. The use of surfactants in drug products, formulations and emulsions is well known in the art. In some embodiments, the present invention employs a penetration enhancer to effect the efficient delivery of the compound, e.g., oligomer, e.g., to aid diffusion across cell membranes and / or enhance the permeability of a lipophilic drug. In some embodiments, the penetration enhancers are a surfactant, fatty acid, bile salt, chelating agent, or non-chelating nonsurfactant.
[0457] In some embodiments, the pharmaceutical compositions or formulations are prepared with carriers that will protect the components of the composition against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
[0458] Agents (e.g., antisense oligomers) or vectors provided herein can be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. An agent (e.g., antisense oligomer) targeted to a UBE3A nucleic acid can be utilized in pharmaceutical compositions by combining the agent with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent can include phosphate-buffered saline (PBS), artificial cerebrospinal fluid (aCSF), physiological saline, or any other suitable solutions.
[0459] Pharmaceutically acceptable salts are suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, etc., and are commensurate with a reasonable benefit / risk ratio. (See, e.g., S. M. Berge, etal., J. Pharmaceutical Sciences, 66: 1- 19 (1977), incorporated herein by reference for this purpose. The salts can be prepared in situ during the final isolation and purification of the compounds, or separately by reacting the free base form with a suitable organic acid. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other documentedmethodologies such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3 -phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate and aryl sulfonate.
[0460] In some embodiments, the compositions are formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. In embodiments, the compositions are formulated as suspensions in aqueous, nonaqueous or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension may also contain stabilizers. In embodiments, a pharmaceutical formulation or composition of the present disclosure includes, but is not limited to, a solution, emulsion, microemulsion, foam or liposome-containmg formulation (e.g., cationic or noncationic liposomes).
[0461] In some embodiments, the pharmaceutical formulation comprises multiple agents (e.g., antisense oligomers). In embodiments, the agent (e.g., antisense oligomer) or a vector encoding the agent is administered in combination with another drug or therapeutic agent.
[0462] Pharmaceutical compositions comprising antisense oligomers can encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense oligomers, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
[0463] A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense oligomer which are cleaved by endogenous nucleases within the body, to form the active antisense oligomer.
[0464] Antisense oligomers disclosed herein can be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligomers. Conjugate groups can include cholesterol moieties and lipid moieties. Additionalconjugate groups can include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
[0465] Antisense oligomers of the present disclosure can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense oligomers to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications can protect the antisense oligomer having terminal nucleic acid from exonuclease degradation and can help in delivery and / or localization within a cell. The cap can be present at the 5’-terminus (5’-cap), or at the 3’-terminus (3’-cap), or can be present on both termini. Cap structures can include, for example, inverted deoxy abasic caps. Further 3’ and 5 ’-stabilizing groups that can be used to cap one or both ends of an antisense oligomer to impart nuclease stability can include those disclosed in WO 03 / 004602 published on January 16, 2003.
[0466] In some embodiments, the antisense oligomers are linked or conjugated with agents that provide desirable pharmaceutical or pharmacodynamic properties. In embodiments, the antisense oligomer is coupled to a substance, known in the art to promote penetration or transport across the blood-brain barrier, e.g., an antibody to the transferrin receptor. In embodiments, the antisense oligonucleotide is linked with a viral vector, e.g., to render the antisense oligomer more effective or increase transport across the blood-brain barrier. In embodiments, osmotic blood brain barrier disruption is assisted by infusion of sugars, e.g, meso erythritol, xylitol, D(+) galactose, D(+) lactose, D(+) xylose, dulcitol, myo-inositol, L(-) fructose, D(-) mannitol, D(+) glucose, D(+) arabinose, D(-) arabinose, cellobiose, D(+) maltose, D(+) raffinose, L(+) rhamnose, D(+) melibiose, D(-) ribose, adonitol, D(+) arabitol, L(-) arabitol, D(+) fucose, L(-) fucose, D(-) lyxose, L(+) lyxose, and L(-) lyxose, or amino acids, e.g., glutamine, lysine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glycine, histidine, leucine, methionine, phenylalanine, proline, serine, threonine, tyrosine, valine, and taurine. Methods and materials for enhancing blood brain barrier penetration are described, e.g., in U.S. Pat. Nos. 9,193,969, 4,866,042, 6,294,520, and 6,936,589, each incorporated herein by reference.Routes of Administration
[0467] Suitable routes for administration of agents e.g., antisense oligomers) or a vector encoding the agent of the present disclosure can vary depending on cell type to which delivery of the agents or the vector is desired. The agent or vector encoding the agent of the present disclosure can be administered to patients parenterally, for example, by intrathecal injection, intracerebroventricular injection, intracranial injection, intra cistema magna injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, or intravenous injection. In some embodiments, the agent or vector encoding the agent of the present disclosure is administered intracranially. In some embodiments, the agent or vector encoding the agent of the present disclosure is administered intracerebroventricularly. In other embodiments, the agent or vector encoding the agent of the present disclosure is administered intrathecally.
[0468] In embodiments, the antisense oligomer is administered with one or more agents capable of promoting penetration of the subject antisense oligomer across the blood-brain barrier by any method known in the art. For example, delivery of agents by administration of an adenovirus vector to motor neurons in muscle tissue is described in U.S. Pat. No. 6,632,427, incorporated herein by reference. Delivery of vectors directly to the brain, e.g., the striatum, the thalamus, the hippocampus, or the substantia nigra, is described, e.g., in U.S. Pat. No. 6,756,523, incorporated herein by reference.
[0469] In some embodiments, the method comprises administering the pharmaceutical composition comprising an agent or a vector encoding the agent described herein as a bolus injection. In some embodiments, the method comprises administering the pharmaceutical composition as a bolus injection over 1 to 180 minutes, 175 minutes, 1 to 170 minutes, 1 to 165 minutes, 1 to 160 minutes, 1 to 155 minutes, 1 to 150 minutes, 1 to 145 minutes, 1 to 140 minutes, 1 to 135 minutes, 1 to 130 minutes, 1 to 125 minutes, 1 to 120 minutes, 1 to 115 minutes, 1 to 110 minutes, 1 to 105 minutes, 1 to 100 minutes, 1 to 95 minutes, 1 to 90 minutes, 1 to 85 minutes, 1 to 80 minutes, 1 to 75 minutes, 1 to 70 minutes, 1 to 65 minutes, 1 to 60 minutes, 1 to 55 minutes, 1 to 50 minutes, 1 to 45 minutes, 1 to 40 minutes, 1 to 35 minutes, 1 to 30 minutes, 1 to 25 minutes, 1 to 20 minutes, 1 to 15 minutes, 1 to 10 minutes, 1 to 5 minutes, or 1 to 3 minutes. In some embodiments, the method comprises administering the pharmaceutical composition as a bolus injection using a spinal anesthesia needle.Dosing Regimen
[0470] The duration of a therapy using the methods described herein can continue for as long as medically indicated or until a desired therapeutic effect (e.g., those described herein) is achieved. In certain embodiments, the administration of the vaccine composition described herein is continued for about 1 month, 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 2 years, 3 years, 4 years, 5 years, 10 years, 20 years, or for a period of years up to the lifetime of a subject in need thereof.
[0471] Appropriate dosing regimens for a given composition can comprise a single administration or multiple doses. Subsequent doses may be given repeatedly at time periods, for example, about two weeks or greater up through the entirety of a subject's life, e.g., to provide a sustained preventative effect. Subsequent doses can be spaced, for example, about two weeks, about three weeks, about four weeks, about one month, about two months, about three months, about four months, about five months, about six months, about seven months, about eight months, about nine months, about ten months, about eleven months, or about one year after a primary administration.
[0472] In certain embodiments, an antisense oligomer targeted to a UBE3A nucleic acid as described herein is administered a therapeutically effective dose to a subject in need thereof. In some embodiments, a therapeutically effective dose comprises the antisense oligomer at an amount of about 1 pg to about 5 pg, about 1 pg to about 7 pg, about 1 pg to about 10 pg, about 1 pg to about 12 pg, about 1 pg to about 15 pg, about 1 pg to about 17 pg, about 1 pg to about 20 pg, about 1 pg to about 22 pg, about 1 pg to about 25 pg, about 1 pg to about 27 pg, about 1 pg to about 30 pg, about 5 pg to about 7 pg, about 5 pg to about 10 pg, about 5 pg to about 12 pg, about 5 pg to about 15 pg, about 5pg to about 17 pg. about 5 pg to about 20 pg, about 5 pg to about 22 pg, about 5 pg to about 25 pg, about 5 pg to about 27 pg, about 5 pg to about 30 pg, about 7 pg to about 10 pg, about 7 pg to about 12 pg, about 7 pg to about 15 pg, about 7 pg to about 17 pg, about 7 pg to about 20 pg, about 7 pg to about 22 pg, about 7 pg to about 25 pg, about 7 pg to about 27 pg, about 7 pg to about 30 pg, about 10 pg to about 12 pg, about 10 pg to about 15 pg, about 10 pg to about 17 pg, about 10 pg to about 20 pg, about 10 pg to about 22 pg, about 10 pg to about 25 pg, about 10 pg to about 27 pg, about 10 pg to about 30 pg, about 12 pg to about 15 pg, about 12 pg to about 17 pg, about 12 pg to about 20 pg, about 12 pg to about 22 pg, about 12 pg to about 25 pg, about 12 pg to about 27 pg, about 12 pg to about 30 pg, about 15 pg to about 17 pg, about 15 pg to about 20 pg, about 15 pg to about 22 pg, about 15 pg to about 25 pg, about 15 pg to about 27 pg, about 15 pg to about 30 pg, about 17 pg to about 20 pg, about 17 pg to about 22 pg, about 17 pg to about 25 pg, about 17 pg to about 27 pg, about 17 pg to about 30 pg, about 20 pg to about 22 pg, about 20 pg to about 25 pg, about 20 pg to about 27 pg, about 20 pg to about 30 pg, about 22 pg to about 25 pg, about 22 pg to about 27 pg, about 22 pg to about 30 pg, about 25 pg to about 27 pg, about 25 pg to about 30 pg, or about 27 pg to about 30 pg. In some embodiments, a therapeutically effective dose comprises the antisense oligomer at an amount of about 1 pg to about 2 pg, about 1 pg to about 3 pg, about 1 pg to about 4 pg, about 1 pg to about 5 pg, about 1 pg to about 6 pg, about 1 pg to about 7 pg, about 1 pg to about 8 pg, about 1 pg to about 9 pg, about 1 pg to about 10 pg, about 1 pg to about 11 pg, about 1 pg to about 12 pg, about 2 pg to about 3 pg, about 2 pg to about 4 pg, about 2 pg to about 5 pg, about 2 pg to about 6 pg, about 2 pg to about 7 pg, about 2 pg to about 8 pg, about 2 pg to about 9 pg, about 2 pg to about 10 pg, about 2 pg to about 11 pg, about 2 pg to about 12 pg, about 3 pg to about 4 pg, about 3 pg to about 5 pg, about 3 pg to about 6 pg, about 3 pg to about 7 pg, about 3 pg to about 8 pg, about 3 pg to about 9 pg, about 3 pg to about 10 pg, about 3 pg to about 11 pg, about 3 pg to about 12 pg, about 4 pg to about 5 pg, about 4 pg to about 6 pg, about 4 pg to about 7 pg, about 4 pg to about 8 pg, about 4 pg to about 9 pg, about 4 pg to about 10 pg, about 4 pg to about 11 pg, about 4 pg to about 12 pg, about 5 pg to about 6 pg, about 5 pg to about 7 pg, about 5 pg to about 8 pg, about 5 pg to about 9 pg, about 5 pg to about 10 pg, about 5 pg to about 11 pg, about 5 pg to about 12 pg, about 6 pg to about 7 pg, about 6 pg to about 8 pg, about 6 pg to about 9 pg, about 6 pg to about 10 pg, about 6 pg to about 11 pg, about 6 pg to about 12 pg, about 7 pg to about 8 pg, about 7 pg to about 9 pg, about 7 pg to about 10 pg, about 7 pg to about 11 pg, about 7 pg to about 12 pg, about 8 pg to about9 pg, about 8 pg to about 10 pg, about 8 pg to about 11 pg, about 8 pg to about 12 pg, about 9 pg to about 10 pg, about 9 pg to about 11 pg, about 9 pg to about 12 pg, about 10 pg to about 11 pg, about10 pg to about 12 pg, about 11 pg to about 12 pg, about 12 pg to about 13 pg, about 12 pg to about 14 pg, about 12 pg to about 15 pg, about 12 pg to about 16 pg, about 12 pg to about 17 pg, about 12 pg to about 18 pg, about 12 pg to about 19 pg, about 12 pg to about 20 pg, about 12 pg to about 21 pg, about 12 pg to about 22 pg, about 12 pg to about 23 pg, about 13 pg to about 14 pg, about 13 pg to about 15 pg, about 13 pg to about 16 pg, about 13 pg to about 17 pg, about 13 pg to about 18 pg,about 13 tig to about 19 pg, about 13 pig to about 20 pg, about 13 pig to about 21 ig, about 13 pg to about 22 tig, about 13 tig to about 23 tig, about 14 pg to about 15 tig, about 14 pg to about 16 pg, about 14 tig to about 17 pg, about 14 tig to about 18 pg, about 14 pg to about 19 tig, about 14 pg to about 20 pg, about 14 pg to about 21 pg, about 14 pg to about 22 pg, about 14 pg to about 23 pg, about 15 tig to about 16 pg, about 15 tig to about 17 pg, about 15 pg to about 18 tig- about 15 pg to about 19 pg, about 15 fig to about 20 ig, about 15 pg to about 21 fig, about 15 pg to about 22 pig, about 15 tig to about 23 pg, about 16 fig to about 17 pg. about 16 pg to about 18 pg, about 16 pg to about 19 pg, about 16 pg to about 20 pg, about 16 pg to about 21 pg, about 16 pg to about 22 pg, about 16 pg to about 23 pg, about 17 pg to about 18 pg, about 17 pg to about 19 pg, about 17 pg to about 20 pg, about 17 pg to about 21 pg, about 17 pg to about 22 pg, about 17 pg to about 23 pg, about 18 pg to about 19 pg, about 18 pg to about 20 pg, about 18 pg to about 21 pg, about 18 pg to about 22 pg, about 18 pg to about 23 pg, about 19 pg to about 20 pg, about 19 pg to about 21 pg, about 19 pg to about 22 pg, about 19 pg to about 23 pg, about 20 pg to about 21 pg, about 20 pg to about 22 pg, about 20 pg to about 23 pg, about 21 pg to about 22 pg, about 21 pg to about 23 pg, or about 22 pg to about 23 pg, about 23 pg to about 24 pg, about 23 pg to about 25 pg, about 23 pg to about 26 pg, about 23 pg to about 27 pg, about 23 pg to about 28 pg, about 23 pg to about 29 pg, about 23 pg to about 30 pg, about 24 pg to about 25 pg, about 24 pg to about 26 pg, about 24 pg to about 27 pg, about 24 pg to about 28 pg, about 24 pg to about 29 pg, about 24 pg to about 30 pg, about 25 pg to about 26 pg, about 25 pg to about 27 pg, about 25 pg to about 28 pg, about 25 pg to about 29 pg, about 25 pg to about 30 pg, about 26 pg to about 27 pg, about 26 pg to about 28 pg, about 26 pg to about 29 pg, about 26 pg to about 30 pg, about 27 pg to about 28 pg, about 27 pg to about 29 pg, about 27 pg to about 30 pg, about 28 pg to about 29 pg, about 28 pg to about 30 pg, or about 29 pg to about 30 pg. In some embodiments, a therapeutically effective dose comprises the antisense oligomer at an amount of about 5 pg, about 6 pg, about 7 pg, about 8 pg, about 9 pg, about 10 pg, about 11 pg, about 12 pg, about 13 pg, about 14 pg, about 15 pg, about 16 pg, about 17 pg, about 18 pg, about 19 pg, about 20 pg, about 21 pg, about 22 pg, about 23 pg, about 24 pg, about 25 pg, about 26 pg, about 27 pg, about 28 pg, about 29 pg, or about 30 pg. In some embodiments, a therapeutically effective dose comprises the antisense oligomer at a weight of at least about 5 pg, at least about 6 pg, at least about 7 pg, at least about 8 pg, at least about 9 pg, at least about 10 pg, at least about 11 pg, at least about 12 pg, at least about 13 pg, at least about 14 pg, at least about 15 pg, at least about 16 pg, at least about 17 pg, at least about 18 pg, at least about 19 pg, at least about 20 pg, at least about 21 pg, at least about 22 pg, at least about 23 pg, at least about 24 pg, at least about 25 pg, at least about 26 pg, at least about 27 pg, at least about 28 pg, at least about 29 pg, or at least about 30 pg.
[0473] In some embodiments, a therapeutically effective dose of antisense oligomer is suspended in a volume of about 20 pl to about 30 pl, about 20 pl to about 40 pl, about 20 pl to about 50 pl, about 20 pl to about 60 pl, about 20 pl to about 70 pl, about 20 pl to about 80 pl, about 20 pl to about 90 pl,about 20 pl to about 100 pl, about 20 pl to about 110 l, about 20 pl to about 120 pl, about 20 pl to about 130 pl. about 30 JLLI to about 40 pl, about 30 JLLI to about 50 pl, about 30 pl to about 60 pl, about 30 pl to about 70 pl, about 30 pl to about 80 pl, about 30 pl to about 90 pl, about 30 pl to about 100 pl, about 30 pl to about 110 pl, about 30 pl to about 120 pl, about 30 pl to about 130 pl, about 40 pl to about 50 pl, about 40 pl to about 60 pl, about 40 pl to about 70 pl, about 40 pl to about 80 pl, about 40 pl to about 90 pl, about 40 pl to about 100 pl, about 40 pl to about 110 pl, about 40 pl to about 120 pl, about 40 pl to about 130 pl, about 50 pl to about 60 pl, about 50 pl to about 70 pl, about 50 pl to about 80 pl, about 50 pl to about 90 pl, about 50 pl to about 100 pl, about 50 pl to about 110 pl, about 50 pl to about 120 pl, about 50 pl to about 130 pl, about 60 pl to about 70 pl, about 60 pl to about 80 pl, about 60 pl to about 90 pl, about 60 pl to about 100 pl, about 60 pl to about 110 pl, about 60 pl to about 120 pl, about 60 pl to about 130 pl, about 70 pl to about 80 pl, about 70 pl to about 90 pl, about 70 pl to about 100 pl, about 70 pl to about 110 pl, about 70 pl to about 120 pl, about 70 pl to about 130 pl, about 80 pl to about 90 pl, about 80 pl to about 100 pl, about 80 pl to about 110 pl, about 80 pl to about 120 pl, about 80 pl to about 130 pl, about 90 pl to about 100 pl, about 90 pl to about 110 pl, about 90 pl to about 120 pl, about 90 pl to about 130 pl, about 100 pl to about 110 pl, about 100 pl to about 120 pl, about 100 pl to about 130 pl, about 110 pl to about 120 pl, about 110 pl to about 130 pl, about 120 pl to about 130 pl, about 120 pl to about 140 pl, about 120 pl to about 150 pl, about 120 pl to about 200 pl, about 120 pl to about 300 pl, about 120 pl to about 400 pl, about 120 pl to about 500 pl, about 120 pl to about 600 pl, about 120 pl to about 700 pl, about 120 pl to about 800 pl, about 120 pl to about 900 pl, about 130 pl to about 140 pl, about 130 pl to about 150 pl, about 130 pl to about 200 pl, about 130 pl to about 300 pl, about 130 pl to about 400 pl, about 130 pl to about 500 pl, about 130 pl to about 600 pl, about 130 pl to about 700 pl, about 130 pl to about 800 pl, about 130 pl to about 900 pl, about 140 pl to about 150 pl, about 140 pl to about 200 pl, about 140 pl to about 300 pl, about 140 pl to about 400 pl, about 140 pl to about 500 pl, about 140 pl to about 600 pl, about 140 pl to about 700 pl, about 140 pl to about 800 pl, about 140 pl to about 900 pl, about 150 pl to about 200 pl, about 150 pl to about 300 pl, about 150 pl to about 400 pl, about 150 pl to about 500 pl, about 150 pl to about 600 pl, about 150 pl to about 700 pl, about 150 pl to about 800 pl, about 150 pl to about 900 pl, about 200 pl to about 300 pl, about 200 pl to about 400 pl, about 200 pl to about 500 pl, about 200 pl to about 600 pl, about 200 pl to about 700 pl, about 200 pl to about 800 pl, about 200 pl to about 900 pl, about 300 pl to about 400 pl, about 300 pl to about 500 pl, about 300 pl to about 600 pl, about 300 pl to about 700 pl, about 300 pl to about 800 pl, about 300 pl to about 900 pl, about 400 pl to about 500 pl, about 400 pl to about 600 pl, about 400 pl to about 700 pl, about 400 pl to about 800 pl, about 400 pl to about 900 pl, about 500 pl to about 600 pl, about 500 pl to about 700 pl, about 500 pl to about 800 pl, about 500 pl to about 900 pl, about 600 pl to about 700 pl, about 600 pl to about 800 pl, about 600 pl to about 900 pl, about 700 pl to about 800 pl, about 700 pl to about 900 pl, about 800 pl to about 900 pl, or about 900 pl to about 1000 pl. In some embodiments, a therapeuticallyeffective dose of antisense oligomer is suspended in a volume of about 1 ml to about 2 ml, about 1 ml to about 3 ml, about 1 ml to about 4 ml, about 1 ml to about 5 ml, about 1 ml to about 6 ml, about 1 ml to about 7 ml, about 1 ml to about 8 ml, about 1 ml to about 9 ml, about 1 ml to about 10 ml, about 1 ml to about 15 ml, about 1 ml to about 20 ml, about 2 ml to about 3 ml, about 2 ml to about 4 ml, about 2 ml to about 5 ml, about 2 ml to about 6 ml, about 2 ml to about 7 ml, about 2 ml to about 8 ml, about 2 ml to about 9 ml, about 2 ml to about 10 ml, about 2 ml to about 15 ml, about 2 ml to about 20 ml, about 3 ml to about 4 ml, about 3 ml to about 5 ml, about 3 ml to about 6 ml, about 3 ml to about 7 ml, about 3 ml to about 8 ml, about 3 ml to about 9 ml, about 3 ml to about 10 ml, about 3 ml to about 15 ml, about 3 ml to about 20 ml, about 4 ml to about 5 ml, about 4 ml to about 6 ml, about 4 ml to about 7 ml, about 4 ml to about 8 ml, about 4 ml to about 9 ml, about 4 ml to about 10 ml, about 4 ml to about 15 ml, about 4 ml to about 20 ml, about 5 ml to about 6 ml, about 5 ml to about 7 ml, about 5 ml to about 8 ml, about 5 ml to about 9 ml, about 5 ml to about 10 ml, about 5 ml to about 15 ml, about 5 ml to about 20 ml, about 6 ml to about 7 ml, about 6 ml to about 8 ml, about 6 ml to about 9 ml, about 6 ml to about 10 ml, about 6 ml to about 15 ml, about 6 ml to about 20 ml, about 7 ml to about 8 ml, about 7 ml to about 9 ml, about 7 ml to about 10 ml, about 7 ml to about 15 ml, about 7 ml to about 20 ml, about 8 ml to about 9 ml, about 8 ml to about 10 ml, about 8 ml to about 15 ml, about 8 ml to about 20 ml, about 9 ml to about 10 ml, about 9 ml to about 15 ml, about 9 ml to about 20 ml, about 10 ml to about 15 ml, about 10 ml to about 20 ml, about 15 ml to about 20 ml, about 20 ml to about 25 ml, about 20 ml to about 30 ml, about 20 ml to about 35 ml, about 20 ml to about 40 ml, about 20 ml to about 45 ml, about 20 ml to about 50 ml, about 20 ml to about 55 ml, about 20 ml to about 60 ml, about 20 ml to about 65 ml, about 20 ml to about 70 ml, about 20 ml to about 75 ml, about 25 ml to about 30 ml, about 25 ml to about 35 ml, about 25 ml to about 40 ml, about 25 ml to about 45 ml, about 25 ml to about 50 ml, about 25 ml to about 55 ml, about 25 ml to about 60 ml, about 25 ml to about 65 ml, about 25 ml to about 70 ml, about 25 ml to about 75 ml, about 30 ml to about 35 ml, about 30 ml to about 40 ml, about 30 ml to about 45 ml, about 30 ml to about 50 ml, about 30 ml to about 55 ml, about 30 ml to about 60 ml, about 30 ml to about 65 ml, about 30 ml to about 70 ml, about 30 ml to about 75 ml, about 35 ml to about 40 ml, about 35 ml to about 45 ml, about 35 ml to about 50 ml, about 35 ml to about 55 ml, about 35 ml to about 60 ml, about 35 ml to about 65 ml, about 35 ml to about 70 ml, about 35 ml to about 75 ml, about 40 ml to about 45 ml, about 40 ml to about 50 ml, about 40 ml to about 55 ml, about 40 ml to about 60 ml, about 40 ml to about 65 ml, about 40 ml to about 70 ml, about 40 ml to about 75 ml, about 45 ml to about 50 ml, about 45 ml to about 55 ml, about 45 ml to about 60 ml, about 45 ml to about 65 ml, about 45 ml to about 70 ml, about 45 ml to about 75 ml, about 50 ml to about 55 ml, about 50 ml to about 60 ml, about 50 ml to about 65 ml, about 50 ml to about 70 ml, about 50 ml to about 75 ml, about 55 ml to about 60 ml, about 55 ml to about 65 ml, about 55 ml to about 70 ml, about 55 ml to about 75 ml, about 60 ml to about 65 ml, about 60 ml to about 70 ml, about 60 ml to about 75 ml, about 65 ml to about 70 ml, about 65 ml to about 75 ml, about 70 ml to about 75 ml, 75 ml to about80 ml, about 75 ml to about 85 ml, about 75 ml to about 90 ml, about 75 ml to about 95 ml, about 75 ml to about 100 ml, about 80 ml to about 85 ml, about 80 ml to about 90 ml, about 80 ml to about 95 ml, about 80 ml to about 100 ml, about 85 ml to about 90 ml, about 85 ml to about 95 ml, about 85 ml to about 100 ml, about 90 ml to about 95 ml, about 90 ml to about 100 ml, or about 95 ml to about 100 ml. In some embodiments, a therapeutically effective dose of antisense oligomer is suspended in a volume of about 20 pl, about 30 pl, about 40 pl, about 50 pl, about 60 pl, about 70 pl, about 80 pl, about 90 pl, about 100 pl, about 110 pl, about 120 pl, about 130 pl, about 140 pl, about 150 pl, about 200 pl, about 300 pl, about 400 pl, about 500 pl, about 600 pl, about 700 pl, about 800 pl, about 900 pl, about 1 ml, about 1.25 ml, about 1.5 ml, about 1.75 ml, about 2 ml, about 3 ml, about 4 ml, about 5 ml, about 6 ml, about 7 ml, about 8 ml, about 9 ml, about 10 ml, about 15 ml, about 20 ml, about 25 ml, about 30 ml, about 35 ml, about 40 ml, about 45 ml, about 50 ml, about 55 ml, about 60 ml, about 65 ml, about 70 ml, about 75 ml, about 80 ml, about 85 ml, about 90 ml, about 95 ml, or about 100 ml. In some embodiments, the antisense oligomer is suspended in artificial cerebrospinal fluid (aCSF). A pharmaceutically acceptable diluent can include phosphate-buffered saline (PBS), artificial cerebrospinal fluid (aCSF), physiological saline, or any other suitable solutions. In one embodiment, a therapeutically effective dose of antisense oligomer is suspended in a volume of about 40 pl aCSF. In another embodiment, a therapeutically effective dose of antisense oligomer is suspended in a volume of about 50 pl aCSF. In yet another embodiment, a therapeutically effective dose of antisense oligomer is suspended in a volume of about 50 ml aCSF. In one embodiment, the antisense oligomer is suspended in a volume of about 75 ml aCSF.
[0474] The precise dose to be employed in the formulation will also depend on the route of administration and should be decided according to the judgment of a medical practitioner and each subject’s circumstances. Ultimately, a practitioner or physician will decide the amount of the antisense oligomer or composition thereof to administer to particular subjects.Therapeutic Target Populations
[0475] Any of the compositions provided herein can be administered to an individual. “Individual” can be used interchangeably with “subject” or “patient.” An individual can be a mammal, for example, a human or animal such as a non-human primate, a rodent, a rabbit, a rat, a mouse, a horse, a donkey, a goat, a cat, a dog, a cow, a pig, or a sheep. In embodiments, the individual is a human. In embodiments, the individual is a fetus, an embryo, or a child. In some embodiments, the compositions provided herein are administered to a cell ex vivo.
[0476] In some embodiments, the individual has a genetic disease, such as any of the diseases described herein. In some embodiments, the individual is at risk of having a disease, such as any of the diseases described herein. In some embodiments, the individual is at increased risk of having a disease or disorder caused by insufficient amount of a protein or insufficient activity of a protein. If an individual is “at an increased risk” of having a disease or disorder caused insufficient amount of a protein or insufficient activity of a protein, the method involves preventative or prophylactictreatment. For example, an individual may be at an increased risk of having such a disease or disorder because of family history of the disease. Typically, individuals at an increased risk of having such a disease or disorder benefit from prophylactic treatment (e.g., by preventing or delaying the onset or progression of the disease or disorder). In embodiments, a fetus is treated in uiero. e.g., by administering the agent (e.g., antisense oligomer) or a vector encoding the agent to the fetus directly or indirectly (e.g., via the mother).
[0477] In some embodiments, the compositions provided herein are administered to an individual as a method of treating a disease or disorder. In certain embodiments, the individual has a neurological disorder. In some cases, the individual has a disease or disorder associated with excessive expression level or activity level of UBE3 A protein. In some cases, the disease or disorder the composition provided herein is applicable to relates to duplication, overexpression, or a gain-of-function mutation, of a UBE3A gene, for instance, a duplication of chromosome 15ql 1 ,2-ql3.1, Dupl5q syndrome.
[0478] Dupl5q syndrome is one of the most common genetic variants associated with autism spectrum disorder (ASD), which is associated with duplication of chromosome 15q 11.2-ql3.1. This chromosomal region includes the imprinted Prader-Willi / Angelman syndrome critical region (PWACR), ubiquitin protein ligase E3A (UBE3A), small nuclear ribonucleoprotein polypeptide N (SNRPN), and three GABAA receptor genes (GABRB3, GABRA5, and GABRG3). Dupl5q syndrome can include two primary types of duplications of 15q 11.2-13.1: (1) an isodicentric chromosome 15 (idic( 15)) that results in two additional maternally derived copies on a supernumerary chromosome that includes 15p and the proximal region of 15q 11, most commonly leading to four copies of the region, or (2) an interstitial 15q duplication in which one extra copy of the 15q 11.2- q 13.1 region occurs on the same chromosome arm, typically resulting in three copies of the region, and has an overall milder phenotype. Duplication of 15ql l.2-ql3.1 confers a strong risk for autism spectrum disorder, epilepsy, and intellectual disability in the patients. Studies have shown that patients with Dupl5q syndrome can exhibit a number of symptoms, including certain behavior profile, such as relative weakness in the areas of motor skills, facial expression, social smile, and reciprocal social interaction. Patients with Dupl5q syndrome can also present a distinctive electroencephalography (EEG) signature in the form of high amplitude spontaneous beta frequency (12-30 Hz) oscillations.
[0479] In certain embodiments, pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A are used for the preparation of a medicament for treating a patient suffering or susceptible to a disorder including Dupl5q syndrome.
[0480] In some embodiments, the human subject is from about 6 months to about 1 year old, from about 1 to about 18, from about 2 to about 18, from about 3 to about 18, from about 4 to about 18, from about 5 to about 18, from about 6 to about 18, from about 7 to about 18, from about 8 to about 18, from about 9 to about 18, from about 10 to about 18, from about 11 to about 18, from about 12 to about 18, from about 13 to about 18, from about 14 to about 18, from about 15 to about 18, fromabout 16 to about 18, or from about 17 to about 18 years old. In some embodiments, the human subject is a human from about 1 to about 17, from about 1 to about 16, from about 1 to about 15, from about 1 to about 14, from about 1 to about 13, from about 1 to about 12, from about 1 to about 11, from about 1 to about 10, from about 1 to about 9, from about 1 to about 8, from about 1 to about 7, from about 1 to about 6, from about 1 to about 5, from about 1 to about 4, from about 1 to about 3, or from about 1 to about 2 years old. In some embodiments, the human subject is less than a year old or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 years old. In one nonlimiting embodiment, the human subject is from 2 to 12 years old. In another embodiment, the human subject is from 13 to 18 years old. In an embodiment, the human subject is at least 13 years old.Therapeutic Effects
[0481] In some cases, antisense oligomers provided herein have an intermediate level of efficiency in reducing the level of UBE3A transcript in cells, e.g, the antisense oligomer, when provided at a maximum dosing level (maximum concentration when delivered in vitro, maximum dose when in vivo, without causing significant adverse effects to the cells or the subject), can reduce UBE3A transcript level by at most 75%, at most 70%, at most 65%, at most 60%, at most 55%, at most 50%, at most 45%, at most 40%, at most 35%, at most 30%, at most 20%, or about 25% to about 75%, about 30% to about 70%, about 35% to about 65%, about 40% to about 60%, or about 45% to about 55%. Without wishing to be bound by a certain theory, antisense oligomers provided herein that have an intermediate level of UBE3A knockdown efficiency can have desirable therapeutic applications. Intermediate level of knockdown efficiency of an antisense oligomer can be an indication that the antisense oligomer targets sequences that are not in all of UBE3A transcripts, that are not accessible to the antisense oligomer for binding at a given moment in time, or both. For instance, an antisense oligomer provided herein that can achieve about 50% maximal UBE3A knockdown efficiency in a cell can be targeting a sequence that is only present in 50% of UBE3A transcripts in the cell. Alternatively, or additionally, it can be because half of the time that the target site of the antisense oligomer on the UBE3A transcript is occupied by another protein complex or otherwise physically inaccessible to the antisense oligomer. Because abnormally reduced level of UBE3A protein can also lead to pathological conditions, proper dosing of antisense oligomer that reduces UBE3A transcripts can be desired for therapeutic applications without causing adverse effects by excessively reducing the level of UBE3A transcripts. With an antisense oligomer provided herein that has an intermediate level of knockdown efficiency, there can be a ceiling to the amount of UBE3A knockdown by the antisense oligomer. Such a ceiling to the knockdown amount of UBE3A can thus create a safety buffer that prevents the antisense oligomer from excessively reducing UBE3A transcripts when administered to a subject that is in need of reducing UBE3A level, for instance, a subject that has duplication, overexpression, or a gain-of-function mutation, of UBE3A gene, or increased activity or expression level of UBE3 A protein.
[0482] In some cases, a subject may express UBE3A transcript levels that exceed normal UBE3A transcript levels by at least about 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%. In some embodiments, administration to a subject of antisense oligomers provided herein reduces UBE3A transcript levels in the subject to clinically normal levels. In some embodiments, administration to a subject of antisense oligomers provided herein reduces UBE3A transcript levels in the subject by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%. In one embodiment, administration to a subject of antisense oligomers provided herein reduces UBE3A transcript levels in the subject by at least about 120%. In another embodiment, administration to a subject of antisense oligomers provided herein reduces UBE3A transcript levels in the subject by at least about 100%. In another embodiment, administration to a subject of antisense oligomers provided herein reduces UBE3A transcript levels in the subject by at least about 70%. In another embodiment, administration to a subject of antisense oligomers provided herein reduces UBE3A transcript levels in the subject by at least about 50%. In another embodiment, administration to a subject of antisense oligomers provided herein reduces UBE3A transcript levels in the subject by at least about 20%.
[0483] In certain embodiments, provided herein are methods for prophylactically reducing UBE3A expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an agent (e.g., an antisense oligomer), or a vector encoding the agent, which is targeted to a UBE3A nucleic acid. In some embodiments, the level of UBE3A expression in a subject in need thereof is reduced to clinically normal levels of UBE3 A expression.
[0484] In one embodiment, administration of a therapeutically effective amount of an antisense oligomer targeted to a UBE3A nucleic acid is accompanied by monitoring of UBE3 A levels in an individual, to determine an individual’s response to administration of the antisense oligomer. An individual’s response to administration of the antisense oligomer can be used by a physician to determine the amount and duration of therapeutic intervention.
[0485] In certain embodiments, administration of an antisense oligomer targeted to a UBE3A nucleic acid results in reduction of the processed mRNA encoding the UBE3A protein (e.g., UBE3A mRNA) and or protein expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, or a range defined by any two of these values.
[0486] In some embodiments, the level of the processed mRNA encoding the UBE3A protein (e.g., UBE3A mRNA) in the cell contacted with the agent or the vector is decreased by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same cell not contacted with the agent or the vector.
[0487] In some embodiments, the level of the processed mRNA encoding the UBE3A protein (e.g., UBE3A mRNA) in the cell contacted with the agent or the vector is decreased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%, as compared to an otherwise same cell not contacted with the agent or the vector.
[0488] In some cases, the method and composition provided herein reduces a level of the UBE3A protein in the cell. In some embodiments, the level of the UBE3A protein in the cell contacted with the agent or the vector is decreased by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, about 95% to about 99%, or about 99% to about 100% as compared to an otherwise same cell not contacted with the agent or the vector. In some cases, the level of the UBE3A protein in the cell contacted with the agent or the vector is decreased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, atleast about 99%, or about 100% as compared to an otherwise same cell not contacted with the agent or the vector.
[0489] In some aspects, administration of an antisense oligomer provided herein to a subject in need thereof reduces the likelihood of developing the disease or condition by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, as compared to a subject not administered the antisense oligomer by reducing expression of a UBE3A protein in at least a portion of the central nervous system of the subject. In some embodiments, the disease or condition is a disease or condition resulting from levels of UBE3A exceeding clinically normal levels. In some embodiments, the disease or condition is Dupl5q syndrome. In some embodiments, administration to a subject of an antisense oligomer provided herein reduces UBE3A transcript levels in the subject by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, whereby the likelihood of developing one or more symptoms of and / or behaviors resulting from Dupl5q syndrome is reduced in the subject, as compared to a subject not administered the antisense oligomer. In some embodiments, administration to a subject of antisense oligomers provided herein reduces UBE3A transcript levels in the subject in need thereof with Dupl5q syndrome by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, whereby the likelihood of developing Dupl5q syndrome is reduced, as compared to a subject not administered the antisense oligomer.
[0490] In some aspects, administration of an antisense oligomer provided herein to a subject in need thereof with a disease or condition improves one or more symptoms of the disease or condition by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, as compared to a subject not administered the antisense oligomer. In some embodiments, the disease or condition is a disease or condition resulting from levels of UBE3A exceeding clinically normal levels. In some embodiments, the disease or condition is Dupl5q syndrome. In some embodiments, administration to a subject of an antisense oligomer provided herein reduces UBE3A transcript levels in the subject by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, whereby one or more symptoms of and / or behaviors resulting from Dupl5q syndrome is improved in the subject, as compared to a subject not administered the antisense oligomer. In some embodiments, administration to a subject of antisense oligomers provided herein reduces UBE3A transcript levels in the subject in need thereof with Dupl5q syndrome by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, whereby Dupl5q syndrome is treated, as compared to a subject not administered the antisense oligomer.
[0491] In certain embodiments, administration to a subject of antisense oligomers provided herein reduces UBE3A transcript levels in a subject in need thereof with Du l5q syndrome by at least about1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%.60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, whereby the severity of one or more symptoms of Dupl5q syndrome in a subject is reduced by at least about 1%, 2%, 3%, 4%, 5%, 6%,7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%.85%, 90%, 95%, 99%, or 100%, as compared to a subject not administered the antisense oligomer. In some embodiments, a symptom of Dupl5q syndrome comprises motor delays, intellectual disability, delayed speech and language development, seizures, behavioral difficulties (e.g., hyperactivity, emotional instability, anxiety, frustration, tantrums), ear infections, hearing loss, epilepsy, higher probability of sudden unexpected death in epilepsy (SUDEP), low muscle tone (e.g., hypotonia), ataxic gate (e.g., wide-based, clumsy gate), delays in development of motor skills (e.g., sitting or walking), difficulties with social interaction, and any combination thereof.
[0492] In certain embodiments, administration of an antisense oligomer targeted to a UBE3A nucleic acid results in improved cognitive function in a subject in need thereof. In certain embodiments, administration of a UBE3A antisense oligomer improves cognitive function in a subject in need thereof by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%,69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%.86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or a range defined by any two of these values, as compared to a subject not administered the antisense oligomer. In some embodiments, administration of a pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A improves speech and language development in a subject in need thereof by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%.45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, or a range defined by any two of these values, as compared to a subject not administered the antisense oligomer. In some embodiments, administration of a pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A reduces the severity of behavioral difficulties in a subject in need thereof by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%,50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, or a range defined by any two of these values. In some embodiments, administration of a pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A reduces the severity of emotional instability in a subject in need thereof by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%,25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%. or a range defined by any two of these values, as compared to a subject not administered the antisense oligomer.
[0493] In certain embodiments, administration of an antisense oligomer targeted to a UBE3A nucleic acid results in improved motor function in a subject in need thereof. In certain embodiments, administration of a UBE3A antisense oligomer improves motor function in a subject need thereof by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%,55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%:72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or a range defined by any two of these values, as compared to a subject not administered the antisense oligomer. In certain embodiments, administration of an antisense oligomer targeted to a UBE3A nucleic acid results in improved motor coordination in an animal. In certain embodiments, administration of a UBE3A antisense oligomer improves motor coordination in a subject need thereof by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 56%, 57%,58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%,75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or a range defined by any two of these values.In some embodiments, administration of a pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A improves muscle tone in a subject in need thereof by at least about 1%,2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, or a range defined by any two of these values. In one nonlimiting embodiment, administration of a pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A reduces the motor delays by at least about 10%. In one nonlimiting embodiment, administration of a pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A improves motor coordination by at least about 10%.
[0494] In certain embodiments, administration of an antisense oligomer targeted to a UBE3A nucleic acid results in improved anxiety in a subject in need thereof. In certain embodiments, administration of a UBE3A antisense oligomer improves anxiety in a subject in need thereof by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 56%,57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%,74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%.91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or a range defined by any two of these values, as compared to a subject not administered the antisense oligomer. In certain embodiments, administration of an antisense oligomer targeted to a UBE3A nucleic acid results in improved social interaction in an animal. In certain embodiments, administration of a UBE3A antisense oligomer improves social interaction in a subject need thereof by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%,8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 56%, 57%, 58%, 59%, 60%, 61%,62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%.79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%,96%, 97%, 98%, 99%, or 100%, or a range defined by any two of these values, as compared to a subject not administered the antisense oligomer. In certain embodiments, administration of an antisense oligomer targeted to a UBE3A nucleic acid results in improved stress tolerance in an animal. In certain embodiments, administration of a UBE3A antisense oligomer improves stress tolerance in a subject need thereof by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%,30%, 35%, 40%, 45%, 50%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%,67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%,84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or a range defined by any two of these values, as compared to a subject not administered the antisense oligomer.
[0495] In certain embodiments, administration of an antisense oligomer targeted to a UBE3A nucleic acid results in reduction of seizures in a subject in need thereof. In certain embodiments, administration of a UBE3A antisense oligomer reduces seizures by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or a range defined by any two of these values, as compared to a subject not administered the antisense oligomer. In one embodiment, administration of a UBE3A antisense oligomer reduces seizures by at least about 10%. In another embodiment, administration of a UBE3A antisense oligomer reduces seizures by at least about 35%. In yet another embodiment, administration of a UBE3A antisense oligomer reduces seizures by at least about 50%. In certain embodiments, administration of an antisense oligomer targeted to a UBE3A nucleic acid results in normalized EEG discharges. In some embodiments, administration of a pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A reduces the frequency of epileptic episodes in a subject by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, or a range defined by any two of these values, as compared to a subject not administered the antisense oligomer. In some embodiments, administration of a pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A reduces the probability of SUDEP in a subject in need thereof by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, or a range defined by any two of these values, as compared to a subject not administered the antisense oligomer. In another nonlimiting embodiment, administration of a pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A reduces susceptibility to seizures by at least about 10%. In another nonlimiting embodiment, administration of a pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A reduces the probability of SUDEP by at least about 10%.
[0496] In certain embodiments, administration of a pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A reduces the frequency of ear infections in a subject in need thereof by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, or a range defined by any two of these values, as compared to a subject not administered the antisense oligomer. In some embodiments, administration of a pharmaceutical compositions comprising an antisense oligomer targeted to UBE3A reduces hearing loss in a subject in need thereof by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, or a range defined by any two of these values, as compared to a subject not administered the antisense oligomer.
[0497] In some embodiments, subjects treated using the methods and compositions are evaluated for improvement in condition using any methods known and described in the art.
[0498] The effects of the agent (e.g., antisense oligomer) provided herein on the level, activity or expression of UBE3A nucleic acids or UBE3A protein can be tested in vitro in a variety of cell types. Illustrative cell types include, but are not limited to, Hela cells, HS02 cells, 293T cells, HepG2 cells, Hep3B cells, and primary hepatocytes.
[0499] In some aspects, provided herein are methods for treatment of cells with agents (e.g., antisense oligomers). Cells can be treated with agents (e.g., antisense oligomers) or a vector encoding the agent when the cells reach approximately 60-80% confluency in culture.
[0500] For instance, the antisense oligomer can be introduced into cultured cells with aid of cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA). Antisense oligomers can be mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligomer and a LIPOFECTIN concentration that may range from 2 to 12 pg / ml per 100 nM antisense oligonucleotide. The antisense oligomer can also be introduced into cultured cells with the aid of LIPOFECTAMINE (Invitrogen, Carlsbad, CA). Antisense oligomer can be mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that may range from 2 to 12 pg / ml per 100 nM antisense oligonucleotide. Another reagent that can be used to introduce antisense oligomers into cultured cells is TURBOFECT (Thermo Scientific, Carlsbad, CA).
[0501] In some cases, antisense oligomers are introduced into cultured cells via electroporation.
[0502] Antisense inhibition of UBE3A nucleic acids can be assessed by measuring UBE3A protein levels or UBE3A mRNA transcript levels. UBE3A mRNA transcript levels can be measured by routine techniques in the art, such as real time PCR. Protein levels of UBE3 A can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistryor fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.In vivo Testing of Antisense Oligomers
[0503] Antisense oligomers, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of UBE3 A and produce phenotypic changes, such as, improved behavior, motor function, cognition, stress tolerance, and social interaction. In certain embodiments, motor function is measured by walking initiation analysis, rotarod, grip strength, pole climb, open field performance, balance beam, hind paw footprint testing in the animal. In certain embodiments, behavior is measured by elevated plus maze and three-chamber social interaction. Testing can be performed in normal animals, or in experimental models. Following a period of treatment with antisense oligonucleotides, RNA can be isolated from CNS tissue or CSF and changes in UBE3A nucleic acid expression can be measured.Exemplary Embodiments[1] A method of reducing expression of a UBE3A protein in a mammalian cell having duplication, overexpression, or a gain-of-function mutation, of a UBE3A gene that encodes the UBE3A protein, the method comprising contacting an agent or a vector encoding the agent to the mammalian cell, wherein the agent reduces a level of a processed mRNA encoding the UBE3A protein in the mammalian cell.[2] The method of paragraph [1], wherein the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleobases of the sequence set forth in any one of SEQ ID NO: 93-120.[3] The method of paragraph [1], wherein the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleobases of each mRNA transcript listed in Table 2.[4] The method of any one of paragraphs [l]-[3], wherein the agent comprises an antisense oligomer.[5] The method of paragraph [4], wherein the agent comprises an antisense oligomer with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.[6] A method of modulating expression of a UBE3A gene encoding a UBE3A protein in a mammalian cell, the method comprising contacting an agent or a vector encoding the agent to the mammalian cell, wherein the agent comprises a polynucleotide sequence that comprises an antisense oligomer with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1- 92.[7] The method of any one of paragraphs [4]-[6], wherein the antisense oligomer comprises a backbone modification, a modified sugar moiety or a combination thereof.[8] The method of any one of paragraphs [4]-[7], wherein the antisense oligomer comprises a phosphorothioate linkage or a phosphorodiamidate linkage.[9] The method of any one of paragraphs [4]-[8], wherein the antisense oligomer comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2’-O-methyl moiety, a 2’-Fluoro moiety, a 2’-O-methoxyethyl moiety, or a 2’-NMA moiety.
[0010] The method of any one of paragraphs [4]-[9], wherein the antisense oligomer comprises at least one modified sugar moiety.
[0011] The method of any one of paragraphs [4] -
[0010] , wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at a 5’ end of the antisense oligomer.
[0012] The method of any one of paragraphs [4]-
[0010] , wherein the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at a 5’ end of the antisense oligomer.
[0013] The method of any one of paragraphs [4]-
[0010] , wherein the antisense oligomer comprises one, two, three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 5’ end of the antisense oligomer.
[0014] The method of any one of paragraphs [4] -
[0013] , wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at a 3’ end of the antisense oligomer.
[0015] The method of any one of paragraphs [4] -
[0013] , wherein the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at a 3’ end of the antisense oligomer.
[0016] The method of any one of paragraphs [4] -
[0013] , wherein the antisense oligomer comprises one, two, three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 3’ end of the antisense oligomer.
[0017] The method of any one of paragraphs [4]-
[0016] , wherein the antisense oligomer comprises three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 5’ end of the antisense oligomer; three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 3’ end of the antisense oligomer; and a phosphorothioate linkage between any two neighboring nucleosides of the antisense oligomer.
[0018] The method of any one of paragraphs [4]-
[0016] , wherein the antisense oligomer comprises: a 5’ region consisting of three, four, five, or six linked nucleosides; a central region consisting of eight, nine, ten, eleven, or twelve linked nucleosides; and a 3’ region consisting of three, four, five, or six linked nucleosides; wherein each of the three, four, five, or six linked nucleosides in the 5’ region and each of three, four, five, or six linked nucleosides in the 3 ’ region comprise a modified sugar moiety, and wherein each of the eight, nine, ten, eleven, or twelve linked nucleosides in the central region is a deoxyribonucleoside.
[0019] The method of any one of paragraphs [4] -
[0018] , wherein the antisense oligomer is from 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases,12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 15 to 50 nucleobases, 15 to 40 nucleobases,15 to 35 nucleobases, 15 to 30 nucleobases, 15 to 25 nucleobases, 15 to 20 nucleobases, 15 to 19 nucleobases, 15 to 18 nucleobases, 15 to 16 nucleobases, 16 to 20 nucleobases, 16 to 19 nucleobases,16 to 18 nucleobases, 17 to 20 nucleobases, 17 to 19 nucleobases, or 18 to 20 nucleobases in length.
[0020] The method of any one of paragraphs [4] -
[0016] , wherein the antisense oligomer is a modified oligonucleotide comprising the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
[0021] The method of any one of paragraphs [4]-
[0016] , wherein the antisense oligomer is a modified oligonucleotide consisting of the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
[0022] The method of any one of paragraphs [1] to [6], wherein the vector comprises a viral vector encoding the agent.
[0023] The method of paragraph
[0022] , wherein the viral vector comprises an adenoviral vector, adeno- associated viral (AAV) vector, lentiviral vector, Herpes Simplex Virus (HSV) viral vector, or retroviral vector.
[0024] The method of any one of paragraphs [4] -
[0023] , wherein the antisense oligomer comprises a sequence with at least 90% sequence identity to the sequence set forth in any one of SEQ ID NO: 1- 92.
[0025] The method of any one of paragraphs [4]-
[0023] , wherein the antisense oligomer comprises a sequence with 100% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0026] The method of any one of paragraphs [4] -
[0023] , wherein the antisense oligomer consists of a sequence with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1- 92.
[0027] The method of any one of paragraphs [4] -
[0023] , wherein the antisense oligomer consists of a sequence with at least 90% sequence identity to the sequence set forth in any one of SEQ ID NO: 1- 92.
[0028] The method of any one of paragraphs [4] -
[0023] , wherein the antisense oligomer consists of a sequence with 100% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0029] The method of any one of paragraphs [6]-
[0028] , wherein the method reduces a level of processed mRNA encoding the UBE3A protein in the mammalian cell.
[0030] The method of any one of paragraphs [l]-[5] or [7]-
[0029] , wherein the level of the processed mRNA encoding the UBE3A protein in the mammalian cell contacted with the agent or the vector is decreased by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40%to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same cell not contacted with the agent or the vector.
[0031] The method of any one of paragraphs
[0001] -[5] or [7] -
[0029] , wherein the level of the processed mRNA encoding the UBE3A protein in the mammalian cell contacted with the agent or the vector is decreased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%, as compared to an otherwise same mammalian cell not contacted with the agent or the vector.
[0032] The method of any one of paragraphs [l]-
[0031] , wherein the method reduces a level of the UBE3A protein in the mammalian cell.
[0033] The method of paragraph
[0032] , wherein the level of the UBE3A protein in the mammalian cell contacted with the agent or the vector is decreased by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same cell not contacted with the agent or the vector.
[0034] The method of paragraph
[0032] , wherein the level of the UBE3A protein in the mammalian cell contacted with the agent or the vector is decreased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at leastabout 95%, or at least about 99%, as compared to an otherwise same cell not contacted with the agent or the vector.
[0035] The method of any one of paragraphs
[0001] -
[0034] , wherein the method comprises contacting the agent or the vector to a population of mammalian cells.
[0036] The method of paragraph
[0035] , wherein the agent reduces a level of the processed mRNA encoding the UBE3A protein in the population of mammalian cells by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30%, or at most about 20%, as compared to an otherwise same population of mammalian cells not contacted with the agent or the vector.
[0037] The method of paragraph
[0035] or
[0036] , wherein the agent reduces a level of the UBE3A protein in the population of mammalian cells by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30%, or at most about 20%, as compared to an otherwise same population of cells not contacted with the agent or the vector.
[0038] The method of any one of paragraph [1] to
[0037] , wherein the mammalian cell is ex vivo.
[0039] The method of any one of paragraph [1] to
[0037] , wherein the mammalian cell is in vivo.
[0040] The method of any one of paragraph [1] to
[0039] , wherein genome of the mammalian cell has a duplication of a genomic region that encompasses the UBE3A gene encoding the UBE3A protein.
[0041] The method of any one of paragraph [1] to
[0039] , wherein the mammalian cell is a human cell, and wherein genome of the mammalian cell has a duplication of chromosome 15ql 1.2-ql3.1.
[0042] The method of any one of paragraph [1] to
[0038] , wherein the mammalian cell is obtained from a human subject suffering from Dupl5q syndrome, or a progeny of a sample cell obtained from the human subject.
[0043] An antisense oligomer that comprises a sequence with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0044] The antisense oligomer of paragraph
[0043] , wherein the antisense oligomer comprises a backbone modification, a modified sugar moiety or a combination thereof.
[0045] The antisense oligomer of paragraph
[0043] or
[0044] , wherein the antisense oligomer comprises a phosphorothioate linkage or a phosphorodiamidate linkage.
[0046] The antisense oligomer of any one of paragraphs
[0043] -
[0045] , wherein the antisense oligomer comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2’-O- methyl moiety, a 2’-Fluoro moiety, a 2’-O-methoxyethyl moiety, or a 2’-NMA moiety.
[0047] The antisense oligomer of any one of paragraphs
[0043] -
[0046] , wherein the antisense oligomer comprises at least one modified sugar moiety.
[0048] The antisense oligomer of any one of paragraphs
[0043] -
[0047] , wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at a 5’ end of the antisense oligomer.
[0049] The antisense oligomer of any one of paragraphs
[0043] -
[0047] , wherein the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at a 5’ end of the antisense oligomer.
[0050] The antisense oligomer of any one of paragraphs
[0043] -
[0047] , wherein the antisense oligomer comprises one, two, three, four, five, or six 2 ’-0 -methoxy ethyl modified nucleosides at a 5’ end of the antisense oligomer.
[0051] The antisense oligomer of any one of paragraphs
[0043] -
[0050] , wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at a 3’ end of the antisense oligomer.
[0052] The antisense oligomer of any one of paragraphs
[0043] -
[0050] , wherein the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at a 3’ end of the antisense oligomer.
[0053] The antisense oligomer of any one of paragraphs
[0043] -
[0050] , wherein the antisense oligomer comprises one, two, three, four, five, or six 2 ’-0 -methoxy ethyl modified nucleosides at a 3’ end of the antisense oligomer.
[0054] The antisense oligomer of any one of paragraphs
[0043] -
[0053] , wherein the antisense oligomer comprises three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 5’ end of the antisense oligomer; three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 3’ end of the antisense oligomer; and a phosphorothioate linkage between any two neighboring nucleosides of the antisense oligomer.
[0055] The antisense oligomer of any one of paragraphs
[0043] -
[0053] , wherein the antisense oligomer comprises: a 5’ region consisting of three, four, five, or six linked nucleosides; a central region consisting of eight, nine, ten, eleven, or twelve linked nucleosides; and a 3’ region consisting of three, four, five, or six linked nucleosides; wherein each of the three, four, five, or six linked nucleosides in the 5’ region and each of three, four, five, or six linked nucleosides in the 3 ’ region comprise a modified sugar moiety, and wherein each of the eight, nine, ten, eleven, or twelve linked nucleosides in the central region is a deoxyribonucleoside.
[0056] The antisense oligomer of any one of paragraphs
[0043] -
[0055] , wherein the antisense oligomer is from 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 15 to 50 nucleobases, 15 to 40 nucleobases, 15 to 35 nucleobases, 15 to 30 nucleobases, 15 to 25 nucleobases, 15 to 20 nucleobases, 15 to 19 nucleobases, 15 to 18 nucleobases, 15 to 16 nucleobases, 16 to 20 nucleobases, 16 to 19 nucleobases, 16 to 18 nucleobases, 17 to 20 nucleobases, 17 to 19 nucleobases, or 18 to 20 nucleobases in length.
[0057] The antisense oligomer of any one of paragraphs
[0043] -
[0056] , wherein the antisense oligomer comprises a sequence with at least 90% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0058] The antisense oligomer of any one of paragraphs
[0043] -
[0056] , wherein the antisense oligomer comprises a sequence with 100% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0059] The antisense oligomer of any one of paragraphs
[0043] -
[0056] , wherein the antisense oligomer consists of a sequence with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0060] The antisense oligomer of any one of paragraphs
[0043] -
[0056] , wherein the antisense oligomer consists of a sequence with at least 90% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0061] The antisense oligomer of any one of paragraphs
[0043] -
[0056] , wherein the antisense oligomer consists of a sequence with 100% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0062] The antisense oligomer of any one of paragraphs
[0043] -
[0056] , wherein the antisense oligomer is a modified oligonucleotide comprising the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
[0063] The antisense oligomer of any one of paragraphs
[0043] -
[0056] , wherein the antisense oligomer is a modified oligonucleotide consisting of the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
[0064] The antisense oligomer of any one of paragraphs
[0043] -
[0063] , wherein the antisense oligomer is configured to reduce a level of a processed mRNA transcript encoding a UBE3A protein in a population of mammalian cells upon contact with the population.
[0065] The antisense oligomer of paragraph
[0064] , wherein the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same population of mammalian cells not contacted with the antisense oligomer.
[0066] The antisense oligomer of paragraph
[0064] , wherein the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3 A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%, as compared to an otherwise same population of mammalian cells not contacted with the antisense oligomer.
[0067] The antisense oligomer of any one of paragraphs
[0064] -
[0066] , wherein the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30%, or at most about 20%, as compared to an otherwise same population of mammalian cells not contacted with the antisense oligomer.
[0068] The antisense oligomer of any one of paragraphs
[0064] -
[0067] , wherein the antisense oligomer is configured to reduce a level of the UBE3A protein in the population of mammalian cells.
[0069] The antisense oligomer of paragraph
[0068] , wherein the antisense oligomer is configured to reduce the level of the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same population of mammalian cells not contacted with the antisense oligomer.
[0070] The antisense oligomer of paragraph
[0068] , wherein the antisense oligomer is configured to reduce the level of the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, atleast about 95%, or at least about 99%, as compared to an otherwise same population of mammalian cells not contacted with the antisense oligomer.
[0071] The antisense oligomer of any one of paragraphs
[0064] -
[0070] , wherein the antisense oligomer is configured to reduce the level of the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30%, or at most about 20%, as compared to an otherwise same population of mammalian cells not contacted with the antisense oligomer.
[0072] The antisense oligomer of any one of paragraphs
[0064] -
[0071] , wherein the mammalian cell is ex vivo.
[0073] The antisense oligomer of any one of paragraphs
[0064] -
[0071] , wherein the mammalian cell is in vivo.
[0074] The antisense oligomer of any one of paragraphs
[0064] -
[0073] , wherein genome of the mammalian cell has a duplication of a genomic region that encompasses the UBE3A gene encoding the UBE3A protein.
[0075] The antisense oligomer of any one of paragraphs
[0064] -
[0074] , wherein the mammalian cell is a human cell.
[0076] The antisense oligomer of paragraph
[0075] , wherein genome of the mammalian cell has a duplication of chromosome 15ql 1.2-ql3.1.
[0077] The antisense oligomer of any one of paragraphs
[0064] -
[0076] , wherein the mammalian cell is obtained from a human subject suffering from Dupl5q syndrome, or a progeny of a sample cell obtained from the human subject.
[0078] A pharmaceutical composition, comprising:(a) a pharmaceutically acceptable excipient or carrier; and(b) the antisense oligomer of any one of paragraphs
[0043] -
[0077] ,
[0079] A pharmaceutical composition, comprising:(a) a pharmaceutically acceptable excipient or carrier; and(b) an agent or a vector encoding the agent, wherein the agent is configured to reduce a level of a processed mRNA transcript encoding a UBE3A protein in a mammalian cell upon contact with the mammalian cell.
[0080] The pharmaceutical composition of paragraph
[0079] , wherein the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleobases of the sequence set forth in any one of SEQ ID NO: 93-120.
[0081] The pharmaceutical composition of paragraph
[0079] , wherein the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleobases of each mRNA transcript listed in Table 2.
[0082] The pharmaceutical composition of any one of paragraphs
[0079] -
[0081] , wherein the agent comprises an antisense oligomer.
[0083] The pharmaceutical composition of paragraph
[0082] , wherein the antisense oligomer has at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0084] The pharmaceutical composition of any one of paragraphs
[0079] -
[0083] , comprising the vector, and wherein the vector comprises a viral vector encoding the agent.
[0085] The pharmaceutical composition of paragraph
[0084] , wherein the viral vector comprises an adenoviral vector, adeno -associated viral (AAV) vector, lentiviral vector, Herpes Simplex Virus (HSV) viral vector, or retroviral vector.
[0086] The pharmaceutical composition of any one of paragraphs
[0082] -
[0085] , wherein the antisense oligomer comprises a sequence with at least 90% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0087] The pharmaceutical composition of any one of paragraphs
[0082] -
[0085] , wherein the antisense oligomer comprises a sequence with 100% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0088] The pharmaceutical composition of any one of paragraphs
[0082] -
[0085] , wherein the antisense oligomer consists of a sequence with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0089] The pharmaceutical composition of any one of paragraphs
[0082] -
[0085] , wherein the antisense oligomer consists of a sequence with at least 90% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0090] The pharmaceutical composition of any one of paragraphs
[0082] -
[0085] , wherein the antisense oligomer consists of a sequence with 100% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
[0091] The pharmaceutical composition of paragraph
[0082] , wherein the antisense oligomer is a modified oligonucleotide comprising the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
[0092] The pharmaceutical composition of paragraph
[0082] , wherein the antisense oligomer is a modified oligonucleotide consisting of the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
[0093] The pharmaceutical composition of any one of paragraphs
[0079] -
[0092] , wherein the agent is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population of the mammalian cells upon contact with the population.
[0094] The pharmaceutical composition of paragraph
[0093] , wherein the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same population of mammalian cells not contacted with the agent or the vector.
[0095] The pharmaceutical composition of paragraph
[0093] , wherein the agent is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about85%, at least about 90%, at least about 95%, or at least about 99%, as compared to an otherwise same population of mammalian cells not contacted with the agent or the vector.
[0096] The pharmaceutical composition of any one of paragraphs paragraph
[0093] -
[0095] , wherein the agent is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30%, or at most about 20%, as compared to an otherwise same population of mammalian cells not contacted with the antisense oligomer.
[0097] The pharmaceutical composition of any one of paragraphs paragraph
[0093] -
[0096] , wherein the agent is configured to reduce a level of the UBE3A protein in the population.
[0098] The pharmaceutical composition of paragraph
[0097] , wherein the agent is configured to reduce the level of the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% toabout 95%, or about 95% to about 99%, as compared to an otherwise same population of mammalian cells not contacted with the agent or the vector.
[0099] The pharmaceutical composition of paragraph
[0097] , wherein the agent is configured to reduce the level of the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%, as compared to an otherwise same population of mammalian cells not contacted with the agent or the vector.
[0100] The pharmaceutical composition of any one of paragraphs
[0097] -
[0099] , wherein the agent is configured to reduce the level of the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30%, or at most about 20%, as compared to an otherwise same population of mammalian cells not contacted with the antisense oligomer.
[0101] The pharmaceutical composition of any one of paragraphs
[0079] -
[0100] , wherein the mammalian cell is ex vivo.
[0102] The pharmaceutical composition of any one of paragraphs
[0079] -
[0100] , wherein the mammalian cell is in vivo.
[0103] The pharmaceutical composition of any one of paragraphs
[0079] -
[0102] , wherein genome of the mammalian cell has a duplication of a genomic region that encompasses the UBE3A gene encoding the UBE3A protein.
[0104] The pharmaceutical composition of any one of paragraphs
[0079] -
[0103] , wherein the mammalian cell is a human cell.
[0105] The pharmaceutical composition of paragraph
[0104] , wherein genome of the mammalian cell has a duplication of chromosome 15ql 1 ,2-ql3. 1.
[0106] The pharmaceutical composition of any one of paragraphs
[0079] -
[0099] , wherein the mammalian cell is obtained from a human subject suffering from Dupl5q syndrome, or a progeny of a sample cell obtained from the human subject.
[0107] The pharmaceutical composition of any one of paragraphs
[0078] -
[0106] , wherein the pharmaceutical composition is formulated for intracerebroventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, intra cistema magna injection, subcutaneous injection, oral administration, synovial injection, intravitreal administration, subretinal injection, topical application, implantation, or intravenous injection.
[0108] The pharmaceutical composition of any one of paragraphs
[0078] -
[0106] , wherein the pharmaceutical composition is formulated for intrathecal injection.
[0109] The pharmaceutical composition of any one of paragraphs
[0078] -
[0108] , wherein the pharmaceutically acceptable excipient or carrier comprises artificial cerebrospinal fluid.
[0110] The pharmaceutical composition of any one of paragraphs
[0078] -
[0109] , wherein the pharmaceutical composition further comprises a second therapeutic agent.
[0111] The pharmaceutical composition of paragraph
[0110] , wherein the second therapeutic agent comprises a small molecule, an antisense oligomer, or a gene editing molecule.
[0112] A method of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof by reducing expression of a UBE3A protein in cells of the subject, comprising contacting to the cells of the subject the pharmaceutical composition of any one of paragraphs
[0078] - [I H].
[0113] The method of paragraph
[0112] , wherein the disease or condition is associated with overexpression or gain-of-fonction mutation in a UBE3A gene encoding the UBE3A protein.
[0114] The method of paragraph
[0112] or
[0113] , wherein genomes of the cells of the subject have at least one excessive copy of a UBE3A gene encoding the UBE3A protein.
[0115] The method of paragraph
[0112] or
[0114] , wherein genomes of the cells of the subject have a duplication of a genomic region encompassing a UBE3A gene encoding the UBE3A protein.
[0116] The method of paragraph
[0112] or
[0115] , wherein genomes of the cells of the subject have a duplication of chromosome 15ql 1.2-ql3.1.
[0117] The method of any one of paragraphs
[0112] -
[0116] , wherein the disease or condition comprises Dupl5q syndrome, autism spectrum disorder, epilepsy, or intellectual disability.
[0118] The method of any one of paragraphs
[0112] -
[0117] , wherein the subject is ahuman.
[0119] The method of any one of paragraphs
[0112] -
[0118] , wherein the subject is a fetus, an embryo, or a child.
[0120] The method of any one of paragraphs
[0112] -
[0119] , wherein the cells are ex vivo.
[0121] The method of any one of paragraphs
[0112] -
[0119] , comprising administering the pharmaceutical composition to the subject by intracerebroventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, intra cistema magna injection, subcutaneous injection, oral administration, synovial injection, intravitreal administration, subretinal injection, topical application, implantation, or intravenous injection.
[0122] The method of any one of paragraphs
[0112] -
[0119] , comprising administering the pharmaceutical composition to the subject by intrathecal injection.
[0123] The method of any one of paragraphs
[0112] -
[0122] , wherein the method treats the disease or condition.EXAMPLES
[0504] The present disclosure will be more specifically illustrated by the following Examples.However, it should be understood that the present disclosure is not limited by these examples in any manner.Example 1. Knockdown of UBE3A Gene in Human Cells.
[0505] In one experiment, effects on human UBE3A mRNA transcripts of compound molecules according to some embodiments of the present disclosure were examined. The compound molecules are modified oligonucleotides listed in Table 3. Among the examined compound molecules, there were 22 test oligonucleotides according to some embodiments of the present disclosure, one no template control (NTC) that serves as a negative control (“Ncontrol”), and one positive control oligonucleotide that is known for its knockdown effect on UBE3A gene (“Pcontrol”). As shown in the table, “ / 52MOErX / ” represents a 2-O-methyoxyethyl modified ribonucleoside X at 5’ end of an oligonucleotide, where X is A, T, G, or methylated cytosine (MeC); ‘7i2MOErX / ” represents an internal 2-O-methyoxyethyl modified ribonucleoside X, where X is A, T, G, or MeC); “ / 32MOErX / ” represents a 2-O-methyoxyethyl modified ribonucleoside X at 3’ end of an oligonucleotide, where X is A, T, G, or MeC; other nucleosides A, T, G, and C are deoxyribonucleosides; represents phosphorothioate linkage between two neighboring nucleosides.Table 3. List of Compound MoleculesTable 4. List of Compound Molecules
[0506] The experiments were conducted with HS02 (primary human fibroblasts) in 96-well plates.8000 cells / well were seeded in 96-well plates 24 UBE3A targeting ASOs (22 exemplary ASOs + 2 controls) were tested in an 8-point concentration-response curve (CRC) format, e.g., 8 different concentrations of each ASO were tested, and the response to the ASO treatment was measured and plotted against the different concentrations. Two control ASOs include a positive control to assess successful ASO delivery at 100 nM (“Pcontrol”) and a negative control, which is an ASO targeting a different gene TUG1 at 100 nM (“Ncontrol”). For each cell plate, there were also wells reserved to receive transfection reagents only (“TF only”) as another negative control for quality control (QC). All the ASOs were delivered by lipofectamine 2000 transfection (0.2 pl / well). The 22 exemplaryASOs were added to the cell medium at a concentration of 100 nM, 31.62 nM, 10 nM, 3.16 nM, 1.0 nM, 0.32 nM, 0.10 nM, or 0.032 nM.
[0507] Each ASO source plate was tested on duplicate cell plates in the same experiment; lysate from each cell well tested in duplicate were measured on the same qPCR plate.
[0508] Each cell well was treated with the respective ASOs for 24 hours before subject to nuclei counting and potency measurement. To count the number of nuclei of the cells that received the ASO treatment, 20 pl / well of Hoechst 33342 (50 pg / ml, nuclear staining) was added for 30 minutes. After staining, the cells were imaged by live-imaging on IN Cell Analyzer 2200 (GE Healthcare) with a lOx objective, 4 fields per well were captured, and automated analysis of the captured images was conducted with Columbus software (PerkinElmer).
[0509] After imaging, the cells were lysed using lysis solution with DNAse I (25 pl / well) and stop solution (2.5 pl / well) from TaqMan one-step Cells-to-Ct kit. The cell lysates were then subject to qPCR tests: 15% of the cell lysate from each well was added for qPCR reaction with TaqMan Master Mix from TaqMan one-step Cells-to-Ct kit.
[0510] For the TaqMan assays, Hs UBE3A assay 3 (FAM) was multiplexed with Hs HPRT1 (VIC). Upon completion of the TaqMan qPCR assay, calculations of the amount of UBE3 A transcripts were done using the 2-AACtmethod, normalized to the measurement of internal reference HPRT1, and the changes in gene expression compared to control condition (100% expression) were then determined.
[0511] Cell loss in the lipofectamine-only condition (TF only, orange) is below 0% indicating some toxicity in the conditions transfected with ASOs. To account for those differences, data was normalized to TUG1 ASO negative CTRL per plate. Cell loss was below 20% for all the test ASOs except for 4 wells, indicating low toxicity in general.
[0512] FIGS. 1A-1D show the CRCs for each tested ASOs, including the 22 exemplary ASOs, as well the potency (percent knockdown of UBE3A mRNA transcripts) of Pcontrol and Ncontrol.
[0513] FIGS. 2A-2B illustrate the effect of various controls on UBE3A mRNA knockdown.
[0514] Table s summarizes average UBE3A knockdown percentage for each of the tested ASOs, including Pcontrol and Ncontrol, and their respective EC50. EC50s (half maximal effective concentrations) were calculated using a non-linear regression (4 parameter) analysis. There were a number of ASOs (eight) for which EC50 values could not be calculated because their CRCs did not result in a S-curve. They are labeled as n.d. (not determined) in the table.Table 5. Potency and EC50 of Tested ASOsSEQUENCE LISTINGSEQ ID NO: 1CGCTTCATTCGGCTAGCTTCSEQ ID NO: 2ATTCGGCTAGCTTCAATGTCSEQ ID NO: 3TCGCTTCATTCGGCTAGCTTSEQ ID NO: 4GCTTCATTCGGCTAGCTTCASEQ ID NO: 5TCGGCTAGCTTCAATGTSEQ ID NO: 6CATTCGGCTAGCTTCAATGTSEQ ID NO: 7TCGGCTAGCTTCAATGTCSEQ ID NO: 8CCGGACAAGTGCATCATCTASEQ ID NO: 9CCGGACAAGTGCATCATCTSEQ ID NO: 10TCACATTCCACGTTAGGTGASEO ID NO: 11CTTCTGGTCTGAATAAGTASEQ ID NO: 12CGGACAAGTGCATCATCTATSEQ ID NO: 13TGTACATGCGAATTCTATTGSEO ID NO: 14TCCATAGCGATCATCTCTAGSEO ID NO: 15TTCCGGCTTCCACATATAAGSEO ID NO: 16CATTCTCCGAATCTGGTCSEO ID NO: 17CCTTCCTGTTTTCATTTGTASEO ID NO: 18CCTTTCTGTGTCTGGGCCATSEQ ID NO: 19CTCTTACAGATTTTTAACCTSEQ ID NO: 20TAGGTAACCTTTCTGTGTCTSEQ ID NO: 21GTGAACATACCAATATCTGGSEQ ID NO: 22GTATGAGATGTAGGTAACCSEQ ID NO: 23ACAGGTTGTCACACCAGTCTSEO ID NO: 24AGTATGAGATGTAGGTAACCSEO ID NO: 25AGCTGTGGCCATTCGGTGACSEO ID NO: 26CAAGTATGAGATGTAGGTASEO ID NO: 27GATAAGTGGTTTTCGACAATSEO ID NO: 28CGGACAAGTGCATCATCTATSEO ID NO: 29CCGGACAAGTGCATCATCTSEO ID NO: 30GTAACACTTTCACGCAAAASEQ ID NO: 31CATTCTCCGAATCTGGTCSEO ID NO: 32GGACAAGTGCATCATCTATSEO ID NO: 33TCCATAGCGATCATCTCTAGSEO ID NO: 34AAGCTGTGGCCATTCGGTSEO ID NO: 35CCTTTCTGTGTCTGGGCCATSEO ID NO: 36CCTTCCTGTTTTCATTTGTASEO ID NO: 37ACATTCGGCTAGCTTCAATGSEQ ID NO: 38TTCGGCTAGCTTCAATGTCSEQ ID NO: 39TTCGGCTAGCTTCAATGTSEQ ID NO: 40CTTACATTCGGCTAGCTTCSEQ ID NO: 41CTTACATTCGGCTAGCTTSEQ ID NO: 42ATTCGGCTAGCTTCAATGTSEQ ID NO: 43TACCATATTTCGCCAAACTSEQ ID NO: 44ACCTTTCTGTGTCTGGGCCASEQ ID NO: 45TCACATTCCACGTTAGGTGSEQ ID NO: 46CGTGTCTTTCTGTGTCTGGGSEQ ID NO: 47CTTACATTCGGCTAGCTSEQ ID NO: 48TGTCTTTCTGTGTCTGGGCCSEQ ID NO: 49CTTACCCGGCTTCCACATATSEQ ID NO: 50TTACATTCGGCTAGCTTCASEO ID NO: 51ACATTCGGCTAGCTTCAATSEO ID NO: 52TTTGTTGCAATAGGCTTGACSEO ID NO: 53CATACCATATTTCGCCAAACSEO ID NO: 54CTTACATTCGGCTAGCTTCASEO ID NO: 55TCACATTCCACGTTAGGTSEQ ID NO: 56ATACCATATTTCGCCAAACTSEQ ID NO: 57CCGTGTCTTTCTGTGTCTGGSEQ ID NO: 58GTCTTTCTGTGTCTGGGCCASEQ ID NO: 59AACCTTTCTGTGTCTGGGCCSEQ ID NO: 60GTGTCTTTCTGTGTCTGGGCSEO ID NO: 61GTAGGTAACCTTTCTGTGTCSEO ID NO: 62ACATTCCACGTTAGGTGACASEO ID NO: 63GTTGCAATAGGCTTGACTASEO ID NO: 64CAGGTTGTCACACCAGTCTSEO ID NO: 65ACCATATTTCGCCAAACTTCSEO ID NO: 66CTTACCCGGACAAGTGCATCSEO ID NO: 67TTACCCGGACAAGTGCATCSEQ ID NO: 68GGCCATTCGGTGACATCASEO ID NO: 69TGATCTTTTACAAGCTGTGGSEO ID NO: 70AGCAAGTATGAGATGTAGGSEO ID NO: 71ACCATATTTCGCCAAACTTSEO ID NO: 72GGTAACCTTTCTGTGTCTGGSEO ID NO: 73ACAGGTTGTCACACCAGTCSEO ID NO: 74GTTGCAATAGGCTTGACTSEQ ID NO: 75TGTGAACATACCAATATCTGSEQ ID NO: 76ACTGTACATGCGAATTCTATSEQ ID NO: 77TTACCCGGACAAGTGCATCASEQ ID NO: 78TGTAGGTAACCTTTCTGTGTSEQ ID NO: 79TTTCCCAGAACTCCCTAATCSEQ ID NO: 80CAAGTATGAGATGTAGGTSEQ ID NO: 81AAGCTGTGGCCATTCGGTGSEQ ID NO: 82GGCCATTCGGTGACATCAGGSEQ ID NO: 83TGCAATAGGCTTGACTASEQ ID NO: 84GGCCATTCGGTGACATCAGSEQ ID NO: 85AGCTGTGGCCATTCGGTGASEQ ID NO: 86TCATTCTCCGAATCTGGTCSEQ ID NO: 87GTAACACTTTCACGCAAAAASEO ID NO: 88AGGTAACCTTTCTGTGTCTGSEO ID NO: 89TTTGTTGCAATAGGCTTGASEO ID NO: 90ATTTCGCCAAACTTCTGAGGSEO ID NO: 91TCTCAAGGTAAGCTGAGCTSEO ID NO: 92TTCCCAGAACTCCCTAATCAExample 2. In vivo ASO Tolerance of Antisense Oligonucleotides (ASOs) via Intracerebroventricular (ICV) Administration.
[0515] This example illustrates experiments that were conducted to test the in vivo tolerability of certain exemplary ASOs of the present disclosure in mice.
[0516] Effects of the exemplary ASOs were examined by in vivo experiments via intracerebroventricular (ICV) administration into mice. Adult C57BL / 6 mice were surgically implanted with an ICV cannula. Following recovery from surgery, mice received an ICV injection of ASO or Dulbecco's phosphate buffered saline (DPBS) on day 0. Observations were made pre-dose and 1 hour, 2 hours, 4 hours, 24 hours, and 7 days after dosing. Animals were terminated 2 weeks post-dose. Terminal plasma, brain, liver, heart, and kidney tissues were collected and stored.
[0517] Adult male C57B1 / 6 mice were used for this study. Upon arrival, animals were housed one per cage in polycarbonate cages and acclimated for at least 4 days prior to commencing the study. Animals were housed on a 12 / 12 hr light / dark cycle with room temperature (22+2°C) and humidity (-50%) maintained. The animals had access to food and water ad libitum. Experiments were conducted in accordance with protocols approved by the Institutional Animal Care and Use Committee of Charles River Laboratories South San Francisco.
[0518] Dosing formulations were prepared at appropriate concentrations to meet target dose levels in each mouse (e.g., 400 pg / mouse, 500 pg / mouse). All ASOs were formulated with DPBS and stored at -80°C until the day of dosing. Each animal test condition contained six animals and each animal received one dose of intracerebroventricular injection constituting 5 pl of a test sample according to the groupings presented in Table 6, with the exceptions of Groups 4, 14, and 25, which were dropped from the study due to solubility issues. Group 1 was the control condition in which only DPBS was administered, and Group 2 was the positive control in which Tominersen, a known antisenseoligonucleotide treatment for reduction of huntingtin protein (HTT) and mutated huntingtin protein (mHTT) expression levels, was administered. Groups 3-26 were the experimental conditions using the ASOs named.Table 6. Animal Testing Groups and Conditions
[0519] Surgical Procedures
[0520] ICV Cannulation Surgery
[0521] Mice were anesthetized using isoflurane (2%, 800 ml / min O2). Bupivacaine was used for local analgesia and carprofen was used for peri- / post-operative analgesia. The animals were placed in a stereotaxic frame (KOPF® Laboratory Instruments, USA). Surgery was performed using aseptic techniques. Anterior-Posterior (AP), Medial-Lateral (ML), and Dorsal-Ventral (DV) axes were zeroed on Bregma. The following coordinates were used for the ICV infusion cannula (PLASTICS ONE®, Roanoke, Virginia): AP -0.3 mm, lateral -1.0, DV -2.2 mm from dura. The locations of the burr holes were designated and drilled. The drill was only used to penetrate the bone, and the infusion cannula was lowered into the lateral ventricle. Two screws and dental acrylic were used to secure the ICV cannula. After surgery, animals were provided food and water ad libitum. Any animal exhibiting unusual or adverse signs were not used in the study.
[0522] Pre- and Post-operative Care
[0523] Carprofen (5 mg / kg SC) was administered before the surgery and Carprofen (0.067 mg / ml) was provided in the drinking water to animals for 3 days after surgery. Animals were carefully monitored on the day of surgery and once daily for an additional 3 days after surgery.
[0524] ICV Infusion (Day 0):
[0525] At least 7 days after surgery, animals were dosed according to the conditions presented in Table 7. Animals were dosed while they were conscious. Infusion cannulas were placed into the ICV cannul...
Claims
CLAIMSWhat is claimed is:
1. A method of reducing expression of a UBE3A protein in a mammalian subject, the method comprising administering to the mammalian subject an agent or a vector encoding the agent, thereby reducing a level of a processed mRNA encoding the UBE3A protein in at least a portion of the central nervous system of the subject, wherein the agent comprises an antisense oligomer with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
2. The method of claim 1, wherein the level of the processed mRNA encoding the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
3. The method of claim 1 or 2, wherein the level of the processed mRNA encoding the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
4. The method of any one of claims 1-3, wherein the method reduces a level of the UBE3A protein in the at least a portion of the central nervous system of the subject.
5. The method of claim 4, wherein the level of the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10%to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
6. The method of claim 4, wherein the level of the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
7. The method of any one of claims 1-6, wherein the at least a portion of the central nervous system of the subject comprises at least a portion of the spinal cord, brain, hippocampus, lumbar spinal cord, cervical spinal cord, thoracic spinal cord, prefrontal cortex, striatum, temporal cortex, cerebellum, pons, thalamus, or medulla.
8. The method of any one of claims 1-7, wherein the method comprises administering the agent or the vector to the subject by intracranial injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, intra cistema magna injection, subcutaneous injection, oral administration, synovial injection, intravitreal administration, subretinal injection, topical application, implantation, or intravenous injection.
9. The method of any one of claims 1-7, wherein the method comprises administering the agent or the vector to the subject by intrathecal injection.
10. The method of any one of claims 1-7, wherein the method comprises administering the agent or the vector to the subject by intracerebroventricular injection or intra cistema magna injection.
11. The method of any one of claims 1-10, wherein the antisense oligomer comprises a backbone modification, a modified sugar moiety or a combination thereof.
12. The method of any one of claims 1-11, wherein the antisense oligomer comprises a phosphorothioate linkage or a phosphorodiamidate linkage.
13. The method of any one of claims 1-12, wherein the antisense oligomer comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2’-O-methyl moiety, a 2’-Fluoro moiety, a 2’-O-methoxyethyl moiety, or a 2’-NMA moiety.
14. The method of any one of claims 1-13, wherein the antisense oligomer comprises at least one modified sugar moiety.
15. The method of any one of claims 1-14, wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at a 5’ end of the antisense oligomer.
16. The method of any one of claims 1-14, wherein the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at a 5’ end of the antisense oligomer.
17. The method of any one of claims 1-16, wherein the antisense oligomer comprises one, two, three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 5’ end of the antisense oligomer.
18. The method of any one of claims 1-17, wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at a 3’ end of the antisense oligomer.
19. The method of any one of claims 1-17, wherein the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at a 3’ end of the antisense oligomer.
20. The method of any one of claims 1-19, wherein the antisense oligomer comprises one, two, three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 3’ end of the antisense oligomer.
21. The method of any one of claims 1 -20, wherein the antisense oligomer comprises three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 5’ end of the antisense oligomer; three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 3’ end of the antisense oligomer; and a phosphorothioate linkage between any two neighboring nucleosides of the antisense oligomer.
22. The method of any one of claims 1-21, wherein the antisense oligomer comprises: a 5’ region consisting of three, four, five, or six linked nucleosides; a central region consisting of eight, nine, ten, eleven, or twelve linked nucleosides; and a 3’ region consisting of three, four, five, or six linked nucleosides; wherein each of the three, four, five, or six linked nucleosides in the 5’ region and each of three, four, five, or six linked nucleosides in the 3 ’ region comprise a modified sugar moiety, and wherein each of the eight, nine, ten, eleven, or twelve linked nucleosides in the central region is a deoxyribonucleoside.
23. The method of any one of claims 1-22, wherein each cytosine in the ribonucleoside in the antisense oligomer is methylated.
24. The method of any one of claims 1-23, wherein each cytosine in the deoxyribonucleoside in the antisense oligomer is unmethylated.
25. The method of any one of claims 1-24, wherein in the antisense oligomer, each cytosine in the ribonucleoside is methylated and each cytosine in the deoxyribonucleoside is unmethylated.
26. The method of any one of claims 1-25, wherein the antisense oligomer is from 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to20 nucleobases, 8 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 15 to 50 nucleobases, 15 to 40 nucleobases,15 to 35 nucleobases, 15 to 30 nucleobases, 15 to 25 nucleobases, 15 to 20 nucleobases, 15 to 19 nucleobases, 15 to 18 nucleobases, 15 to 16 nucleobases, 16 to 20 nucleobases, 16 to 19 nucleobases,16 to 18 nucleobases, 17 to 20 nucleobases, 17 to 19 nucleobases, or 18 to 20 nucleobases in length.
27. The method of any one of claims 1-26, wherein the antisense oligomer is a modified oligonucleotide comprising the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
28. The method of any one of claims 1-26, wherein the antisense oligomer is a modified oligonucleotide consisting of the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
29. The method of any one of claims 1-9, wherein the vector comprises a viral vector encoding the agent.
30. The method of claim 29, wherein the viral vector comprises an adenoviral vector, adeno- associated viral (AAV) vector, lentiviral vector, Herpes Simplex Virus (HSV) viral vector, or retroviral vector.
31. The method of any one of claims 1-30, wherein the genome of the subject has a duplication of chromosome 15ql 1 ,2-ql3.1.
32. A method of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition comprising an antisense oligomer at an amount of about 1 pg to about 50 pg, about 2 pg to about 20 pg, about 5 pg to about 15 pg, about 8 pg to about 12 pg, about 0.5 pg to about 25 pg, about 1 pg to about 15 pg, about 2 pg to about 10 pg, or about 4 pg to about 8 pg, wherein the antisense oligomer with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
33. A method of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof by reducing expression of a UBE3A protein in at least a portion of the central nervous system of the subject, comprising administering to the subject a pharmaceutical composition comprising an agent or a vector encoding the agent, wherein the agent comprises an antisense oligomer with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1- 92.
34. The method of claim 32 or 33, wherein the disease or condition is associated with overexpression or gain-of-function mutation in a UBE3A gene encoding the UBE3A protein.
35. The method of any one of claims 32-34, wherein the genome of the subject has at least one excessive copy of a UBE3A gene encoding the UBE3A protein.
36. The method of any one of claims 32-35, wherein the genome of the subject has a duplication of a genomic region encompassing a UBE3A gene encoding the UBE3A protein.
37. The method of any one of claims 32-36, wherein the genome of the subject has a duplication of chromosome 15ql 1.2-ql3.1.
38. The method of any one of claims 32-37, wherein the disease or condition comprises Dupl5q syndrome, autism spectrum disorder, epilepsy, or intellectual disability.
39. The method of any one of claims 32-38, wherein the subject is at most 18 years old.
40. The method of any one of claims 32-38, wherein the subject is at least 1 month old.
41. The method of any one of claims 32-38, wherein the subject is from 1 month to 6 months old, from 6 months to 1 year old, or from 1 to 18, from 2 to 18, from 3 to 18, from 4 to 18, from 5 to 18, from 6 to 18, from 7 to 18, from 8 to 18, from 9 to 18, from 10 to 18, from 11 to 18, from 12 to 18, from 13 to 18, from 14 to 18, from 15 to 18, from 16 to 18, or from 17 to 18 years old.
42. The method of any one of claims 32-41 , wherein the subject is a fetus, an embryo, or a child.
43. The method of any one of claims 32-42, wherein the method comprises administering the pharmaceutical composition to the subject by intracerebroventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, intra cistema magna injection, subcutaneous injection, oral administration, synovial injection, intravitreal administration, subretinal injection, topical application, implantation, intracranial injection, or intravenous injection.
44. The method of any one of claims 32-42, wherein the method comprises administering the pharmaceutical composition to the subject by intrathecal injection.
45. The method of any one of claims 32-42, wherein the method comprises administering the pharmaceutical composition to the subject by intracerebroventricular injection or intra cistema magna injection.
46. The method of any one of claims 32-45, wherein the method treats the disease or condition.
47. The method of any one of claims 32-46, wherein the level of the processed mRNA encoding the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared toan otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
48. The method of any one of claims 32-46, wherein the level of the processed mRNA encoding the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
49. The method of any one of claims 32-48, wherein the method reduces a level of the UBE3A protein in the at least a portion of the central nervous system of the subject.
50. The method of claim 49, wherein the level of the UBE3A protein in the at least a portion of the central nervous system of the subject is decreased by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
51. The method of claim 49, wherein the level of the UBE3 A protein in the at least a portion of the central nervous system of the subject is decreased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%, as compared to an otherwise same at least a portion of the central nervous system of a control subject not administered with the agent or the vector.
52. The method of any one of claims 32-51 , wherein the at least a portion of the central nervous system of the subject comprises at least a portion of the spinal cord, brain, hippocampus, lumbarspinal cord, cervical spinal cord, thoracic spinal cord, prefrontal cortex, striatum, temporal cortex, cerebellum, pons, thalamus, or medulla.
53. The method of any one of claims 32-52, wherein the antisense oligomer comprises a backbone modification, a modified sugar moiety, or a combination thereof.
54. The method of any one of claims 32-53, wherein the antisense oligomer comprises a phosphorothioate linkage or a phosphorodiamidate linkage.
55. The method of any one of claims 32-54, wherein the antisense oligomer comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2’-O-methyl moiety, a 2’-Fluoro moiety, a 2’-O-methoxyethyl moiety, or a 2’-NMA moiety.
56. The method of any one of claims 32-55, wherein the antisense oligomer comprises at least one modified sugar moiety.
57. The method of any one of claims 32-56, wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at a 5’ end of the antisense oligomer.
58. The method of any one of claims 32-56, wherein the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at a 5’ end of the antisense oligomer.
59. The method of any one of claims 32-58, wherein the antisense oligomer comprises one, two, three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 5’ end of the antisense oligomer.
60. The method of any one of claims 32-59, wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at a 3’ end of the antisense oligomer.
61. The method of any one of claims 32-59, wherein the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at a 3’ end of the antisense oligomer.
62. The method of any one of claims 32-61 , wherein the antisense oligomer comprises one, two, three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 3’ end of the antisense oligomer.
63. The method of any one of claims 32-62, wherein the antisense oligomer comprises three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 5’ end of the antisense oligomer; three, four, five, or six 2’-O-methoxyethyl modified nucleosides at a 3’ end of the antisense oligomer; and a phosphorothioate linkage between any two neighboring nucleosides of the antisense oligomer.
64. The method of any one of claims 32-62, wherein the antisense oligomer comprises: a 5’ region consisting of three, four, five, or six linked nucleosides; a central region consisting of eight, nine, ten, eleven, or twelve linked nucleosides; and a 3’ region consisting of three, four, five, or six linked nucleosides; wherein each of the three, four, five, or six linked nucleosides in the 5’ region and each of three, four, five, or six linked nucleosides in the 3 ’ region comprise a modified sugar moiety, and wherein each of the eight, nine, ten, eleven, or twelve linked nucleosides in the central region is a deoxyribonucleoside.
65. The method of any one of claims 32-64, wherein each cytosine in the ribonucleoside in the antisense oligomer is methylated.
66. The method of any one of claims 32-65, wherein each cytosine in the deoxyribonucleoside in the antisense oligomer is unmethylated.
67. The method of any one of claims 32-66, wherein in the antisense oligomer, each cytosine in the ribonucleoside is methylated and each cytosine in the deoxyribonucleoside is unmethylated.
68. The method of any one of claims 32-67, wherein the antisense oligomer is from 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to20 nucleobases, 8 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 15 to 50 nucleobases, 15 to 40 nucleobases,15 to 35 nucleobases, 15 to 30 nucleobases, 15 to 25 nucleobases, 15 to 20 nucleobases, 15 to 19 nucleobases, 15 to 18 nucleobases, 15 to 16 nucleobases, 16 to 20 nucleobases, 16 to 19 nucleobases,16 to 18 nucleobases, 17 to 20 nucleobases, 17 to 19 nucleobases, or 18 to 20 nucleobases in length.
69. The method of any one of claims 32-68, wherein the antisense oligomer is a modified oligonucleotide comprising the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
70. The method of any one of claims 32-68, wherein the antisense oligomer is a modified oligonucleotide consisting of the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
71. The method of any one of claims 32-70, wherein the method comprises administering about 1 pg to about 50 pg, about 2 pg to about 20 pg, about 5 pg to about 15 pg, about 8 pg to about 12 pg, about 0.5 pg to about 25 pg, about 1 pg to about 15 pg, about 2 pg to about 10 pg, or about 4 pg to about 8 pg of the antisense oligomer to the subject.
72. The method of any one of claims 32-70, wherein the method comprises administering about 5 pg, about 6 pg, about 7 pg, about 8 pg, about 9 pg, about 10 pg, about 11 pg, about 12 pg, about 13 pg, about 14 pg, about 15 pg, about 16 pg, about 17 pg, about 18 pg, about 19 pg, about 20 pg, about21 pg, about 22 pg, about 23 pg, about 24 pg, about 25 pg, about 26 pg, about 27 pg, about 28 pg, about 29 pg, or about 30 pg of the antisense oligomer to the subject.
73. The method of any one of claims 33-68, wherein the method comprises administering the vector to the subject, and wherein the vector comprises a viral vector encoding the agent.
74. The method of claim 73, wherein the viral vector comprises an adenoviral vector, adeno- associated viral (AAV) vector, lentiviral vector, Herpes Simplex Virus (HSV) viral vector, or retroviral vector.
75. The method of any one of claims 32-74, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable excipient, carrier, or diluent.
76. The method of any one of claims 32-75, wherein the pharmaceutical composition is a liquid composition.
77. The method of claim 76, wherein the pharmaceutical composition comprises from 0.1 ml to 50 ml of a diluent, and wherein the compound is solubilized or diluted in the diluent.
78. The method of any one of claims 32-77, wherein the pharmaceutical composition comprises about 40 pl, 50 pl, 60 pl, 70 pl, 0.1 ml, 0.5 ml, 1 ml, 2 ml, 2.5 ml, 3 ml, 4 ml, 5 ml, 6 ml, 7 ml, 8 ml, 9 ml, 10 ml, 11 ml, 12 ml, 13 ml, 14 ml, 15 ml, 16 ml, 17 ml, 18 ml, 19 ml, 20 ml, 25 ml, 30 ml, 35 ml, 40 ml, 45 ml, 50 ml, or 75 ml of the diluent.
79. The method of any one of claims 32-77, wherein the pharmaceutical composition comprises about 40 pl to 70 pl of the diluent, 1 ml to 5 ml of the diluent, 1 ml to 20 ml of the diluent, 2 ml to 10 ml of the diluent, or 10 ml to 80 ml of the diluent.
80. The method of any one of claims 32-79, wherein the diluent comprises a cerebral spinal fluid (CSF) sample from the subject or an artificial cerebral spinal fluid (aCSF) solution.
81. The method of any one of claims 32-80, wherein the method ameliorates one or more symptoms of the disease or condition.
82. The method of claim 81, wherein the one or more symptoms comprise motor delays, intellectual disability, delayed speech and language development, seizures, behavioral difficulties (e.g., hyperactivity, emotional instability, anxiety, frustration, tantrums), ear infections, hearing loss, epilepsy, higher probability of sudden unexpected death in epilepsy (SUDEP), low muscle tone (e.g., hypotonia), ataxic gate (e.g., wide-based, clumsy gate), delays in development of motor skills (e.g., sitting or walking), difficulties with social interaction, and any combination thereof.
83. Use of a pharmaceutical composition comprising an antisense oligomer targeted to UBE3A in the manufacture of a medicament for the treatment of a disease or disorder in a subject in need thereof, wherein the pharmaceutical composition comprises the antisense oligomer at an amount of about 1 pg to about 50 pg, about 2 pg to about 20 pg, about 5 pg to about 15 pg, about 8 pg to about 12 pg, about 0.5 pg to about 25 pg, about 1 pg to about 15 pg, about 2 pg to about 10 pg, or about 4 pg to about 8 pg, and wherein the antisense oligomer with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 1-92.
84. The use of claim 83, wherein the antisense oligomer is a modified oligonucleotide with at least 80% sequence identity to the sequence set forth in any one of SEQ ID NO: 154-189 or 192-247.
85. The use of claim 83 or 84, wherein the disease or condition comprises Dupl5q syndrome.
Citation Information
Patent Citations
UBE3a antisense therapeutics
US20220259601A1
UBE3a genes and expression cassettes and their use
WO2020237130A1