Novel promoter

Abstract

Provided is a novel promoter for expressing a recombinant protein with a mammalian cell as a host.　Exemplified is a promoter constituted by a polynucleotide in which a partial region of a CAG promoter sequence is deleted, wherein, in a CAG promoter of SEQ ID NO: 1, nucleic acids are deleted in one or both of the region (a) of positions 469-571 and the region (b) of positions 799-1563.

Description

New Promoter

[0001] The present invention relates to a promoter for expressing a recombinant protein in a mammalian cell as a host, and to a method for producing a recombinant protein using the promoter.

[0002] To express recombinant proteins in mammalian cells as hosts, an expression vector incorporating the gene for the target protein is commonly introduced into the host cells and cultured. Protein expression vectors contain sequences necessary for gene transcription and translation, such as promoters, terminators, and translation initiation signals. Recombinant protein production depends on various factors, including the sequences of these regions in the expression vector and the culture conditions of the recombinant cells. The selection of the promoter is particularly important, as it affects the level of recombinant protein expression. Several plasmid and viral vectors using the powerful CAG promoter are commercially available.

[0003] The CAG promoter is constructed as a hybrid promoter in which a CMV enhancer is linked to a modified chicken-derived β-actin promoter. The wild-type CAG promoter is described in Gene 108:193-199, "Efficient Selection for High-Expression Transfectants with a Novel Eukaryotic Vector" (Non-Patent Document 1). The contents of this document are incorporated herein by reference. The CAG promoter is also described in Japanese Patent Application Laid-Open No. 3-168087.

[0004] The DNA sequence of the wild-type CAG promoter is shown in SEQ ID NO: 1. Japanese Patent No. 5670330 (WO2010 / 015079) discloses an improved CAG promoter.

[0005] Patent No. 5670330 (WO2010 / 015079) JP-A-3-168087

[0006] Niwa et al., 1991, Gene 108:193-199

[0007] An object of the present invention is to provide a versatile promoter that is superior in many respects to the CAG promoter, an existing high-expression promoter, for recombinant protein production using mammalian cells.

[0008] The present inventors have conducted extensive research to develop a promoter superior to conventional CAG promoters. They have identified a deletion site in the CAG promoter and, by deleting this site, have discovered a novel modified CAG promoter that is easy to use and has high expression levels. This promoter is referred to as the "promoter of the present invention."

[0009] The promoters of the present invention include promoters in which nucleic acids in either or both of the following regions in the CAG promoter set forth in SEQ ID NO: 1 have been deleted: (a) 469 to 571; (b) 799 to 1563.

[0010] The invention disclosed in this application includes the following aspects: (1) An isolated polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1, with at least the region from base 469 to base 571 deleted, or with a nucleotide sequence having 90% or more identity thereto. (2) The polynucleotide set forth in (1) above, with the nucleotide sequence set forth in SEQ ID NO: 2, or with a nucleotide sequence having 90% or more identity thereto. (3) An isolated polynucleotide consisting of the sequence set forth in SEQ ID NO: 1, with at least the region from base 799 to base 1563 deleted, or with a nucleotide sequence having 90% or more identity thereto. (4) The polynucleotide set forth in (3) above, with the nucleotide sequence set forth in SEQ ID NO: 3, or with a nucleotide sequence having 90% or more identity thereto. (5) An isolated polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1, lacking at least the following regions (a) and (b), or consisting of a nucleotide sequence having 90% or more identity thereto: (a) the region from base 469 to base 571; and (b) the region from base 799 to base 1563. (6) The polynucleotide set forth in (5) above, consisting of the sequence set forth in SEQ ID NO: 4, or consisting of a nucleotide sequence having 90% or more identity thereto. (7) A promoter consisting of the polynucleotide set forth in any of (1) to (6) above. (8) A vector containing the promoter set forth in (7) above. (9) A vector containing the promoter set forth in (7) above and a gene encoding a protein. (10) A transformed cell obtained by transforming a mammalian cell with the vector set forth in (9) above. (11) The transformed cell set forth in (10) above, wherein the mammalian cell is a CHO cell. (12) A method for producing a recombinant protein, comprising the steps of producing a recombinant protein by culturing the transformed cell described in (11) above, and recovering the recombinant protein produced from the resulting culture.(13) The method according to (12) above, which is a method for producing an antibody, wherein the vector comprises a promoter consisting of a sequence set forth in any one of SEQ ID NOs: 2, 3, and 4 and a gene encoding the antibody, and the gene encodes an amino acid sequence containing the VL or VH of the antibody, or the gene encodes an amino acid sequence containing the VL and VH of the antibody. (14) An isolated polynucleotide fragment having promoter function, the polynucleotide fragment consisting of a sequence having at least 70%, at least 80%, at least 90%, or 100% identity to the sequence set forth in any one of SEQ ID NOs: 2, 3, and 4. (15) The vector according to (9) above, wherein the protein is an antibody heavy chain (H chain) or light chain (L chain). (16) A cell comprising a gene incorporating a promoter consisting of a nucleotide sequence set forth in any one of SEQ ID NOs: 2, 3, and 4. (17) The cell according to (16) above, wherein the gene encodes an antibody polypeptide. (18) An antibody production method using a cell comprising a gene incorporating a promoter consisting of a nucleotide sequence set forth in any one of SEQ ID NOs: 2, 3, and 4.

[0011] The present inventors identified the minimum required sequence of the CAG promoter and developed a promoter that is excellent in terms of foreign gene expression and ease of handling. The promoter of the present invention has a broad host range similar to the wild-type CAG promoter, allowing cell lines that stably express foreign genes to be established using a variety of cell types derived from various animals. Furthermore, the promoter of the present invention is easier to grow and maintain than the wild-type CAG promoter. For example, the promoter of the present invention can be easily amplified by PCR because it lacks the GC-rich region 469-571 of the DNA sequence of the wild-type CAG promoter (SEQ ID NO: 1). Because DNA fragments containing the promoter of the present invention can be amplified by PCR, the need for subcloning using an intermediate plasmid can be avoided. Therefore, the promoter of the present invention can be used to easily construct expression vectors incorporating foreign genes.

[0012] The promoter of the present invention can be used in the production of antibody pharmaceuticals using animal cells constructed using genetic engineering technology as a cell substrate for production. In addition, the present invention is highly versatile and can serve as a platform technology for the production of not only antibodies but also various other protein pharmaceuticals.

[0013] 1 shows a circular DNA containing the sequence of the promoter of the present invention shown in SEQ ID NO: 2. 1 shows a circular DNA containing the sequence of the promoter of the present invention shown in SEQ ID NO: 3. 1 shows luciferase expression using the promoter of the present invention and a wild-type CAG promoter. 1 shows amplification of a promoter fragment by PCR. 1 shows monoclonal antibody expression using the promoter of the present invention and a wild-type CAG promoter.

[0014] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described herein. All publications mentioned below are incorporated herein by reference.

[0015] The promoter of the present invention can be easily used by deleting a portion of an existing CAG promoter, and can improve the expression level of a foreign gene in mammalian cells. Specifically, the promoter is a promoter in which one or more nucleic acids in the following regions (a) or (b) of the CAG promoter sequence set forth in SEQ ID NO: 1 are deleted: (a) T at position 469 to C at position 571; (b) G at position 799 to C at position 1563.

[0016] A specific example of the promoter of the present invention is a promoter consisting of the sequence set forth in SEQ ID NO: 2, in which the nucleotides at positions 469 to 571 of the nucleotide sequence set forth in SEQ ID NO: 1 have been deleted.

[0017] A specific example of the promoter of the present invention is a promoter consisting of the sequence set forth in SEQ ID NO: 3, in which the nucleotides at positions 799 to 1563 of the nucleotide sequence set forth in SEQ ID NO: 1 have been deleted.

[0018] A specific example of the promoter of the present invention is a promoter consisting of the sequence set forth in SEQ ID NO: 4, in which the nucleotides at positions 469 to 571 and 799 to 1563 of the nucleotide sequence set forth in SEQ ID NO: 1 are deleted.

[0019] SEQ ID NO: 2 and SEQ ID NO: 3 were prepared by deleting a partial sequence of the CAG promoter from a circular DNA (plasmid) into which the CAG promoter of SEQ ID NO: 1 had been cloned. SEQ ID NO: 4 of the present invention was prepared by artificial synthesis. Details of the preparation of the promoter of the present invention will be described later.

[0020] The promoter of the present invention can be easily amplified by PCR because the DNA polynucleotide fragment lacks the GC-rich region from 469 to 571. In contrast, the wild-type CAG promoter contains a GC-rich region and therefore cannot be amplified by PCR as is.

[0021] The promoter of the present invention can be maintained and stored as a polynucleotide fragment or cloned into a circular or linear plasmid, or it can be inserted into an appropriate cloning vector and maintained and stored in a microorganism such as E. coli.

[0022] To produce a recombinant protein using the promoter of the present invention, it is preferable to use an expression vector containing the promoter of the present invention and a polynucleotide encoding the recombinant protein. When producing a recombinant antibody protein using mammalian cells as a host, a plasmid vector is generally used as the expression vector.

[0023] However, the vector to which the promoter of the present invention can be applied is not particularly limited in type, and may be any vector that can express a target protein in animal cells, cell-free protein translation systems, etc.

[0024] The expression vector may further contain components that enable stable protein expression when incorporated into mammalian cells. The expression vector preferably has a suitable restriction enzyme site downstream of the promoter of the present invention, allowing insertion of a gene encoding a protein of interest. The expression vector preferably also contains a marker gene for selecting or visualizing cells transformed with the protein expression vector, with another promoter upstream of the marker gene for expressing the marker gene. This other promoter is generally a promoter other than the promoter of the present invention. The expression vector may further contain components for maintaining the vector in E. coli, facilitating cloning in E. coli.

[0025] There are no particular limitations on the recombinant proteins that can be expressed using the promoter of the present invention. Examples of proteins for pharmaceutical use include antibody proteins (immunoglobulins), various enzymes, and human-derived receptor proteins.

[0026] In one embodiment, the promoter of the present invention is used in the production of antibody pharmaceuticals. In the process of producing antibody pharmaceuticals using genetic recombination technology, a gene expression construct (expression vector) is constructed by inserting the gene of the target antibody into a vector suitable for recombinant protein expression. The expression vector is then introduced (transfected) into host cells to obtain antibody-producing cells.

[0027] The antibody gene can comprise a nucleic acid encoding an amino acid sequence comprising a VL (e.g., a light chain amino acid sequence) and an amino acid sequence comprising a VH (e.g., a heavy chain amino acid sequence). When expressing a recombinant antibody protein, the nucleic acid encoding the amino acid sequence comprising a VL and the nucleic acid encoding the amino acid sequence comprising a VH are each placed downstream of the promoter of the present invention. The nucleic acid encoding the amino acid sequence comprising a VL and the nucleic acid encoding the amino acid sequence comprising a VH may be contained in the same expression vector. The nucleic acid encoding the amino acid sequence comprising a VL and the nucleic acid encoding the amino acid sequence comprising a VH may be contained in separate expression vectors.

[0028] There are no particular limitations on the mammalian cells used to express recombinant proteins using the promoter of the present invention, including Chinese hamster ovary (CHO) cells (K1, DG44, and DXB11 strains), human embryonic kidney-derived cells (HEK cells), human leukemia-derived cells (HL-60 cells), human cervical cancer-derived cells (HeLa cells), human leukemia T-cell-derived cells (Jurkat), African green monkey kidney-derived cells (COS cells), mouse myeloma cells such as Sp2 / 0 and NS0 cells, and induced pluripotent stem cells (iPSCs).

[0029] Recombinant proteins produced using CHO cells have been confirmed to be safe for use as pharmaceuticals, and are now commonly used. Therefore, one embodiment of producing a protein as an active ingredient of a pharmaceutical using the promoter of the present invention is a recombinant protein expression system using CHO cells. The promoter of the present invention can be suitably used to construct a CHO cell line that highly expresses an antibody.

[0030] Means for delivering genes into cells are well known in the art and may be selected appropriately depending on the cells used as a host. Commercially available gene transfer systems may be used to transform cells with an expression vector containing the promoter of the present invention. Methods for introducing expression vectors into mammalian cells include methods using transfection reagents such as electroporation and lipofection, and methods using viral vectors. Methods for inserting foreign genes into the host genome of mammalian cells include random integration, targeted integration (site-specific gene insertion using recombinase, a sequence-specific recombinase enzyme), transposon vectors, and site-specific nucleases. Site-specific gene transfer methods into specific locations in the host genome are expected to be a method for efficiently obtaining cells with excellent target protein production and passage stability.

[0031] When developing a recombinant protein as a pharmaceutical, microorganisms or cells into which the gene for the target protein has been introduced are cultured, and the target protein is then extracted, purified, concentrated, and formulated.

[0032] The recombinant protein can be produced with high efficiency by transforming mammalian cells with an expression vector containing the promoter of the present invention and a gene for a target protein to obtain a transformant (transformed cell) capable of producing the recombinant protein, culturing the obtained transformant, and recovering the produced recombinant protein from the obtained culture.

[0033] When recovering a recombinant protein from a culture of a transformant, a purification procedure using chromatography such as affinity chromatography, ion exchange chromatography, hydrophobic chromatography, or gel filtration chromatography may be combined, and such procedures allow the recombinant protein to be recovered with high efficiency and high purity.

[0034] In a further aspect of the present invention, there is provided a purified or isolated polynucleotide fragment (DNA) having promoter function, the polynucleotide fragment (DNA) consisting of a sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to the nucleotide sequence set forth in SEQ ID NO:4. Here, a promoter is said to have promoter function when the expression induced by a promoter consisting of these DNAs (i.e., having 70% or more identity to the nucleotide sequence set forth in SEQ ID NO: 4) is at a level equal to or higher than the expression induced by the wild-type CAG promoter consisting of the DNA set forth in SEQ ID NO: 1, specifically, when it shows 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more. Note that the expression efficiency referred to here refers to the efficiency of expression when the promoter and the promoter set forth in SEQ ID NO: 1 are each linked to substantially the same reporter gene, transfected into substantially the same cell line, and cultured under the same conditions. Typically, it refers to the efficiency of expression when cultured under conditions optimal for expressing the reporter gene by the promoter.

[0035] The present invention will be specifically described below with reference to examples. Note that these examples are for the purpose of illustrating the present invention and are not intended to limit the scope of the present invention.

[0036] [Preparation of the promoter of the present invention] A circular DNA containing the sequence of the promoter of the present invention shown in SEQ ID NO: 2 is shown in Figure 1. Inverse PCR was performed using primer CAGDel3F (AGCCAATCAGAGCGGCGC: SEQ ID NO: 5) and primer CAGDel3R2 (ATTAAAAAATAAATAAATACAAAATTGGGGGTGG: SEQ ID NO: 6) to remove 103 base pairs from positions 469 to 571, and the resulting fragment was ligated using T4 ligase to prepare a circular DNA containing the promoter of the present invention.

[0037] A circular DNA containing the sequence of the promoter of the present invention shown in SEQ ID NO: 3 is shown in Figure 2. 765 base pairs from positions 799 to 1563 were removed using the restriction enzymes AfeI and SacII, and the resulting residue was ligated using T4 ligase to prepare a circular DNA containing the promoter of the present invention.

[0038] The promoter of the present invention shown in SEQ ID NO: 4 was prepared by artificially synthesizing a DNA fragment consisting of a sequence in which base pairs 469 to 571 and 799 to 1563 were deleted by the method described above.

[0039] Example 1: Luciferase Expression A luciferase reporter gene was introduced downstream of a promoter lacking nucleic acids 469 to 571 of SEQ ID NO: 1 (i.e., SEQ ID NO: 2), a promoter lacking nucleic acids 799 to 1563 of SEQ ID NO: 3, or a wild-type CAG promoter. The plasmid was transfected into CHO cells using a site-specific gene insertion method (targeted integration system) using recombinase. Stable expressing cell pools were selected, and luciferase expression was evaluated in a fed-batch culture for 14 days (n=3). Luciferase expression was measured on days 3, 5, 7, 10, 12, and 14 and normalized to luciferase expressed under the control of wild-type CAG.

[0040] The results are shown in Figure 3. The promoter of SEQ ID NO: 2 did not affect reporter gene expression compared to wild-type CAG, whereas the promoter of SEQ ID NO: 3 increased reporter gene expression by approximately 40% from 7 to 14 days compared to wild-type CAG.

[0041] Example 2: PCR amplification of deleted promoter fragment The promoter of SEQ ID NO: 4 was amplified by PCR using two different polymerases and primer sets.

[0042] The results are shown in Figure 4. When the promoter of SEQ ID NO: 4 was used as a template, the desired PCR product (approximately 860 bp) was obtained under all conditions without the need for PCR optimization. On the other hand, the wild-type CAG failed to amplify the desired product (approximately 1730 bp) under any conditions. These results confirmed that the promoter of SEQ ID NO: 4 can be amplified by PCR.

[0043] Example 3: Expression of STA551 STA551 is a switch antibody that utilizes Switch-Ig (registered trademark) developed by Chugai Pharmaceutical Co., Ltd. It is activated by recognizing adenosine triphosphate (ATP), which is believed to be present at high concentrations in tumor tissues, as a switch molecule, and binds to the target antigen, CD137.

[0044] A plasmid containing four copies of the L chain and two copies of the H chain of STA551 using SEQ ID NO: 4 or wild-type CAG as the promoter was prepared.

[0045] The wild-type CAG plasmid was prepared in two steps. First, to introduce ligation / homology sites, each of the L / H genes was subcloned into an intermediate plasmid containing the wild-type CAG and the appropriate homology sites for ligation using standard cloning methods. Next, after amplifying and purifying each intermediate plasmid, all fragments were ligated into a single expression plasmid using the homology / ligation method. This process requires two E. coli transformation steps and takes at least 5 days.

[0046] On the other hand, the plasmid containing the promoter of SEQ ID NO:4 was prepared in one step without the need for an intermediate plasmid, because the fragment containing SEQ ID NO:4 could be amplified by PCR. A DNA fragment containing the promoter of SEQ ID NO:4, the L / H gene, and a homology site for ligation was prepared by PCR using appropriate primers. Construction of the plasmid containing the promoter of SEQ ID NO:4 required only one E. coli transformation step and took only three days.

[0047] The plasmid was transfected into CHO cells using a recombinase-based site-specific gene insertion method (targeted integration system), and a stable expressing cell pool was selected. STA551 expression was assessed on days 10, 12, and 14 of a 14-day fed-batch culture (n=3). STA551 expression was comparable between the two promoters.

[0048] These results confirmed that the use of the promoter of sequence number 4 facilitates the construction of complex plasmids and that the promoter of sequence number 4 can be used to express monoclonal antibodies at a level at least equivalent to that of wild-type CAG.

[0049] While the foregoing has shown a preferred embodiment of the invention, it will be recognized and understood that various modifications may be made thereto, and the appended claims are intended to cover all such modifications that do not depart from the spirit and scope of the invention.

[0050] This shows the promoter sequence described in the present invention. SEQ ID NO: 1_CAG promoter GTCGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATA GCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGC CCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAG GGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTAC ATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCG CCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACG TATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCA TCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAG CGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGC GGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGT TTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGG CGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCC CGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTC CTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTG AAAGCCTTGAGGGGCTCCGGGAGGGCCCTTTGTGCGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCTCCGCGCTGCCCGGCGGCTGTGAGC GCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAGTGTGCGCGAGGGGAGCGCGGCCG GGGGCGGTGCCCCGCGGTGCGGGGGGGGCTGCGAGGGGAACAAAGGCTGCGTGCGGGGTG TGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGTCGGTCGGGCTGCAACCCCCCCTGC ACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGGGGCTCCGTACGGGGC GTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAGGTGGGGGTGCCGGGCGGGG CGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGGGGCGCGGCGGCCCCCGGAGCGCCG GCGGCTGTCGAGGCGCGGCGAGCCGCAGCCATTGCCTTTTATGGTAATCGTGCGAGAGGG CGCAGGGACTTCCTTTGTCCCAAATCTGTGCGGAGCCGAAATCTGGGAGGCGCCGCCGCA CCCCCTCTAGCGGGCGCGGGGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGG AGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTGTC CGCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTG TGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGC TCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAccggt

[0051] Array number 2_469~571 (Del3) GTCGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATA GCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGC CCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAG GGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTAC ATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCG CCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACG TATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCA TCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATAGCCAATCAGAG CGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAA GCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGC CGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGG GCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTC TTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGCCCTTTGTGCGGGGGGAG CGGCTCGGGGGGTGCGTGCGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCTCCGCGCT GCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAGTGTGCG CGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGCTGCGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGTCGGTCGG GCTGCAACCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGC GGGGCTCCGTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAGGT GGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGGGGCGCGG CGGCCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCATTGCCTTTTATG GTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGTGCGGAGCCGAAATC TGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGGCGAAGCGGTGCGGCGCCGGCAG GAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCCTCT CCAGCCTCGGGGCTGTCCGCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGG GTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTT CTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGG CAAAccggt

[0052] Array number 3_799~1563 (Del12) GTCGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATA GCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGC CCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAG GGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTAC ATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCG CCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACG TATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCA TCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAG CGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGC GGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGT TTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGG CGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCC CGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTC CTCCGGGCTGTAATTAGCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGGT TCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCT TCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAccggt

[0053] Accession Nos. 4_469 to 571, 799 to 1563 (eCAPE) GTCGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATA GCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGC CCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAG GGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTAC ATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCG CCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACG TATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCA TCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATAGCCAATCAGAG CGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAA GCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGC CGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGG GCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGGGGGGACGGCTGCCTTCGGGGGGG ACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAA CCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCT GTCTCATCATTTTGGCAAAccggt

Claims

1. An isolated polynucleotide comprising a nucleotide sequence in which the region from at least the 469th base to the 571st base is deleted from the nucleotide sequence set forth in SEQ ID NO: 1, or a nucleotide sequence having 90% or more identity thereto.

2. The polynucleotide according to claim 1, comprising a nucleotide sequence set forth in SEQ ID NO: 2, or a nucleotide sequence having 90% or more identity thereto.

3. An isolated polynucleotide comprising a nucleotide sequence in which the region from at least the 799th base to the 1563rd base is deleted from the nucleotide sequence set forth in SEQ ID NO: 1, or a nucleotide sequence having 90% or more identity thereto.

4. The polynucleotide according to claim 3, comprising a nucleotide sequence set forth in SEQ ID NO: 3, or a nucleotide sequence having 90% or more identity thereto.

5. An isolated polynucleotide comprising a nucleotide sequence in which at least the following regions (a) and (b) are deleted from the nucleotide sequence set forth in SEQ ID NO: 1, or a nucleotide sequence having 90% or more identity thereto: (a) the region from the 469th base to the 571st base; and (b) the region from the 799th base to the 1563rd base.

6. The polynucleotide according to claim 5, comprising a nucleotide sequence set forth in SEQ ID NO: 4, or a nucleotide sequence having 90% or more identity thereto.

7. A promoter comprising the polynucleotide according to any one of claims 1 to 6.

8. A vector comprising the promoter according to claim 7.

9. A vector comprising the promoter according to claim 7 and a gene encoding a protein.

10. A transformed cell obtained by transforming mammalian cells with the vector according to claim 9.

11. The transformed cell according to claim 10, wherein the mammalian cell is a CHO cell.

12. A method for producing a recombinant protein, comprising culturing the transformed cell according to claim 11 to produce the recombinant protein and recovering the recombinant protein produced from the resulting culture.

13. The method according to claim 12, which is a method for producing an antibody, wherein the vector comprises a promoter consisting of the nucleotide sequence set forth in any one of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 and a gene encoding the antibody, and the gene encodes an amino acid sequence containing the VL of the antibody or an amino acid sequence containing the VH of the antibody, or the gene encodes an amino acid sequence containing the VL of the antibody and an amino acid sequence containing the VH of the antibody.

14. An isolated polynucleotide fragment having promoter function, which consists of a sequence having at least 70%, at least 80%, at least 90% or 100% identity with the sequence set forth in any one of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:

4.

15. The vector according to claim 9, wherein the protein is the heavy chain (H chain) or light chain (L chain) of an antibody.

16. A cell comprising a gene incorporating a promoter consisting of the nucleotide sequence set forth in any one of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:

4.

17. The cell according to claim 16, wherein the gene encodes an antibody polypeptide.

18. A method for producing an antibody using a cell comprising a gene incorporating a promoter consisting of the nucleotide sequence set forth in any one of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.

Images