Heterodimeric proteins comprising dimerization motifs and methods of using

Heterodimeric proteins combining TCRs with dimerization motifs address the challenges of TCR mispairing and reduced expression in cancer immunotherapy, improving therapeutic efficacy and safety for TCR-redirected T cells.

WO2025133340A1PCT designated stage expired Publication Date: 2025-06-26LUDWIG INSTITUTE FOR CANCER RESEARCH LTD +3
View PDF 26 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2024/088236
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-21
Filing Date
2024-12-20
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

Current TCR-based cancer immunotherapies face challenges such as TCR mispairing, reduced protein levels, and increased risk of self-reactive TCRs, leading to toxicity and decreased therapeutic efficacy.

Method used

Development of heterodimeric proteins comprising a TCR and a dimerization motif, which include specific sequences with high identity to SEQ ID NOs, to improve TCR pairing and expression, thereby enhancing therapeutic efficacy and safety.

Benefits of technology

The use of heterodimeric proteins with dimerization motifs effectively reduces TCR mispairing, increases TCR expression, and enhances the therapeutic efficacy and safety of TCR-redirected T cells for cancer immunotherapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000052_0001
    Figure IMGF000052_0001
  • Figure IMGF000053_0001
    Figure IMGF000053_0001
  • Figure IMGF000055_0001
    Figure IMGF000055_0001
Patent Text Reader

Abstract

Provided herein are heterodimeric proteins comprising a T cell receptor (TCR) and a dimerization motif. Also provided are immune cells expressing such heterodimeric proteins and the use of such heterodimeric protein and immune cells in adoptive cell transfer or adoptive cell therapy.
Need to check novelty before this filing date? Find Prior Art

Description

HETERODIMERIC PROTEINS COMPRISING DIMERIZATION MOTIFS AND METHODS OF USINGCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Application No. 63 / 613,432 filed December 21, 2023, which is incorporated herein by reference in its entirety.REFERENCE TO A SEQUENCE LISTING

[0002] This application contains a Sequence Listing, which has been submitted electronically in xml format and is hereby incorporated by reference in its entirety. Said xml copy, created on December 17, 2024, is named SeqList-084276-00402.xml and is 67,369 bytes in size.FIELD

[0003] The present disclosure relates generally to the field of molecular biology and medicine. More specifically, the present disclosure relates to compositions and methods for treating cancer or a tumor in a subject by modulating the immune system of the subject.BACKGROUND

[0004] Adoptive cell transfer (ACT) immunotherapies are a recently established class of therapies for treating various diseases, including cancer, autoimmune conditions, and infections (including viral infections). There are two main ACT approaches. The first approach involves isolating tumor infiltrating T cells (TILs) from a patient biopsy, expanding the TILs, and reinfusing them into the patient. The second approach involves the genetic modification of peripheral blood T cells either with a T cell receptor (TCR) or a chimeric antigen receptor (CAR).

[0005] A TCR generally is a disulfide-linked, membrane-bound, heterodimeric protein comprising two variable chains, which usually form a complex with six invariant CD3 chain molecules. In humans, the vast majority (95%) of T cells express TCRs comprising variable alpha (a) and beta (P) chains (encoded by TRA and TRB, respectively). 5% of human T cellsexpress TCRs comprising variable gamma and delta (y / 8) chains (encoded by TRG and TRD, respectively).

[0006] The introduction of genetic information encoding a transgenic TCR (also referred to herein as an “Exo-TCR” or a heterologous TCR) into a T cell during TCR gene therapy can cause a variety of problems. To start, expressing both heterologous and endogenous TCR alpha and beta chains in the same T cell can lead to incorrect chain pairings. Such TCR mispairing in turn can reduce the protein levels of correctly paired Exo-TCRs, thus reducing the desired therapeutic effect. Additionally, TCR mispairing can also create self-reactive TCRs. Consistent with this, lethal graft-versus-host disease has been observed in mouse models of T cell receptor gene therapy. As more and more TCR-based therapies enter the clinic, there is an increased risk that such toxicity will also occur in patients. Finally, both transgenic TCRs and endogenous TCRs (also referred to as native or endogenous (endo) TCRs herein) compete for endogenous CD3 to form TCR complexes on the cell surface. This competition decreases the surface expression of both transgenic and endogenous TCR complexes.

[0007] Various approaches have been employed to improve surface expression of the Exo- TCR, including murinization (use of murine constant regions), the use of TCR-specific disulfide bonds, the use of single-chain TCRs, TCR domain swapping, and TCR framework engineering. However, none of these strategies completely abrogates mispairing. While complete elimination of TCR mispairing can be achieved by deleting endogenous alpha / beta TCR chains using genetic editing, a major concern of such an approach is the relatively high frequency of off-target effects.

[0008] As such, new engineering approaches for improving the therapeutic efficacy and safety of TCR-redirected T cells for cancer immunotherapy are urgently needed.SUMMARY

[0009] Provided herein are heterodimeric proteins comprising a TCR and a dimerization motif as well as nucleic acids encoding heterodimeric proteins disclosed herein, cells comprising nucleic acids encoding heterodimeric proteins, cells expressing heterodimeric proteins disclosed herein, and methods of using any of the compositions provided herein for treating a subject.

[0010] Provided herein is a heterodimeric protein comprising:(a) (1) a first polypeptide comprising (i) a first T cell receptor (TCR) variable chain and (ii) a first dimerization domain comprising a sequence having at least 80% sequenceidentity to SEQ ID NO:9 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO: 11; or(b) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO: 11 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO:9.

[0011] In some embodiments, (1) the first TCR variable chain is a TCR alpha chain and the second TCR variable chain is a TCR beta chain or (2) the first TCR variable chain is a TCR beta chain and the second TCR variable chain is a TCR alpha chain. In some embodiments, (1) the first TCR variable chain is a TCR gamma chain and the second TCR variable chain is a TCR delta chain or (2) the first TCR variable chain is a TCR delta chain and the second TCR variable chain is a TCR gamma chain.

[0012] Provided is a heterodimeric protein comprising:(a) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO:9 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO: 11; or(b) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO: 11 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO:9.

[0013] Provided is a heterodimeric protein comprising:(a) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising SEQ ID NO:9 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising SEQ ID NO: 11; or(b) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising SEQ ID NO: 11 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising SEQ ID NO:9.

[0014] In embodiments, (1) the first polypeptide further comprises a sequence having at least 80% sequence identity to SEQ ID NO: 19 and the second polypeptide further comprises a sequence having at least 80% sequence identity to SEQ ID NO:20; or (2) the first polypeptide further comprises a sequence having at least 80% sequence identity to SEQ ID NO:20 and the second polypeptide further comprises a sequence having at least 80% sequence identity to SEQ ID NO: 19.

[0015] In embodiments, (1) the first polypeptide further comprises a sequence having at least 90% sequence identity to SEQ ID NO: 19 and the second polypeptide further comprises a sequence having at least 90% sequence identity to SEQ ID NO:20; or (2) the first polypeptide further comprises a sequence having at least 90% sequence identity to SEQ ID NO:20 and the second polypeptide further comprises a sequence having at least 90% sequence identity to SEQ ID NO: 19.

[0016] In embodiments, (1) the polypeptide further comprises SEQ ID NO: 19 and the second polypeptide further comprises SEQ ID NO:20; or (2) the first polypeptide further comprises SEQ ID NO:20 and the second polypeptide further SEQ ID NO: 19.

[0017] In embodiments, (1) the first polypeptide further comprises a first linker connecting the first TCR variable chain and the first dimerization domain; and / or (2) the second polypeptide further comprises a second linker connecting the second TCR variable chain and the second dimerization domain.

[0018] In embodiments, the first and / or the second linker is a flexible polypeptide linker.

[0019] In embodiments, the first and / or the second linker comprises SEQ ID NO: 13 or SEQID NO: 14.

[0020] Provided is a heterodimeric protein comprising:(a) (1) a first polypeptide comprising from N- to C-terminus: (i) a first TCR variable chain, wherein the first TCR variable chain is a TCR alpha chain, (ii) a linker, and (iii) a first dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO:9; and (2) a second polypeptide comprising from N- to C-terminus: (i) a second TCR variable chain, wherein the second TCR variable chain is a TCR beta chain, (ii) a linker, and (iii) a second dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO: 11; or(b) (1) a first polypeptide comprising from N- to C-terminus: (i) a first TCR variable chain, wherein the first TCR variable chain is a TCR alpha chain, (ii) a linker, and (iii) a first dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO: 11; and (2) a second polypeptide comprising from N- to C-terminus: (i) asecond TCR variable chain, wherein the second TCR variable chain is a TCR beta chain, (ii) a linker, and (iii) a second dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO:9.

[0021] Provided is a heterodimeric protein comprising:(a) (1) a first polypeptide comprising from N- to C-terminus: (i) a first TCR variable chain, wherein the first TCR variable chain is a TCR alpha chain, (ii) a linker, and (iii) a first dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO:9; and (2) a second polypeptide comprising from N- to C-terminus: (i) a second TCR variable chain, wherein the second TCR variable chain is a TCR beta chain, (ii) a linker, and (iii) a second dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO: 11; or(b) (1) a first polypeptide comprising from N- to C-terminus: (i) a first TCR variable chain, wherein the first TCR variable chain is a TCR alpha chain, (ii) a linker, and (iii) a first dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO: 11; and (2) a second polypeptide comprising from N- to C-terminus: (i) a second TCR variable chain, wherein the second TCR variable chain is a TCR beta chain, (ii) a linker, and (iii) a second dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO:9.

[0022] In embodiments, the heterodimeric protein comprises:(a) (1) a first polypeptide comprising from N- to C-terminus: (i) a first TCR variable chain, wherein the first TCR variable chain is a TCR alpha chain, (ii) a linker, and (iii) a first dimerization domain comprising SEQ ID NO:9; and (2) a second polypeptide comprising fromN- to C-terminus: (i) a second TCR variable chain, wherein the second TCR variable chain is a TCR beta chain, (ii) a linker, and (iii) a second dimerization domain comprising SEQ ID NO: 11; or(b) (1) a first polypeptide comprising from N- to C-terminus: (i) a first TCR variable chain, wherein the first TCR variable chain is a TCR alpha chain, (ii) a linker, and (iii) a first dimerization domain comprising SEQ ID NO: 11; and (2) a second polypeptide comprising fromN- to C-terminus: (i) a second TCR variable chain, wherein the second TCR variable chain is a TCR beta chain, (ii) a linker, and (iii) a second dimerization domain comprising SEQ ID NO: 9.

[0023] In embodiments, the first polypeptide further comprises a sequence that is C- terminally located with respect to the first dimerization domain and that has at least 80% sequence identity to SEQ ID NO: 19 or 20.

[0024] In embodiments, the second polypeptide further comprises a sequence that is C- terminally located with respect to the second dimerization domain and that has at least 80% sequence identity to SEQ ID NO: 19 or 20.

[0025] In embodiments, the first polypeptide further comprises a sequence that is C- terminally located with respect to the first dimerization domain and that comprises SEQ ID NO: 19 or 20.

[0026] In embodiments, the second polypeptide further comprises a sequence that is C- terminally located with respect to the second dimerization domain and that comprises SEQ ID NO: 19 or 20.

[0027] Provided is a heterodimeric protein, wherein:(a) the first polypeptide further comprises a sequence that is C-terminally located with respect to the first dimerization domain and that has at least 80% sequence identity to SEQ ID NO: 19 and the second polypeptide further comprises a sequence that is C- terminally located with respect to the second dimerization domain and that has at least 80% sequence identity to SEQ ID NO:20; or(b) the first polypeptide further comprises a sequence that is C-terminally located with respect to the first dimerization domain and that has at least 80% sequence identity to SEQ ID NO:20 and the second polypeptide further comprises a sequence that is C- terminally located with respect to the second dimerization domain and that has at least 80% sequence identity to SEQ ID NO: 19.

[0028] In embodiments, (a) the first polypeptide further comprises a sequence that is C- terminally located with respect to the first dimerization domain and that has at least 90% sequence identity to SEQ ID NO: 19 and the second polypeptide further comprises a sequence that is C-terminally located with respect to the second dimerization domain and that has at least 90% sequence identity to SEQ ID NO:20; or (b) the first polypeptide further comprises a sequence that is C-terminally located with respect to the first dimerization domain and that has at least 90% sequence identity to SEQ ID NO:20 and the second polypeptide further comprises a sequence that is C-terminally located with respect to the second dimerization domain and that has at least 90% sequence identity to SEQ ID NO: 19.

[0029] In embodiments, (a) the first polypeptide further comprises a sequence that is C- terminally located with respect to the first dimerization domain and that comprises SEQ ID NO: 19 and the second polypeptide further comprises a sequence that is C-terminally located with respect to the second dimerization domain and that comprises SEQ ID NO:20; or (b) the first polypeptide further comprises a sequence that is C-terminally located with respect to thefirst dimerization domain and that comprises SEQ ID NO:20 and the second polypeptide further comprises a sequence that is C-terminally located with respect to the second dimerization domain and that comprises SEQ ID NO: 19.

[0030] Provided is a heterodimeric protein comprising:(a) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a sequence having at least 80% sequence identity to SEQ ID NO: 10 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a sequence having at least 80% sequence identity to SEQ ID NO: 12; or(b) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a sequence having at least 80% sequence identity to SEQ ID NO: 12 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a sequence having at least 80% sequence identity to SEQ ID NO: 10.

[0031] Provided is a heterodimeric protein comprising:(a) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a sequence having at least 90% sequence identity to SEQ ID NO: 10 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a sequence having at least 90% sequence identity to SEQ ID NO: 12; or(b) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a sequence having at least 90% sequence identity to SEQ ID NO: 12 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a sequence having at least 90% sequence identity to SEQ ID NO: 10.

[0032] Provided is a heterodimeric protein comprising:(a) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a sequence comprising SEQ ID NO: 10 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a sequence comprising SEQ ID NO: 12; or(b) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a sequence comprising SEQ ID NO: 12 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a sequence comprising SEQ ID NO: 10.

[0033] In embodiments, (a) (i) the first TCR variable chain is a TCR alpha chain and the second TCR variable chain is a TCR beta chain or (ii) first TCR variable chain is a TCR beta chain and the second TCR variable chain is a TCR alpha chain or (b) (i) the first TCR variable chain is a TCR gamma chain and the second TCR variable chain is a TCR delta chain or (ii) the first TCR variable chain is a TCR delta chain and the second TCR variable chain is a TCR gamma chain.

[0034] Provided is a nucleic or set of nucleic acids encoding the heterodimeric protein disclosed herein.

[0035] Provided is a vector comprising a nucleic or set of nucleic acids disclosed herein.

[0036] Provided is a cell comprising a nucleic or set of nucleic acids disclosed herein. The cell may be an immune cell. The immune cell may be a lymphocyte. The immune cell may be a T lymphocyte.

[0037] Provided is a pharmaceutical composition comprising (a) a heterodimeric protein disclosed herein or a cell disclosed herein and (b) a pharmaceutically acceptable excipient.

[0038] Provided is a method of treating cancer, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein disclosed herein or a cell expressing a heterodimeric protein disclosed herein.

[0039] Provided is a method of reducing the growth of a tumor, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein disclosed herein or a cell expressing a heterodimeric protein disclosed herein.

[0040] Provided is a method of reducing cancer sternness, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein disclosed herein or a cell expressing a heterodimeric protein disclosed herein.

[0041] Provided is a method of reducing tumor-associated fibrosis, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein disclosed herein or a cell expressing a heterodimeric protein disclosed herein.

[0042] Provided is a method of reducing tumor metastasis, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein disclosed herein or a cell expressing a heterodimeric protein disclosed herein.

[0043] Provided is a method of increasing cytokine production in the tumor microenvironment, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein disclosed herein or a cell expressing a heterodimeric protein disclosed herein.

[0044] Provided is a method of method of increasing anti-tumor immunity, the method comprising administering to a subject in need thereof a pharmaceutical composition comprisinga heterodimeric protein disclosed herein or a cell expressing a heterodimeric protein disclosed herein.

[0045] Provided is a method of method of increasing infiltration of a tumor with immune cells, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein disclosed herein or a cell expressing a heterodimeric protein disclosed herein.

[0046] Provided is a method of method of reducing T cell tolerance, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein disclosed herein or a cell expressing a heterodimeric protein disclosed herein.

[0047] In embodiments, the subject has one or more cancers selected from the group consisting of sarcoma, carcinoma, melanoma, pancreatic cancer, thyroid cancer, lung cancer, colorectal cancer, squamous cancer, prostate cancer, breast cancer, bladder cancer, ovarian, and gastric cancer.

[0048] In embodiments, the method further comprises administering to the patient an additional therapeutic agent. The additional therapeutic agent may be a chemotherapeutic agent. The additional therapeutic agent may be a chemotherapeutic agent or an immune checkpoint inhibitor. The immune checkpoint inhibitor may be selected from the group of a PD1 inhibitor, a PD-L1 inhibitor, a CD28 inhibitor, a CTLA4 inhibitor, or combinations thereof. The immune checkpoint inhibitor may be an antibody or fragment thereof.

[0049] In embodiments, the subject is a human.BRIEF DESCRIPTION OF THE FIGURES

[0050] Figs. 1A, IB, 1C, ID, IE, and IF illustrate the CRISPR-Cas9 knockout screening strategy used to evaluate TCR chain mispairing. Fig. 1A. Schematic of screening strategy to evaluate TCR chain mispairing in T cells, in which genes encoding the TCR alpha endo (alpha-endo) chain, the TCR beta-endo chain, or the TCR alpha / beta-endo chains have been knocked out and in which an exogenous TCR (exo-TCR) has been introduced by viral transduction. Four different types of TCRs can be expressed in the transduced T cells, namely, (1) the correctly paired Exo-TCR, (2) the correctly paired endogenous TCR endo-TCR, (3) a TCR comprising a TCR-exo alpha chain and a TCR-endo beta chain (mispaired TCR), and (4) and a TCR comprising a TCR-exo beta chain and a TCR-endo alpha chain (mispaired TCR). Following transduction of the T cells (step 2), the cells were electroporated with desired aribonucleoprotein (RNP) complex with TRAC (targeting the endogenous gene for TCR chain alpha) and / or TRBC (targeting the endogenous gene for TCR chain beta) guides to create single or double TCR knockout (KO) T cells (step 3). TCR chain mispairing was evaluated using flow cytometry (FC) and calculated as a percentage of the TCR+Tetramer' population in transduced T cells (Transduced + CRISPR), compared to a control group (CRISPR alone) (step 4). The knockout of both endogenous TRAC (alpha-endo KO) and endogenous TRBC (beta-endo KO) abrogates chain mispairing. Fig. IB. Top: Representative dot plots illustrating the KO efficiency for TRAC and / or TRBC in mouse CD8+T cells. Bottom: Bar plots representing pooled data (n=3) for mouse (left) and human (right) TRAC and / or TRBC KO (alpha-endo, beta-endo and alpha / beta-endo KO). Mock electroporated (Mock) T cells were used as controls in all the experiments. Fig. 1C. Comparison of dual Va (V-alpha) and VP (V-beta) staining versus Tetramer staining of OT1 TCR-transduced T cells. Top: Representative flow cytometry plots showing percentage of Valpha2+Vbeta5+(left; 79%) and Tetramer (right; 29%) population of equivalent Thyl.l+transduced T cells. Thyl.l served as a surrogate marker for transduced T cells. Bottom: Plot represents pooled data from n=4 biological replicates. Untransduced (UTD) T cells were used as control. Fig. ID. Evaluation of TCR chain mispairing. Top: Representation of possible TCR mispairing on gated transduced mCherry+T cells expressing an endo-TCR, or in T cells in which alpha-endo, beta-endo or alpha / beta-endo chain genes are knocked out. Bottom: Summary of mispairing levels for a panel of human TCRs as well as mouse OT1 TCR (n=3, means ± SEM). Untransduced (UTD) and UTD mock electroporated (z.e., Cas9 only electroporated) T cells were used as controls in all experiments. Top bars: alpha chain. Bottom bars: beta chain. Fig. IE. TCR alpha-exo and alpha-endo chains do not homodimerize. Top left: Pan-TCR staining of mock electroporated (Cas9 only), untransduced (UTD) T cells. Top right: Representative flow cytometry plots show the percentage of TCR+T cells in the UTD and MC2 TCR alpha-chain transduced cells in beta- endo KO T cells. mCherry served as a surrogate marker for transduced (TD) T cells. Bottom: Bar plot represents pooled data (n=4, means ± SEM). Fig. IF. Evaluation of exo-TCR expression in beta-endo KO T cells using previously described chain-pairing strategies. Top: Representative flow cytometry plots show the level of MC2b- exo chain mispairing with alpha- endo in beta-endo KO T cells, gated on equivalent levels of transduced cells (mCherry+). Bottom: Bar plot represents MC2 beta-exo mispairing in beta-endo KO T cell for chain-pairing strategies (n=2) including a non-native disulfide bridge (DB), replacement of human with mouse constant regions (EIM), and framework (FW) mutations (z.e., L96alpha, R9beta andYlObeta) previously described to generate dominant TCRs. mCherry served as a surrogate marker for transduced T cells.

[0051] Figs. 2A, 2B, 2C, 2D, 2E, and 2F illustrate that a Zip A / B dimerization motif promotes exogenous TCR chain pairing and increases TCR expression more efficiently than previously described strategies. Fig. 2A. Top: Illustration of TCR alpha and beta chains fused to gamma-aminobutyric acid (GABA)-receptor derived heterodimerization domains, ZipA and ZipB. The homodimerization domains were linked to an endoplasmic reticulum (ER) retention motif and a masking sequence, respectively. Bottom: A first construct, TCRvl, allows the expression of (1) a fusion ofZipB-ER and the TCRb-chain and (2) a fusion of ZipA with the TCR a-chain. A second construct, TCRv2, allows the expression of (1) a fusion of ZipB-ER and the TCR a-chain and (2) a fusion of ZipA with the TCR b-chain. The vectors also encode mCherry as a marker for transduction. P2A and T2A are self-cleaving peptides. Fig. 2B. Top: Jurkat T cells. From left to right: (i) untransduced (UTD), (ii) lentivirally transduced to express the wild-type MAGE-C2 TCR, (iii) lentivirally transduced to express the MAGE-C2 TCRvl construct, and (iv) lentivirally transduced to express the MAGE-C2 TCRv2 construct. Chain mispairing was evaluated by flow cytometric analysis of Tstained Jurkat cells. Bottom: mCherry expression and anti-TCRvbeta3 staining (binds to the human V-beta 3 chain of the T-cell receptor) demonstrated similar transduction efficiencies in Jurkat cells for the different constructs. Tetramer staining revealed that fusion of a TCR to a ZipER dimerization motif can effectively abrogate TCR chain mispairing. Fig. 2C. The ER retention motif prevents mispairing of the TCR beta chain in mouse and human T cells. Left: Representative dot plots for Vbeta5 stained mouse CD8+T cells transduced (TD) with the OT1 TCR beta chain + / - ZipER retention motif (gated on Thyl.l+). Thy 1.1 served as a surrogate marker for transduced T cells. Basal expression of Vbeta5 in untransduced T cells (UTD) was used as control. Right: Bar plot of pooled data from n=3 biological replicates (means ± SEM). Fig 2D. Bar plot summarizing Vbeta3 staining for human CD8+ T cells transduced (mCherry+) with MC2 TCR beta chain + / - ER motif and Zip alone (n=3, means ± SEM). Fig. 2E. Left: Representative histogram plot comparing tetramer staining of TCR-Zip or TCR-ZipER engineered T cells versus previously described chain-pairing strategies, a non-native disulfide bond (DB), framework region mutations (FW), and replacement of human with mouse constant regions (HM). Right: Summary of Tetramer staining of T cells transduced with TCRs employing different chain pairing strategies (n=5, means ± SEM). Tetramer staining of engineered T cells gated on mCherry+with untransduced (UTD) T cells served as a negative control. Fig. 2F. Bar plot of MC2 beta-exo chain mispairing in beta-endo KO T cells for all chain-pairing strategies(n=4, means ± SEM). TCR+Tetramer percentage analyzed on gated mCherry+T cells. UTD T cells were used as a negative control. TCR expression in mouse T cells was evaluated by pan anti-TCRbeta antibody staining.

[0052] Figs. 3A, 3B, 3C, 3D, 3E, and 3F illustrate that the Zip A / B dimerization motif universally prevents exogenous TCR chain mispairing. Fig. 3A. Top: Representative dot plots show mispairing analysis ofMC2 versus MC2-ZipER TCR transduced T cells with alpha- endo or beta-endo chains genes knocked out. Bottom: Exo-TCR mispairing analysis (gated on mCherry+or Thyl .1+) for various TCRs + / - ZipER (n=3). A2 / NY = wild-type (also referred to as parent) NY-ESO TCR. A2 / NY-A97L = affinity optimized A97L NY-ESO TCR. HPV = TCR that binds to a HPC peptide. The ZNT8 TCR binds to Zinc Transporter 8 (ZnT8). The OT1 TCR is of murine origin. Fig. 3B. Top: Representative ImageStream images for Tetramer staining by DRB3 / NY-TCR + / - ZipER engineered T cells. Bottom: Bar plots show Tetramer staining (gated on mCherry+ or Thyl.l+) for T cells transduced to express a panel of TCRs + / - ZipER. Number of biological replicates (n) is indicated in each plot. Fig. 3C. ZipER engineering enforces TCR expression even at low transduction efficiency. Left: Representative dot plots demonstrating various TCRs + / - ZipER T cells with low (L), intermediate (I) and high (H) level of transduction based on mCherry mean fluorescence intensity (MFI). Right: Tetramer staining of TCR versus TCR-ZipER T cells at different levels of transduction efficiency (n=3). Fig. 3D. Tetramer staining of TCR + / - ZipER transduced T cells (gated on mCherry+or Thyl. l+) in which alpha / beta-endo TCR chains are knocked out. Number of biological replicates (n) shown in each plot. mCherry and Thyl. l serve as surrogate markers for transduced T cells. For statistical analysis a paired t test was performed. Fig. 3E. ZipER engineering augments TCR expression levels independently of chain mispairing. Top: Schematic of the generation of Jurkat TCR alpha / beta KO clones. Bottom: representative dot plots of two different Jurkat TCR alpha / beta KO clones. Fig. 3F. Top: representative dot plots of mCherry expression in DRB3 / NY TCR+ / - ZipER engineered T cells. Middle: representative dot plots for Tetramer staining of Jurkat TCR alpha / beta KO T cells transduced with the DRB3 / NY TCR+ / - ZipER. Bottom: Plot represents pooled data from two different KO clones transduced with the A2 / NY TCR + / - ZipER.

[0053] Figs. 4A, 4C, 4C, 4D, 4E, 4F, 4G, and 4H illustrate ZipER motif does not interfere with TCR-CD3 complex association and augments the function and safety of TCR-engineered T cells. Fig. 4A. Model of the engineered TCR with the GABA ZipER domain. Left: Possible conformation for MC2 TCR alpha and beta chain transmembrane helices with intracellular C-termini connected to the ZipER by two flexible linkers. Theapproximate membrane position is indicated by horizontal lines. Right: Full model of the engineered TCR alpha and beta chains with CD3 epsilon, delta, gamma and zeta complex proteins. The intrinsically disordered intracellular domains are shown in one conformation compatible with the ZipER domain for illustration purposes but can potentially adopt widely different configurations. Fig. 4B. Sequences for the local homology modeling step and secondary structure predictions using Porter 4.0. See Table 6 for further information on sequences. Bold letters highlight residues that were resolved in the template structures used for homology modelling. On the prediction line, H denotes a predicted a-helical conformation, and C denotes a predicted random coil conformation. Numbers on the confidence line range from 1 (low confidence) to 9 (high confidence). Fig. 4C. TCR and TCR-ZipER cell-surface expression in + / - CD3-zeta KO T cells (n=3). Fig. 4D. Intracellular cytokine production for TCR- versus TCR-ZipER T cells co-cultured at an mCherry+T cell / target cell ratio of 1 : 1 for 5 hours with increasing concentrations of target peptide-pulsing (n=3, mean ± SEM). Top trace: TCR-ZipER. Middle trace: TCR. Bottom trace: UTD. Fig. 4E. Representative plot illustrates cytolytic capacity of TCR- versus TCR-ZipER T cells measured by IncuCyte (data are representative of n=3 biological replicates). Traces from top to bottom: Target alone, UTD, TCR, TCR-ZipER. Fig. 4F. ZipER engineering enhances the cytolytic capacity of T cells. Top: Representative IncuCyte images illustrate cytolytic capacity of mouse OT1 TCR+ / - ZipER engineered CD8+T cells co-cultured with B16-OVA. TCR + / - ZipER T cells were co-cultured at transduced (z.e., mCherry+or Thy 1. l+)-to-target ratio of 1 : 1 with their respective target cells. Dead tumor cells take up Cytotox red dye. Bottom: Representative plots illustrate cytolytic capacity of transduced CD8+with OT1 and A2 / NY TCR + / -ZipER (data are representative of n=3 biological replicates). Traces from top to bottom: TCR-ZipER, TCR, UTD, target only. Fig. 4G. LDH release measured for TCR + / - ZipER engineered primary human T cells co- cultured at different effector (z.e., mCherry+or Thyl.l+)-to-target ratio of 1 : 1 with their respective target cells. The bar plots represent pooled data from n=3 biological replicates (means ± SEM). Bars from left to right as in figure legend from top to bottom. Fig. 4H. LDH release for two clones of TCR alpha / betaKO Jurkat E6.1 cells transduced to express DRB3 / NY TCR + / - ZipER following overnight co-culture with T333A-CIITA melanoma cells (right, n=2). The bar plots represent pooled data from n=2 different KO clones. Untransduced (UTD) primary or Jurkat T cells served as controls for the experiments. Bars from left to right as in figure legend from top to bottom.

[0100] Figs. 5A, 5B, 5C, 5D, 5E, 5F, and 5G illustrate that TCR-ZipER T cells demonstrate superior in vivo tumor control and safety. Fig. 5A. Quantification of numbersof cell clusters observed at 10, 15, and 20 h post co-culture (5h of imaging) per visual field (VF) for all conditions. Note that ZipER TCR T cells co-cultures show significantly higher numbers of clusters at all measured timepoints (n=3, means ± SD). Bars from left to right: Target, UTD, TCR, TCR-ZipER. Fig. 5B. Cluster sizes (area in pm2) measured at 15h of coculture in all the groups, n > 20 clusters per condition. Fig. 5C. Representative images illustrating the process of cell cluster formation for TCR ZipER in co-culture with the target cells. T cells start to engage with one target cell (T) (example 85min) and subsequently two and more targets surround one T cell. Scale 10 pm. Untransduced (UTD) T cells served as controls for the experiments. Fig. 5D. Target cell killing at immune synapses for A2 / NY-WT ZipER TCR. Selected images at different times (10, 17 and 37 min). At 10 minutes, the T cell was scanning the target cell at an initial contact. At 17 minutes, a stable synapse was formed. Subsequently, the T cell detached and target cell killing occurred at 37 minutes. Fig. 5E. Top: Schematic of adoptive T-cell transfer studies for syngeneic (left) and xenograft (right) tumor models. Bottom: Tumor control curves (means ± SEM). Traces from top to bottom: UTD, OT1, OTl-ZipER. Fig. 5F. Improved survival of tumor-bearing mice treated with TCR-ZipER versus TCR-T cells. Kaplan-Meier survival curves for OT1 (left) and A2 / A97L (right) TCR + / - ZipER T cell treated mice in EG7-OVA and A375 tumor models, respectively. Traces from top to bottom: TCR-ZipER, TCR, UTD. Fig. 5G. Top: Schematic of xGvHD in vivo model. Bottom: Kaplan-Meier survival curves. Statistical significance was analyzed by two-way ANOVA with Tukey’s multiple comparison test. Traces from top to bottom: PBS / MC2 TCR- ZipER endo-beta, MC2 TCR endo-beta, UTD.

[0054] Figs. 6A, 6B, 6C, 6D, 6E, and 6F illustrate that WT TCR-ZipER engineered T cells outperform affinity-enhanced TCR T cells. Fig. 6A. WT TCR-ZipER engineered T cells outperform affinity-enhanced TCR T cells. Top, left: Representative dot plots of CD8+T cells transduced with the affinity enhanced A97L-A2 / NY-TCR versus the wild type (WT) A2 / NY TCR + / - ZipER with mCherry as a surrogate marker for transduction. Bottom, left: Representative dot plots of Tetramer staining by transduced CD8+T cells (gated on mCherry+) for A97L-A2 / NY TCR-T cells versus WT A2 / NY TCR-T cells + / - ZipER. Top, right: Bar plot summary of Tetramer binding (n=8, mean± SEM). Bottom, right: Tetramer versus Vbetal3 staining of the A97L-A2 / NY TCR-T cells versus WT A2 / NY TCR-T cells + / - ZipER CD8+T cells (n=8). Fig. 6B. Bar plot of differentiation status of the A97L-A2 / NY TCR-T cells versus WT A2 / NY TCR-T cells + / - ZipER T cells. TSTM: CCR7+CD45RA+, TEM: CCR7' CD45RA', TCM: CCR7+CD45RA', TEMRA: CCR7 CD45RA . (TSTM: stem cell-like memory T cells, TEM: effector memory T cells, TCM: central memory T cells, TEMRA: terminallydifferentiated effector memory T cells). Segments within bar graphs from top to bottom as in figure legend from bottom to top. Fig. 6C. Cytokine expression in the A97L-A2 / NY TCR-T cells versus WT A2 / NY TCR-T cells + / - ZipER T cells upon 5-hour co-culture with T2 cells pulsed with increasing concentrations of target peptide. Data pooled from n=3 biological replicates (mean ± SEM). Traces from bottom to top as in figure legend from left to right. Fig. 6D. TCR-ZipER T cells show higher in vitro function than affinity-optimized TCR-T cells. Cytokine production of differently transduced T cells following overnight co-culture with A375 melanoma cells at effector (z.e., transduced T cells)-to-target ratio of 1 : 1. Bar plots represent pooled data from n=3 independent experiments (means ± SEM). In all the conditions, fold-change was normalized to cytokine production by A2 / NY TCR T cells. Fig. 6E. Evaluation of cytolytic capacity of A97L-A2 / NY TCR-T cells versus WT A2 / NY TCR-T cells + / - ZipER T cells co-cultured with A375 tumor cells at mCherry+ / target ratio of 1 : 1 using livecell IncuCyte imaging (data are representative of n=3 biological replicates). Traces from top to bottom as in figure legend. Fig. 6F. Expression of activation markers, checkpoint receptors and intracellular cytokine production by CD8+A97L-A2 / NY TCR-T cells versus WT A2 / NY TCR- T cells + / - ZipER T cells upon overnight co-culture with Me275 tumor cells at mCherry+ / target ratio of 1 : 1 (n=3, mean ± SEM).

[0055] Figs. 7A, 7B, 7C, 7D, and 7E illustrate that the ZipER motif is compatible with non-viral T-cell engineering. Fig. 7A. Tetramer staining of affinity-optimized I53F-A2 / NY TCR + / - ZipER T cells at low, intermediate and high levels of transduction (gated on tEGFR+, n=3). Fig. 7B. Cytokine production as measured by flow cytometric analysis for transposon engineered TCR + / - ZipER T cells upon 5h coculture with peptide-pulsed T2 cells. Plots show the percentage of IL-2+(left) and TNF-alpha+(right) for low, intermediate and high tEGFR MFI of primary T cells transduced with TCR (open circle) or the TCR-ZipER (dark closed circle) from n=3 biological replicates. Fig. 7C. Evaluation of mispairing by comparing Tetramer and Vbetal3 staining of TCR + / - ZipER T cells in beta-endo knockout (KO) T cells (n=3). Truncated EGFR (tEGFR) served as a surrogate marker for transposon edited T cells in all above experiments. Fig. 7D. Orthotopic DRB3 / NY TCR + / - ZipER replacement in TRAC locus. Plot shows Tetramer staining for knockin+(KI) cells (mCherry+) into alpha-endo or alpha / beta-endo KO T cells. Fig. 7E. Left: plot shows relative MFI of KI+(mCherry+) in all KO conditions. Middle and right: Cytokine production measured by flow cytometric analysis for edited TCR T cells upon overnight co-culture with T333A-CIITA melanoma cells at a mCherry+T cells / target ratio of 1 : 1. Plots show the percentage of IL-2+(middle) and TNF-alpha (right) on gated KI+(mCherry ) T cells edited with TCR (open circle) or the TCR-ZipER (dark closed circle) for n=3 biological replicates.DETAILED DESCRIPTION

[0056] Provided herein are heterodimeric proteins comprising a dimerization motif. Provided herein are heterodimeric proteins comprising a TCR and a dimerization motif. Also provided are nucleic acids encoding heterodimeric proteins disclosed herein, vectors and cells comprising nucleic acids encoding heterodimeric proteins disclosed herein, cells expressing heterodimeric proteins disclosed herein, and methods of using any of the compositions provided herein, including, for example, for treating a subject in need thereof.

[0057] T cell receptors (TCRs)

[0058] As used herein, the term “T cell receptor (TCR)” refers to a heterodimer comprising (1) a variable alpha (a) and a variable beta (P) chain or (2) variable gamma (y) chain and a variable delta (5) chain. TCR variable chains usually comprise a variable region, a constant region, a transmembrane region, and a short cytoplasmic tail. Each variable region of the TCR usually has three hypervariable or complementarity-determining regions (CDRs), facilitating recognition of a cognate antigen.

[0059] A “TCR complex,” as used herein, comprises the TCR and additional signaling molecules that are not variable chains. Preferably, the TCR complex comprises six CD3 signaling modules (2x CD3s (CD3 epsilon), CD35 (CD3 delta), CD3y (CD3 gamma), and 2x CD3(^ (CD3 zeta)), which form three CD3 dimers: CD3sy (epsilon / gamma), CD3s5 (epsilon / delta), and CD3( (zeta / zeta).

[0060] The variable TCR chains allow recognition of peptide fragments that have been generated by proteolytic degradation of foreign or self-proteins within cells expressing major histocompatibility complex (MHC) class I or class II molecules. The peptides are usually presented to the TCR by the MHC molecules located on antigen-presenting cells (APCs). When the TCR engages with an antigenic peptide and MHC (peptide / MHC), the T cell is activated through signal transduction, mediated by the CD3 subunits in the TCR complex. MHC / antigen complexes are, however, not the only molecules capable of interaction with TCRs. Non-peptide antigens such as lipids can interact with TCRs via some of the five isoforms of CD1 (a-e) (Mori & Libero, T cells specific for lipid antigens, Immunol Res. 2012 Sep;53(l-3): 191-9, incorporated herein by reference in its entirety). Further, several studies describe TCRs bindingto metabolic intermediates bound to the MHC like molecule MR1 (Reantragoon et al., Structural insight into MR1 -mediated recognition of the mucosal associated invariant T cell receptor, J Exp Med. 2012 Apr 9;209(4):761-74, incorporated herein by reference in its entirety).

[0061] T cell-based immunotherapy can target peptide epitopes derived from tumor- associated or tumor-specific proteins, which are presented by molecules of the MHC. These tumor associated antigens (TAAs) can be peptides derived from all protein classes, such as enzymes, receptors, transcription factors, etc., which are expressed and, as compared to unaltered cells of the same origin, usually up-regulated in cells of the respective tumor. The MHC-molecules of the human are also designated as human leukocyte-antigens (HLA).

[0062] T cell clones expressing native TCRs against specific cancer antigens (antigenic peptide fragments derived from cancer cells) have been previously disclosed (Traversari et al, A nonapeptide encoded by human gene MAGE-1 is recognized on HLA-A1 by cytolytic T lymphocytes directed against tumor antigen MZ2-E, J Exp Med. 1992 Nov 1 ; 176(5): 1453-7; Ottaviani et al, A MAGE-1 antigenic peptide recognized by human cytolytic T lymphocytes on HLA-A2 tumor cells, Cancer Immunol Immunother. 2005 Dec;54(12): 1214-20; Chaux et al, Identification of five MAGE-A1 epitopes recognized by cytolytic T lymphocytes obtained by in vitro stimulation with dendritic cells transduced with MAGE-A1, J Immunol. 1999 Sep l;163(5):2928-36; Luiten & van der Bruggen, A MAGE-A1 peptide is recognized on HLA-B7 human tumors by cytolytic T lymphocytes, Tissue Antigens. 2000 Feb;55(2): 149-52; van der Bruggen et al, A peptide encoded by human gene MAGE-3 and presented by HLA-A2 induces cytolytic T lymphocytes that recognize tumor cells expressing MAGE-3, Eur J Immunol. 1994 Dec;24(12):3038-43; Huang et al, Cytolytic T lymphocytes recognize an antigen encoded by MAGE-A10 on a human melanoma, J Immunol. 1999 Jun 1; 162(11):6849-54; Ma et al, Two new tumor-specific antigenic peptides encoded by gene MAGE-C2 and presented to cytolytic T lymphocytes by HLA-A2, Int J Cancer. 2004 May l;109(5):698-702; Ebert et al, A long, naturally presented immunodominant epitope from NY-ESO-1 tumor antigen: implications for cancer vaccine design, Cancer Res. 2009 Feb 1;69(3): 1046-54; Ayyoub et al, Proteasome- assisted identification of a SSX-2-derived epitope recognized by tumor-reactive CTL infiltrating metastatic melanoma, J Immunol. 2002 Feb 15; 168(4): 1717-22; Wang et al, Selective identification of HLA-DP4 binding T cell epitopes encoded by the MAGE- A gene family, Cancer Immunol Immunother. 2007 Jun;56(6):807-18; Schultz et al, A MAGE-A3 peptide presented by HLA-DP4 is recognized on tumor cells by CD4+ cytolytic T lymphocytes, Cancer Res. 2000 Nov 15;60(22):6272-5; Zhang et al, A MAGE-3 peptide presented by HLA-DR1 to CD4+ T cells that were isolated from a melanoma patient vaccinated with a MAGE-3 protein, J Immunol. 2003 Jul 1 ; 171 (1):219-25; Gnjatic et al, Survey of naturally occurring CD4+ T cell responses against NY-ESO-1 in cancer patients: correlation with antibody responses, Proc Natl Acad Sci U S A. 2003 Jul 22;100(15):8862-7; Chaux et al, A MAGE-1 peptide recognized on HLA-DR15 by CD4(+) T cells, Eur J Immunol. 2001 Jun;31(6):1910- 6; Cesson et al, MAGE-A3 and MAGE-A4 specific CD4(+) T cells in head and neck cancer patients: detection of naturally acquired responses and identification of new epitopes, Cancer Immunol Immunother. 2011 Jan;60(l):23-35), all of which are incorporated herein by reference in their entireties. Such TCRs may be used in the compositions and methods disclosed herein.

[0063] In embodiments, provided is a heterodimeric protein comprising a TCR that recognizes antigenic peptide fragments derived from antigens expressed in the target tumor cell by a human leukocyte antigen (HLA) complex, also referred to as the major histocompatibility complex (MHC). Not-limiting examples of antigenic peptide fragments include CD19, CD20, CD30, CD33, CD38, CD133, BCMA, TEM8, EpCAM, ROR1, Folate Receptor, CD70, MAGE-1, MAGE-2, MAGE-3, MAGE A-10, MAGE-C2, MAGE-A12, CEA, tyrosinase, midkin, BAGE, CASP-8, beta-catenin, CA-125, CDK-1, ESO-1, gp75, gplOO, MART-1, MUC-1, MUM-1, p53, PAP, PSA, PSMA, ras, trp-1, HER-2, TRP-1, TRP- 2, IL13Ralpha, IL13Ralpha2, AIM-2, AIM-3, NY-ESO-1, C9orfl l2, SART1, SART2, SART3, BRAP, RTN4, GLEA2, TNKS2, KIAA0376, ING4, HSPH1, C13orf24, RBPSUH, C6orfl53, NKTR, NSEP1, U2AF1L, CYNL2, TPR GOLGA, BMI1, COX-2, EGFRvIII, EZH2, LIC AM, Livin, Livin beta, MRP-3, Nestin, OLIG2, ART1, ART4, B-cycline, Glil, Cav-1, Cathepsin B, CD74, E- Cadherin, EphA2 / Eck, Fra-1 / Fosl 1, GAGE-1, Ganglioside / GD2, GnT-V, betal, 6-N, Ki67, Ku70 / 80, PROXI, PSCA, SOX10, SOX11, Survivin, beta hCG, WT1, mesothelin, melan-A, NY-BR-1, NY-CO-58, MN (gp250), telomerase, SSX-2, PRAME, PLK1, VEGF-A, VEGFR2, and Tie-2.

[0064] Heterodimeric proteins

[0065] Provided herein are heterodimeric proteins comprising two subunits. As used herein, “heterodimeric protein” refers to a protein formed by the combination of two different monomeric proteins.

[0066] Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain.

[0067] Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) a first TCR variable chain, (ii) a first dimerization domain, and (iii) a first helper sequence, and (2) a second polypeptide comprising (i) a second TCR variable chain, (ii) a second dimerization domain, and (iii) a second helper sequence.

[0068] Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) a first TCR variable chain, (ii) a linker, and (iii) a first dimerization domain and (2) a second polypeptide comprising (i) a second TCR variable chain, (ii) a linker, and (iii) a second dimerization domain.

[0069] Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) a first TCR variable chain, (ii) a linker, (iii) a first dimerization domain, and (iv) a first helper sequence and (2) a second polypeptide comprising (i) a second TCR variable chain, (ii) a linker, (iii) a second dimerization domain, and (iv) a second helper sequence.

[0070] TCR chains

[0071] In one embodiment, the first TCR variable chain is a TCR alpha chain and the second TCR variable chain is a TCR beta chain. In one embodiment, the first TCR variable chain is a TCR beta chain and the second TCR variable chain is a TCR alpha chain.

[0072] In one embodiment, the first TCR variable chain is a TCR gamma chain and the second TCR variable chain is a TCR delta chain. In one embodiment, the first TCR variable chain is a TCR delta chain and the second TCR variable chain is a TCR gamma chain.

[0073] Provided herein are heterodimeric proteins comprising TCR variable chains that combine elements from more than one TCR variable chain. For example, the variable region, constant region, transmembrane region, and the short cytoplasmic tail may be derived from one or more different TCR variable chains. In some embodiments, the first or the second TCR variable chain comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:27-32. In some embodiments, the first or the second TCR variable chain comprises any one of SEQ ID NOs:27-32.

[0074] As used herein, the term “identity” refers to sequence identity between two nucleic acid molecules or polypeptides. Identity can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. For example, when a position in the compared nucleotide sequence is occupied by the same base, then the molecules are identical at that position. A degree identity between nucleic acid or amino acid sequences is a function of the number of identical or matching nucleotides or amino acids at shared positions. For example, polypeptides having at least 85%, 90%, 95%, 98%, or 99% identity to specificpolypeptides described herein and preferably exhibiting substantially the same functions, as well as polynucleotides encoding such polypeptides, are contemplated. Methods and computer programs for determining both sequence identity and similarity are publicly available, including, but not limited to, the GCG program package (Devereux et al., A comprehensive set of sequence analysis programs for the VAX, Nucleic Acids Res. 1984 Jan 11; 12(1 Pt 1):387- 95), BLASTP, BLASTN, FAST A (Altschul et al, Basic local alignment search tool, J Mol Biol. 1990 Oct 5;215(3):403-10), and the ALIGN program (version 2.0). The well-known Smith Waterman algorithm may also be used to determine similarity. The BLAST program is publicly available from NCBI and other sources (BLAST Manual, Altschul, et al., NCBI NLM NIH, Bethesda, Md. 20894; BLAST 2.0 at http: / / www.ncbi.nlm.nih.gov / blast / ). In comparing sequences, these methods account for various substitutions, deletions, and other modifications.

[0075] The two TCR chains may be linked by one or more disulfide bonds.

[0076] Dimerization domains

[0077] Provided herein are dimerization sequences that facilitate the dimerization of polypeptide sequences that the dimerization sequences are fused to. As used herein, a dimerization motif comprises two subunits (such as a first dimerization domain and a second dimerization domain), which interact with each other and cause the formation of a dimer. A non-limiting example of a dimerization motif is the Zip A / B dimerization motif described in the Examples. Unlike other zipper domains, such as c-Jun and c-Fos leucine zippers, the embodiments disclosed herein do not have the drawback of reduced IL-2 production by the T cells expressing the resulting heterodimeric protein comprising the zipper. See, e.g., Spear et al., TCR modifications that enhance chain pairing in gene-modified T cells can augment crossreactivity and alleviate CD8 dependence, J Leukoc Biol. 2018 May;103(5):973-983, incorporated herein in its entirety.

[0078] Provided herein is a dimerization motif that is derived from the human gamma- aminobutyric acid (GABA)-receptor. See Fig. 2A for an illustration. See also PDB: 4PA and Burmakina et al., Heterodimeric coiled-coil interactions of human GAB AB receptor, Proc Natl Acad Sci U S A. 2014 May 13;111 (19):6958-63, incorporated herein in its entirety by reference. In the Examples discussed below, the dimerization motif comprises two sequences, ZipA and ZipB sequences. ZipA contains a dileucine internalization motif.

[0079] Provided is a heterodimeric protein comprising dimerization motif. Provided is a heterodimeric protein comprising a first polypeptide comprising a first dimerization domain and a second polypeptide comprising a second dimerization domain.

[0080] In some embodiments, the heterodimeric protein comprises a first polypeptide comprising a first dimerization domain, wherein the first dimerization domain comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:9. In some embodiments, the heterodimeric protein comprises a first polypeptide comprising a first dimerization domain, wherein the first dimerization domain comprises SEQ ID NO:9.

[0081] In some embodiments, the heterodimeric protein comprises a first polypeptide comprising a first dimerization domain, wherein the first dimerization domain comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 11. In some embodiments, the heterodimeric protein comprises a first polypeptide comprising a first dimerization domain, wherein the first dimerization domain comprises SEQ ID NO: 11.

[0082] In some embodiments, the heterodimeric protein comprises a second polypeptide comprising a second dimerization domain, wherein the second dimerization domain comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:9. In some embodiments, the heterodimeric protein comprises a second polypeptide comprising a second dimerization domain, wherein the second dimerization domain comprises SEQ ID NO:9.

[0083] In some embodiments, the heterodimeric protein comprises a second polypeptide comprising a second dimerization domain, wherein the second dimerization domain comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 11. In some embodiments, the heterodimeric protein comprises a second polypeptide comprising a second dimerization domain, wherein the second dimerization domain comprises SEQ ID NO: 11.

[0084] Provided is a heterodimeric protein comprising: (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:9 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 11. Provided is a heterodimeric protein comprising: (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising SEQ ID NO:9 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising SEQ ID NO: 11.

[0085] Provided is a heterodimeric protein comprising: (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 11 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:9. Provided is a heterodimeric protein comprising: (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising a SEQ ID NO: 11 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising SEQ ID NO:9.

[0086] Helper sequences

[0087] As used herein, a “helper sequence” is a sequence that effects a desired outcome, including, but not limited to, increased expression of a TCR on the cellular surface, reduced TCR mispairing, and / or improved dimerization of polypeptides fused to the helper sequences.

[0088] Provided is a heterodimeric protein comprising a first polypeptide comprising a first helper sequence and a second polypeptide comprising a second helper sequence.

[0089] Provided is a heterodimeric protein comprising a first polypeptide comprising a first helper sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 19 or 20. Provided is a heterodimeric protein comprising a first polypeptide comprising a first helper sequence comprising SEQ ID NO: 19 or 20.

[0090] Provided is a heterodimeric protein comprising a second polypeptide comprising a second helper sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 19 or 20. Provided is a heterodimeric protein comprising a second polypeptide comprising a second helper sequence comprising SEQ ID NO: 19 or 20. Provided is a heterodimeric protein comprising a second polypeptide comprising a second helper sequence comprising a sequence that has one, two, three, four, or five amino acid substitutions as compared to SEQ ID NO: 19 or 20.

[0091] In some embodiments, the heterodimeric protein comprises a first polypeptide comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10 or 12. In one embodiment, the heterodimeric protein comprises a first polypeptide comprising SEQ ID NO: 10 or 12.

[0092] In some embodiments, the heterodimeric protein comprises a second polypeptide comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10 or 12. In one embodiment, the heterodimeric protein comprises a second polypeptide comprising SEQ ID NO: 10 or 12.

[0093] Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) a first TCR variable chain, (ii) a first dimerization domain comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 9, and (iii) a first helper sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 19, and (2) a second polypeptide comprising (i) a second TCR variable chain, (ii) a second dimerization domain comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 11, and (iii) a second helper sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:20.

[0094] Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) a first TCR variable chain, (ii) a first dimerization domain SEQ ID NO:9, and (iii) a first helper sequence comprising SEQ ID NO: 19, and (2) a second polypeptide comprising (i) a second TCR variable chain, (ii) a second dimerization domain comprising SEQ ID NO: 11, and (iii) a second helper sequence comprising SEQ ID NO:20.

[0095] Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) a first TCR variable chain, (ii) a first dimerization domain comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 11, and (iii) a first helper sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 19, and (2) a second polypeptide comprising (i) a second TCR variable chain, (ii) a second dimerization domain comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:9, and (iii) a second helper sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:20.

[0096] Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) a first TCR variable chain, (ii) a first dimerization domain SEQ ID NO: 11, and (iii) a firsthelper sequence comprising SEQ ID NO: 19, and (2) a second polypeptide comprising (i) a second TCR variable chain, (ii) a second dimerization domain comprising SEQ ID NO:9, and (iii) a second helper sequence comprising SEQ ID NO:20.

[0097] Linker sequences

[0098] The heterodimeric proteins disclosed herein may further comprise linker sequences connecting the individual components of the heterodimeric proteins.

[0099] Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) a first TCR variable chain, (ii) a first linker, and (iii) a first dimerization domain and (2) a second polypeptide comprising (i) a second TCR variable chain, (ii) a second linker, and (iii) a second dimerization domain. Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) a first TCR variable chain, (ii) a first linker, (iii) a first dimerization domain, and (iv) a first helper sequence and (2) a second polypeptide comprising (i) a second TCR variable chain, (ii) a second linker, (iii) a second dimerization domain, and (iv) a second helper sequence.

[0100] In one embodiment, the first or the second linker is a flexible linker. In one embodiment, the first or the second linker is a rigid linker. In one embodiment, the first or the second linker is a cleavable linker. In one embodiment, the linker is a non-cleavable linker. In one embodiment, the linker is a helical linker. In one embodiment, the linker is a non-helical linker. In some embodiments, the linker is a polypeptide linker. In some embodiments, the flexible linker is between 3 and 30 amino acids long. In certain embodiments, the peptide linker can, for example and not by way of limitation, be between about 1 and about 25 or between about 5 and about 20 or between about 5 and about 15 amino acids in length. Non-limiting examples of linkers for use in the presently disclosure subject matter are disclosed in International Patent Publication WO 2017 / 165464 (e.g., SEQ ID NOs:42, 44, 45, 75, 76, 77 and 78), the contents of which are incorporated by reference herein in its entirety. In some embodiments, the flexible linker predominantly comprises glycines and serines.

[0101] In some embodiments, the first or the second linker comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 13 or SEQ ID NO: 14. In some embodiments, the first or the second linker comprises SEQ ID NO: 13 or SEQ ID NO: 14. In some embodiments, the linker has two, three, or four amino acid substitutions as compared to SEQ ID NO: 13 or 14.

[0102] Provided herein is a heterodimeric protein that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or atleast 99% identical to any one of the sequences in Tables 1, 2, 5, or 6. Provided herein is a heterodimeric protein that comprises any one of the sequences in Tables 1, 2, 5, or 6.

[0103] Provided is a heterodimeric protein comprising:(1) a first polypeptide comprising:(i) a first TCR variable chain,(ii) a first linker,(iii) a first dimerization domain that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 9 or 11, and / or(iv) a first helper sequence that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 19 or 30, and(2) a second polypeptide comprising(i) a second TCR variable chain ,(ii) a second linker,(iii) a second dimerization domain that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:9 or 11, and / or(iv) a second helper sequence that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 19 or 30.

[0104] Also provided are fragments of any of the heterodimeric proteins disclosed herein. In embodiments, a fragment of a heterodimeric protein disclosed herein retains at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the activity of the full-length heterodimeric protein disclosed herein. In the context of a TCR, the activity may be to bind to its cognate peptide and / or to induce TCR signaling.

[0105] In some embodiments, the dimerization motifs disclosed herein can also be used to promote dimerization of subunits other than TCR chains. The dimerization motifs disclosed herein can promote heterodimerization (different subunits) or homodimerization (identical subunits). For example, provided herein are heterodimers that comprise the two (different) domains of the dimerization motif, but whereby the two (different) domains of the dimerization motif are each fused to the same polypeptide, causing homodimerization of the fused polypeptides.

[0106] In embodiments, the dimerization motifs disclosed herein can be used to generate constitutively active cytokine receptors. Cytokine receptor dimerization often results in activation of downstream signalling pathways. As such, in one embodiment, two cytokine receptor subunits may be fused to a first and a second dimerization domain disclosed herein, respectively, resulting in a permanently dimerized cytokine receptor. Examples of cytokine receptors include, but are not limited to, IL-2 receptor or IL-7 receptors.

[0107] Recombinant soluble TCR refolding

[0108] Provided herein are also methods of promoting soluble TCR refolding. The soluble TCRs can be used in any of the methods disclosed herein. Also provided are pharmaceutical compositions comprising such soluble TCRs.

[0109] In embodiments, the transmembrane and intracellular portions of the TCR variable chain are replaced with a dimerization domain disclosed herein.

[0110] Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) the variable and constant region of a first TCR variable chain and (ii) a first dimerization domain and (2) a second polypeptide comprising (i) the variable and constant region of a second TCR variable chain and (ii) a second dimerization domain.[OHl] Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) the variable and constant region of a first TCR variable chain, (ii) a first linker, and (iii) a first dimerization domain and (2) a second polypeptide comprising (i) the variable and constant region of a second TCR variable chain, (ii) a second linker, and (iii) a second dimerization domain.

[0112] Provided is a heterodimeric protein comprising (1) a first polypeptide comprising (i) the variable region of a first TCR variable chain, (ii) an immunoglobulin constant region, and (iii) a first dimerization domain and (2) a second polypeptide comprising (i) the variable of a second TCR variable chain, (ii) an immunoglobulin constant region, and (iii) a second dimerization domain.

[0113] The heterodimeric protein may further comprise linkers connecting the different subcomponents. The immunoglobulin constant region may comprise one or more of a CHI, CH2, and CH3 region.

[0114] Nucleic acids and vectors

[0115] Provided herein are nucleic acids encoding the heterodimeric proteins or fragments thereof disclosed herein. The term “nucleic acid” as used herein refers to a polymeric form ofnucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double- or multi- stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.

[0116] Provided herein are vectors comprising one or more nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein. “Vector,” as used herein, means a vehicle that comprises a polynucleotide to be delivered into a host cell, either in vitro or in vivo. Non-limiting examples of vectors include a recombinant plasmid, yeast artificial chromosome (YAC), mini chromosome, DNA mini-circle, or a virus (including virus-derived sequences).

[0117] Also, provided herein are viral genomes comprising one or more nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein.

[0118] Provided herein is a nucleic acid sequence that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of the sequences in Tables 1 or 5. Provided herein is a nucleic acid sequence that comprises any one of the sequences in Tables 1 or 5.

[0119] Provided herein is an expression construct comprising a nucleic acid sequence encoding a heterodimeric protein or fragment thereof disclosed herein. The nucleic acid sequence encoding the heterodimeric protein or fragment thereof is usually operatively linked to a promoter sequence.

[0120] In some embodiments, the heterodimeric protein comprises a first and a second polypeptide, wherein the first and the second polypeptide are expressed by two separate nucleic acid sequences, e.g., by a pair of nucleic acid sequences.

[0121] In some embodiments, heterodimeric protein comprises a first and a second polypeptide, wherein the first and the second polypeptide are encoded by the same nucleic acid, but wherein the encoding sequence comprises an Internal Ribosome Entry Site (IRES) or a sequence encoding a self-cleaving peptide (including, but not limited to, P2A and T2A) between the genes encoding the first and the second polypeptide. An IRES sequence may be used to produce more than one polypeptide from a single gene transcript. A P2A / T2A sequence can induce ribosomal skipping during translation of a protein in a cell. As such, a P2A / T2A sequence may be used to produce more than one polypeptide from a single gene transcript. Self-cleaving sequences are known in the art. See, e.g., Liu et al., Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector. Sci Rep. 2017 May 19;7(1 ):2193 ,incorporated herein by reference in its entirety. Illustrative sequences for self-cleaving peptides are shown in Tables 1 and 2.

[0122] A wide variety of vectors can be used for the expression of a heterodimeric protein or fragment thereof disclosed herein. The ability of certain viruses to infect cells or enter cells via receptor-mediated endocytosis, and to integrate into a host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign nucleic acids into cells. Accordingly, in certain embodiments, a viral vector is used to introduce one or more nucleotide sequences encoding a heterodimeric protein or fragment thereof into a host cell for expression. The viral vector may comprise a nucleotide sequence encoding the heterodimeric protein or fragment thereof operably linked to one or more control sequences, for example, a promoter. Alternatively, the viral vector may not contain a control sequence and will instead rely on a control sequence within the host cell to drive expression of the heterodimeric protein. Non-limiting examples of viral vectors that may be used to deliver a nucleic acid include adenoviral vectors, AAV vectors, and retroviral vectors.

[0123] For example, an adeno-associated virus (AAV) can be used to introduce one or more nucleotide sequences encoding a heterodimeric protein into a host cell for expression. AAV systems have been described previously and are generally well known in the art (Kelleher and Vos, Biotechniques, 17(6): 1110-7, 1994; Cotten et al., Proc Natl Acad Sci USA, 89(13):6094- 6098, 1992; Curiel, Nat Immun, 13(2-3): 141-64, 1994; Muzyczka, Curr Top Microbiol Immunol, 158:97-129, 1992). Details concerning the generation and use of rAAV vectors are described, for example, in U.S. Pat. Nos. 5,139,941 and 4,797,368, each incorporated herein by reference in its entirety for all purposes.

[0124] In some embodiments, a retroviral expression vector can be used to introduce one or more nucleotide sequences encoding a heterodimeric protein or fragment thereof disclosed herein into a host cell for expression. These systems have been described previously and are generally well known in the art (Nicolas and Rubinstein, In, Rodriguez and Denhardt, eds., Stoneham: Butterworth, pp. 494-513, 1988; Temin, In: Gene Transfer, Kucherlapati (ed.), New York: Plenum Press, pp. 149-188, 1986). Examples of vectors for eukaryotic expression in mammalian cells include AD5, pSVL, pCMV, pRc / RSV, pcDNA3, pBPV, etc., and vectors derived from viral systems such as vaccinia virus, adeno-associated viruses, herpes viruses, retroviruses, etc., using promoters such as CMV, SV40, EF-1, UbC, RSV, ADV, BPV, and beta-actin.

[0125] In some embodiments, expression of the heterodimeric protein or fragment thereof is regulated by a constitutively activated promoter. In some embodiments, expression of theheterodimeric protein or fragment thereof is regulated by an inducible promoter. In some embodiments, expression of the heterodimeric protein or fragment thereof in a lymphocyte is induced upon activation of the lymphocyte.

[0126] Combinations of retroviruses and an appropriate packaging line may also find use, where the capsid proteins will be functional for infecting the target cells. Usually, the cells and viruses will be incubated for at least about 24 hours in the culture medium. The cells are then allowed to grow in the culture medium for short intervals in some applications, e.g., 24-73 hours, or for at least two weeks, and may be allowed to grow for five weeks or more, before analysis. Commonly used retroviral vectors are “defective,” z.e., unable to produce viral proteins required for productive infection. Replication of the vector requires growth in the packaging cell line. The host cell specificity of the retrovirus is determined by the envelope protein, env (pl20). The envelope protein is provided by the packaging cell line. Envelope proteins are of at least three types, ecotropic, amphotropic and xenotropic. Retroviruses packaged with ecotropic envelope protein, e.g., MMLV, are capable of infecting most murine and rat cell types. Ecotropic packaging cell lines include BOSC23. Retroviruses bearing amphotropic envelope protein, e.g., 4070A, are capable of infecting most mammalian cell types, including human, dog, and mouse. Amphotropic packaging cell lines include PA12 and PA317. Retroviruses packaged with xenotropic envelope protein, e.g., AKR env, are capable of infecting most mammalian cell types, except murine cells. The vectors may include genes that can later be removed, e.g., using a recombinase system such as Cre / Lox, or the cells that express them destroyed, e.g., by including genes that allow selective toxicity such as herpesvirus TK, BCL-xs, etc. Suitable inducible promoters are activated in a desired target cell type, either the transfected cell or progeny thereof.

[0127] Non-limiting examples of the vectors useful for the genetically engineered cells comprising one or more nucleic acids encoding a heterodimeric protein of fragment thereof disclosed herein include retroviral vector SFG.MCS, and helper plasmids RD114, Peg-Pam3 (Arber et al. J Clin Invest 2015 Jan 2; 125(1): 157-168), lentiviral vector pRRL, and helper plasmids R8.74 and pMD2G (e.g., Addgene Plasmid #12259). In some embodiments, the Sleeping Beauty transposon system can be used (Deniger etal. 2016 Mol Ther. Jun;24(6):1078- 1089). In some embodiments, nucleic acids encoding heterodimeric proteins or fragments thereof can be introduced into cells via deforming a cell as it passes through a small opening, disrupting the cell membrane and allowing material to be inserted into the cell, for example, electroporation (Xiaojun et al. 2017 Protein Cell, 8(7): 514-526), or the Cell Squeeze® method. Such electroporation methods of an RNA encoding a transgene allow for transient expressionof such transgene in cells which can limit toxicity and other undesirable effects of engineered cells (Barrett et al. 2011 Hum Gene Ther. Dec; 22 (12): 1575-1586).

[0128] In some embodiments, genome-editing techniques, such as CRISPR / Cas9 systems, designer zinc fingers, transcription activator-like effectors (TALEs), or homing meganucleases are available to induce expression of the heterodimeric protein or fragment thereof disclosed herein in a cell, including in an immune cell. In general, “CRISPR / Cas9 system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr- mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. One or more elements of a CRISPR system may be derived from a type I, type II, or type III CRISPR system. Alternatively, one or more elements of a CRISPR system may be derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system).

[0129] In some embodiments, the cells, such as lymphocytes, disclosed herein are genetically modified by transfecting the cell with a vector (e.g., lentiviral vector) encoding the heterodimeric protein or a functional fragment thereof and CA9 or a functional fragment thereof. In some embodiments, the nucleic acid(s) encoding the heterodimeric protein or a functional fragment thereof and C A9 (or functional fragment thereof) or can be introduced into the cell using one, two, or more vectors.

[0130] Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising exogenous vectors and / or nucleic acids are well known in the art. See, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).

[0131] Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as an in vitro and in vivo release vehicle is a liposome (e.g., an artificial membrane vesicle).

[0132] In the case where a non-viral delivery system is used, an exemplary delivery vehicle is a liposome. The use of lipid formulations is contemplated for the introduction of the nucleic acids into a host cell (in vitro, ex vivo, or in vivo). In another aspect, the nucleic acid may be associated with a lipid. The nucleic acid associated with a lipid may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, bound to a liposome via a binding molecule that is associated with both the liposome and the oligonucleotide, entrapped in a liposome, in a complex with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, content or in a complex with a micelle, or associated otherwise with a lipid. The compositions associated with lipids, lipids / DNA or lipids / expression vector are not limited to any particular structure in solution. For example, they can be present in a bilayer structure, as micelles, or with a “collapsed” structure. They can also be simply interspersed in a solution, possibly forming aggregates that are not uniform in size or shape. Lipids are fatty substances that can be natural or synthetic lipids. For example, lipids include fatty droplets that occur naturally in the cytoplasm as well as the class of compounds containing long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.

[0133] Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) can be obtained from Sigma, St. Louis, MO; Dicetylphosphate (“DCP”) can be obtained from K & K Laboratories (Plainview, NY); Cholesterol (“Choi”) can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) and other lipids can be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Lipid stock solutions in chloroform or chloroform / methanol can be stored at about -20°C. Chloroform is used as the sole solvent since it evaporates more easily than methanol. “Liposome” is a generic term that encompasses a variety of unique and multilamellar lipid vehicles formed by the generation of bilayers or closed lipid aggregates. Liposomes can be characterized as having vesicular structures with a bilayer membrane of phospholipids and an internal aqueous medium. Multilamellar liposomes have multiple layers of lipids separated by an aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and trap dissolved water and solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5: 505-10). However, compositions that have different structures in solution than the normal vesicular structure are also included. Forexample, lipids can assume a micellar structure or simply exist as nonuniform aggregates of lipid molecules. Lipofectamine-nucleic acid complexes are also contemplated.

[0134] Regardless of the method used to introduce exogenous nucleic acids into a host cell, the presence of the recombinant DNA sequence in the host cell can be confirmed by a series of tests. Such assays include, for example, “molecular biology” assays well known to those skilled in the art, such as Southern and Northern blot, RT-PCR and PCR; biochemical assays, such as the detection of the presence or absence of a particular peptide, for example, by immunological means (ELISA and Western blot) or by assays described herein to identify agents that are within the scope of the disclosure.

[0135] Cells

[0136] Provided herein are cells expressing a heterodimeric protein or fragment thereof disclosed herein. Provided herein are cells comprising a heterodimeric protein or fragment thereof disclosed herein. Provided herein are cells comprising one or more nucleic acids encoding for a heterodimeric protein or fragment thereof disclosed herein.

[0137] In some embodiments, the cell is a bacterial cell, a yeast cell, an insect cell, or a mammalian cell. In one embodiment, the cell is a human cell.

[0138] In some embodiments, the cell is an immune cell. In some embodiments, the cell is a lymphocyte. Lymphocytes are one of the subtypes of a white blood cell in a vertebrate's immune system and include T cells, B cells, and natural killer (NK) cells. In embodiments, the cell is a T cell.

[0139] In some embodiments, the lymphocytes disclosed herein are derived from CD34 hematopoietic stem cells, embryonic stem cells, or induced pluripotent stem cells. In certain embodiments, the lymphocytes disclosed herein are autologous, allogeneic, syngeneic, or xenogeneic. In a preferred embodiment, the lymphocytes disclosed herein are autologous. In some embodiments, the lymphocytes disclosed herein are human.

[0140] Prior to the expansion and genetic modification of the lymphocytes described herein, a source of lymphocytes from a subject may be obtained. Lymphocytes can be obtained from several sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from an infection site, ascites, pleural effusion, splenic tissue, and tumors. As described herein, any number of lymphocyte lines available in the art can be used. Lymphocytes can be obtained from a unit of blood collected from a subject using any number of techniques known to the person skilled in the art, such as the Ficoll™ separation. Circulating blood cells of an individual are obtained by apheresis. Theapheresis product typically contains lymphocytes, including T lymphocytes, monocytes, granulocytes, B lymphocytes, other nucleated white blood cells, red blood cells, and platelets. The cells harvested by apheresis can be washed to remove the plasma fraction and place the cells in a suitable buffer or medium for the subsequent processing steps. The cells may be washed with phosphate-buffered saline (PBS). Alternatively, the wash solution may lack calcium and may lack magnesium or may lack many, if not all, divalent cations. As those of ordinary skill in the art would readily appreciate, a washing step can be achieved by methods known to those skilled in the art, such as using a semiautomatic continuous flow centrifuge (e.g., the Cobe 2991 cell processor, the Baxter CytoMate, or elHaemonetics Cell Saver 5) according to the manufacturer's instructions. After washing, the cells can be resuspended in a variety of biocompatible buffers, such as, for example, Ca2+free, PBS free Mg2+, PlasmaLyte A, or other saline solution with or without buffer. Alternatively, the undesirable components of the apheresis sample can be removed, and the cells resuspended directly in a culture medium.

[0141] As described herein, lymphocytes may be isolated from peripheral blood by lysis of red blood cells and depletion of monocytes, for example, by centrifugation through a PERCOLL™ gradient or by countercurrent centrifugal elutriation. Lymphocytes may also be isolated from the spleen. If needed, specific subpopulation lymphocytes, such as T lymphocytes (z.e., CD3+, CD28+, CD4+, CD8+, CD45RA+or CD45RO+T lymphocytes) can be further isolated by positive or negative selection techniques. For example, T lymphocytes may be isolated by incubation with conjugated anti-CD3 beads for a sufficient period of time (z.e., 30 minutes to 24 hours) for positive selection of the desired T lymphocytes. For the isolation of T lymphocytes from patients with leukemia, the use of longer incubation times, such as 24 hours, can increase cellular performance. Longer incubation times can be used to isolate T lymphocytes in any situation where there are few T lymphocytes compared to other cell types, such as isolating tumor-infiltrating lymphocytes (TILs) from tumor tissue or from immunocompromised individuals. The person skilled in the art will recognize that multiple rounds of selection may also be used. It may be desirable to perform the selection procedure and use the “unselected” cells in the activation and expansion process. “Unselected” cells can also undergo new rounds of selection.

[0142] Enrichment of a population of lymphocytes (e.g., T lymphocytes) by negative selection can be performed with a combination of antibodies directed to unique surface markers for the negatively selected cells. One method is the sorting and / or selection of cells by negative magnetic immune adherence or flow cytometry using a cocktail of monoclonal antibodies directed to cell surface markers present in the negatively selected cells. For example, to enrichCD4+cells by negative selection, a monoclonal antibody typically includes antibodies against CD14, CD20, CDl lb, CD16, HLA-DR, and CD8. Alternatively, the regulatory T lymphocytes are depleted by anti-C25 conjugate beads or other similar selection method.

[0143] Lymphocytes for stimulation can also be frozen after a washing step. Wishing not to be bound by theory, freezing and the following thawing step provide a more uniform product by eliminating granulocytes and, to some extent, monocytes in the cell population. After the washing step that removes the plasma and platelets, the cells can be suspended in a freezing solution. Although many solutions and freezing parameters are known in the art and will be useful in this context, one method involves the use of PBS containing 20% DMSO and 8% human serum albumin, or culture medium containing 10% dextran 40 and 5% dextrose human albumin and 7.5% DMSO or 31.25% Plasmalyte A, 31.25% dextrose 5%, 0.45% NaCl, 10% dextran 40 and 5% of dextrose, 20% serum of human albumin and 7.5% of DMSO or other suitable cell freezing medium containing for example Hespan and PlasmaLyte A. The cells may then be frozen at -80 °C at a rate of 1°C per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing can be used, as well as uncontrolled freezing immediately at -20 °C or in liquid nitrogen.

[0144] The cryopreserved cells may be thawed and washed as described herein and allowed to stand for one hour at room temperature before activation using the methods of the present disclosure. As described herein, lymphocytes can be expanded, frozen, and used later. As described herein, samples may be collected from a patient shortly after the diagnosis of a particular disease as described herein, but before any treatment. The cells may be isolated from a blood sample or an apheresis of a subject before any number of relevant treatment modalities, including but not limited to treatment with agents such as natalizumab, efalizumab, antiviral agents, chemotherapy, radiation, immunosuppressive agents such as cyclosporine, azathioprine, methotrexate, mycophenolate and FK506, antibodies or other immunoablatories such as CAMPATH, anti-CD3 antibodies, cytoxane, fludarabine, cyclosporin, FK506, rapamycin, mycophenolic acid, steroids, FR901228, and irradiation. These drugs inhibit calcium-dependent calcineurin phosphatase (e.g., ciclosporin and FK506) or inhibit p70S6 kinase that is important for signaling induced by the growth factor (rapamycin) (Liu et al., Cell 66: 807-815, 1991; Henderson et al., Immun 73: 316-321, 1991, Bierer et al., Curr. Opin. Immun., 5: 763-773, 1993). The cells may be isolated from a patient and frozen for later use together with (e.g., before, simultaneously or after) bone marrow or stem cell transplant, therapy with T lymphocyte ablation using chemotherapeutic agents such as fludarabine, radiotherapy external beam (XRT), cyclophosphamide, or antibodies such as OKT3 orCAMPATH. As described herein, the cells may be isolated before and can be frozen for later use in the treatment after therapy with ablation of B lymphocytes, such as agents that react with CD20, for example, Rituxan.

[0145] Either before or after the genetic modification of lymphocytes (e.g., T lymphocytes) to express a desirable transgene (such as a gene encoding a heterodimeric protein or fragment thereof disclosed herein), lymphocytes can be activated and expanded generally using methods such as those described, for example, in U.S. Patents 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and the publication of US patent application. No. 20060121005.

[0146] In some embodiments, the immune cells disclosed herein further engineered to secrete therapeutic transgenes, including, but not limited to IL-2, IL-2 mutein, IL- 15, CD40L, IL-33, and IL-12, or variants thereof. In embodiments, the immune cells disclosed herein are modified using the Genetic Engineering for the Enhanced Performance of T-cells technology described in PCT application publication No. WO2021 / 097278, which is incorporated herein by reference in its entirety. In embodiments, the immune cells disclosed herein are further engineered to express a transgene described in WO2021 / 097278, including, but not limited to the transgenes recited in the claims of WO2021 / 097278.

[0147] In some embodiments, the immune cells disclosed herein are further engineered to express a protein that inhibits, blocks, or antagonizes the interaction of immunosuppressive polypeptides and / or their ligands. Immunosuppressive polypeptides that known to suppress or decrease an immune response via their binding include CD47, PD-1, CTLA-4, and their corresponding ligands, including SIRPalpha, PD-L1, PD-L2, B7-1, B7-2, and TIGIT. Such polypeptides are present in the tumor microenvironment and inhibit immune responses to neoplastic cells.

[0148] Pharmaceutical compositions

[0149] Provided herein is a pharmaceutical composition comprising heterodimeric protein or fragment thereof disclosed herein and a pharmaceutically acceptable carrier. Provided herein is a pharmaceutical composition comprising a vector disclosed herein and a pharmaceutically acceptable carrier. Provided herein is a pharmaceutical composition comprising a therapeutically effective number of an immune cell, such as a lymphocyte, disclosed herein and a pharmaceutically acceptable carrier. Provided are pharmaceutical compositions thatgenerally comprise substantially isolated / purified lymphocytes and a pharmaceutically acceptable carrier in a form suitable for administration to a subject.

[0150] Pharmaceutically-acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. The pharmaceutical compositions may generally be formulated in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.

[0151] The terms “pharmaceutically acceptable,” “physiologically tolerable,” as referred to compositions, carriers, diluents, and reagents, are used interchangeably and include materials are capable of administration to or upon a subject without the production of undesirable physiological effects to the degree that would prohibit administration of the composition. For example, “pharmaceutically acceptable excipient” includes an excipient that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human pharmaceutical use.

[0152] Examples of such carriers or diluents include, but are not limited to, water, saline, Ringer's solutions, dextrose solution, and 5% human serum albumin. The use of such media and compounds for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or compound is incompatible with the compositions disclosed herein, use of the media or compound in the compositions disclosed herein is contemplated. In some embodiments, a second therapeutic agent, such as an anti-cancer or anti-tumor, can also be incorporated into pharmaceutical compositions.

[0153] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate-buffered saline (PBS). The composition may be sterile and fluid to the extent that easy syringeability exists. In embodiments, the compositions disclosed herein are stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, e.g., water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, e.g., by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.

[0154] In some embodiments, the composition includes the genetically modified lymphocytes as described above and optionally a cryo-protectant (e.g., glycerol, DMSO, PEG).

[0155] Methods of making genetically modified lymphocytes

[0156] Provided herein are methods that involve the genetic modification of immune cells, such lymphocytes.

[0157] The disclosure further provides a method of preparing the genetically modified lymphocytes disclosed herein. In one aspect, provided is a method comprising: (a) providing a plurality of lymphocytes; (b) introducing into the plurality of lymphocytes one or more nucleic acid molecules encoding a heterodimeric protein or fragment thereof to obtain a plurality of genetically modified lymphocytes; and (c) expanding the plurality of genetically modified lymphocytes in a cell culture medium.

[0158] The term “culturing” or “expanding” refers to maintaining or cultivating cells under conditions in which they can proliferate and avoid senescence. For example, cells may be cultured in media optionally containing one or more growth factors, i.e., a growth factor cocktail. In some embodiments, the cell culture medium is a defined cell culture medium. The cell culture medium may include neoantigen peptides. Stable cell lines may be established to allow for the continued propagation of cells.

[0159] Cells may be further purified or enriched prior to use or storage.

[0160] Methods

[0161] Also provided are methods of using the compositions provided herein, including methods of treating a subject using a composition disclosed herein.

[0162] Provided are methods of treating a subject having a disease or disorder by administering a therapeutically effective amount of a heterodimeric protein or fragment thereof disclosed herein, a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, a vector comprising a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, or an immune cell (such as a lymphocyte) expressing a heterodimeric protein or fragment thereof described herein. In another aspect, provided are methods of treating a subject having a disease or disorder by administering a therapeutically effective amount of a pharmaceutical composition comprising a heterodimeric protein or fragment thereof disclosed herein, a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, a vector comprising a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragmentthereof disclosed herein, or an immune cell (such as a lymphocyte) expressing a heterodimeric protein or fragment thereof described herein.

[0163] In some embodiments, the lymphocyte or population of lymphocytes is washed or otherwise purified to remove cytokines before administration to the subject.

[0164] The terms “treat,” “treated,” “treating,” or “treatment” as used herein refer to therapeutic treatment, wherein the object is to slow down (lessen) an undesired physiological condition, disorder or disease, or to obtain beneficial or desired clinical results. For the purposes of this disclosure, beneficial or desired clinical results include, but are not limited to alleviation of symptoms; diminishment of the extent of the condition, disorder or disease; stabilization (z.e., not worsening) of the state of the condition, disorder or disease; delay in onset or slowing of the progression of the condition, disorder or disease; amelioration of the condition, disorder or disease state; and remission (whether partial or total), whether detectable or undetectable, or enhancement or improvement of the condition, disorder or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment. The terms “prevent”, “prevention”, and the like refer to acting prior to overt disease or disorder onset, to prevent the disease or disorder from developing or to minimize the extent of the disease or disorder or slow its course of development.

[0165] An “effective amount” or “therapeutically effective amount” refers to an amount of the compound or agent that is capable of producing a medically desirable result in a treated subject. The treatment method can be performed in vivo or ex vivo, alone or in conjunction with other drugs or therapy. A therapeutically effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route. In relation to ATC, an “effective amount” or “therapeutically effective amount” may also be expressed a certain or a minimal number of cells that are administered to a subject and that are capable of producing a medically desirable result in the treated subject.

[0166] As used herein, the terms “subject” and “patient” are used interchangeably irrespective of whether the subject has undergone treatment in the past or is currently undergoing any form of treatment. As used herein, the terms “subject” and “subjects” may refer to any vertebrate, including, but not limited to, a mammal (e.g., cow, pig, camel, llama, horse, goat, rabbit, sheep, hamsters, guinea pig, cat, dog, rat, and mouse, a non-human primate (for example, a monkey, such as a cynomolgus monkey, chimpanzee, etc.) and a human). Thesubject may be a human or a non-human. In some embodiments, the subject is a human. In some embodiments, the subject is immune-depleted.

[0167] Provided herein is a method of treating cancer, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a lymphocyte expressing a heterodimeric protein disclosed herein.

[0168] The term "cancer" refers to or describes the physiological condition in mammals that is typically characterized by unregulated cell growth. Included in this definition are benign and malignant cancers, as well as dormant tumors or micrometastases. Accordingly, the term "cancer" as used herein refers to an uncontrolled growth of cells, which interferes with the normal functioning of the bodily organs and systems, including cancer stem cells and tumor vascular niches. A subject that has a cancer is a subject having objectively measurable cancer cells present in the subject's body. Included in this definition are benign and malignant cancers, as well as dormant tumors or micrometastases. Cancers that migrate from their original location and seed vital organs can eventually lead to the death of the subject through the functional deterioration of the affected organs. Hematopoietic cancers, such as leukemia, are able to out- compete the normal hematopoietic compartments in a subject, thereby leading to hematopoietic failure (in the form of anemia, thrombocytopenia and neutropenia) ultimately causing death.

[0169] Provided herein is a method of reducing the growth of a tumor, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein or fragment thereof disclosed herein, a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, a vector comprising a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, or an immune cell (such as a lymphocyte) expressing a heterodimeric protein or fragment thereof described herein.

[0170] Provided herein is a method of reducing cancer sternness, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein or fragment thereof disclosed herein, a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, a vector comprising a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, or an immune cell (such as a lymphocyte) expressing a heterodimeric protein or fragment thereof described herein.

[0171] Provided herein is a method of reducing tumor-associated fibrosis, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein or fragment thereof disclosed herein, a nucleic acid or set of nucleicacids encoding a heterodimeric protein or fragment thereof disclosed herein, a vector comprising a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, or an immune cell (such as a lymphocyte) expressing a heterodimeric protein or fragment thereof described herein.

[0172] Provided herein is a method of reducing tumor metastasis, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein or fragment thereof disclosed herein, a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, a vector comprising a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, or an immune cell (such as a lymphocyte) expressing a heterodimeric protein or fragment thereof described herein.

[0173] Provided herein is a method of increasing cytokine production in the tumor microenvironment, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein or fragment thereof disclosed herein, a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, a vector comprising a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, or an immune cell (such as a lymphocyte) expressing a heterodimeric protein or fragment thereof described herein.

[0174] Provided herein is a method of increasing anti-tumor immunity, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein or fragment thereof disclosed herein, a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, a vector comprising a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, or an immune cell (such as a lymphocyte) expressing a heterodimeric protein or fragment thereof described herein.

[0175] Provided herein is a method of increasing infiltration of a tumor with immune cells, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a heterodimeric protein or fragment thereof disclosed herein, a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, a vector comprising a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, or an immune cell (such as a lymphocyte) expressing a heterodimeric protein or fragment thereof described herein.

[0176] Provided herein is a method of reducing T cell tolerance, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising aheterodimeric protein or fragment thereof disclosed herein, a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, a vector comprising a nucleic acid or set of nucleic acids encoding a heterodimeric protein or fragment thereof disclosed herein, or an immune cell (such as a lymphocyte) expressing a heterodimeric protein or fragment thereof described herein.

[0177] Cancers that can be treated by the compositions and methods disclosed herein include tumors that are not vascularized or are not substantially vascularized, as well as vascularized tumors. Cancers may comprise non-solid tumors (such as hematologic tumors, e.g., leukemias and lymphomas) or may comprise solid tumors. The types of cancers to be treated with the genetically engineered lymphocytes disclosed herein include, but are not limited to, carcinoma, blastoma and sarcoma, and certain leukemias or malignant lymphoid tumors, benign and malignant tumors and malignancies, e.g., sarcomas, carcinomas, and melanomas. Also included are adult tumors / cancers and pediatric tumors / cancers.

[0178] Hematologic cancers are cancers of the blood or bone marrow. Examples of hematologic (or haematogenous) cancers include leukemias, including acute leukemias (such as acute lymphocytic leukemia, acute myelocytic leukemia, acute myelogenous myelogenous leukemia, promyelocytic, myelomonocytic, monocytic and erythroleukemia), chronic leukemias (such as chronic myelocytic (granulocytic) leukemia, chronic myelogenous leukemia and chronic lymphocytic leukemia), polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin’s lymphoma (indolent and high-grade forms), myeloma Multiple, Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia, and myelodysplasia.

[0179] Solid tumors are abnormal masses of tissue that usually do not contain cysts or liquid areas. Solid tumors can be benign or malignant. The different types of solid tumors are named for the type of cells that form them (such as sarcomas, carcinomas, and lymphomas). Examples of solid tumors, such as sarcomas and carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma and other sarcomas, synovium, mesothelioma, Ewing tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancer, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, carcinoma of the sweat gland, medullary thyroid carcinoma, papillary thyroid carcinoma, sebaceous gland carcinoma of pheochromocytomas, carcinoma papillary, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms tumor, cervical cancer, testicular tumor, seminoma,bladder carcinoma, melanoma, and CNS tumors (such as glioma) (such as brainstem glioma and mixed gliomas), glioblastoma (also astrocytoma, CNS lymphoma, germinoma, medulloblastoma, Schwannoma craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, and brain metastasis).

[0180] Provided herein is a method of isolating tumor-infiltrating lymphocytes (TIL) from a tumor, selecting a desired TIL expressing a TCR (for example, a TIL with high tumor reactivity), and creating a heterodimeric protein comprising said TCR and a dimerization domain disclosed herein. A TIL with high tumor reactivity may show a high reactivity to a tumor antigen (e.g., a tumor-associated antigen (TAA) or an intratumoral neoantigen). In one embodiment, the heterodimeric fusion protein comprises a TCR obtained with a method described in U.S. Provisional Patent Application No. 63 / 612,106, filed December 19, 2023, entitled “Method for Identifying Clinically-Relevant T Cell Receptors for Personalized T-Cell Therapy”, and incorporated herein by reference in its entirety.

[0181] The pharmaceutical compositions, as described, can be administered in a manner appropriate to the disease to be treated (or prevented). The amount and frequency of administration will be determined by factors such as the condition of the patient, and the type and severity of the patient's disease, although appropriate dosages can be determined by clinical trials. The precise amount of the compositions disclosed herein to be administered can be determined by a physician having account for individual differences in age, weight, tumor size, extent of infection or metastasis, and patient's condition (subject). It can generally be stated that a pharmaceutical composition comprising the lymphocytes described herein can be administered at a dose of 104to 109cells / kg body weight, e.g., 105to 106cells / kg body weight, including all values integers within these intervals. The compositions can also be administered several times at these dosages. The genetically modified lymphocytes disclosed herein can be administered using infusion techniques that are commonly known in immunotherapy see, for example, Rosenberg et al., New Eng. J. of Med. 319: 1676, 1988). The optimal dose and treatment regimen for a particular patient can be determined by one skilled in the art of medicine by monitoring the patient for signs of the disease and adjusting the treatment accordingly.

[0182] The administration of the present compositions can be carried out in any convenient way, including infusion or injection (i.e., intravenous, intrathecal, intramuscular, intraluminal, intratracheal, intraperitoneal, or subcutaneous), transdermal administration, or other methods known in the art. Administration can be once every two weeks, once a week, or more often,but the frequency may be decreased during a maintenance phase of the disease or disorder. In some embodiments, the composition is administered by intravenous infusion.

[0183] In certain cases, the compositions described herein are administered to a patient together with (e.g., before, simultaneously or consecutively) any number of relevant treatment modalities. Also described herein, the lymphocytes can be used in combination with chemotherapy, radiation, immunosuppressive agents, such as cyclosporin, azathioprine, methotrexate, mycophenolate, and FK506, antibodies, or other immunoablating agents such as CAMPATH, anti-cancer antibodies. CD3 or other antibody therapies, cytoxine, fludarabine, cyclosporine, FK506, rapamycin, mycophenolic acid, steroids, FR901228, cytokines, and irradiation.

[0184] The compositions described herein can also be administered to a patient together with (e.g., before, simultaneously or after) bone marrow transplantation, therapy with T lymphocyte ablation using chemotherapy agents such as fludarabine, radiation therapy external beam (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH. Also described herein, the compositions can be administered after ablative therapy of B lymphocytes, such as agents that react with CD20, for example, Rituxan. For example, subjects may undergo standard treatment with high-dose chemotherapy followed by transplantation of peripheral blood stem cells. In certain cases, after transplantation, the subjects receive an infusion of the expanded lymphocytes, or the expanded lymphocytes are administered before or after surgery.

[0185] Combination therapies

[0186] In some embodiments, the method may further include administering to the subject a second therapeutic agent. In some embodiments, the second therapeutic agent is an anticancer or anti-tumor agent. In some embodiments, the composition is administered to the subject before, after, or concurrently with the second therapeutic agent.

[0187] “ Combination” therapy, as used herein, unless otherwise clear from the context, is meant to encompass administration of two or more therapeutic agents in a coordinated fashion, and includes, but is not limited to, concurrent dosing. Specifically, combination therapy encompasses both co-administration (e.g., administration of a co-formulation or simultaneous administration of separate therapeutic compositions) and serial or sequential administration, provided that administration of one therapeutic agent is conditioned in some way on administration of another therapeutic agent. For example, one therapeutic agent may be administered only after a different therapeutic agent has been administered and allowed to act for a prescribed period of time. See, e.g., Kohrt et al. (2011) Blood 117:2423.

[0188] In some embodiments, the method further comprises administering a therapeutically effective amount of an immune checkpoint modulator. Accordingly, in some embodiments, genetically engineered lymphocytes disclosed herein are administered with a checkpoint inhibitor. Checkpoint proteins interact with specific ligands that send a signal into the T cell and switch off or inhibit T cell function. By expressing high levels of checkpoint proteins on their surface, cancer cells can control the function of T cells that enter the tumor microenvironment, thus suppressing the anticancer immune response. Examples of immune checkpoint modulators include PD1, PDL1, CTLA4, TIM3, LAG3, and TRAIL. The immune checkpoint protein Programmed Death- 1 (PD-1) is a key immune checkpoint receptor expressed by activated T and B cells and mediates immunosuppression. PD-1 is a member of the CD28 family of receptors, which includes CD28, CTLA-4, ICOS, PD-1, and BTLA. Two cell surface glycoprotein ligands for PD-1 have been identified, Programmed Death Ligand- 1 (PD- Ll) and Programmed Death Ligand-2 (PD-L2), that are expressed on antigen-presenting cells as well as many human cancers and have been shown to downregulate T cell activation and cytokine secretion upon binding to PD-1 (Freeman et al., 2000; Latchman et al., 2001). Inhibition of the PD-1 / PD-L1 interaction can promote potent antitumor activity. Examples of PD-1 inhibitors include, but are not limited to, Pembrolizumab (MK-3475), Nivolumab (MDX- 1106), Cemiplimab-rwlc (REGN2810), Pidilizumab (CT-011), Spartalizumab (PDR001), tislelizumab (BGB-A317), PF-06801591, AK105, BCD-100, BI 754091, JS001, LZM009, MEDI0680, MGA012, Sym021, TSR-042. Examples of PD-L1 inhibitors include, but are not limited to, Atezolizumab (MPDL3280A), Durvalumab (MEDI4736), Avelumab (MSB0010718C), BGB-A333, CK-301, CS1001, FAZ053, KN035, MDX-1105, MSB2311, SHR-1316. The checkpoint modulators may be administered simultaneously, separately, or concurrently with the genetically engineered lymphocytes disclosed herein.

[0189] In some embodiments, the method further comprises administering a therapeutically effective amount of a “chemotherapeutic agent,” which is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclophosphamide (CYTOXANTM); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, methyldopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethylenethiophosphaoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; cally statin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CBI-TMI); eleutherobin; pancrati statin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine; antibiotics such as the enediyne antibiotics (e.g. calicheamicin, see, e.g, Agnew Chem. Inti. Ed. Engl. 33: 183-186 (1994); dynemicin, including dynemicin A; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotics chromomophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L- norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5 -fluorouracil (5- FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine, 5-FU; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin; phenamet; pirarubicin; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK®.; razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2, 2’, 2’ ’-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); cyclophosphamide; thiotepa; taxoids, e.g. paclitaxel (TAXOL®, Bristol-Myers Squibb Oncology, Princeton, N.J.) and doxetaxel (TAXOTERE®, Rhone- Poulenc Rorer, Antony, France); chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum;etoposide (VP- 16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; navelbine; novantrone; teniposide; daunomycin; aminopterin; xeloda; ibandronate; CPT-11; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above. Also included in this definition are anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens including for example tamoxifen, raloxifene, aromatase inhibiting 4(5)-imidazoles, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene (Fareston); and anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, xeloda, gemcitabine, KRAS mutation covalent inhibitors and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the above. Additional examples include irinotecan, oxaliplatinum, and other standard colon cancer regimens.

[0190] Methods of assessing chain mispairing between exogenous and endogenous TCRs

[0191] Provided herein are methods of assessing mispairing between exogenous and endogenous TCRs. Developing a robust mispairing analysis system holds significant importance, since it not only enables the assessment of TCR mixed dimers but also provides a versatile framework for comparing different pairing strategies.

[0192] However, currently available methods for analyzing TCR chain mispairing are lacking. For instance, some methods rely on detecting alpha and / or beta chains to assess mispairing. However, such methods fall short is for clinical applications, which involve therapeutic TCRs comprising both alpha and beta chains, opposed to rather than single-chain TCRs. Also, most of antibodies targeting single TCR chains (especially those targeting the alpha chain) are not readily available commercially, making this strategy unsuitable for universal application. Furthermore, dual staining of alpha and beta chains fails to capture the true extent of exogenous TCR (Exo-TCR) mispairing. TCR-transduced cells exhibit mixed dimers, wherein the Exo-TCR alpha chain combines with the endogenous TCR (Endo-TCR) beta chain, or the Exo-TCR beta chain combines with the Endo-TCR alpha chain within the same T cell. As such, a cell population identified as Exo-TCR alpha+ and Exo-TCR beta+ using two antibodies directed against the Exo-TCR alpha chain and the Exo-TCR beta chain, respectively, might actually capture cells expressing three different types of TCRs: (1) TCRs comprising an Exo-TCR alpha chain and an Endo-TCR beta chain, (2) TCRs comprising an Exo-TCR beta chain and an Endo-TCR alpha chain, and (3) correctly paired TCRs comprisingan Exo-TCR alpha chain and an Exo-TCR beta chain. In contrast, tetramers that specifically bind to only correctly paired TCRs comprising an Exo-TCR alpha chain and an Exo-TCR beta chain are able to identify the cell population of interest.

[0193] Provided herein is a method of detecting the correct pairing of an TCR alpha and a beta chain (or a TCR gamma and a TCR delta chain) by contacting the paired TCR chains with a tetramer and detecting the binding of the tetramer to the correctly paired TCR. As used herein, a “tetramer” is a molecule comprising four identical copies of an MHC protein loaded with a specific peptide antigen. It can be used to identify T cells expressing a specific TCR that recognizes that peptide-MHC complex. The tetrameric structure enhances the binding affinity to the TCR, making it easier to identify the relevant T cells.

[0194] Provided is a method of detecting mispairing between an endogenous TCR alpha chain and an exogenous TCR beta chain in a population of cells, the method comprising (1) substantially reducing or eliminating the expression of the endogenous TCR alpha chain in the population of cells, (2) introducing into the population of cells a nucleic acid encoding an exogenous TCR alpha chain and an exogenous TCR beta chain, (3) cultivating the population of cells to allow for pairing of the exogenous TCR beta chain with the endogenous TCR alpha chain and / or the exogenous TCR alpha chain, and (4) detecting mispaired TCRs that the comprise endogenous TCR alpha chain and the exogenous TCR beta chain.

[0195] Provided is a method of detecting mispairing between an endogenous TCR beta chain and an exogenous TCR alpha chain in a population of cells, the method comprising (1) substantially reducing or eliminating the expression of the endogenous TCR beta chain in the population of cells, (2) introducing into the population of cells a nucleic acid encoding an exogenous TCR alpha chain and an exogenous TCR beta chain, (3) cultivating the population of cells to allow for pairing of the exogenous TCR alpha chain with the endogenous TCR beta chain and / or the exogenous TCR beta chain, and (4) detecting mispaired TCRs that the comprise endogenous TCR beta chain and the exogenous TCR alpha chain.

[0196] Equivalent methods may be used to detect TCR delta / gamma chain mispairings.

[0197] Methods for the detection of mispaired TCRs include the methods described herein. For example, the subpopulation of cells comprising a mispaired TCR can be detected by isolating cells that express a TCR (e.g., as determined using a pan TCR marker) but that do not substantially bind to a tetramer targeting the correctly paired exogenous TCR.

[0198] Kits

[0199] In another aspect, provided are kits for the manufacturing, preparation, and development of the compositions described above, comprising at least one or more containers, each with a different reagent for the manufacturing of the compositions disclosed herein. Kits may include a set of instructions in the use of the reagents, essential information on how performing the procedures for the manufacturing.

[0200] In certain embodiments, kits are provided for the preparation and development of a pharmaceutical composition comprising a therapeutically effective amount of a composition disclosed herein and a pharmaceutically acceptable carrier. The kit may comprise at least one, or more containers, each with a different reagent. Kits may include instruction for the manufacturing, for the therapeutic regimen to be used, and periods of administration. In more complex embodiments, the kits may comprise further therapeutic elements, e.g. checkpoint modulators, in accordance with this disclosure.

[0201] The composition or the pharmaceutical composition described herein can be provided in a kit. In one embodiment, the kit includes (a) a container that contains the composition and optionally (b) informational material. The informational material can be descriptive, instructional, marketing or other material that relates to the methods described herein and / or the use of the agents for therapeutic benefit. For example, kits may include instruction for the manufacturing, for the therapeutic regimen to be used, and periods of administration. In an embodiment, the kit includes also includes an additional therapeutic agent (e.g., a checkpoint modulator). The kit may comprise one or more containers, each with a different reagent. For example, the kit includes a first container that contains the composition and a second container for the additional therapeutic agent.

[0202] The containers can include a unit dosage of the pharmaceutical composition. In addition to the composition, the kit can include other ingredients, such as a solvent or buffer, an adjuvant, a stabilizer, or a preservative.

[0203] The kit optionally includes a device suitable for administration of the composition, e.g., a syringe or other suitable delivery device. The device can be provided pre-loaded with one or both of the agents or can be empty, but suitable for loading.

[0204] All methods described herein are performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. In regard to any of the methods provided, the steps of the method may occur simultaneously or sequentially. When the steps of the method occur sequentially, the steps may occur in any order, unless noted otherwise.

[0205] In cases in which a method comprises a combination of steps, each and every combination or sub-combination of the steps is encompassed within the scope of the disclosure, unless otherwise noted herein.

[0206] It is to be understood that this invention is not limited to the particular molecules, compositions, methodologies, or protocols described, as these may vary. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention. It is further to be understood that the disclosure of the invention in this specification includes all possible combinations of such particular features. For example, where a particular feature is disclosed in the context of a particular aspect or embodiment of the invention, or a particular claim, that feature can also be used, to the extent possible, in combination with and / or in the context of other particular aspects and embodiments of the invention, and in the invention generally.

[0207] All referenced patents, patent applications, book chapters, scientific publications, etc. are incorporated herein by reference in their entireties. Furthermore, where a definition or use of a term in a reference, which is incorporated by reference herein is inconsistent or contrary to the definition of that term provided herein, the definition of that term provided herein applies and the definition of that term in the reference does not apply.

[0208] To facilitate a better understanding of the present invention, the following examples of specific embodiments are given. The following examples should not be read to limit or define the entire scope of the invention.EXAMPLES

[0209] Example 1: Materials and Methods for Examples 2-8

[0210] Mice

[0211] I dMC -Prkdcscid Il2rgtmlWjU zi (NSG) and C57BL / 6 mice were purchased from The Jackson Laboratory and Harlan, respectively. These mice were subsequently housed and bred under specific and opportunistic pathogen-free (SOPF) conditions at the Epalinges / UNIL Animal Facility. All in vivo experiments were conducted in accordance and with approval from the Service of Consumer and Veterinary Affairs (SCAV) of the Canton of Vaud and Swiss federal law.

[0212] Cell lines

[0213] Jurkat (T cell leukemia), A375 (melanoma; HLA-A*02:01+, NY-ESO-1+), T2 (HLA-A*02:01+, derived from a variant of the T1 cell line), E.G7-OVA (derivative of EL4),Cl 498 (murine AML cell line), HEK293T (human embryonic kidney), and Phoenix-ECO cell lines were purchased from ATCC. The mouse B16-OVA cell line (melanoma) was a gift from Prof. Pedro Romero (UNIL, Switzerland). T333A-CIITA (melanoma; HLA-DRB3*02:02+, NY-ESO-U) cell line, derived from melanoma patient (Lausanne, CHUV) cultured in RPMI 1640 Glutamax medium (BioConcept) supplemented with 10% heat-inactivated FBS (Gibco), 1% penicillin / streptomycin (BioConcept), 1% non-essential amino acid (Gibco) and 1% hepes buffer (BioConcept). All other cell lines were maintained in RIO medium (RPMI 1640 supplemented with 10% heat-inactivated FBS and 1% penicillin / streptomycin). For E.G7- OVA cell line, R10 medium supplemented with 0.4 mg / ml G418 sulfate (Gibco).

[0214] Generation of lentiviral and retroviral TCR constructs

[0215] DNA constructs encoding the various TCR specificities, fused at their carboxy termini to Zip or ZipER, were cloned into lentiviral pRRL or retroviral pMSGV vectors (Fig. 2A). Each gene construct consisted of a TCR alpha chain followed by a P2A sequence, a TCR beta chain, a T2A sequence, and either mCherry or Thyl. l, which served as surrogate markers for transgene transduction (Genescript and Twist bioscience).

[0216] The TCRvl construct comprised from 5’ LTR to 3’LTR sequences encoding the following: (1) TCR alpha chain (comprising variable alpha chain, constant alpha chain, transmembrane region, cytoplasmic tail, GABA zipper domain A (referred to herein as ZipA)) - self-cleaving peptide T2A - TCR beta chain (comprising variable beta chain, constant beta chain, transmembrane region, cytoplasmic tail, GABA zipper domain B (referred to herein as ZipB), and a C-terminal RSRR endoplasmic reticulum (ER)-retention motif) - self-cleaving peptide P2A - reporter protein (such as mCherry or Thy 1.1). 2 A peptides act through ribosomal skipping to allow for the encoding of polyprotein that can dissociate into individual proteins upon translation. The TCRv2 construct comprised from 5’ LTR to 3’LTR sequences encoding the following: (1) TCR alpha chain (comprising variable alpha chain, constant alpha chain, transmembrane region, cytoplasmic tail, ZipB, ER-retention motif) - self-cleaving peptide T2A - TCR beta chain (comprising variable beta chain, constant beta chain, transmembrane region, cytoplasmic tail, Zip A) - self-cleaving peptide P2A - reporter protein (such as mCherry or Thyl. l). Fusion proteins comprising the ER-retention motif are referred to as ZipER herein. See Table 1 and Table 2 for sequences.Table 1. Components of TCRvl and TCRv2 constructs (nucleic acid sequences). *Used for co-expression of TCR alpha and beta chains.Table 2. Components of TCRvl and TCRv2 constructs (amino acid sequences). *Used for

[0217] Retrovirus and lentivirus production

[0218] Retroviral or lentiviral transduction was used to introduce TCRs (TCR-Zip, TCR- ZipER) into primary mouse and human T cells (and Jurkat cells), respectively. To generate retroviral particles, Phoenix-ECO cells (ATCC) were transfected with pMSGV expression vector and pCL-ECO retroviral packaging plasmid using a mix of Turbofect (Thermo Fisher Scientific) and Opti-MEM medium (Thermo Fisher Scientific). To produce lentiviral particles, HEK293 cells (ATCC) were transfected with pRRL expression vector and pVSV-G and R874 lentiviral packaging plasmid. For both strategies, virus supernatant was collected at 48-hour post transfection and concentrated using ultracentrifuge. The concentrated virus resuspended in RPMI 1640 Glutamax medium (BioConcept) and kept at -80 °C until use.

[0219] Human T cell isolation, activation, transduction

[0220] PBMCs were separated from healthy donor buffy coats (Transfusion Interregionale CRS SA, Epalinges, Switzerland) using Lymphoprep (Axonlab). CD4+and CD8+T cells were negatively isolated using magnetic beads (EasySep, Stemcell Technology) and furtherstimulated with anti-human CD3 / CD28 beads (Thermo Fisher Scientific) at a 2:1 bead / T cell ratio in RIO medium supplemented with 50 lU / ml human IL-2 (hIL-2, Peprotech) and 10 ng / mL of hIL-15 and hIL-7 (Miltenyi Biotec GmbH). After 24 hours of activation, T cells were transduced with lentivirus in the presence of Lentiboost (Sirion Biotech). At 48 hours poststimulation the beads were removed and the cells refreshed with RIO medium supplemented with 50 lU / ml hIL-2 (Peprotech) and 10 ng / mL of hIL-15 and hIL-7 (Miltenyi Biotec GmbH). Engineered TCR-T cells were adjusted based on their surrogate expression marker (z.e. mCherry and Thy 1.1) before all the experiments.

[0221] Mouse T cell isolation, activation, transduction

[0222] Splenic derived mouse CD4+and CD8+T cells were negatively selected using magnetic beads (EasySep, Stemcell Technology). Isolated T cells were activated with antimouse CD3 / CD28 beads (Thermo Fisher Scientific) at 2:1 bead / T cell ratio in RPMI 1640 Glutamax supplemented with 10% heat-inactivated FBS (Gibco), 1% penicillin / streptomycin (BioConcept), 1% sodium pyruvate (Gibco), 1% non-essential amino acids (Gibco), and 0.1% 2-mercaptoethanol (Gibco). Upon 24 hours of activation, murine T cells were transduced with retroviral particles in retronectin (20 pg / ml, Takara) pre-coated plate wells. At 48 hours poststimulation the beads were removed and the cells refreshed with mouse medium supplemented with 50 lU / ml hIL-2 (Peprotech) and 5 ng / mL of hIL-15 and hIL-7 (Miltenyi Biotec GmbH). Engineered TCR-T cells were adjusted for equal levels of transduction based on their surrogate expression marker (i.e. mCherry or Thyl. l) before all the experiments.

[0223] Flow cytometry

[0224] To evaluate TCR chain mispairing, transduced T cells were stained with surface markers including anti-mouse TCR Vbeta (Biolegend), anti-mouse TCR Vbeta5.1, 5.2 (Biolegend), anti-mouse TCR Valpha2 (Biolegend), anti-mouse CD90.1 (Thyl. l, Biolegend), anti-human TCR pan alpha / beta (Beckman Coulter), anti-human EGFR (Biolegend), antihuman Vbeta3 and Vbetal3.1 (Beckman Coulter), TCR specific Tetramer (Tetramer Core Facility, UNIL) based on the manufacturer’s instructions. For exhaustion and activation profiles, T cells were stained for PD1, LAG3 and CD137 (all from BioLegend). For intracellular staining (ICS), fixed cells were stained for anti-mouse / human TNF-alpha and IL- 2 (BioLegend) following the manufacturer’s instructions. Anti-human CCR7 and Anti-human CD45RA (BioLegend) were used to check differentiation status of engineered TCR+ / - ZipER. In all the experiments, fixable Near-IR dead cell stain (Thermo Fisher Scientific) was used to discriminate dead cells. All samples were acquired by LSR II flow cytometry machine and further analyzed with FlowJo 10.7.2 software (Tree Star).

[0225] CRISPR Cas9 (RNP) electroporation of human and mouse cells

[0226] All human and mouse guide (g)RNA sequences were selected based on highest on- target and lowest off-target scores using CHOP-CHOP. Guide RNA (gRNA) sequences are listed in Table 3.Table 3. Mouse and human guide RNA sequences used for CRISPR / Cas9 engineering.

[0227] Selected CRISPR RNA (crRNA) sequences were:

[0228] GGCUCAAACAAGGAGACCUU (SEQ ID NO:48) for mouse TRBC1 / 2

[0229] CGUC AUGAGC AGGUUAAAUC (SEQ ID NO : 35) for mouse TRAC 1

[0230] GGAGAAUGACGAGUGGACCC (SEQ ID NO:52) for human TRBC1 / 2

[0231] AGAGUCUCUCAGCUGGUACA (SEQ ID NO:51) for human TRACI .

[0232] For human gene encoding CD3zeta, two crRNAs, GACGCCCCCGCGUACCAGCA (SEQ ID NO:56) and GUGGAAGGCGCUUUUCACCG (SEQ ID NO:58), were used to achieve high KO efficiency.

[0233] Briefly, 5 pg of SpyFi Cas9 (Aldevron) and 3 pg sgRNA (Synthego) were mixed in optimum (Invitrogen) and incubated at room temperature to generate ribonucleoprotein complex (RNP). Upon 48-hour activation, T cells were washed with Opti-MEM reduced serum medium (Gibco) and resuspended in MaxCyte buffer (HyClone). A total of 1-2* 106of T cells mixed with desired amount of RNP complex and electroporated using the Expanded T Cell-3 protocol (Human T cells) and Expanded T Cell-4 protocol (Murine T cells) on the MaxCyte® ExPERT ATX® device. The transfected cells were cultured in mouse or human medium supplemented with 2 pM DNA-PK inhibitor Nedisertib (M3814, Selleckchem), 50 lU / ml hlL- 2, 10 ng / ml hIL-7 and 10 ng / ml hIL-15. For TCR transduced T cells, lentiviral or retroviral transduction occurred 24 hours before electroporation. TCR KO efficiency was evaluated 5 days post-electroporation by flow cytometry. To generate Jurkat TCRalpha / beta KO clones, 1- 2* 106Jurkat cells were mixed with desired amount of RNP complex as described above and electroporated using the Optimization 4 protocol on the MaxCyte® ExPERT ATx® device. Five days post-electroporation, Jurkat cells were sorted as single cells using BD FACSAria™ III Cell Sorter and cultured in RIO in 96 well plates. Thirty-five days post-electroporation, cells were stained for TCR expression and KO clones were selected by sorting.

[0234] Antigen-specific activation of T cells for cytokine measurement and marker expression

[0235] For peptide pulsing experiments, murine C1498 or human T2 cells were incubated with desired peptide concentration for 1 hour in R10 medium or RPMI 1640 medium, respectively, at 37 °C. T cells were co-cultured with peptide-loaded target cells at transduced T cells (i.e. mCherry+, tEGFR+or Thyl. U) to target ratio of 1 : 1 in complete medium supplemented with brefeldin A (1 : 1,000, BD GolgiPlug) and Monensin (1 : 1,000, BD GolgiStop) for 4-5 hours at 37 °C. For tumor-specific cell activation experiments, T cells were co-cultured at transduced T cells (i.e. mCherry+, tEGFR+) to target ratio of 1 : 1 in R10 medium supplemented with brefeldin A (1 : 1,000, BD GolgiPlug) and Monensin (1 : 1,000, BD GolgiStop) for overnight at 37 °C. Cytokine production by the differently activated T cells was assessed by intracellular staining of TNF-alpha (Biolegend) and IL-2 (Biolegend) according to manufacturer's instructions. To evaluate T cell specific activation and exhaustion markers, T cells were co-cultured at a transduced T cells (i.e., mCherry+) to target ratio of 1 : 1 in R10 medium supplemented for 24 hours at 37 °C followed by staining of PD-1, LAG3 and CD137 (all from BioLegend) surface markers. All samples were acquired by LSR II flow cytometry machine (BD Biosciences) and further analyzed with FlowJo 10.7.2 software (Tree Star).

[0236] Real-time killing assay

[0237] Real-time target cell killing by TCR-T cells was analyzed by IncuCyte S3 Live-Cell Analysis (Essen Bioscience). Briefly, 10* 103GFP+A375 (melanoma; HLA-A*0201+, NY- ESO-1+) target cells were seeded in 96 flat-bottom well plate (Costar, Vitaris) to adhere. Rested T cells were then added at a transduced T cell (z.e., mCherry+) to target ratio of 1 : 1 and 2: 1 in complete medium. T-cell cytolysis was assessed by real-time monitoring of GFP+objects (GFP+tumor cells). The Normalized Cell Index (NCI) was determined by dividing the total GFP+cell numbers at various time points by those at the initial time point.

[0238] Alternatively, for non-GFP+target cells, 125nM cytox red (Essen Bioscience) was added to the cultures and cell death determined by following increase in Total Red Object Area / mm2over time. All target cell killing analysis was performed with software provided by IncuCyte (Essen Bioscience).

[0239] LDH cytotoxicity assay

[0240] The cytotoxic potential of the primary or Jurkat T cells transduced with DRB3 / NY TCR+ / - ZipER was assessed against HLA-matched (T333A-CIITA) melanoma cell lines. Target cells were incubated with effectors at different ratios of transduced T cells (mCherry+) to target cells for 24 h at 37 °C, in the presence of cognate peptide at IpM. To evaluate cytolytic capacity of T cells transduced with MC2 and HPV TCR+ / - ZipER, human T2 cells were pulsed with cognate peptide at IpM concentration for one hour in RPMI 1640 medium at 37 °C. T cells were co-cultured with peptide-loaded target cells at different ratio of transduced T cells (mCherry+) to target cells for 24h at 37 °C. Supernatants were collected and mixed with Reaction mixture (CyQUANT™ LDH Cytotoxicity Assay Kit ThermoFisher Scientific) for 30 minutes at room temperature in the dark. Stop solution was added and the absorbances at 490 nm and 680 nm were measured to determine LDH activity. The percentage of specific lysis was calculated as follows: % cytotoxicity = (experimental - effector spontaneous - target spontaneous) / (target max - target spontaneous) x 100

[0241] Tc-buster transposon engineering

[0242] Isolated CD8+T cells were activated at a 1 :2 ratio of T cells to anti-CD3 / CD28 antibody-coated beads in R10 medium supplemented with 50 lU / m h-IL2, 10 ng / ml hIL-7 and 10 ng / ml hIL-15 per ml RPMI for G I O6T cells. After 48 hours of activation, beads were magnetically removed and cells washed with Opti-MEM reduced serum medium (Gibco) prior resuspension in MaxCyte buffer (HyClone). 3-5* 106T cells were mixed with 1 pg of transposase mRNA (Trilink) and 3 pg transposon nanoplasmid encoding A2 / NY-I53F TCR (Aldevron), then topped up to 25 pl with MaxCyte buffer. The mixture was transferred to aprocessing assembly (OC-25x3, MaxCyte) and electroporated using the Expanded T Cell-4 protocol on the MaxCyte® ExPERT ATx® device. Electroporated T cells were transferred to a 24-well plate (Costar) in RIO medium supplemented with 50 lU / m hIL-2, 10 ng / ml hIL-7 and hIL-15.

[0243] CRISP R-Cas9 -mediated KO and KI

[0244] Isolated CD4+T cells were activated at a 1 :2 ratio of T cells to anti-CD3 / CD28 antibody-coated beads in serum- free medium X-VIV015 (Lonza) supplemented with 50 lU / m IL-2, 10 ng / ml IL-7 and 10 ng / ml IL- 15 per ml medium for l * 106T cells. After 48 hours of activation, the first of two consecutive electroporations was performed. Briefly, beads were magnetically removed, cells washed twice with Opti-MEM reduced serum medium (Gibco) and then resuspended in MaxCyte buffer (HyClone). For the first electroporation, 3-5* 106T cells were mixed with 10 pg of Cas9 (Aldevron) and 6 pg of chemically modified gRNA targeting TRAC (or TRAC and TRBC) (Synthego), then topped up to 25 pl with MaxCyte buffer. The mixture was transferred to a processing assembly (OC-25x3, MaxCyte) and electroporated using the Expanded T Cell-4 protocol on the MaxCyte® ExPERT ATx® device. After this first electroporation, the cells were transferred to 24-Well Plate (Costar) containing serum- free medium X-VIV015 supplemented with 2 pM DNA-PK inhibitor Nedisertib (M3814, Selleckchem) and 50 lU / m hIL-2 and incubated at 37 °C for 5 hours. After 5h incubation, cells were washed with Opti-MEM reduced serum medium (Gibco), resuspended in MaxCyte buffer (HyClone) and then mixed with 5 pg of HDR template plasmid (generated in-house) with an HDR cassette encoding DRB3 / NY alpha / beta-TCR and mCherry with homology arms covering the TRAC sgRNA PAM site and electroporated for a second time using the Expanded T Cell-3 protocol on the MaxCyte® ExPERT ATx® device. Following the second electroporation the cells were transferred to 24-Well Plate (Costar) containing X- VIV015 supplemented with 50 lU / m hIL-2, 10 ng / ml hIL-7 and 10 ng / ml hIL-15 per ml RPMI for l * 106T cells.

[0245] Amnis ImageStream

[0246] Imaging flow cytometry was conducted using a dual camera ImageStream X MKII (ISx) system equipped with a 488 nm, 405 nm, 561 nm and 642 nm excitation lasers (Amnis, Seattle, USA). Bright-field (BF) illumination was collected in channels (CH) 1 (camera 1, 430 nm-480 nm) and 9 (camera 2, 560 nm-595 nm). Instrument setup and performance tracking was performed daily using the Amnis® SpeedBead® Kit (Luminex Corporation) for verifying optimal instrument performance. Data was collected at 60* magnification and high sensitivity fluidics mode was selected within the INSPIRE acquisition software. PE labeled Tetrameremission was measured from the 561nm laser in CH3 (560 nm-590 nm), mCherry emission was measured from the 561nm lasers in CH4 (595 nm-642 nm), and Live / Dead Near-IR emission was measured from the 642nm laser in CH12 (740 nm-800 nm). The excitation laser powers used were 200mW (488 nm), 200mW (561 nm), and 150 mW (642 nm) and were set to avoid saturation of the 12-bit CCD camera (raw max pixel values below 4096). An acquisition storage gate was set on a plot of CHI BF area versus CHI BF aspect ratio to exclude small debris from the file. Single stained controls were collected with BF illumination and scatter laser turned off in order to generate a compensation matrix post-acquisition. Fully stained samples were acquired collecting 10,000 cell events per sample. Raw image files (.rif) were compensated using the wizard embedded within the IDEAS V6.2 (Amnis). Focused cells from were selected using the gradient RMS feature. Doublets and larger cells were excluded based on the area and aspect ratio of the BF image. Live cells were selected using the Live / dead NIR stain. Cells were then evaluated for mCherry and PE (Tetramer) emission.

[0247] Spinning disk live confocal microscopy

[0248] For live imaging A375 melanoma cells were labeled with CSFE 647 (Thermofisher), washed twice and seeded in IBIDI 18 well p-chamber slides (Ibidi) at a concentration of 50000 cells per well, and let to adhere for 20min. Untransduced and transduced T cells were stained for F-actin and tubulin (SPYactin and SPYtubulin, Spirochrome) for 1 hour and added to tumor cells in a 1 : 1 ratio in R10 medium. luM of caspase 3 / 7 (Sigma) dye was added to each well shortly before imaging. The best timing for immune synapse formation and cell death was empirically determined in long-term time lapse pilot experiments. Dishes were mounted on the stage of a Nikon T2 Yokogawa CSU-W1 spinning disk confocal microscope at 37 °C, 5% CO2, 88% humidity and imaging performed in confocal mode with a perfect focus system using a 40x objective. Three z-stacks of 4pm distance were acquired per condition covering a z-space of 8pm total. Frame rates were 2.5 minutes with 18 positions per slide and imaged at one position per well. Images were obtained using 555 (for T cells and dead cells) and 647 (for tumor cells) laser channels as well as in bright-field mode. The best imaging interval was determined to be between 10 and 20h of co-culture. Imaging started therefore after lOh of coculture and timelapse movies of 10-12h duration were obtained. Engineered T cells were imaged for 3 different healthy donors. Each condition was imaged in duplicate per imaging slide and two slides were analyzed yielding in 4 replicate movies per condition. Image analysis was performed using Fiji / ImageJ and homemade macros. A cell cluster is defined as a minimum of 4 tumor cells and 1 T cell (or more) in close proximity, showing 20% of membrane overlap at 40x. Immune synapse formation is defined as a stable cell-cell contact of > 5 min.Transient contacts are T cells with polarized actin cytoskeleton but no uropod contraction and contact time < 5 min (2 frames).

[0249] CBA assay

[0250] Cytometric bead array (CBA; BD Biosciences) was performed to quantify cytokine secretion upon T cell: target cell co-culture. Briefly, 20* 103GFP+A375 (melanoma; HLA- A*0201+, NY-ESO-1+) target cells were seeded in 96 flat-bottom well plate (Costar) to adhere. Rested TCR-T cells were then added at a transduced T cells (z.e., mCherry+) to target ratio of 1 : 1 in RIO medium. After 24h co-culture, supernatants were collected and IFN-y, TNF-alpha and Granzyme B levels assessed by CBA following the manufacturer’s protocol. All data were analyzed using FCAP Array Software v3.0 (BD Biosciences) using manual bead clustering. Values were normalized to the non- modified TCR (z.e., WT TCR).

[0251] Winn assay

[0252] For the xenograft tumor model, 6-8 weeks old female C57BL / 6 mice were coinjected with A375 and T cells. In brief, engineered TCR T cells were mixed with A375 tumor cells at mCherry to target ratio of 3: 1 (l * 105+ 3* 105mCherry+T cells) and subcutaneously inoculated into the right flank of the mice. For negative control group, untransduced (UTD) T cells were injected into the control group. Tumor growth was measured by caliper 2-3 times a week post injection. Tumor volume was calculated by using formula of V= (L W2) / 2 (L= greatest longitudinal diameter and W= greatest transverse diameter). Mice were euthanized when tumors reached 1,000 mm3.

[0253] Syngeneic and xenograft ACT tumor models

[0254] For the syngeneic tumor model, female C57BL / 6 mice aged 6-8 weeks were engrafted with 5xl05E.G7-OVA cells which present the ovalbumin specific peptide SIINFEKL by H2Kb. ACT by tail vein injection of 3xl06Thyl.l+T cells for OT1 TCR + / - ZipER groups, and equivalent numbers of untransduced T cells was performed on days 6 and 8 post-tumor cell inoculation. For the xenograft tumor model, female NSG mice aged 6-8 weeks were engrafted with 5xl05A375 (A27NY+) cells and ACT on days day 6 and 8 posttumor cell inoculation of 10xl06mCherry4T cells for A2 / A97L + / - ZipER groups, and equivalent numbers of untransduced T cells performed. For both tumor models, ACT started when the tumors reached 50-100 mm3. Tumor growth and survival of all mice were monitored and mice were sacrificed once tumors reached 1,000 mm3.

[0255] Xenogeneic Graft-Versus-Host Disease (xGvHD)

[0256] To evaluate toxicity induced by mispaired TCRs, beta-endo KO CD8+T cells were lentivirally transduced with TCR + / - ZipER and on day 1, 10* 106mCherry+CD8+T cells (in1 OOpl) were transferred into NSG mice aged 8-12 weeks that had been irradiated by 1.5 Gy (24 hour earlier, day 0) to render them lymphopenic. As a control for maximum potential toxicity, mice received the same number of untransduced T cells (i.e., maximum polyclonal TCR repertoire), and as a negative control mice received PBS injections. Mice were monitored regularly post- ACT for GvHD related cachexia and euthanized upon 15% wight loss.

[0257] Statistical analysis and data representation

[0258] Statistical analysis and data visualization were performed by Prism (GraphPad, San Diego, CA) using relevant statistical tests specified in the figure legends (*P<0.05; **P<0.01; ***p<0.001; ****P<0.0001).

[0259] Example 2: Evaluation of TCR chain mispairing using CRISPR-Cas9 technology

[0260] To assess the specific mispairing of TCR chains, a combination of (1) Exo-TCR transduction using retrovirus or lentivirus and (2) CRISPR-Cas9 complex (RNP) electroporation to knock out the TCR endogenous chain(s) was used (Fig. 1A). In a T cell in which the alpha-endo chain gene (i.e., the gene for the alpha chain of the endogenous TCR) is knocked out, the alpha-exo chain can pair with either the beta-endo (endogenous TCR beta chain) or the beta-exo chain in the absence of competition by the native alpha-endo chain (Fig. ID)

[0261] TCR mispairing was assessed by a comparison of Tetramer staining (detecting only correctly assembled TCRs) and Pan-TCR staining (detecting all TCRs). The percentage of the specific mispaired population (TCR+Tetramer') for each condition was calculated by comparison to the control group (TCR+Tetramer4-) (Fig. 1A). A side-by-side comparison of variable alpha- and beta-chain staining versus pan-TCR beta-chain / Tetramer staining revealed that the former completely fails to capture the level of chain mispairing in TCR-transduced T cells (Fig. 1C).

[0262] Next, the method for detecting TCR chain mispairing was benchmarked with an anti- MAGE-C2 (MC2) TCR. The beta-chain of this TCR had a high tendency to mispair with alpha- endo-chain in the absence of competition from the beta-endo chain (Fig. ID, left). Screening a panel of TCRs revealed a general trend of beta-exo mispairing with alpha-endo chains, but to different degrees (Fig. ID, right).

[0263] Finally, it was confirmed that the TCR+Tetramer population was caused by chain homodimerization (Fig. IE).

[0264] To further illustrate the advantages of using a CRISPR-based system as a readout for TCR mispairing (e.g., as compared to detection of TCR single chain), TCR mispairing was examined in the NY-ESO TCR context (Table 4). The NY-ESO TCR binds to the HLA-A2 restricted epitope NY-ESO-I157-165. TCR variant NY-ESO A97L (also referred to as A2 / NY- A97L) is an affinity-enhanced TCR that comprises a single amino acid replacement (A97L) in the beta chain (in CDR3) as compared to the WT / parent NY-ESO TCR. NY-ESO A97L TCR, WT NY-ESO TCR and NY-ESO I53F TCR share the same alpha chain. NY-ESO A97L TCR has an increased affinity (KD = 2.7 microM) to its target epitope as compared to the NY-ESO parent (KD = 21.4 microM) and demonstrated superior in vitro function and in vivo tumor control as compared to the parent. The improved function of A2 / NY-A97L TCR-T cells as compared to T cells expressing the parent TCR may not only be due to improved affinity, but also on account of lower levels of chain-mi spairing, resulting from a single amino acid replacement in CD3beta (Fig. ID, right).Table 4. Illustrative T cell receptors tested useful for the compisitions and methods disclosed herein, intending the TCRs’ HLA-haplotype restriction and target peptide sequence. *See Intematinal Patent Publication No. WO2020188348.

[0265] Additional mispairing experiments were performed for TCRs targeting human papillomavirus (HPV) and Zinc Transporter 8 (ZnT8). Also tested were the DRB3 / NY TCR and the OT1 TCR (the latter being to murine origin) (Fig. ID, bottom and Table 4). The remaining TCRs are of human origin. See Tables 5 and 6 for selected sequences.

[0266] Finally, the efficacy of previously described chain-pairing strategies was tested. These strategies included the introduction of a non-native disulfide bridge (DB), replacement of human by mouse constant regions (HM), and framework region mutations (FW) (z.e., L99alpha, R9beta and YlObeta) previously described to generate dominant TCRs. See Cohen et al., Enhanced antitumor activity of T cells engineered to express T-cell receptors with a second disulfide bond, Cancer Res, 2007. 67(8): p. 3898-903; Kuball et al., Facilitating matched pairing and expression of TCR chains introduced into human T cells, Blood, 2007. 109(6): p. 2331-8; Thomas et al., Framework engineering to produce dominant T cell receptors with enhanced antigen-specific function, Nat Commun, 2019. 10(1): p. 4451; Cohen et al., Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR / CD3 stability, Cancer Res, 2006. 66(17): p. 8878-86, all of which are incorporated herein in their entireties. L96alpha is a proline to leucine substitution. R9beta is a serine to arginine substitution. YlObeta is an asparagine to substitution. See Thomas, 2019.

[0267] None of these previously employed strategies efficiently detected beta-exo-chain MC2 mispairing in beta-endo chain KO T cells (z.e., there was no impedance to its mispairing with the alpha-endo chain) (Fig. IF). While CRISPR KO of the endo-TCR can abrogate mispairing, unless the KO is 100% efficient in the T-cell, mispairing can still occur.Table 5. Selected TCR nucleic acid sequences.Table 6. Selected TCR amino acid sequences. Constant region in bold and underlined. The variable region is located N-terminal of the constant region. Transmembrane domains in italics. Cytoplasmic tail underlined (not bold). The heterodimeric proteins herein may comprise one portion of the sequences in this table (e.g., only the variable domain) as well as variants thereof. The sequences of A2 / NY-WT beta chain (A at position 97) and the A2 / NY- I53F beta chain (F at position 53) can be easily derived from the sequence for the A2 / NY-A97L beta chain (SEQ ID NO: 30),

[0268] In sum, by utilizing a CRISPR-based strategy, deeper insights into the specific mispairing events of Exo-TCR chains with Endo-TCR chains can be gained that are not detected using single-chain transduction, particularly in cases where a dominant chain is present in the Exo-TCR.

[0269] Example 3: The Zip A / B dimerization motif facilitates preferential TCR chain pairing and enhances surface expression of correctly paired TCR chains

[0270] Various strategies have been employed to enhance exogenous TCR chain pairing and optimize exogenous TCR expression. As discussed herein, such have included murinization, TCR-specific disulfide bonds, single-chain TCRs, TCR domain swapping, and framework engineering. Problematically however, these approaches cannot completely abrogate the issue of chain mispairing. So far, complete elimination of the TCR mispairing has only been achieved by deletion of endogenous alpha / beta TCR chains using genetic editing. Yet, the relatively high frequency of off-target effects during TCR gene editing remains a major concern. To address this challenge, a new engineering approach utilizing a coil-coil dimerization GABA motif was developed to promote preferential Exo-TCR chain pairing and surface expression of Exo-TCR.

[0271] For proof-of-concept, the melanoma-associated antigen C2 (MAGE-C2) TCR employed in Example 2 was used. Two different lentiviral variants of the MAGE-C2 TCR were used, each incorporating gamma-aminobutyric acid (GABA)-receptor-deriveddimerization motifs ZipA and ZipB (Fig. 2A). ZipA and ZipB form a coiled-coil (zipper) between the C-termini of the two heterodimerization subunits. The vectors also contained a gene encoding mCherry to monitor transduction efficacy.

[0272] Initial experiments in a Jurkat cell line demonstrated that both engineered MAGE- C2 TCRs constructs TCRvl and TCRv2 (Fig. 2A) paired without exhibiting mixed dimers on the surface of T cells (Fig. 2B). Furthermore, swapping the GABA dimerization motif between the MAGE-C2 TCR alpha and beta chains had no impact on TCR expression and chain pairing (compare constructs vl and v2 in Fig. 2B).

[0273] In addition to the dimerization motif, GAB AB 1 contains an arginine-based signal in its carboxy-terminal tail, causing its retention in the endoplasmic reticulum (ER) (Fig. 2A). This ER retention is masked by GABAB2 once present in the ER, aiding in the release of the correctly paired receptor. Inclusion of the ER retention signal and masking sequence (see Tables 1 and 2) offers an opportunity for even stricter control over chain pairing in T cells, which is particularly useful when one TCR chain is more promiscuous than its counterpart.

[0274] To that end, the ER motif of the GABABI coil was fused to the beta-exo chain (Fig. 2A), based on beta-exo chain’s higher tendency to mispair with the alpha-endo chain (Fig. ID). It is important to note that Jurkat T cells, which contain a single gene encoding the alpha / beta of TCRs, cannot fully replicate a clinical setting in which polyclonal TCR T cells are present. Therefore, further evaluations were conducted to assess the impact of Exo TCR- Zip and Exo TCR-Zip-ER expression in primary T cells.

[0275] Transduction of T cells with the OTI b-chain or OTI b-chain-ZipER alone showed extensive pairing with alpha-endo, but OTI beta-chain-ZipER did not (z.e., it was retained in the ER) (Fig. 2C). The functionality of the ER retention motif in the context of the OTI TCR was further demonstrated in murine T cells (Fig. 2D).

[0276] Next, the ability of the ZIP or ZipER (GABABI coil + ER motif fused to the TCR b- chain and GABAB2 coil + masking sequence fused to the TCR a-chain) to abrogate MC2 mispairing was compared to previously described strategies to prevent TCR mispairing, including DB, HM and FW engineering (see Example 2). Both the Zip and ZipER motifs significantly increased TCR expression (on average -89% and -92%, respectively) in transduced T cells as compared to WT TCR and the other chain pairing strategies (Fig. 2E). Moreover, both the Zip and ZipER motifs reduced MC2 chain mispairing to negligible levels (on average -6% and -5 %, respectively) in beta-endo KO T cells. In contrast, the DB and FW strategies did not decrease mispairing at all, and HM only marginally reduced mispairing (Fig. 2F).

[0277] These findings demonstrate that the incorporation of the ZipA / B dimerization motif into a TCR results in an improved preferential chain pairing for Exo-TCRs and enhanced Exo- TCR surface expression.

[0278] Example 4: The ZipA / B dimerization motif can be applied universally to TCR engineering

[0279] As shown in Example 3, integration of the Zip A / B dimerization motif into the MAGE-C2 TCR had proven successful, resulting in a reduction of TCR mispairing comparable to CRISPR editing. In order to demonstrate the universal applicability of this approach, various TCRs comprising the Zip A / B dimerization motif were engineered.

[0280] Comprehensive screening of a panel of TCRs revealed that the ZipER can universally mitigate mispairing of alpha-exo as well as beta-exo chains to negligible levels in transduced T cells (under stringent conditions in which alpha-endo or beta-endo genes are knocked out; Fig. 3A). Representative pan-TCR and Tetramer staining for MC2 versus MC2- ZipER transduced T cells, for example, demonstrated that, with the ZipER, alpha-exo mispairing reduces from 52% to 2% (in alpha-endo KO cells) and exo-beta mispairing drops from 85% to 4% (in beta-endo KO cells; Fig. 3A). The enforced chain pairing by the ZipER also significantly increases the frequency of Tetramer T cells, up to 59-fold for MC2 (Fig. 3B). Moreover, the increase in frequency of Tetramer T cells for TCR-ZipER versus TCR was observed at high, medium and low levels of transduction efficiency as evaluated by mCherry expression levels, confirming that this strategy robustly works even in T cells with low transduction levels (Fig. 3C).

[0281] Of note, ZipER engineering improves TCR expression in Jurkat and primary T cells lacking endogenous TCR chains (Figs. 3D, 3E, and 3F), indicating that ZipER-engineered TCRs achieve superior surface expression relative to non-engineered TCR, even in the absence of competition for CD3 complex association.

[0282] These results provide compelling evidence for the substantial impact of the dimerization motif on enhancing TCR expression.

[0283] Example 5: TCR-ZipER T cells demonstrate superior in vitro function

[0284] To evaluate the potential impact of Zip A / B dimerization motif incorporation on CD3 assembly and surface TCR expression, an analysis of TCR expression in the absence of the CD3 zeta subunit was conducted.

[0285] Molecular modeling indicated that the Zip-ER motif does not disrupt the structure of the CD3 zeta endo-domain, which is an important signaling subunit of CD3 complex and required for CD3 assembly (Figs. 4A and 4B). Modeling also suggested that the ZipER domain does not impair function of the immunoreceptor tyrosine-based activation motifs (ITAMs), which trigger intracellular signaling cascades upon cognate TCR / HLAp engagement.

[0286] Consistent with this, the inclusion of the Zip A / B dimerization motif does not abrogate CD3 -dependence for TCR cell-surface expression (Fig. 4C).

[0287] Furthermore, to determine the impact of the Zip A / B dimerization motif on TCR downstream signaling and function, TCR-transduced T cells were stimulated with T2 cells presenting the respective cognate peptides (concentrations ranging from 1 pM to 1 pM). The intracellular production of TNF-alpha and IL-2 was determined.

[0288] T cells expressing TCR-ZipER constructs demonstrated a significant improvement in a dose response profile as compared to cells expressing only the respective TCR. A similar pattern was observed for the five different TCR examined here (Fig. 4D). Remarkably, for some TCRs, such as OT1 TCR, increased avidity achieved by ZipER enabled IL-2 and TNF- alpha production at 1000-fold lower concentrations of peptide pulsing (Fig. 4D).

[0289] Finally, TCR T cells expressing TCR-ZipER constructs effectively preserved their cytotoxic capabilities (Figs. 4E-4H).

[0290] Taken together, these results underscore that the incorporation of the Zip A / B dimerization motif has no negative impact on TCR expression, allowing engineered T cells to maintain their multifunctionality and potent cytolytic potential.

[0291] Example 6: TCR-ZipER T cells demonstrate superior in vivo tumor control and safety

[0292] Next, it was examined if the ZipER impacted T-cell engagement of target tumor cells and immune synapse formation. TCR-ZipER T cells formed larger multi-cell clusters at 15h of co-culture, as observed with spinning disk live microscopy (Figs. 5A and 5B). Moreover, higher resolution analysis revealed that as compared to TCR-T cells, TCR-ZipER T cells interacted with higher numbers of tumor cells and were positioned centrally in multicell clusters that form over time (Fig. 5C). More stable immune synapses were observed for TCR- ZipER T cells as well as transient kinapse-like interactions with target cells (Fig. 5D).

[0293] Next, the activity of TCR- versus TCR-ZipER-T cells in vivo was compared. In both syngeneic and xenograft tumor models, superior tumor control and survival was observed for mice treated with TCR-ZipER-T cells (Figs. 5E and 5F).

[0294] The in vivo toxicity caused by TCR chain mispairing was examined. To that end, untransduced (UTD; polyclonal TCR T cells), MC2-T cells (with beta-endo KO to favor chain mispairing) and MC2-ZipER-T cells (with beta-endo KO), respectively were adoptively transferred into irradiated NSG mice.

[0295] Lowest survival, as expected, was observed for UTD treated mice on account of the polyclonal TCR repertoire (some T cells among this repertoire will drive an anti-host response). MC2-T cells lead to higher survival rates as compared to UTD (with beta-endo KO; i.e. high levels of polyclonal mispaired TCRs), leading to about 20% lethal TCR-induced Xenogeneic Graft-versus-Host Disease (TI-xGvHD). In contrast, 100% of control PBS and MC2-ZipER (with beta-endo KO; i.e., the T cells are monoclonal for MC2 TCR) were alive, showing no signs of toxicity at 40 days post treatment (Fig. 5G).

[0296] In sum, this data demonstrates superior in vivo tumor control by TCR-ZipER versus TCR-engineered T cells, as well as a reduction in xGVHD in response to ACT in NSG mice.

[0297] Example 7: TCR-ZipER-T cells outperform affinity-optimized TCR-T cells

[0298] TCR affinity-optimization can improve responses to ACT. However, this strategy requires either computational modeling (a non-universal strategy) or library screening and validation and comes with the inherent risk of generating cross-reactive specificities. As such, it was tested whether engineering T cells with a WT TCR-ZipER to increase overall avidity was equally effective, if not superior, to expressing an affinity-optimized TCR in T cells.

[0299] To that end, T cells were transduced to express A2 / NY-WT (KD = 21.4 microM), A2 / NY-97L (KD= 2.7 microM), or A2 / NY-WT-ZipER.

[0300] Significantly higher Tetramer binding was observed for A2 / NY-WT-ZipER-T cells as compared to A97L-T cells, corresponding to an increased frequency of correctly paired TCRs confirmed by a comparison of A2 / NY Tetramer and Vbetal3 staining (Fig. 6A). Phenotypic evaluation revealed no differences in the differentiation status of WT and affinity- optimized TCR- versus TCR-ZipER T cells, with the majority of both having stem-cell like memory phenotype (Fig. 6B). The A2 / NY-WT-ZipER-T cells consistently demonstrated higher in vitro function than A97L-T cells in terms of proporti on expressing IL-2 or TNF-alpha upon co-culture with peptide pulsed target cells (Figs. 6C and 6D), as well as target cell killing (Fig. 6E). Finally, co-culture with A2 / NY" Me275 melanoma cells revealed significantlyhigher upregulation of the activation marker CD 137 as well as of the coinhibitory receptors programmed cell death protein 1 (PD-1) and lymphocyte-activation gene 3 (LAG3), and of TNF-alpha expression for A2 / NY-WT-ZipER-TCR T cells as compared to A97L-T cells (Fig. 6F).

[0301] This data shows that by increasing avidity, the ZipER circumvented the need for TCR affinity optimization.

[0302] Example 8: TCR-ZipER is compatible with non-viral gene-editing

[0303] Non-viral engineering including transposon-based and CRISPR / Cas9 technologies are increasingly being used to engineer T cells for clinical use. A major advantage of these techniques is the speed at which GMP-grade non-viral vectors can be generated as compared to virus transfection. Moreover, orthotopic replacement of TCRs by CRISPR / Cas9 integration into the TCR alpha chain (TRAC) locus preserves near-physiological T cell function. Hence, it was evaluated whether TCR-ZipER is compatible with these non-viral strategies.

[0304] Using transposon editing, higher Tetramer staining of TCR-ZipER- versus TCR-T cells (using an affinity-optimized A2 / NY TCR; I53F) was observed at low, medium and high integration levels (Fig. 7A), which corresponded to higher effector function (Fig. 7B). Like for virally transduced T cells, the ZipER mitigated beta-exo mispairing was confirmed by comparing Tetramer and Vbetal3 staining (Fig. 7C).

[0305] For CRISPR / Cas9 genome-editing, TCRs are typically integrated in the TRAC locus and involve concomitant KO of both the TRAC and TRBC loci to abrogate chain mispairing. Multiplex editing by CRISPR / Cas9 requiring more than one double stranded (ds)DNA break, however, can cause genetic abnormalities and toxicity in T cells. As such, it was tested if use of the ZipER could overcome the need to target both the TRAC and TRBC loci.

[0306] DRB3 / NY TCR (shown to have a high level of alpha-exo mispairing, Fig. ID), knock-in (KI) into the TRAC locus had to be combined with TRBC KO to mitigate chain mispairing and achieve optimal TCR expression (Fig. 7D). In contrast, for TRAC KI of the TCR-ZipER concomitant KO of TRBC was not necessary to achieve comparative (slightly higher) Tetramer staining and equally functioning T cells (Figs 7D and 7E).

[0307] This data shows that the TCR-ZipER motif can be effectively engineered by non- viral means, including transposon-based and CRISPR / Cas9 KI. In the context of orthotopic TCR replacement in the TRAC locus by CRISPR / Cas9 KI, for TCR-ZipER it was not necessary to further KO endo-beta because the ZipER abrogates mispairing. Hence, in a clinical setting, the ZipER can enable important cost savings and safety in the manufacture of TCR-Tcells for ACT. For example, if viral integration is being used, there is no need to set up additional CRISPR / Cas9 KO of the endo-chains. Moreover, if CRISPR / Cas9 is being used for orthotopic TCR KI into TRAC, there is no need to KO TRBC which can lead to chromosomal abnormalities, or to incur the additional cost of further KO of TRBC.

[0308] The methods provided herein address a long-standing obstacle in the generation of therapeutic TCR-engineered T cells for ACT: mispairing of the exo- and endo-TCR chains. Such mixed pairing not only risks the generation of autoreactive TCR specificities but also drives competition for the CD3 complex which is required for cell-surface expression of the therapeutic TCR. Lower density at the cell surface of non-dominant therapeutic TCRs (z.e., ones that have a high tendency to mispair) can dramatically decrease the avidity of the engineered T cells and thereby limit their sensitivity and activity levels against target cells as compared to antigen-specific T cells naturally expressing TCRs. This is a critical barrier to the clinical efficacy of TCR-T cells in patients.

[0309] The ZipER, which is compatible with both viral and non-viral TCR integration, is a simple and universal strategy for enforcing therapeutic TCR chain pairing and enhancing the avidity and function of T cells.

Claims

CLAIMSWe claim:

1. A heterodimeric protein comprising:(a) (1) a first polypeptide comprising (i) a first T cell receptor (TCR) variable chain and (ii) a first dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO:9 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO: 11; or(b) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO: 11 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO:9.

2. The heterodimeric protein of claim 1, wherein (1) the first TCR variable chain is a TCR alpha chain and the second TCR variable chain is a TCR beta chain or (2) the first TCR variable chain is a TCR beta chain and the second TCR variable chain is a TCR alpha chain.

3. The heterodimeric protein of claim 1, wherein (1) the first TCR variable chain is a TCR gamma chain and the second TCR variable chain is a TCR delta chain or (2) the first TCR variable chain is a TCR delta chain and the second TCR variable chain is a TCR gamma chain.

4. The heterodimeric protein of any one of claims 1-3, the heterodimeric protein comprising:(a) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO:9 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO: 11; or(b) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO: 11 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO:9.

5. The heterodimeric protein of claim 4, the heterodimeric protein comprising:(a) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising SEQ ID NO:9 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising SEQ ID NO: 11; or(b) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a first dimerization domain comprising SEQ ID NO: 11 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a second dimerization domain comprising SEQ ID NO:9.

6. The heterodimeric protein of any one of claims 1-5, wherein (1) the first polypeptide further comprises a sequence having at least 80% sequence identity to SEQ ID NO: 19 and the second polypeptide further comprises a sequence having at least 80% sequence identity to SEQ ID NO:20; or (2) the first polypeptide further comprises a sequence having at least 80% sequence identity to SEQ ID NO:20 and the second polypeptide further comprises a sequence having at least 80% sequence identity to SEQ ID NO: 19.

7. The heterodimeric protein of claim 6, wherein (1) the first polypeptide further comprises a sequence having at least 90% sequence identity to SEQ ID NO: 19 and the second polypeptide further comprises a sequence having at least 90% sequence identity to SEQ ID NO:20; or (2) the first polypeptide further comprises a sequence having at least 90% sequence identity to SEQ ID NO:20 and the second polypeptide further comprises a sequence having at least 90% sequence identity to SEQ ID NO: 19.

8. The heterodimeric protein of claim 7, wherein (1) the polypeptide further comprises SEQ ID NO: 19 and the second polypeptide further comprises SEQ ID NO:20; or (2) the first polypeptide further comprises SEQ ID NO:20 and the second polypeptide further SEQ ID NO: 19.

9. The heterodimeric protein of any one of claims 1-8, wherein (1) the first polypeptide further comprises a first linker connecting the first TCR variable chain and the first dimerization domain; and / or (2) the second polypeptide further comprises a second linker connecting the second TCR variable chain and the second dimerization domain.

10. The heterodimeric protein of claim 9, wherein the first and / or the second linker is a flexible polypeptide linker.

11. The heterodimeric protein of claim 9, wherein the first and / or the second linker comprises SEQ ID NO: 13 or SEQ ID NO: 14.

12. The heterodimeric protein of claim 1, the heterodimeric protein comprising:(a) (1) a first polypeptide comprising from N- to C-terminus: (i) a first TCR variable chain, wherein the first TCR variable chain is a TCR alpha chain, (ii) a linker, and (iii) a first dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO:9; and (2) a second polypeptide comprising from N- to C-terminus: (i) a second TCR variable chain, wherein the second TCR variable chain is a TCR beta chain, (ii) a linker, and (iii) a second dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO: 11; or(b) (1) a first polypeptide comprising from N- to C-terminus: (i) a first TCR variable chain, wherein the first TCR variable chain is a TCR alpha chain, (ii) a linker, and (iii) a first dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO: 11; and (2) a second polypeptide comprising from N- to C-terminus: (i) a second TCR variable chain, wherein the second TCR variable chain is a TCR beta chain, (ii) a linker, and (iii) a second dimerization domain comprising a sequence having at least 80% sequence identity to SEQ ID NO:9.

13. The heterodimeric protein of claim 12, the heterodimeric protein comprising:(a) (1) a first polypeptide comprising from N- to C-terminus: (i) a first TCR variable chain, wherein the first TCR variable chain is a TCR alpha chain, (ii) a linker, and (iii) a first dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO:9; and (2) a second polypeptide comprising from N- to C-terminus: (i) a second TCR variable chain, wherein the second TCR variable chain is a TCR beta chain, (ii) a linker, and (iii) a second dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO: 11; or(b) (1) a first polypeptide comprising from N- to C-terminus: (i) a first TCR variable chain, wherein the first TCR variable chain is a TCR alpha chain, (ii) a linker, and (iii) a first dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO: 11; and (2) a second polypeptide comprising from N- to C-terminus: (i) a second TCR variable chain, wherein the second TCR variable chain is a TCR beta chain, (ii) a linker, and (iii) a second dimerization domain comprising a sequence having at least 90% sequence identity to SEQ ID NO:9.

14. The heterodimeric protein of claim 13, the heterodimeric protein comprising:(a) (1) a first polypeptide comprising from N- to C-terminus: (i) a first TCR variable chain, wherein the first TCR variable chain is a TCR alpha chain, (ii) a linker, and (iii) a first dimerization domain comprising SEQ ID NO:9; and (2) a second polypeptide comprising fromN- to C-terminus: (i) a second TCR variable chain, wherein the secondTCR variable chain is a TCR beta chain, (ii) a linker, and (iii) a second dimerization domain comprising SEQ ID NO: 11; or(b) (1) a first polypeptide comprising from N- to C-terminus: (i) a first TCR variable chain, wherein the first TCR variable chain is a TCR alpha chain, (ii) a linker, and (iii) a first dimerization domain comprising SEQ ID NO: 11; and (2) a second polypeptide comprising fromN- to C-terminus: (i) a second TCR variable chain, wherein the second TCR variable chain is a TCR beta chain, (ii) a linker, and (iii) a second dimerization domain comprising SEQ ID NO: 9.

15. The heterodimeric protein of any one of claims 12-14, wherein (a) the first polypeptide further comprises a sequence that is C-terminally located with respect to the first dimerization domain and that has at least 80% sequence identity to SEQ ID NO: 19 or 20 or (b) the second polypeptide further comprises a sequence that is C-terminally located with respect to the second dimerization domain and that has at least 80% sequence identity to SEQ ID NO: 19 or 20.

16. The heterodimeric protein of claim 15, wherein (a) the first polypeptide further comprises a sequence that is C-terminally located with respect to the first dimerization domain and that comprises SEQ ID NO: 19 or 20 or (b) the second polypeptide further comprises a sequence that is C-terminally located with respect to the second dimerization domain and that comprises SEQ ID NO: 19 or 20.

17. The heterodimeric protein of any one of claims 12-14, wherein:(a) the first polypeptide further comprises a sequence that is C-terminally located with respect to the first dimerization domain and that has at least 80% sequence identity to SEQ ID NO: 19 and the second polypeptide further comprises a sequence that is C- terminally located with respect to the second dimerization domain and that has at least 80% sequence identity to SEQ ID NO:20; or(b) the first polypeptide further comprises a sequence that is C-terminally located with respect to the first dimerization domain and that has at least 80% sequence identity to SEQ ID NO:20 and the second polypeptide further comprises a sequence that is C- terminally located with respect to the second dimerization domain and that has at least 80% sequence identity to SEQ ID NO: 19.

18. The heterodimeric protein of any one of claims 12-14, wherein:(a) the first polypeptide further comprises a sequence that is C-terminally located with respect to the first dimerization domain and that comprises SEQ ID NO: 19 and thesecond polypeptide further comprises a sequence that is C-terminally located with respect to the second dimerization domain and that comprises SEQ ID NO:20; or(b) the first polypeptide further comprises a sequence that is C-terminally located with respect to the first dimerization domain and that comprises SEQ ID NO:20 and the second polypeptide further comprises a sequence that is C-terminally located with respect to the second dimerization domain and that comprises SEQ ID NO: 19.

19. The heterodimeric protein of any one of claims 1-3, the heterodimeric protein comprising:(c) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a sequence having at least 80% sequence identity to SEQ ID NO: 10 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a sequence having at least 80% sequence identity to SEQ ID NO: 12; or(d) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a sequence having at least 80% sequence identity to SEQ ID NO: 12 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a sequence having at least 80% sequence identity to SEQ ID NO: 10.

20. The heterodimeric protein of claim 19, the heterodimeric protein comprising:(c) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a sequence having at least 90% sequence identity to SEQ ID NO: 10 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a sequence having at least 90% sequence identity to SEQ ID NO: 12; or(d) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a sequence having at least 90% sequence identity to SEQ ID NO: 12 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a sequence having at least 90% sequence identity to SEQ ID NO: 10.

21. The heterodimeric protein of claim 20, the heterodimeric protein comprising:(c) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a sequence comprising SEQ ID NO: 10 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a sequence comprising SEQ ID NO: 12; or(d) (1) a first polypeptide comprising (i) a first TCR variable chain and (ii) a sequence comprising SEQ ID NO: 12 and (2) a second polypeptide comprising (i) a second TCR variable chain and (ii) a sequence comprising SEQ ID NO: 10.

22. The heterodimeric protein of any one of claims 19-21, wherein (a) (i) the first TCR variable chain is a TCR alpha chain and the second TCR variable chain is a TCR beta chain or (ii) first TCR variable chain is a TCR beta chain and the second TCR variable chain is a TCRalpha chain or (b) (i) the first TCR variable chain is a TCR gamma chain and the second TCR variable chain is a TCR delta chain or (ii) the first TCR variable chain is a TCR delta chain and the second TCR variable chain is a TCR gamma chain.

23. A nucleic or set of nucleic acids encoding the heterodimeric protein of any one of claims 1-22.

24. A vector comprising the nucleic or set of nucleic acids of claim 23.

25. A cell comprising the nucleic or set of nucleic acids of claim 23 or the vector of claim 24.

26. The cell of claim 25, wherein the cell is an immune cell.

27. The cell of claim 26, wherein the immune cell is a lymphocyte.

28. The cell of claim 27, wherein the immune cell is a T lymphocyte.

29. A pharmaceutical composition comprising (a) the heterodimeric protein of any one of claims 1-22 or the cell of any one of claims 25-28 and (b) a pharmaceutically acceptable excipient.

30. A method of treating cancer, the method comprising administering to a subject in need thereof the pharmaceutical composition of claim 29.

31. A method of reducing the growth of a tumor, the method comprising administering to a subject in need thereof the pharmaceutical composition of claim 29.

32. A method of reducing cancer sternness, the method comprising administering to a subject in need thereof the pharmaceutical composition of claim 29.

33. A method of reducing tumor-associated fibrosis, the method comprising administering to a subject in need thereof the pharmaceutical composition of claim 29.

34. A method of reducing tumor metastasis, the method comprising administering to a subject in need thereof the pharmaceutical composition of claim 29.

35. A method of increasing cytokine production in the tumor microenvironment, the method comprising administering to a subject in need thereof the pharmaceutical composition of claim 29.

36. A method of method of increasing anti-tumor immunity, the method comprising administering to a subject in need thereof the pharmaceutical composition of claim 29.

37. A method of method of increasing infiltration of a tumor with immune cells, the method comprising administering to a subject in need thereof the pharmaceutical composition of claim 29.

38. A method of method of reducing T cell tolerance, the method comprising administering to a subject in need thereof the pharmaceutical composition of claim 29.

39. The method of any one of claims 30-38, wherein the subject has one or more cancers selected from the group consisting of sarcoma, carcinoma, melanoma, pancreatic cancer, thyroid cancer, lung cancer, colorectal cancer, squamous cancer, prostate cancer, breast cancer, bladder cancer, ovarian, and gastric cancer.

40. The method of any one of claims 30-39, the method further comprising administering to the patient an additional therapeutic agent.

41. The method according to claim 40, wherein the additional therapeutic agent is a chemotherapeutic agent.

42. The method according to claim 40, wherein the additional therapeutic agent is a chemotherapeutic agent is an immune checkpoint inhibitor.

43. The method according to claim 42, wherein the immune checkpoint inhibitor is selected from the group of a PD1 inhibitor, a PD-L1 inhibitor, a CD28 inhibitor, a CTLA4 inhibitor, or combinations thereof.

44. The method of claim 42 or 43, wherein the immune checkpoint inhibitor is an antibody or fragment thereof.

45. The method of any one of claims 30-44, wherein the subject is a human.

Citation Information

Patent Citations

  • annular gap magnet system

    FR901228A

  • Activation and expansion of cells

    US20060121005A1

  • Adeno-associated virus as eukaryotic expression vector

    US4797368A

  • AAV transduction vectors

    US5139941A

  • Methods for selectively stimulating proliferation of T cells

    US5858358A