Novel promoter for constitutive expression, target protein expression system comprising same, and method for producing allulose using same
A novel promoter, Pds2 or Pds4, is developed to enhance the constitutive expression of allulose epimerase in Corynebacterium strains, addressing the inefficiencies of existing systems. This promoter allows for high and constant expression of the enzyme, facilitating the economical mass production of allulose from fructose.
Patent Information
- Application Number
- PCT/KR2024/006885
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-19
- Filing Date
- 2024-05-22
- Publication Date
- 2025-06-26
AI Technical Summary
Existing prokaryotic expression systems, such as those using Escherichia coli, require expensive inducers like IPTG and precise control of inducer concentration and time, making them inefficient for mass-producing proteins like allulose epimerase. Additionally, previous systems using Corynebacterium strains have weak expression intensity and complex regulation, making them unsuitable for constant production of target proteins.
A novel promoter, designated as Pds2 or Pds4, is developed by modifying the bidirectional promoter region between the McaA gene and the sod gene in Corynebacterium glutamicum. This promoter eliminates bidirectionality and enhances the constitutive expression of target proteins, specifically allulose epimerase, in Corynebacterium strains. The promoter is used in a recombinant expression vector that is introduced into a Corynebacterium host strain, allowing for efficient production of allulose epimerase and allulose from fructose.
The novel promoter achieves high and constant expression of allulose epimerase in Corynebacterium strains, enabling efficient and cost-effective mass production of allulose. This approach eliminates the need for expensive inducers and precise control of induction conditions, making the process more economical and scalable.
Abstract
Description
Novel promoter for constitutive expression, target protein expression system comprising the same, and method for producing allulose using the same
[0001] The present invention relates to a novel promoter and its use, and more particularly, to a novel promoter capable of constantly and highly expressing a target protein, a target protein expression system comprising the same, and a method for producing allulose using the same.
[0002] With the advancement of molecular biology, various mechanisms regulating gene expression have been discovered. Gene expression refers to the series of processes that occur within a cell, synthesizing proteins according to the code encoded in the gene through transcription and translation. Transcription, in particular, is the initial step of gene expression. It is initiated by RNA polymerase, with the assistance of various auxiliary factors, binding to the promoter sequence located upstream of the gene. Transcription factors (TFs) are known to bind directly to the promoter sequence, one of these auxiliary factors. In prokaryotes, gene expression regulation primarily occurs at the transcription stage, and researchers are continually discovering new transcription factors and promoters.
[0003] Industrially, to produce foreign proteins such as enzymes, transformants produced by transforming prokaryotes such as Escherichia coli with pET-type expression vectors containing the foreign protein genes are used as expression systems. Prokaryotic expression systems transformed with pET-type expression vectors generally require expensive expression inducers such as IPTG (isopropyl-β-D-thiogalactopyranoside), and have the disadvantage of requiring precise control of inducer concentration, equipment, and expression induction time.
[0004] Meanwhile, an expression system using a Corynebacterium strain, a GRAS (Generally Recognized As Safe) strain, as a host cell to mass-produce a psicose epimerase (or allulose epimerase) that has the activity of converting fructose to allulose (or psicose) is proposed. Regarding a system for expressing a pseudo-epimerase (or allulose epimerase) based on a Corynebacterium spp. strain, Korean Patent No. 10-1695830 discloses a gene expression cassette comprising a nucleic acid sequence encoding a pseudo-epimerase and a regulatory sequence operably linked upstream thereof and controlling the expression of the pseudo-epimerase in a Corynebacterium spp. strain, wherein the regulatory sequence comprises a transcription promoter derived from E. coli selected from a trc promoter, a Tac1 promoter, a Tac2 promoter, or a sod promoter, which is a transcription promoter derived from Corynebacterium glutaricum. In general, a promoter conserves a site where RNA polymerase binds, and a binding site for a transcription factor that promotes or suppresses various RNA expressions exists within the 5'UTR sequence and 3'UTR sequence centered on the core promoter region, and the gene arrangement around the promoter sequence is important for improving expression efficiency. The Corynebacterium strain-based pseudomonas spp.-epimerase expression system disclosed in the above prior art has a promoter sequence located in a bidirectional promoter region in which the McrA gene and the sod gene are arranged to be expressed in opposite directions, and therefore requires a highly advanced control mechanism for the expression of bidirectional genes, and is not suitable as a system for constant expression of a desired single-purpose protein.In addition, the psycos epimerization enzyme expression system based on a Corynebacterium strain disclosed in the above prior art has a relatively weak expression intensity due to structural hindrance of the promoter or complex regulation of the promoters, and is not suitable for mass production of psycos.
[0005] The present invention was developed against the background of prior art technology, and its purpose is to provide a novel promoter capable of consistently and highly expressing a target protein. Furthermore, the present invention provides various applications of the novel promoter, including a target protein expression system and a method for producing allulose.
[0006] The inventors of the present invention created promoters that eliminated bidirectionality by deleting a portion of a bidirectional promoter region existing between the McaA gene and the sod gene in the genome sequence of Corynebacterium glutamicum ATCC 13032 strain, and confirmed that a specific promoter among them can constitutively high-express allulose epimerase in a Corynebacterium strain, thereby completing the present invention. In addition, the inventors of the present invention constructed a recombinant expression vector by operably linking promoters that excluded the above bidirectionality with a polynucleotide encoding allulose epimerase, and introduced the recombinant expression vector into Corynebacterium glutamicum, a GRAS (Generally Recognized As Safe) strain, and transformed the vector. As a result, random mutations occurred in some promoters, and among the promoter mutants obtained through random mutations, a specific promoter mutant significantly increased the expression efficiency of allulose epimerase, thereby completing the present invention.
[0007]
[0008] In order to solve the above problem, one example of the present invention provides a promoter comprising a base sequence of SEQ ID NO: 6 or a base sequence of SEQ ID NO: 27 and characterized by regulating the expression of allulose epimerase in a strain of the genus Corynebacterium.
[0009] To solve the above problem, one example of the present invention provides an allulose epimerase expression cassette comprising a polynucleotide encoding allulose epimerase and a promoter operably linked thereto. The promoter comprises the nucleotide sequence of SEQ ID NO: 6 or the nucleotide sequence of SEQ ID NO: 27.
[0010] To solve the above problem, one example of the present invention provides a recombinant expression vector having an allulose epimerase expression cassette inserted therein.
[0011] To solve the above problem, one example of the present invention provides a recombinant Corynebacterium strain, wherein the Corynebacterium host strain is transformed by introduction of an allulose epimerase expression cassette or a recombinant expression vector into which the expression cassette is inserted.
[0012] To solve the above problem, one example of the present invention provides a method for producing allulose, including the step of adding a recombinant Corynebacterium strain to a fructose-containing solution and reacting it.
[0013] The novel promoter according to the present invention can constitutively and highly express a target protein, particularly an enzyme, in a Corynebacterium strain. For example, by using a recombinant Corynebacterium strain transformed with an expression vector containing the novel promoter according to the present invention, allulose epimerase can be economically mass-produced or allulose can be economically mass-produced from fructose.
[0014] Hereinafter, the present invention will be described in detail.
[0015] The term 'promoter' used in the present invention refers to a minimum nucleic acid sequence that is operably linked to a target nucleotide sequence that is a transcription target and controls the transcription of the target nucleotide sequence. In addition, the promoter may include promoter structures sufficient to cause the expression of a regulatable promoter-dependent gene induced by a cell type-specific or external signal or agent, and such structures may be located at the 5' or 3' portion of the gene. The promoter includes both conserved promoters and inducible promoters. The promoter sequence may be derived from prokaryotes, eukaryotes, or viruses. In prokaryotes, the promoter is usually defined as a binding site immediately adjacent to the transcription start site where RNA polymerase binds.
[0016] The term "homology" used in the present invention refers to identity with the nucleic acid sequence of a wild type or a variant having the same activity. Homology can be compared visually or by using a readily available comparison program to calculate the percentage (%) of homology between two or more sequences. In addition, "homology" is used to refer to identity with the amino acid sequence of a wild type or a variant having the same activity.
[0017] The term 'target protein' used in the present invention refers to a foreign protein that cannot normally exist in a transformed strain (or host cell) expressing the protein.
[0018] The term 'polynucleotide' used in the present invention refers to any polyribonucleotide (RNA) or polydeoxyribonucleotide (DNA), whether non-modified or modified. The polynucleotide includes, but is not limited to, single- or double-stranded DNA, DNA which is a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA which is a mixture of single- and double-stranded regions, or hybrid molecules thereof.
[0019] The term "operably linked" as used herein is defined as a state in which a promoter sequence and a nucleotide sequence encoding a target protein are functionally linked so that the promoter can control the expression of the target protein. For example, if a promoter can control the expression of a coding sequence (i.e., if the coding sequence is under the transcriptional control of the promoter), the promoter is operatively linked to the coding sequence, or if the ribosome binding site is positioned so as to promote translation, the ribosome binding site is operatively linked to the coding sequence. The coding sequence can be operatively linked to the regulatory sequence in the sense or antisense direction.
[0020] The term 'recombinant vector' used in the present invention is defined as a recombinant DNA produced by cutting out a promoter mutant or a target gene using a restriction enzyme and inserting it into a vector.
[0021] The term "expression cassette" as used herein refers to a regulatory sequence functionally linked to a nucleotide sequence to be expressed, for example, a polynucleotide sequence encoding allulose epimerase. Therefore, unlike an expression unit, an expression cassette comprises not only nucleotide sequences that regulate transcription and translation, but also nucleotide sequences that are expressed as proteins as a result of transcription and translation.
[0022] The term "expression vector" used in the present invention is defined as a DNA sequence necessary for transcription and translation of cloned DNA in a suitable host, and specifically refers to a genetic construct containing essential regulatory elements operably linked to an insert so that the insert is expressed when present in the cells of an organism. The expression vector can be produced and purified using standard recombinant DNA technology. The type of the expression vector is not particularly limited as long as it functions to express a desired gene and produce a desired protein in various host cells of prokaryotic and eukaryotic cells. The expression vector includes at least a promoter, an initiation codon, a gene encoding a desired protein, and a stop codon terminator. In addition, the expression vector may also appropriately include DNA encoding a signal peptide, additional expression regulatory sequences, untranslated regions at the 5' and 3' ends of the desired gene, a selectable marker region, or a replicative unit. The selectable marker region may be a selectable marker gene of an antibiotic for selecting a desired vector.
[0023] The term 'recombinant strain' used in the present invention refers to a cell transformed by introducing a polynucleotide encoding one or more target proteins or an expression vector having the same into a host cell. Methods for producing a transformant by introducing the expression vector into a host cell include, but are not limited to, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran-mediated transfection, polybrene-mediated transfection, electroporation, electroinjection, chemical treatment methods such as PEG, methods using a gene gun, etc., and heat shock. In addition, the host cell of the recombinant strain is not particularly limited in type as long as the promoter present in the expression vector can operate smoothly, and is preferably a prokaryotic organism.
[0024] The term "substrate" as used herein refers to any substance or compound that is converted or is intended to be converted into another compound by the action of an enzyme. The term encompasses not only a single compound but also combinations of compounds, such as solvents, mixtures, and other materials containing at least one substrate, as well as derivatives thereof.
[0025]
[0026] One aspect of the present invention relates to a novel promoter capable of constitutively high-level expression of a target protein. According to an example of the present invention, the novel promoter comprises a nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence of SEQ ID NO: 27. The inventors of the present invention named the promoter comprising the nucleotide sequence of SEQ ID NO: 6 'Pds2', and the promoter comprising the nucleotide sequence of SEQ ID NO: 27 'Pds4'. The promoter Pds2 is a promoter in which a portion of a bidirectional promoter region existing between the McaA gene and the sod gene in the genome sequence of a Corynebacterium glutamicum strain is deleted, thereby eliminating bidirectionality and improving the expression efficiency of the target protein. In addition, the promoter Pds4 is a promoter mutant in which 6 bp of bases located from the 195th to the 200th positions of the promoter Pds2 are deleted and a new 3 bp base is inserted, which is caused by a mutation in the ribosome-binding site (RBS) spacer. An expression system including a promoter according to an example of the present invention can constitutively and highly express a target protein in a Corynebacterium strain. In particular, the promoter according to an example of the present invention regulates the expression of allulose epimerase in a Corynebacterium strain. Therefore, the promoter Pds2 or the promoter Pds4 according to an example of the present invention can be used as a promoter for constitutive expression in a Corynebacterium strain. A novel promoter according to an example of the present invention is comprised of the base sequence of SEQ ID NO: 6 or the base sequence of SEQ ID NO: 27, but the homologous range of the promoter is not necessarily limited thereto. For example, the homologous range of the novel promoter according to an example of the present invention includes a sequence having substantial identity to the base sequence of SEQ ID NO: 6 or the base sequence of SEQ ID NO: 27.The above substantial identity means that the base sequence of SEQ ID NO: 6 or the base sequence of SEQ ID NO: 27 and any other sequence are aligned to the greatest extent possible, and the sequences are analyzed, and the any other sequence has a sequence homology of 70% or more, 90% or more, or 98% or more with the base sequence of SEQ ID NO: 6 or the base sequence of SEQ ID NO: 27. Those skilled in the art will readily understand that a polynucleotide having the same or similar activity can be produced within the range of substantial homology by substituting, adding, or deleting one or more bases in the base sequence of the novel promoter using a genetic recombination technique known in the art. This comparison of homology can be performed by calculating the homology between two or more sequences as a percentage (%) using a commercially available computer program. Accordingly, the homology range of the novel promoter according to an example of the present invention may include a base sequence having 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more homology with the base sequence of SEQ ID NO: 6 or the base sequence of SEQ ID NO: 27, within a range in which the function of constantly high-expressing the target protein is maintained.
[0027]
[0028] One aspect of the present invention relates to a target protein expression system comprising a novel promoter. The novel promoter can be used to produce an allulose epimerase expression cassette, a recombinant vector, and a recombinant strain.
[0029] An allulose epimerase expression cassette according to an example of the present invention comprises a polynucleotide encoding allulose epimerase and the aforementioned promoter operably linked thereto. The promoter is preferably located upstream of the polynucleotide encoding the allulose epimerase, which is a target protein. The promoter, which is a component of the allulose epimerase expression cassette, is composed of the base sequence of SEQ ID NO: 6 or the base sequence of SEQ ID NO: 27. The type of the polynucleotide encoding the allulose epimerase, which is a component of the allulose epimerase expression cassette, is not particularly limited as long as it is a polynucleotide encoding an enzyme having an activity of converting fructose into allulose. For example, the allulose epimerization enzyme may be derived from Flavonifractor plautii, Clostridium scidens, Treponema primitia, Ensifer adhaerens or Ruminococcus torques, and considering the activity of converting fructose into allulose, the allulose epimerization enzyme is preferably derived from Flavonifractor plautii. Specifically, the allulose epimerization enzyme may be composed of the amino acid sequence of SEQ ID NO: 14, the amino acid sequence of SEQ ID NO: 16 or the amino acid sequence of SEQ ID NO: 18. The allulose epimerization enzyme composed of the amino acid sequence of SEQ ID NO: 14 is a wild type enzyme derived from Flavonifractor plautii.The allulose epimerase comprising the amino acid sequence of SEQ ID NO: 16 is one in which the tryptophan (Trp) at position 29 of the amino acid sequence of SEQ ID NO: 14 is substituted with lysine (Lys), the glycine (Gly) at position 216 is substituted with serine (Ser), and simultaneously the methionine (Met) at position 234 is substituted with isoleucine (Ile). The allulose epimerase comprising the amino acid sequence of SEQ ID NO: 18 is one in which the tryptophan (Trp) at position 29 of the amino acid sequence of SEQ ID NO: 14 is substituted with lysine (Lys), the alanine (Ala) at position 77 is substituted with serine (Ser), the glycine (Gly) at position 216 is substituted with serine (Ser), and simultaneously the methionine (Met) at position 234 is substituted with isoleucine (Ile). The polynucleotide encoding the above allulose epimerase is not particularly limited in type, and preferably consists of the base sequence of SEQ ID NO: 15, or may include a base sequence having 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more homology with the base sequence of SEQ ID NO: 15. The base sequence of SEQ ID NO: 15 is a polynucleotide encoding the allulose epimerase consisting of the amino acid sequence of SEQ ID NO: 14. In addition, the polynucleotide encoding the above allulose epimerase may consist of the base sequence of SEQ ID NO: 17 or the base sequence of SEQ ID NO: 19. The base sequence of SEQ ID NO: 17 is a polynucleotide encoding an allulose epimerase comprising the amino acid sequence of SEQ ID NO: 16, and the base sequence of SEQ ID NO: 19 is a polynucleotide encoding an allulose epimerase comprising the amino acid sequence of SEQ ID NO: 18.The present invention includes the contents disclosed in Korean Patent Publication No. 10-1919713, Korean Patent Publication No. 10-2187354, Korean Patent Publication No. 10-1656063, Korean Patent Publication No. 10-1695830, Korean Patent Publication No. 10-2189458, Korean Patent Publication No. 10-1539097, Korean Patent Publication No. 10-1539096, Korean Patent Publication No. 10-1455759, Korean Patent Publication No. 10-1318422, Korean Patent Publication Publication No. 10-2023-0073739, etc., with respect to allulose epimerase and polynucleotides encoding the same.
[0030] An allulose epimerase expression cassette according to an embodiment of the present invention may further include one or more sequences selected from the group consisting of a replication origin, a multi-cloning site (MCS) for cloning a target protein gene, a transcription termination sequence, and a selection marker. The selection marker is for selecting cells transformed with the vector, and markers that confer a selectable phenotype such as drug resistance, nutrient requirement, resistance to cytotoxic agents, or expression of surface proteins may be used. For example, the selection marker may be an antibiotic resistance gene marker such as a kanamycin antibiotic resistance gene or an ampicillin antibiotic resistance gene. An allulose epimerase expression cassette according to an embodiment of the present invention may preferably include a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 25 or a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 28. The polynucleotide comprising the nucleotide sequence of SEQ ID NO: 25 is an expression cassette fragment in which a promoter comprising the nucleotide sequence of SEQ ID NO: 6 and an allulose epimerase gene comprising the nucleotide sequence of SEQ ID NO: 19 are sequentially linked. In addition, the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 28 is an expression cassette fragment in which a promoter comprising the nucleotide sequence of SEQ ID NO: 27 and an allulose epimerase gene comprising the nucleotide sequence of SEQ ID NO: 19 are sequentially linked.
[0031] A recombinant vector according to one embodiment of the present invention is a recombinant expression vector into which the above-described allulose epimerase expression cassette is inserted. The recombinant expression vector preferably has a structure in which a replication origin, a promoter, a polynucleotide encoding allulose epimerase, a transcription terminator, a kanamycin resistance gene marker, etc. are sequentially linked.
[0032] A recombinant strain according to an example of the present invention is a recombinant Corynebacterium strain in which a host cell is transformed by introduction of the above-described allulose epimerase expression cassette or a recombinant expression vector into which the expression cassette is inserted. The host strain used to produce the above recombinant Corynebacterium strain is not particularly limited in type as long as it is a Corynebacterium strain, and may be selected from the group consisting of, for example, Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, Corynebacterium thermoaminogenes, Corynebacterium melassecola, and Corynebacterium efficiens.
[0033]
[0034] One aspect of the present invention relates to a method for producing allulose using a target protein expression system comprising a novel promoter.
[0035] A method for producing allulose according to an example of the present invention comprises a step of adding a recombinant Corynebacterium strain to a fructose-containing solution and reacting the fructose. The fructose acts as a substrate for the allulose epimerase, which is a target protein expressed by the recombinant Corynebacterium strain. The fructose-containing solution may further include Ca to promote the activity of the allulose epimerase. 2+ , Mn 2+ It may further include metal ions such as . In addition, in the method for producing allulose from fructose, the reaction temperature is in the range of 50 to 70°C, preferably 55 to 65°C, and more preferably 60 to 65°C when considering smooth enzyme expression of the recombinant strain, stability of the enzyme, and maximum activity, and the reaction pH is in the range of 6.5 to 8, preferably 6.5 to 7.5, and more preferably 6.5 to 7. In addition, in the method for producing allulose from fructose, the fructose concentration of the fructose-containing solution is not particularly limited, but when considering productivity and economy, it is preferably 5 to 75% (w / w) based on the total weight of the fructose-containing solution, and more preferably 10 to 55% (w / w).
[0036]
[0037] Hereinafter, the present invention will be described in more detail through examples. However, the following examples are intended only to clearly illustrate the technical features of the present invention and do not limit the scope of protection of the present invention.
[0038]
[0039] Example 1: Amplification and acquisition of a promoter sequence for expression of D-allulose 3-epimerase.
[0040] In order to secure a bidirectional promoter existing in a Corynebacterium sp. strain, PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC 13032 strain as a template and the Pctrl-F primer and Pds-R primer set described in Table 1 below. The obtained amplified product was cloned into the pGEM T-easy vector (Promega Co., USA) and the base sequence was analyzed. As a result, it was confirmed to be a polynucleotide fragment having a length of 336 bp and consisting of the base sequence of SEQ ID NO: 1. Among the polynucleotide fragment consisting of the base sequence of SEQ ID NO: 1, the region corresponding to the promoter was named "Pctrl". The promoter Pctrl consists of the base sequence of SEQ ID NO: 2. In addition, in order to secure a mutant promoter of the promoter Pctrl, PCR was performed to amplify each mutant promoter using the genomic DNA of Corynebacterium glutamicum ATCC 13032 strain as a template and the Pds1-F and Pds-R primer sets; Pds2-F and Pds-R primer sets; and Pds3-F and Pds-R primer sets described in Table 1 below. The obtained amplified products were cloned into the pGEM T-easy vector (Promega Co., USA) and the base sequence was analyzed. As a result, the amplified product obtained using the Pds1-F primer and Pds-R primer sets was a polynucleotide fragment having a length of 282 bp and consisting of the base sequence of SEQ ID NO: 3. Among the polynucleotide fragments consisting of the base sequence of SEQ ID NO: 3, the region corresponding to the promoter was named "Pds1". The promoter Pds1 consists of the nucleotide sequence of sequence number 4.In addition, the amplification product obtained using the Pds2-F primer and the Pds-R primer set was a polynucleotide fragment having a length of 236 bp and consisting of the base sequence of SEQ ID NO: 5. Among the polynucleotide fragments having a base sequence of SEQ ID NO: 5, the region corresponding to the promoter was named "Pds2". The promoter Pds2 was composed of the base sequence of SEQ ID NO: 6. In addition, the amplification product obtained using the Pds3-F primer and the Pds-R primer set was a polynucleotide fragment having a length of 236 bp and consisting of the base sequence of SEQ ID NO: 7. Among the polynucleotide fragments having a base sequence of SEQ ID NO: 7, the region corresponding to the promoter was named "Pds3". The promoter Pds3 was composed of the base sequence of SEQ ID NO: 8. Promoter Pctrl is a bidirectional promoter that contains an intergenic region between the McaA gene and the sod gene in the genome sequence of Corynebacterium glutamicum strain ATCC 13032. Promoters Pds1, Pds2, and Pds3 are promoter mutants in which a portion of the promoter Pctrl sequence is deleted, centered on the 282 bp-long intergenic region.
[0041] Sequence number Primer name Primer base sequence (5'→3') 9Pctrl-FCAGCTTGCATGCCTGCAGAAGCGCCTCATCAGCGGT 10Pds1-FCAGCTTGCATGCCTGCAGAACAGGAATGTTCCTTTC 11Pds2-FCAGCTTGCATGCCTGCAGACCCTACTTAGCTGCCAA 12Pds3-FCAGCTTGCATGCCTGCAGTGAAAAATTTCGTTGCAA 13Pds-RCATTCCAATCGGGTTCATGGGTAAAAAATCCTTTCG
[0042]
[0043] Example 2: Amplification and acquisition of a polynucleotide sequence encoding D-allulose 3-epimerase.
[0044] The applicant of the present invention disclosed a wild-type D-allulose epimerase derived from Flavonifractor plautii and a polynucleotide encoding the same through Korean Patent Publication No. 10-14739180. The wild-type D-allulose epimerase comprises an amino acid sequence of SEQ ID NO: 14, and the polynucleotide encoding the same comprises a base sequence of SEQ ID NO: 15.
[0045] In addition, the applicant of the present invention disclosed a D-allulose epimerase variant W29K / G216S / M234I with improved conversion rate of fructose to allulose and thermal stability and a polynucleotide encoding the same through Korean Patent Publication No. 10-2021-0132405. The D-allulose epimerase variant W29K / G216S / M234I is one in which tryptophan (Trp) at position 29 of the amino acid sequence of wild-type D-allulose epimerase derived from Flavonifractor plautii is substituted with lysine (Lys), glycine (Gly) at position 216 is substituted with serine (Ser), and methionine (Met) at position 234 is substituted with isoleucine (Ile). The above D-allulose epimerase variant W29K / G216S / M234I is composed of an amino acid sequence of SEQ ID NO: 16, and a polynucleotide encoding the same is composed of a base sequence of SEQ ID NO: 17.
[0046] In addition, the applicant of the present invention disclosed a D-allulose epimerase variant W29K / A77S / G216S / M234I with improved conversion rate of fructose to allulose and thermal stability and a polynucleotide encoding the same through Korean Patent Publication No. 10-2023-0073739. The above D-allulose epimerase mutant W29K / A77S / G216S / M234I is a wild-type D-allulose epimerase derived from Flavonifractor plautii, in which tryptophan (Trp) at position 29 is substituted with lysine (Lys), alanine (Als) at position 77 is substituted with serine (Ser), glycine (Gly) at position 216 is substituted with serine (Ser), and methionine (Met) at position 234 is substituted with isoleucine (Ile). The above D-allulose epimerase mutant W29K / A77S / G216S / M234I is composed of an amino acid sequence of SEQ ID NO: 18, and a polynucleotide encoding the same is composed of a base sequence of SEQ ID NO: 19.
[0047] The inventor of the present invention named the D-allulose epimerase mutant W29K / A77S / G216S / M234I disclosed in Korean Patent Publication No. 10-2023-0073739 as "FpDPE2". In the same manner as disclosed in Korean Patent Publication No. 10-2023-0073739, a polynucleotide (SEQ ID NO: 19) fragment of the D-allulose epimerase mutant W29K / A77S / G216S / M234I was inserted into the expression vector pET28a (Novagen) to construct a recombinant vector pET28a::FpDPE2. Thereafter, PCR was performed using the recombinant vector pET28a::FpDPE2 as a template and the FpDPE2-F primer and FpDPE2-R primer set described in Table 2 below. The obtained amplified product was cloned into the pGEM T-easy vector (Promega Co., USA) and the base sequence was analyzed. As a result, it was confirmed to be a polynucleotide fragment having a length of 921 bp and consisting of the base sequence of sequence number 20.
[0048] Sequence number Primer name Primer base sequence (5'→3') 21FpDPE2-FCGAAAGGATTTTTTACCCATGAACCCGATTGGAATG 22FpDPE2-RTTTCCCACCCGGGGATCCTTACGCGGTCAGCTCCTT
[0049]
[0050] Example 3: Production of a linked fragment of a promoter and an allulose epimerase variant gene.
[0051] Using a polynucleotide fragment consisting of the nucleotide sequence of SEQ ID NO: 1 and a polynucleotide fragment consisting of the nucleotide sequence of SEQ ID NO: 20 as templates, overlap extension PCR was performed using the Pctrl-F primer set described in Table 1 and the FpDPE2-R primer set described in Table 2, and an expression cassette fragment Pctrl_FpDPE2 in which the promoter Pctrl-F and the allulose epimerase gene FpDPE2 are linked was constructed. The expression cassette fragment Pctrl_FpDPE2 was cloned into the pGEM T-easy vector (Promega Co., USA) and the nucleotide sequence was analyzed. As a result, it was confirmed that it was a fragment having a length of 1,221 bp and including a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 23. In addition, an overlap extension PCR was performed using a polynucleotide fragment consisting of the base sequence of SEQ ID NO: 3 and a polynucleotide fragment consisting of the base sequence of SEQ ID NO: 20 as templates, and the Pds1-F primer set described in Table 1 and the FpDPE2-R primer set described in Table 2 to produce an expression cassette fragment Pds1_FpDPE2 in which the promoter Pds1 and the allulose epimerase gene FpDPE2 are linked. The expression cassette fragment Pds1_FpDPE2 is a fragment including a polynucleotide consisting of the base sequence of SEQ ID NO: 24. In addition, an overlap extension PCR was performed using a polynucleotide fragment consisting of a base sequence of SEQ ID NO: 5 and a polynucleotide fragment consisting of a base sequence of SEQ ID NO: 20 as templates, and the Pds2-F primer set described in Table 1 and the FpDPE2-R primer set described in Table 2 to produce an expression cassette fragment Pds2_FpDPE2 in which the promoter Pds2 and the allulose epimerase gene FpDPE2 are linked. The expression cassette fragment Pds2_FpDPE2 is a fragment including a polynucleotide consisting of a base sequence of SEQ ID NO: 25.In addition, an overlap extension PCR was performed using a polynucleotide fragment consisting of the base sequence of SEQ ID NO: 7 and a polynucleotide fragment consisting of the base sequence of SEQ ID NO: 20 as templates, and the Pds3-F primer set described in Table 1 and the FpDPE2-R primer set described in Table 2 to produce an expression cassette fragment Pds3_FpDPE2 in which the promoter Pds3 and the allulose epimerase gene FpDPE2 are linked. The expression cassette fragment Pds3_FpDPE2 is a fragment including a polynucleotide consisting of the base sequence of SEQ ID NO: 26. Specifically, 1 pM of the primer set was added to the reaction solution containing 100 μM of deoxynucleotide triphosphates (dATP, dCTP, dGTP, dTTP), 100 ng each of the promoter and D-allulose epimerase mutant DNA fragments used as templates were mixed, and PCR reaction was performed for 25 to 30 cycles in the presence of 1 unit of pfu-X DNA polymerase mixture (Bioneer) using a thermocycler (TP600, TAKARA BIO Inc., JAPAN).
[0052]
[0053] Example 4: Construction of a D-allulose epimerase mutant expression vector
[0054] The expression cassette fragments Pctrl_FpDPE2, Pds1_FpDPE2, Pds2_FpDPE2, and Pds3_FpDPE2 constructed in Example 3 above were each digested with restriction enzymes PstI and BamHI, and then ligated with the commercial plasmid expression vector pVWEx1 having the same restriction enzyme sites to construct D-allulose epimerase mutant expression vectors pPctrl_FpDPE2, pPds1_FpDPE2, pPds2_FpDPE2, and pPds3_FpDPE2. Thereafter, the D-allulose epimerase mutant expression vectors were transformed into Escherichia coli DH5α strain using the heat shock method (see Sambrook and Russell: Molecular Cloning) to obtain colonies resistant to kanamycin. The obtained colonies were inoculated into LB liquid medium containing kanamycin and cultured overnight at 37°C. The recombinant plasmid was extracted and sequenced, confirming that the vector sequences of the clones were identical. The extracted recombinant plasmid was transformed into E. coli strain JM110 using the heat shock method (see Sambrook and Russell: Molecular Cloning), and colonies with kanamycin resistance were obtained.
[0055]
[0056] Example 5: Production of a recombinant Corynebacterium strain expressing a D-allulose epimerase mutant
[0057] A colony of the recombinant E. coli JM110 strain obtained in the above Example 4 was inoculated into an LB liquid medium containing kanamycin and cultured O / N at 37°C. The recombinant plasmid was extracted again, and the extracted recombinant plasmid was transformed into a Corynebacterium glutamicum strain using the heat shock method (see Sambrook and Russell: Molecular Cloning). Thereafter, the transformed recombinant Corynebacterium glutamicum strain was inoculated into a 2YT solid medium containing kanamycin and cultured at 30°C for 24 hours to obtain a colony resistant to kanamycin. Thereafter, the obtained colony was inoculated into a 2YT liquid medium containing kanamycin and cultured at 30°C for 24 hours. The recombinant plasmid was extracted and the base sequence was analyzed. As a result, random mutations were identified in the promoter Pds2 or allulose epimerase mutant gene sequences of some recombinant plasmids containing promoter Pds2. Table 3 below summarizes the random mutations that occurred in some recombinant plasmids containing promoter Pds2.
[0058] Colony distinction Promoter Pds2 sequence mutation details FpDPE2 gene sequence mutation details Colony 1 Match 10th nucleotide (A) 1 bp deletion / frame shift mutation Colony 2 195-200th nucleotide 6 bp (TTACCC) deletion, 3 bp (CAT) insertion / ribosome-binding site (RBS) spacer mutation Match Colony 3 Match 24th nucleotide (C) 1 bp deletion / frame shift mutation and acquisition of stop codon (TAG), and transcription termination after the 6th histidine Colony 4 Match 1 bp deletion / frame shift mutation at the 1st nucleotide (A) / loss of initiation codon (ATG) Colony 5 Match 33rd nucleotide (G) 1 bp deletion / frame shift mutation and Corresponds to acquisition of a termination codon (TGA) and termination of transcription after the 22nd phenylalanine. Colony 6: 3 bp deletion of nucleotides 80-182 (CTA) / RBS surrounding sequence mutation. Match. Colony 7: 101st nucleotide substitution (T→A), 104th nucleotide substitution (G→A), 111th nucleotide substitution (C→T), 1 bp deletion of 112th nucleotide (G). Match. Colony 8: 1 bp deletion of 2nd nucleotide (T) / loss of initiation codon (ATG).
[0059] As shown in Table 3 above, in the case of the recombinant plasmid expression vectors recovered from colonies 1, 3, 4, 5, and 8, mutations occurred in the allulose epimerase mutant gene sequences, so it is expected that they will not be able to translate to produce the desired allulose epimerase mutant. On the other hand, in the case of the recombinant plasmid expression vectors recovered from colonies 2, 6, and 7, mutations occurred in the promoter sequences, and since the enzyme gene sequences were identical, it was determined that there was a possibility of expression of the desired enzyme. The mutant promoter in the recombinant plasmid expression vector recovered from colony 2 was named "Pds4", the mutant promoter in the recombinant plasmid expression vector recovered from colony 6 was named "Pds4-1", and the mutant promoter in the recombinant plasmid expression vector recovered from colony 7 was named "Pds4-2". The above promoter Pds4 is composed of the base sequence of SEQ ID NO: 27. In addition, the recombinant plasmid expression vector recovered from colony 2 was renamed pPds4_FpDPE2, the recombinant plasmid expression vector recovered from colony 6 was renamed pPds4-1_FpDPE2, and the recombinant plasmid expression vector recovered from colony 7 was renamed pPds4-2_FpDPE2. The expression cassette fragment Pds4_FpDPE2 present in the above recombinant plasmid expression vector pPds4_FpDPE2 is a fragment including a polynucleotide composed of the base sequence of SEQ ID NO: 28.
[0060]
[0061] Example 6: Measurement of the conversion rate of fructose to allulose by recombinant Corynebacterium strain and comparison of the enzyme expression intensity of the promoter.
[0062] The conversion rate of fructose to allulose is proportional to the expression level of D-allulose epimerase in the Corynebacterium strain. The induction strength of enzyme expression of each promoter in the recombinant Corynebacterium strain was compared by measuring the conversion rate of fructose to allulose in each recombinant Corynebacterium strain.
[0063] To culture the recombinant Corynebacterium strain transformed with the recombinant expression vector, 100 ml of LB medium containing 50 μg / ml of kanamycin was placed in a 1 L flask, and 1 ml of the recombinant Corynebacterium strain produced in Example 5 was inoculated therein. Thereafter, the flask was transferred to a shaking incubator, and the recombinant Corynebacterium strain was cultured for 14 hours while maintaining a temperature of 30°C and a shaking condition of 140 rpm, and the culture solution was centrifuged to collect the cells. Afterwards, the recovered cells were added at a concentration of 1 mg / mL to a 50 mM PIPES buffer solution (pH 7.0) containing 30% (w / w) fructose and 1 mM manganese sulfate (MnSO4) metal ions, and the reaction was carried out at 62°C for a predetermined time. After that, the temperature of the reaction product was lowered to 4°C to stop the reaction, and the supernatant was recovered by centrifugation under the conditions of 16,600×g and 4°C. Thereafter, the allulose concentration and fructose concentration in the supernatant were measured using high-performance liquid chromatography (HPLC), and the conversion rate of fructose to allulose was calculated from the measured results, and the conversion rate was used as an indicator of enzyme activity. Table 4 below summarizes the conversion rate according to the reaction time when converting fructose to allulose using the recombinant Corynebacterium strain produced in the examples of the present invention.
[0064] Conversion rate of fructose to allulose according to promoter response time in recombinant Corynebacterium strains (%)2 hr4 hr8 hrPctrl4.318.5418.40Pds13.025.459.20Pds24.9210.3222.30Pds33.377.2113.20Pds45.6712.3225.30Pds4-11.211.812.23Pds4-22.113.215.54
[0065] As shown in Table 4 above, the recombinant Corynebacterium strains into which the promoter Pds4 was introduced and the recombinant Corynebacterium strains into which the promoter Pds2 was introduced showed higher conversion rates of fructose to allulose than the recombinant Corynebacterium strains into which the promoter Pctrl was introduced. In particular, the recombinant Corynebacterium strains into which the promoter Pds4 was introduced showed the highest conversion rate of fructose to allulose. These results show that the enzyme expression induction effects of the promoters Pds4 and Pds2 are stronger than those of the promoter Pctrl. In addition, since the promoters Pds4 and Pds2 are partially deleted or mutated forms of the promoter Pctrl in the Corynebacterium strain, they are expected not to cause a load on the recombinant Corynebacterium strain and are judged to be suitable as constitutive expression promoters.
[0066]
[0067] While the present invention has been described through the above-described embodiments, the scope of protection of the present invention is not necessarily limited to these embodiments. It goes without saying that various modifications are possible within the scope and spirit of the present invention. Therefore, the scope of protection of the present invention is not limited to the specific embodiments disclosed as the best mode, but should be interpreted to include all embodiments falling within the scope of the appended claims.
Claims
1. A promoter characterized by comprising a base sequence of sequence number 6 or a base sequence of sequence number 27 and controlling the expression of allulose epimerase in a strain of the genus Corynebacterium.
2. An allulose epimerase expression cassette comprising a polynucleotide encoding allulose epimerase and the promoter of claim 1 operably linked thereto.
3. An allulose epimerization enzyme expression cassette in the second paragraph, wherein the allulose epimerization enzyme is derived from Flavonifractor plautii, Clostridium scidens, Treponema primitia, Ensifer adhaerens, or Ruminococcus torques.
4. An allulose epimerization enzyme expression cassette in the second paragraph, wherein the allulose epimerization enzyme is composed of an amino acid sequence of SEQ ID NO: 14, an amino acid sequence of SEQ ID NO: 16, or an amino acid sequence of SEQ ID NO:
18.
5. An allulose epimerization enzyme expression cassette according to claim 2, wherein the polynucleotide encoding the allulose epimerization enzyme comprises a base sequence of SEQ ID NO: 15, a base sequence of SEQ ID NO: 17, or a base sequence of SEQ ID NO:
19.
6. In the second paragraph, an allulose epimerase expression cassette comprising a polynucleotide consisting of a base sequence of SEQ ID NO: 25 or a polynucleotide consisting of a base sequence of SEQ ID NO:
28.
7. A recombinant expression vector having an expression cassette of any one of claims 2 to 6 inserted therein.
8. A recombinant Corynebacterium strain, wherein the Corynebacterium host strain is transformed by introduction of an expression cassette of any one of claims 2 to 6 or a recombinant expression vector having the expression cassette inserted therein.
9. In the 8th paragraph, the Corynebacterium host strain is a recombinant Corynebacterium strain selected from the group consisting of Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, Corynebacterium thermoaminogenes, Corynebacterium melassecola, and Corynebacterium efficiens.
10. A method for producing allulose, comprising the step of adding and reacting a recombinant Corynebacterium strain of claim 9 to a fructose-containing solution.
Citation Information
Patent Citations
Expression system for psicose epimerase and production for psicose using the same
KR1020160050569A
Method of preparing psicose from fructose-containing substrate
KR1020170057078A
Lumbar protecting chair of movable seat type
KR1020200117110A
Semiconductor device and method for manufacturing the semiconductor device
KR1020240143709A
KR20230100925A