Composition for imparting drought stress resistance

Abstract

Provided are: a composition for imparting drought stress resistance to a plant; a method for producing a plant body having drought stress resistance; and a method for imparting drought stress resistance to a plant body.　This composition for imparting drought stress resistance to a plant contains, as an active ingredient, N-acetylglutamic acid or a salt or solvate thereof.

Description

Composition for imparting drought stress tolerance

[0001] The present invention relates to a technique for imparting drought stress tolerance to plants.

[0002] Unlike animals, plants are sessile and cannot move. Therefore, they must rapidly respond to various environmental stresses to survive in a changing environment. Drought stress is one of the environmental stresses that is thought to have a serious impact on plants due to recent global warming. When plants are exposed to drought stress, various physiological responses are activated to prevent internal water loss, as well as the synthesis of genes and plant hormones that control these responses. For example, the synthesis of abscisic acid (ABA), a plant hormone, is induced by drought stress. This promotes the closure of stomata, the gas exchange site in plants, thereby preventing water loss from the plant due to drought stress (Non-Patent Document 1). Furthermore, DREB2A, a master transcription factor in plant drought stress responses, is activated by drought stress and regulates the transcription of genes, such as metabolic enzymes, that function to alleviate drought stress (Non-Patent Document 2). Furthermore, it has been reported that Arabidopsis thaliana, in which arginine metabolism is constitutively activated by gene transfer, exhibits increased accumulation of metabolic intermediates and drought stress tolerance (Non-Patent Document 3).

[0003] Attempts are being made to develop methods to enhance the drought stress tolerance of practical plants by utilizing the knowledge described above. However, ABA is expensive, and the use of drought stress-related genes such as DREB2A requires the creation of recombinant plants for each individual plant. This poses problems such as cost, safety, and the enormous time required to popularize the technology.

[0004] On the other hand, it has been reported that low-molecular-weight compounds enhance plant environmental stress tolerance, and these range from physiologically active compounds such as plant hormones to amino acids and volatile molecules. For example, the amino acid γ-aminobutyric acid (GABA) accumulates in plants in response to high light and high temperature stress, and adding GABA to plants enhances their high temperature stress tolerance (Non-Patent Document 4).

[0005] Agarwal and Jha, Biologia Plantarum Volume 54, Pages 201-212, 2010Sakuma et al, Plant Cell, Volume 18, Issue 5, Pages 1292-1309, 2006Kalamaki et al, Journal of Experimental Botany, Volume 60, Issue 6, Pages 1859-1871, 2009Balfagon et al, Plant Physiology, Volume 188, Issue 4, Pages 2026-2038, 2022et al, 2022

[0006] The present invention aims to provide a composition for imparting drought stress tolerance to plants, a method for producing a plant having drought stress tolerance, and a method for imparting drought stress tolerance to a plant. In preparation for the frequent occurrence of abnormal weather such as droughts due to global warming and food shortages due to population growth, improving the drought stress tolerance of crops is one of the most important challenges for developing crops that can tolerate unexpected droughts or that can be cultivated on dry land that is unsuitable for cultivation.

[0007] The present inventors have conducted extensive research into methods for imparting drought stress tolerance to plants, and as a result have found that application of N-acetylglutamic acid, or a salt or solvate thereof to plants can impart drought stress tolerance to plants, thereby completing the present invention.

[0008] That is, the present invention is as follows: [1] A composition for imparting drought stress tolerance to a plant, comprising N-acetylglutamic acid, or a salt or solvate thereof as an active ingredient. [2] The composition according to [1], in which the drought stress tolerance is exerted under conditions of exposure to drought stress. [3] A composition for promoting stomatal closure, cuticle reinforcement, or root elongation in a plant, comprising N-acetylglutamic acid, or a salt or solvate thereof as an active ingredient. [4] The composition according to [3], in which stomatal closure, cuticle reinforcement, or root elongation is maintained or promoted under conditions of exposure to drought stress. [5] A composition for promoting expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, or RD29B gene, comprising N-acetylglutamic acid, or a salt or solvate thereof as an active ingredient. [6] Any of the compositions according to [1] to [5], in which the plant is not a genetically modified plant containing an N-acetylglutamic acid gene and a gene that induces expression of said gene. [7] The composition of any of [1] to [6], wherein the plant is a dicotyledonous or monocotyledonous plant. [8] A method for producing a plant with drought stress tolerance, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant. [9] The method of [8], wherein the drought stress tolerance is exerted under conditions of exposure to drought stress.

[10] A method for producing a plant with stomatal closure, enhanced cuticle layer, or promoted root elongation, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant.

[11] The method of

[10] , wherein stomatal closure, enhanced cuticle layer, or root elongation is maintained or enhanced under conditions of exposure to drought stress.

[12] A method for producing a plant with enhanced expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, or RD29B gene, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant.

[13] Any of the methods [8] to

[12] , wherein the plant to which N-acetylglutamic acid, or a salt or solvate thereof, is applied is not a genetically modified plant having neither an N-acetylglutamic acid gene nor a gene that induces expression of said gene.

[14] Any of the methods [8] to

[13] , wherein the plant is a dicotyledonous or monocotyledonous plant.

[15] A method for imparting drought stress tolerance to a plant, comprising applying N-acetylglutamic acid, or a salt or solvate thereof to the plant.

[16] The method of

[15] , wherein the drought stress tolerance is exerted under conditions of exposure to drought stress.

[17] A method for promoting stomatal closure, cuticle enhancement, or root elongation in a plant, comprising applying N-acetylglutamic acid, or a salt or solvate thereof to the plant.

[18] The method of

[17] , wherein stomatal closure, cuticle enhancement, or root elongation is maintained or enhanced under conditions of exposure to drought stress.

[19] A method for promoting the expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, or RD29B gene in a plant, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant.

[20] Any of the methods

[15] to

[19] , wherein the plant to which N-acetylglutamic acid or a salt or solvate thereof is applied is not a genetically modified plant containing an N-acetylglutamic acid gene and a gene that induces expression of said gene.

[21] Any of the methods

[15] to

[20] , wherein the plant is a dicotyledonous or monocotyledonous plant.

[22] Use of a composition containing N-acetylglutamic acid, a salt or solvate thereof as an active ingredient to confer drought stress tolerance to a plant.

[23] The use of

[22] , wherein the drought stress tolerance is exerted under conditions of exposure to drought stress.

[24] Use of a composition containing N-acetylglutamic acid or a salt or solvate thereof as an active ingredient for promoting stomatal closure, cuticle strengthening, or root elongation in a plant.

[25] The use of

[24] , in which stomatal closure, cuticle strengthening, or root elongation is maintained or promoted under conditions of exposure to drought stress.

[26] Use of a composition containing N-acetylglutamic acid, or a salt or solvate thereof as an active ingredient, to promote expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, or RD29B gene.

[27] The use of any of

[22] to

[26] , wherein the plant is not a genetically modified plant containing an N-acetylglutamic acid gene and a gene that induces expression of said gene.

[28] The use of any of

[22] to

[26] , wherein the plant is a dicotyledonous or monocotyledonous plant. This specification incorporates the disclosure of Japanese Patent Application No. 2023-220767, from which the present application claims priority.

[0009] Applying N-acetylglutamic acid or a salt or solvate thereof to plants can confer drought stress tolerance to the plants. Furthermore, stomatal closure, cuticle reinforcement, or root elongation can be promoted in plants. Furthermore, expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, or RD29B gene, or a homologous gene thereof, can be promoted in plants. As a result, crops that can tolerate unexpected droughts or that can be cultivated on dry, unsuitable land can be produced in preparation for food shortages due to population growth and the frequent occurrence of abnormal weather such as droughts caused by global warming and the resulting water shortages.

[0010] Figure 3 shows the appearance of lettuce plants subjected to drought stress. The left panel shows the appearance of lettuce plants subjected to drought stress without NAG, and the right panel shows the appearance of lettuce plants subjected to drought stress after treatment with 1 μM NAG. Figure 3 shows the fresh weight of lettuce plants subjected to drought stress. The relative fresh weight of lettuce plants treated with 1 μM NAG is shown compared to the control (NAG 0). n = 14-17 (error bars indicate standard error). Figure 3 shows the stomatal aperture of lettuce plants treated with NAG. Figure 3A shows an image of lettuce stomata, showing the long and short sides. Figure 3B shows the stomatal aperture of lettuce plants treated with NAG. n = 89 (Test method: Student's t-test, **P < 0.01, error bars indicate standard error). Figure 3 shows the appearance of spinach plants subjected to drought stress. The left panel shows the appearance of spinach plants subjected to drought stress without NAG, and the right panel shows the appearance of spinach plants treated with 1 μM NAG. Figure 1 shows the fresh weight of spinach plants treated with NAG and subjected to drought stress. The relative fresh weight of 1 μM NAG plants compared to the control (NAG 0) is shown. n = 14–17 (error bars indicate standard error). Figure 2 shows the stomatal aperture of NAG-treated spinach plants. n = 98–99 (Testing method: Student's t-test **P < 0.01, error bars indicate standard error). Figure 3 shows the appearance of rice plants subjected to drought stress. The left panel shows the appearance of rice plants subjected to drought stress without NAG, and the right panel shows the appearance of rice plants treated with 1 μM NAG and subjected to drought stress. Figure 4 shows the fresh weight of rice plants treated with NAG and subjected to drought stress. The relative fresh weight of 1 μM NAG plants compared to the control (NAG 0) is shown. n = 43 (Testing method: Student's t-test **P < 0.01, error bars indicate standard error). Figure 5 shows the results of an analysis of the expression levels of drought stress-responsive genes in NAG-treated Arabidopsis plants. The relative expression levels were calculated relative to the expression levels in the NAG-untreated compartment. A, B, C, D, E, and F show the expression levels of DREB2A, ERD1, RD29A, NCED3, LEA, and RD29B, respectively.n = 3 (Testing method: Student's t-test **P < 0.01 *P < 0.05; Error bars indicate standard error). Figure 1 shows the results of expression analysis of drought stress-responsive genes in NAG-treated rice. Relative expression levels were calculated to those in the NAG-untreated plot. A, B, and C show the expression levels of OsDREB2A, OsDREB2B, and OsERD1, respectively. n = 3 (Testing method: Student's t-test **P < 0.01 *P < 0.05; Error bars indicate standard error). Figure 1 shows the results of expression analysis of drought stress-responsive genes in NAG-treated hop. Relative expression levels were calculated, with the expression level in the NAG-untreated plot set at 1. A and B show the expression levels of HlDREB2A and HlNCED3, respectively. n = 3 (Student's t-test **P < 0.01 *P < 0.05; Error bars indicate standard error).

[0011] The present invention is described in detail below. The present invention relates to a composition for imparting drought stress tolerance to plants. "Imparting drought stress tolerance" refers to imparting the ability to suppress the effects of drought stress when the stress is applied or to suppress the effects of drought stress before the stress is applied, and includes reducing or eliminating the effects of drought stress. The active ingredient in the composition of the present invention is N-acetylglutamic acid, or a salt or solvate thereof. The present invention also relates to a method for imparting drought stress tolerance to plants or a method for producing plants with drought stress tolerance by applying N-acetylglutamic acid, or a salt or solvate thereof to plants.

[0012] The composition of the present invention containing N-acetylglutamic acid can impart drought stress tolerance to plants, thereby reducing the effects of drought stress that plants normally experience and enhancing plant growth, and therefore can also be called a composition for enhancing plant growth. The drought stress that plants normally experience includes mild drought stress that does not cause leaf wilting, poor growth, withering, etc.

[0013] The effects of drought stress refer to unfavorable conditions for plants, such as wilting of leaves, poor growth, and withering, which occur in plants due to drought stress.

[0014] In the present invention, drought stress tolerance is imparted to plants by applying N-acetylglutamic acid, or a salt or solvate thereof, thereby eliminating the need for genetic modification such as knocking in or knocking out a specific gene involved in plant drought stress tolerance. Genes involved in plant drought stress tolerance are not limited, and examples include abscisic acid (ABA) genes and genes that induce the expression of these genes, γ-aminobutyric acid (GABA) genes and genes that induce the expression of these genes, N-acetylglutamic acid genes and genes that induce the expression of these genes, DREB2A genes, ERD1 genes, RD29A genes, NCED3 genes, LEA genes, and RD29B genes, with particular examples including N-acetylglutamic acid genes and genes that induce the expression of these genes.

[0015] 1. N-Acetylglutamic acid N-Acetylglutamic acid has the structural formula shown in Formula I and the chemical formula is CH 11 It is expressed as NO5 and abbreviated as NAG. Its appearance is white to almost white crystals or crystalline powder.

[0016]

[0017] Both L-type (N-acetyl-L-glutamic acid) and D-type (N-acetyl-D-glutamic acid) can be used, but L-type (N-acetyl-L-glutamic acid) synthesized in vivo is preferred. In prokaryotes and simple eukaryotes, N-acetylglutamic acid is produced by, for example, N-acetylglutamate synthase or ornithine acetyltransferase. Therefore, secretions, isolates, extracts, or purified products of N-acetylglutamic acid-producing organisms can be used, or the organisms themselves can be used. Enzymatic production without the involvement of a living organism or fermentation using microorganisms with or without mutagenesis can also be used. N-acetylglutamic acid can also be chemically synthesized. Commercially available N-acetylglutamic acid can be used. Commercially available N-acetylglutamic acid is available from Fujifilm Wako Pure Chemical Industries, Ltd., Sigma-Aldrich Corporation, Tokyo Chemical Industry Co., Ltd., and other manufacturers.

[0018] Salts include both hydrated and anhydrous salts, and include salts with inorganic bases such as sodium, potassium, magnesium, calcium, and aluminum; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine and ornithine; and ammonium salts. The salts may be acid addition salts, and specific examples of such salts include acid addition salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, methanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. Hereinafter, the term "N-acetylglutamic acid" includes its salts and solvates.

[0019] N-acetylglutamic acid is quantified using high-performance liquid chromatography and mass spectrometry (MS). Specifically, a sample containing N-acetylglutamic acid is separated into components by high-performance liquid chromatography, and the separated components are then subjected to mass spectrometry (single MS or tandem MS) to measure the amount of N-acetylglutamic acid contained in the sample.

[0020] 2. Drought Stress According to the Agricultural Technology Encyclopedia by the National Agriculture and Food Research Organization (http: / / lib.ruralnet.or.jp / nrpd / ), drought stress is a condition in which a lack of water occurs due to drought, high temperatures, strong light, low temperatures, low humidity, etc., disrupting the physiological environment within the plant, resulting in a significant decrease in plant growth and yield. If the amount of water supplied to the plant is less than the amount of water transpiration from the plant, plant growth will be suppressed or inhibited.

[0021] Plants have the ability to suppress declines in survival rate, growth, yield, etc. in response to drought stress, and this ability is called drought tolerance (dryness tolerance).

[0022] Drought tolerance refers to the ability to withstand water deficiency. When water is scarce, plants protect themselves by thickening the cuticle on the leaf surface, closing stomata to prevent transpiration, and increasing root elongation to expand the rhizosphere in deeper, moister soil. They also maintain water balance by osmoregulation through the accumulation of compatible solutes, such as sugars and amino acids, in the cytoplasm. Hydrophilic LEA proteins are thought to retain water and prevent other proteins from crystallizing due to desiccation. Therefore, drought stress refers to a plant's exposure to moisture conditions below the normal growth moisture for any length of time and any number of times. Plants exposed to drought stress experience physiological disorders, including stunted growth and wilting. This tolerance allows plants to cope with drought stress and suppress declines in survival, growth, and yield, even under drought stress.

[0023] N-acetylglutamic acid confers the above-mentioned drought stress tolerance to plants, and as a result, plants can acquire tolerance to drought stress.

[0024] 3. Enhancement of drought stress-responsive gene expression N-acetylglutamic acid enhances the expression of drought stress-responsive genes involved in drought stress tolerance in plants, thereby conferring drought stress tolerance to plants.

[0025] In Arabidopsis, the drought stress-responsive genes include the DREB2A gene, the ERD1 gene, the RD29A gene, the NCED3 gene, the LEA gene, and the RD29B gene. Among these, the DREB2A gene is important.

[0026] In other plant species, the expression of homologs of the Arabidopsis thaliana DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, and RD29B gene is enhanced. For each plant species, for example, when obtaining the nucleotide sequence of a homolog, a TBLASTN search can be performed using the amino acid sequence of the protein encoded by the above Arabidopsis thaliana genes as a query, and the gene with the highest score can be selected as the homolog from among the genes listed as homolog candidate.

[0027] For example, in rice, the expression of the OsDREB2A gene and OsDREB2B gene, which are homologs of the Arabidopsis thaliana DREB2A gene, and the OsERD1 gene, which is a homolog of the Arabidopsis thaliana ERD1 gene, is enhanced.In hop, the expression of the HlDREB2A gene, which is a homolog of the Arabidopsis thaliana DREB2A gene, and the HlNCED3 gene, which is a homolog of the Arabidopsis thaliana NCED3 gene, is enhanced. The proteins encoded by homologs of the Arabidopsis thaliana DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, and RD29B gene in various plant species are collectively referred to as the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, and RD29B gene, respectively, and the proteins encoded by homologs of the Arabidopsis thaliana DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, and RD29B gene in various plant species are collectively referred to as DREB2A, ERD1, RD29A, NCED3, LEA, and RD29B, respectively.

[0028] In plants to which N-acetylglutamic acid has been applied, the expression of these drought stress-responsive genes is increased by 1.1-fold or more, preferably 1.2-fold or more, more preferably 1.5-fold or more, more preferably 1.7-fold or more, even more preferably 1.8-fold or more, even more preferably 1.9-fold or more, even more preferably 2.0-fold or more, even more preferably 2.1-fold or more, even more preferably 2.3-fold or more, even more preferably 2.5-fold or more, even more preferably 3.0-fold or more, even more preferably 4.0-fold or more, even more preferably 5.0-fold or more, even more preferably 6.3-fold or more, even more preferably 10-fold or more, even more preferably 15-fold or more, and even more preferably 19-fold or more, compared to plants to which N-acetylglutamic acid has not been applied. For example, in Arabidopsis thaliana, the expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, and RD29B gene is increased by approximately 5.6-fold, 6.3-fold, 1.6-fold, 19-fold, 2.5-fold, and 1.8-fold, respectively. In rice, the expression of the OsDREB2A, OsDREB2B, and OsERD1 genes increases approximately 1.6-, 1.6-, and 1.5-fold, respectively. In hop, the expression of the HlDREB2A and HlNCED3 genes increases approximately 2.2-, and 2.3-fold, respectively.

[0029] Whether or not gene expression is enhanced in a plant by N-acetylglutamic acid can be measured by extracting RNA from the plant, synthesizing cDNA using reverse transcriptase, and analyzing the expression level by real-time PCR. Here, enhancement of gene expression by N-acetylglutamic acid includes both cases where expression is enhanced before drought stress is applied to the plant and cases where expression is enhanced when drought stress is applied to the plant.

[0030] The present invention encompasses compositions containing N-acetylglutamic acid for enhancing expression of drought stress-responsive genes or compositions for enhancing expression. Specifically, the present invention encompasses compositions containing N-acetylglutamic acid for enhancing expression of the DREB2A gene, the ERD1 gene, the RD29A gene, the NCED3 gene, the LEA gene, and the RD29B gene. The composition of these compositions is similar to that of compositions for imparting drought stress tolerance to plants.

[0031] Treating plants with N-acetylglutamic acid can enhance the expression of the DREB2A, ERD1, RD29A, NCED3, LEA, and RD29B genes, thereby conferring tolerance to drought stress.

[0032] In other words, conferring drought stress tolerance by treating plants with N-acetylglutamic acid can also be achieved by enhancing the expression of the above genes. Furthermore, by enhancing the expression of these genes, N-acetylglutamic acid treatment can not only induce stomatal closure but also inhibit water loss by strengthening the cuticle layer and increase water absorption through root elongation. In other words, treatment of plants with N-acetylglutamic acid not only induces stomatal closure but also promotes cuticle strengthening and root elongation. Here, strengthening the cuticle layer refers to changes in the properties of the cuticle, including thickening and changes in the components that make up the cuticle, thereby suppressing water evaporation. Furthermore, DREB2A, the master transcription factor in plant drought stress responses, is activated by drought stress and regulates the transcription of genes that function to alleviate drought stress, such as metabolic enzymes (Non-Patent Document 2). Therefore, this gene triggers various responses in plants to cope with drought stress. For example, it has been reported that overexpression of DREB2A in Arabidopsis promotes root growth under drought stress conditions (Meena et al., Molecular Biology Reports, 49 (8), page 7347-7358, 2022), indicating that enhancing expression of this gene promotes root growth in response to drought stress. Additionally, it has been reported that overexpression of RAP2.4, a gene in the same gene family as DREB2A, enhances the synthesis of waxes that form the cuticle in response to drought stress in Arabidopsis (Yang et al., Frontiers in Plant Science, 11, page 895, 2020), indicating that enhancing expression of the DREB2A gene leads to enhanced cuticle growth.

[0033] 4. Target Plants In the present invention, target plants include both angiosperms and gymnosperms, but are preferably angiosperms. Furthermore, angiosperms include both dicotyledonous and monocotyledonous plants. Examples of monocotyledonous plants include grasses such as rice, corn, barley, wheat, and sorghum; Araceae plants such as taro and konjac; Amaryllidaceae plants such as onion and leek; and Asparagaceae plants such as asparagus. Among these, grasses are preferred. Examples of dicotyledonous plants include Cannabaceae plants such as hemp, hops, Zelkova, and Enoki mushroom; Brassicaceae plants such as cabbage, Chinese cabbage, broccoli, radish, arugula, komatsuna, mizuna, mustard, and Arabidopsis; Solanaceae plants such as potato, tobacco, Nicotiana benthamiana, and tomato; Asteraceae plants such as lettuce and artichoke; Legumes such as alfalfa and soybean; Amaranthaceae plants such as spinach and sugar beet; Lamiaceae plants such as perilla and basil; Umbelliferae plants such as carrot and mitsuba; Cucurbitaceae plants such as melon, watermelon, cucumber, and pumpkin; and Malvaceae plants such as cotton. Among these, Cannabaceae and Cruciferae plants are preferred. Tomatoes are also preferred.

[0034] 5. Application Method and Amount of N-acetylglutamic Acid To confer drought stress tolerance to plants with N-acetylglutamic acid, N-acetylglutamic acid may be applied to plants.

[0035] Here, application of N-acetylglutamic acid refers to bringing N-acetylglutamic acid into contact with a plant or allowing it to be taken up into the plant, for example, treating a plant with N-acetylglutamic acid or administering or adding N-acetylglutamic acid to a plant.

[0036] N-acetylglutamic acid may be applied as is in powder or crystalline form, or may be dissolved in an appropriate solvent such as water or a buffer solution, coexist with an excipient, or incorporated into fertilizers, culture media, potting soil, pesticides, etc. N-acetylglutamic acid can be applied to plants, for example, in culture, hydroponics, soil, or potted plants. Specifically, N-acetylglutamic acid may be administered to culture media or soil, or directly to the plant, or may be sprayed or applied to either or both of the culture media / soil and the plant. Administration to plants may be by, for example, spraying, spraying, applying, irrigating, or drenching plant seeds, seedlings, leaves, stems, etc., preferably by root absorption. In the present invention, N-acetylglutamic acid dissolved in a solvent, incorporated into fertilizers, culture media, potting soil, pesticides, etc., or coexisting with an excipient, spreader, etc., is referred to as a composition containing N-acetylglutamic acid. The composition can be applied in the form of an emulsifiable concentrate, liquid, water-soluble concentrate, powder, dust, paste, granules, wettable powder, etc. When spraying or spraying on plants, a sprayer or applicator can be used, and when spraying on a large scale over a large farm, aerial spraying can be performed using a helicopter or drone.

[0037] The timing of application of N-acetylglutamic acid is not limited, and may be before exposure to drought stress, simultaneously with exposure to drought stress, or after exposure to drought stress. Preferably, in order to previously impart drought stress tolerance to the plant, application is made before exposure to drought stress or simultaneously with exposure to drought stress. Application before exposure to drought stress is particularly preferred.

[0038] For example, when a weather forecast predicts that a plant will be exposed to drought stress, N-acetylglutamic acid can be applied to the plant in advance.Also, when a sudden change in weather causes a plant to be exposed to drought stress, N-acetylglutamic acid can be applied to the plant promptly.

[0039] In either case, N-acetylglutamic acid may be applied continuously or intermittently. Continuous application here refers, for example, to mixing N-acetylglutamic acid into a medium and cultivating or hydroponically cultivating the plant for a certain period of time, or cultivating the plant in soil using a tool that allows for a continuous supply of N-acetylglutamic acid. Intermittent application refers, for example, to application in a timely manner in accordance with the expected timing and level of drought stress in the case of culture or hydroponic cultivation, or in soil cultivation, to application in accordance with the soil moisture status and the expected timing and level of stress. When applied continuously, the application period is not limited, and application can be continued, for example, until the cause of drought stress disappears. When applied intermittently, the number and amount of application are not limited, and application can be repeated, for example, until the cause of drought stress disappears, including continuous application followed by reapplication.

[0040] The concentration of N-acetylglutamic acid in the composition containing N-acetylglutamic acid is not limited, and the composition can be applied so that the required amount of N-acetylglutamic acid described below can be applied to the plant.

[0041] The amount of N-acetylglutamic acid to be applied can be adjusted appropriately depending on the type of plant, its growth stage, and the degree of drought stress.

[0042] Examples of application amounts are as follows: The compound can be applied at a concentration of, for example, 0.0001 to 1,000,000 μM, preferably 0.001 to 100,000 μM, 0.01 to 10,000 μM, or 0.1 to 1,000 μM per volume of medium or per volume of soil.

[0043] 6. Method for Confirming the Impartation of Drought Stress Tolerance Whether or not drought stress tolerance has been imparted to a plant to which N-acetylglutamic acid has been applied can be confirmed by exposing the plant to which N-acetylglutamic acid has been applied to drought stress and then visually checking the degree of leaf wilting or by measuring the fresh weight of the above-ground parts of the plant excluding seeds and roots. Furthermore, since application of N-acetylglutamic acid to a plant reduces stomatal aperture by maintaining or promoting stomatal closure, whether or not drought stress tolerance has been imparted to the plant can be confirmed by measuring stomatal aperture. Stomata are structures found in the epidermis of terrestrial plants, consisting of two guard cells and a gap between them. They are generally found on the underside of leaves (Agricultural Technology Encyclopedia, http: / / lib.ruralnet.or.jp / nrpd / #box_search=%E6%B0%97%E5%AD%94&kensuu=100&sort=0&logic=1&page=0&bunya=&koumoku=11176&db=&uid=0). N-acetylglutamic acid can confer drought stress tolerance by preventing water loss from plants through stomatal closure. Stomatal aperture can be calculated by photographing stomata under a microscope, measuring the lengths of the long and short sides of the stomata using image analysis software, and calculating the ratio of the long and short sides (Huang et al., International Journal of Molecular Sciences. 2022 Jul 24;23(15):8145). When evaluating the effect of N-acetylglutamic acid on stomata, it is preferable to select stomata present on a certain leaf surface of the target plant treated or untreated with N-acetylglutamic acid, or to select from multiple leaves (for example, even if 100 stomata are observed, photograph 50 stomata from different leaves). This is to prevent bias in the results and obtain accurate evaluation results. Here, in this example, the observation target was set to stomata on the abaxial side of the leaf, and stomata of multiple leaves were observed.

[0044] Application of N-acetylglutamic acid to plants confer drought stress tolerance under conditions of exposure to drought stress. In other words, under conditions of exposure to drought stress, the adverse effects of drought stress (withering, leaf wilting, and loss of fresh weight) and adverse effects on mechanisms that counteract drought stress (increased stomatal aperture) are hardly observed, and the plants do not wither even when exposed to drought stress. As a result, the effects of drought stress can be prevented while imparting drought stress tolerance through application of N-acetylglutamic acid. Typically, when plants are exposed to drought stress, many individuals wither and die, leaving only a portion that survive, some of which may subsequently grow. However, in the present invention, application of N-acetylglutamic acid results in fewer plants withering compared to plants not treated with N-acetylglutamic acid, and preferably, plants are able to continue growing without withering even under conditions of exposure to drought stress.

[0045] For example, drought stress tolerance can be confirmed by placing a plant to which N-acetylglutamic acid has been applied under drought conditions and then visually checking the degree of leaf wilting, measuring the fresh weight of the above-ground parts of the plant excluding seeds and roots, or measuring stomatal aperture. The plant can be placed under drought conditions by stopping water supply. If the degree of leaf wilting, decrease in fresh weight, or stomatal aperture is less than that of an untreated plant or a plant to which N-acetylglutamic acid has not been applied, it can be determined that drought stress tolerance has been conferred.

[0046] 7. Stomatal closure, cuticle thickening, and root elongation As described above, plants to which N-acetylglutamic acid is applied exhibit the effects of stomatal closure, cuticle thickening, and root elongation. Whether or not these effects have been achieved can be confirmed by comparing plants to which N-acetylglutamic acid has been applied with plants to which it has not been applied by measuring stomatal aperture, cuticle thickness and its components, and root elongation using the methods described above.

[0047] 8. Plant Growth Enhancement Plants to which N-acetylglutamic acid has been applied show enhanced growth even under dry conditions such as drought. Whether or not the growth-enhancing effect has been imparted to plants to which N-acetylglutamic acid has been applied can be confirmed by measuring the fresh weight of the above-ground parts of the plants, excluding the seeds and roots, after application of N-acetylglutamic acid. It can also be confirmed by measuring the number of leaves, plant height, leaf color, etc.

[0048] The present invention will be specifically explained by the following examples, but the present invention is not limited to these examples.

[0049] Example 1: Enhancement of drought stress tolerance in lettuce by treatment with N-acetylglutamic acid 1. Objective Focusing on N-acetylglutamic acid, we investigated whether it confers drought stress tolerance to plants using lettuce, a dicotyledonous plant.

[0050] 2. Experimental Method (1) Experimental Materials Lettuce (variety: Green Wave) was used as the experimental material. Seeds were purchased from Takii Seed Co., Ltd. (https: / / www.takii.co.jp / ).

[0051] (2) Growth Method: Wet rockwool blocks (Yamato Plastics) were placed in plastic trays, and one lettuce seed was sown per block. A 500-fold dilution of Hyponex stock solution (Hyponex Japan) containing 1 μM N-acetylglutamic acid (NAG, Tokyo Chemical Industry) (hereafter referred to as NAG-containing Hyponex diluted solution) was then poured into the trays, which were then placed in a climate chamber (Nippon Medical & Chemical Instruments) to initiate growth. The climate chamber was maintained at 22°C with a photoperiod of 16 hours light and 8 hours dark. Watering (Hyponex diluted solution with or without NAG) was initiated when the rockwool blocks ran out of water, and NAG-containing Hyponex diluted solution was added every week.

[0052] (3) Drought stress treatment and measurement of fresh weight Two weeks after sowing, drought stress treatment was initiated by stopping the water supply to the rock wool block. One week after water absorption was stopped, the above-ground parts of the lettuce were excised from the rock wool block and their weights were measured.

[0053] (4) Measurement of stomatal aperture Two weeks after sowing, three true leaves of lettuce were harvested, and the abaxial stomata were photographed using an upright microscope BA81 and Moticam1080BMH (Shimadzu Rika). The images were analyzed using the image analysis software ImageJ to measure the lengths of the long and short sides of the stomata, and the stomatal aperture was calculated by calculating the ratio of the long side to the short side (Huang et al., International Journal of Molecular Sciences. 2022 Jul 24;23(15):8145).

[0054] 3. Results: When lettuce plants were grown in the absence of NAG, their leaves wilted when exposed to drought stress. However, when lettuce plants were grown in a diluted solution of Hyponex containing NAG, leaf wilting due to drought stress was suppressed (Fig. 1A). A comparison of the fresh weights of the two plants revealed that the lettuce plants with added NAG had a greater fresh weight than those without added NAG (Fig. 2). Furthermore, measurements of stomatal aperture revealed that addition of NAG significantly reduced leaf stomatal aperture (Figs. 3A and 3B).

[0055] 4. Conclusions: NAG suppressed the loss of fresh weight associated with drought stress and promoted stomatal closure, suggesting that NAG confers drought stress tolerance in lettuce by preventing water loss through stomatal closure.

[0056] Example 2: Enhancement of drought stress tolerance in spinach by N-acetylglutamic acid treatment 1. Objective The drought stress-alleviating effect of NAG observed in lettuce was examined in spinach, another dicotyledonous plant. By using potting soil for growing spinach, it was also confirmed whether the stress-alleviating effect of NAG was observed under soil planting conditions.

[0057] 2. Experimental Method (1) Experimental Materials Spinach (variety: Kyokuroi All-Right) was used as the experimental material. Seeds were purchased from Takii Seed Co., Ltd. (https: / / www.takii.co.jp / ).

[0058] (2) Growing method: Prepare moistened potting soil (Iris Ohyama) in a plastic cell tray and place the seeds in one cell (area 9 cm). 2 Spinach seeds were sown individually in a tray (4 cm deep). A 500-fold diluted solution of Hyponex stock solution containing a final concentration of 1 μM NAG was added to the tray, and the tray was placed in an artificial growth chamber (Nippon Medical Instruments Co., Ltd.) to initiate growth. The incubation conditions in the artificial growth chamber were a temperature of 22°C and a photoperiod of 16 hours light and 8 hours dark. Watering of the culture medium was performed when the medium was dehydrated and dry. Watering with diluted Hyponex solution containing NAG was performed every week.

[0059] (3) Drought stress treatment and measurement of fresh weight Two weeks after sowing, drought stress treatment was initiated by stopping water supply to the culture medium. One week after water absorption was stopped, the above-ground parts of the spinach plants were excised from the culture medium and their weight was measured.

[0060] (4) Measurement of stomatal aperture Two weeks after sowing, three spinach leaves were harvested, and the abaxial stomata were photographed using an upright microscope BA81 and Moticam1080BMH (Shimadzu Rika). The images were opened in the image analysis software ImageJ, and the lengths of the long and short sides of the stomata were measured. The stomatal aperture was calculated as the ratio of the short side to the long side.

[0061] 3. Results: Spinach plants grown in the absence of NAG exhibited leaf wilting when exposed to drought stress, whereas spinach grown in a diluted solution of Hyponex containing NAG exhibited reduced leaf wilting due to drought stress (Fig. 4). A comparison of fresh weights between the two plants revealed that the fresh weight of spinach treated with NAG was greater than that of spinach not treated with NAG (Fig. 5). Furthermore, measurements of leaf stomatal aperture revealed that addition of NAG significantly reduced stomatal aperture (Fig. 6).

[0062] 4. Conclusions: NAG suppressed the loss of fresh weight associated with drought stress and promoted stomatal closure, suggesting that NAG confers drought stress tolerance in spinach by preventing water loss through stomatal closure. Furthermore, because the spinach used in the experiment was grown in potting soil, it was suggested that the drought stress-alleviating effect of NAG is also exerted when planted in soil.

[0063] Example 3: Enhancement of drought stress tolerance in rice by N-acetylglutamic acid treatment 1. Objectives We investigated whether the drought stress alleviation effect of NAG in dicotyledonous plants, lettuce and spinach, could also be confirmed in monocotyledonous plants, using rice as a sample.

[0064] 2. Experimental Method (1) Experimental Materials Rice (variety: Nipponbare) was used as the experimental material. Seeds were purchased from Nouken Co., Ltd. (https: / / www.k-nouken.com / ).

[0065] (2) Growth method: Rice seeds were husked using a thresher, soaked in Kitchen Haiter solution ("Haiter" is a registered trademark of Kao Corporation) for 30 minutes, and then washed five times with sterile water. Next, water-moistened rockwool blocks were prepared in plastic trays, and three rice seeds were sown per block. A 500-fold diluted solution of Hyponex concentrate containing 1 μM NAG was poured into the trays, which were then placed in an artificial growth chamber to initiate growth. The incubation conditions in the artificial growth chamber were a temperature of 22°C and a photoperiod of 16 hours light and 8 hours dark. Watering of the rockwool blocks was performed when the blocks were dehydrated and dry. Watering of the rice plants with diluted Hyponex solution containing NAG was performed every week.

[0066] (3) Drought stress treatment and measurement of fresh weight Two weeks after sowing, drought stress treatment was initiated by stopping water supply to the rice plants. One week after water absorption was stopped, the above-ground parts of the rice plants were excised from the rock wool block and their weights were measured.

[0067] 3. Results: When rice plants were grown in the absence of NAG, their leaves wilted when exposed to drought stress, whereas leaf wilting due to drought stress was suppressed in rice plants grown in a diluted Hyponex solution containing NAG (Fig. 7). A comparison of the fresh weights of the two plants revealed that the fresh weight of the rice plants treated with NAG was significantly greater than that of the lettuce plants without NAG (Fig. 8).

[0068] 4. Conclusions NAG suppressed the loss of fresh weight associated with drought stress, suggesting that NAG confers drought stress tolerance in rice.

[0069] Example 4: Promotion of Heat Stress-Responsive Gene Expression by N-Acetylglutamate in Arabidopsis thaliana 1. Objectives In response to drought stress, plants induce physiological responses, such as stomatal closure, to prevent water loss from the body, and also activate the expression of genes that control these responses. In plants, the transcription factor DREB2A is activated in response to drought stress and plays a central role in regulating the expression of genes that function in drought tolerance (Sakuma et al., Plant Cell, Volume 18, Issue 5, Pages 1292-1309, 2006). Therefore, to examine the drought stress-alleviating effect of NAG from the perspective of gene expression regulation, we examined whether NAG-treated Arabidopsis thaliana promoted the expression of DREB2A and other drought stress-responsive genes.

[0070] 2. Experimental Methods (1) Experimental Materials Arabidopsis thaliana wild-type strains (accession: Col-0) were used as experimental materials. Seeds were purchased from Inplanta Innovations Co., Ltd. (https: / / www.inplanta.jp / ).

[0071] (2) Growth Method: A liquid medium containing 1 / 2 Murashige-Skoog medium mixed salts (Nacalai) and 1 (w / v)% sucrose (FUJIFILM Wako) was used as the growth medium. Arabidopsis seeds were sterilized for 3 minutes with Kitchen Haiter solution (registered trademark, Kao) diluted to half its concentration with distilled water, washed three times with sterile distilled water, and then incubated overnight at 4°C. 3 mL of the growth medium was dispensed into 12-well microplates (IWAKI), and five seeds were seeded per well. The plates were then transferred to an incubator (TOMY) to initiate growth. The incubator was set at 22°C with a 16-hour light / 8-hour dark photoperiod.

[0072] (3) N-acetylglutamic acid treatment and RNA extraction. Seven days after sowing, Arabidopsis thaliana plants were cultured with NAG at a final concentration of 0.4 mM and incubated for 2 hours. The incubator was set at 22°C with a photoperiod of 16 hours light and 8 hours dark. After incubation, the samples were frozen in liquid nitrogen, and RNA was extracted using the RNeasy Plant Mini Kit (Thermo Fischer Scientific).

[0073] (4) Analysis of expression levels of drought stress-responsive genes by real-time PCR. cDNA, which is required as a template for real-time PCR, was synthesized from the obtained RNA. 1000 ng of total RNA from each sample was used, and PrimeScript TMcDNA was synthesized using RT Master Mix (Perfect Real Time) (TaKaRa). The synthesized cDNA was diluted 5-fold with sterile distilled water and subjected to real-time PCR. The target genes for real-time PCR were DREB2A (AGI code: AT5G05410), ERD1 (AGI code: AT5G51070), RD29A (AGI code: ), NCED3 (AGI code: AT3G14440), LEA (AGI code: AT3G02480), and RD29B (AGI code: AT5G52300), and the reference gene was ACTIN2 (AGI code: AT3G18780). PCR reactions were prepared using TB Green Ex Taq II (TaKaRa). PCR reactions were performed using a Thermal Cycler Dice® Real Time System IV (TaKaRa), with 50 PCR cycles. The primers used were as follows: DREB2A Fw: AACCTGTCAGCAACAACAGC (SEQ ID NO: 1) Rv: AAGCCTGCAAACACATCGTC (SEQ ID NO: 2) / ERD1 Fw: TGGGCTTGACATTGCTAACC (SEQ ID NO: 3) Rv: AAGGGTTGTGGATGCAATGC (SEQ ID NO: 4) / RD29A Fw: ATCATCTGGCTGGTTTGGTG (SEQ ID NO: 5) Rv: AACAACAGTGGAGCCAAGTG (SEQ ID NO: 6) / NCED3 Fw: CACGATTTCGCGATTACAGAGA (SEQ ID NO: 7) Rv: CCGGCAGCTTGAAAACGAAC (SEQ ID NO: 8) / LEA Fw: GCAAAACGCGAGCTACCAA (SEQ ID NO: 9) Rv: GTCCAGTCTGTTGCAAGGAGTCT (SEQ ID NO: 10) / RD29B Fw: GCGCACCAGTGTATGAATCCT (SEQ ID NO: 11) Rv: CGGCATGACTAAGAGACTTAGGTTT (SEQ ID NO: 12) / ACT2 Fw: GATCTCCAAGGCCGAGTATGAT (SEQ ID NO: 13) Rv: CCCATTCATAAAACCCCAGC (SEQ ID NO: 14).Then, the relative expression level of the target gene upon treatment with NAG was calculated using the ΔΔCt method using the Cp value obtained from real-time PCR.

[0074] 3. Results Compared to the control, NAG treatment increased the expression levels of DREB2A, ERD1, RD29A, NCED3, LEA, and RD29B by approximately 5.6-, 6.3-, 1.6-, 19-, 2.5-, and 1.8-fold, respectively (Figure 9).

[0075] 4. Conclusions Our results suggest that NAG enhances drought stress tolerance in Arabidopsis by upregulating the expression of drought stress-responsive genes.

[0076] Example 5: Promotion of drought stress response gene expression by N-acetylglutamic acid in rice 1. Objective We investigated whether the effect of NAG on enhancing the expression of drought stress response genes seen in Arabidopsis thaliana could also be confirmed in rice.

[0077] 2. Experimental Methods (1) Search for Arabidopsis drought stress-responsive gene homologs in rice. To design target gene primers required for gene expression analysis by real-time PCR, we searched for rice homologs of Arabidopsis drought stress-responsive genes. The amino acid sequences of Arabidopsis DREB2A and ERD1 were obtained from TAIR (https: / / www.arabidopsis.org / ), and the nucleotide sequences of the homologs were obtained using RAP-DB (https: / / rapdb.dna.affrc.go.jp / ). We also obtained the nucleotide sequence of the Arabidopsis ACT2 (AGI code: AT3G18780) homolog as a reference gene. The rice homologs were named OsDREB2A, OsDREB2B, OsERD1, and OsACT1.

[0078] (2) Experimental Materials The same as in Example 3.

[0079] (3) Growth method A liquid medium consisting of a 1 / 2 Murashige-Skoog medium mixed salts was used as the growth medium. Using a 50 mL Falcon tube, rice seeds were sterilized for 30 minutes with a solution of bleach diluted halfway with distilled water, and then washed five times with sterile distilled water. The tube was placed horizontally, and sterile distilled water was poured over the washed seeds to cover them. The seeds were then cultured in an incubator for three days to allow germination. The incubator was set at 30°C with a photoperiod of 16 hours light and 8 hours dark.

[0080] (4) N-acetylglutamic acid treatment and RNA extraction. Rice samples germinated for 3 days were placed in a liquid medium consisting of a 1 / 2 Murashige-Skoog salt mixture. Specifically, 3 mL of the liquid medium was dispensed into a 12-well microplate (IWAKI), and three samples were transferred at a time. NAG was added to each well to a final concentration of 0.5 mM. After incubation at 30°C for 2 hours, RNA was extracted from the aerial shoots using the RNeasy Plant Mini Kit.

[0081] (5) Analysis of expression levels of drought stress-responsive genes by real-time PCR. cDNA, which is required as a template for real-time PCR, was synthesized from the obtained RNA. 1000 ng of total RNA from each sample was used, and PrimeScript TMcDNA was synthesized using RT Master Mix (Perfect Real Time). The synthesized cDNA was diluted 5-fold with sterile distilled water and subjected to real-time PCR. The target genes for real-time PCR were OsDREB2A, OsDREB2B, and OsERD1, and the reference gene was OsACT1. The PCR reaction mixture was prepared using TB Green Ex Taq II. The PCR reaction was performed using the Thermal Cycler Dice® Real Time System IV, with 50 amplification cycles. The primers used were as follows: OsDREB2A Fw: AGAGAACGCGAAGGAAAAGC (SEQ ID NO: 15) Rv: TCTGGTTTTGCTCCTTCCAC (SEQ ID NO: 16) / OsDREB2B Fw: AAAAAGCGACCACGGAGATC (SEQ ID NO: 17) Rv: TGCCTTCCTTGCCTTCTTTG (SEQ ID NO: 18) / OsERD1 Fw: ACCTGATTTGCGAAGAAGGC (SEQ ID NO: 19) Rv: TTGCTTCGCTGATCACATCC (SEQ ID NO: 20) / OsACT1 Fw: AGCACATTCCAGCAGATGTG (SEQ ID NO: 21) Rv: TTCCTGTGCACAATGGATGG (SEQ ID NO: 22). The relative expression levels of the target genes upon NAG treatment were then calculated using the ΔΔCt method.

[0082] 3. Results: Compared to the control, NAG treatment increased the expression levels of OsDREB2A, OsDREB2B, and OsERD1 by approximately 1.6-, 1.6-, and 1.5-fold, respectively (Fig. 10). This suggests that NAG enhances drought stress tolerance in rice by upregulating the expression of drought stress-responsive genes.

[0083] Example 6: Promotion of drought stress response gene expression by N-acetylglutamic acid in hops 1. Objective We investigated whether the promotion of drought stress response gene expression by NAG observed in Arabidopsis and rice could also be confirmed in hops.

[0084] 2. Experimental Methods (1) Search for Homologs of Arabidopsis Drought Stress-Responsive Genes in Hop To design primers for target genes required for gene expression analysis by real-time PCR, we searched for hop homologs of Arabidopsis heat-responsive genes. The amino acid sequences of Arabidopsis DREB2A and HlNCED3 were obtained from TAIR (https: / / www.arabidopsis.org / ), and the nucleotide sequences of their homologs were obtained using Hopbase (http: / / hopbase.cgrb.oregonstate.edu / ). To obtain the homolog sequences, a TBLASTN search was performed using the Arabidopsis amino acid sequence as a query. Genes with the highest scores among the candidate homologs were considered to be hop homologs. In addition, the nucleotide sequence of a homolog of Arabidopsis EF1α (AGI code: AT1G18070) was also obtained as a reference gene. The hop homologue genes were named HlDREB2A, HlNCED3, and HlEF1α.

[0085] (2) Experimental Materials Hops (variety: Saaz). Hop seedlings were purchased from Hana no Yakata (http: / / hananoyakata.shop-pro.jp).

[0086] (3) Growth medium (i) Agar medium: 2.2 g of Murashige-Skoog mixed salts and 20 g of glucose (FUJIFILM Wako) were dissolved in 1 L of purified water, and the pH was adjusted to 5.8. After adjusting the pH, 8 g of agar (Ina Food Industry) was melted and the mixture was autoclaved (121°C, 15 minutes).

[0087] (ii) Liquid Medium 2.2 g of mixed salts for Murashige-Skoog medium and 20 g of glucose were dissolved in 1 L of pure water, the pH was adjusted to 5.8, and the mixture was autoclaved (121°C, 20 minutes).

[0088] (4) Preparation and Growth of Tissue-Cultured Seedlings Tissue-cultured seedlings used as experimental materials were prepared as follows. Stem fragments containing a single node were excised from Saaz seedlings and sterilized by incubating in 70% ethanol (FUJIFILM Wako) for 1 minute and 1% hypochlorous acid (FUJIFILM Wako) for 5 minutes. The explants were washed three times with sterile water for 1 minute each and then drained on paper towels. Afterwards, the explants were placed on agar medium and cultured in an incubator. The incubator was set at 20°C with a photoperiod of 16 hours light and 8 hours dark. After two weeks of culture, axillary buds extending from the nodes were excised and placed on agar medium. Individuals that grew well were used as tissue-cultured seedlings. The tissue-cultured seedlings were periodically subcultured by placing the apical buds on fresh agar medium.

[0089] (5) N-acetylglutamic acid treatment and RNA extraction. Leaves from the first and second nodes of the apical bud of tissue-cultured seedlings 1.5 months after subculture were sampled and placed in a liquid medium consisting of 1 / 2 Murashige-Skoog salt mixture and 2 (w / v)% glucose. Specifically, 5 mL of the liquid medium was dispensed into a 6-well microplate (IWAKI), and five hop leaves were placed in each well. NAG was added to each well to a final concentration of 1 mM. After incubation at 20°C for 2 hours, RNA was extracted from the leaves using the RNeasy Plant Mini Kit.

[0090] (6) Analysis of expression levels of drought stress-responsive genes by real-time PCR. cDNA, which is required as a template for real-time PCR, was synthesized from the obtained RNA. 1000 ng of total RNA from each sample was used, and PrimeScript TMcDNA was synthesized using RT Master Mix (Perfect Real Time). The synthesized cDNA was diluted 5-fold with sterile distilled water and subjected to real-time PCR. For real-time PCR, the target genes were HlDREB2A and HlNCED3, and the reference gene was HlEF1α. The PCR reaction mixture was prepared with TB Green Ex Taq II. The PCR reaction was performed using the Thermal Cycler Dice® Real Time System IV, with 50 amplification cycles. The primers used were as follows: HlDREB2A Fw: AAGTGGGTTGCTGAAATCCG (SEQ ID NO: 23) Rv: AGAAAGTACCGAGCCAAAGC (SEQ ID NO: 24) / HlNCED3 Fw: TGCATTGACGGTGTTTACGC (SEQ ID NO: 25) Rv: TTGAACGGCGTGAACCATTC (SEQ ID NO: 26) / HlEF1α Fw: TTTTGCTGTCAGGGACATGC (SEQ ID NO: 27) Rv: TTGGCAGCGGATTTGGTAAC (SEQ ID NO: 28). The relative expression levels of the target genes upon NAG treatment were then calculated using the ΔΔCt method.

[0091] 3. Results Compared to the control, NAG treatment increased the expression levels of HlDREB2A and HlNCED3 by approximately 2.2-fold and 2.3-fold, respectively (Figure 11).

[0092] 4. Conclusions Our results suggest that NAG enhances drought stress tolerance in hops by increasing the expression of drought stress-responsive genes.

[0093] By applying N-acetylglutamic acid or a salt or solvate thereof to a plant, it is possible to impart drought stress tolerance to the plant, thereby increasing the yield of the plant even in a harsh environment where drought stress occurs. All publications, patents, and patent applications cited herein are incorporated by reference in their entirety.

Claims

1. A composition for imparting drought stress tolerance to plants, comprising N-acetylglutamic acid or a salt or solvate thereof as an active ingredient.

2. The composition according to claim 1, wherein the drought stress tolerance is exerted under conditions of being exposed to drought stress.

3. A composition for promoting the closure of plant stomata, enhancing the cuticle layer, or promoting root elongation, comprising N-acetylglutamic acid or a salt or solvate thereof as an active ingredient.

4. The composition according to claim 3, wherein the closure of stomata, enhancement of the cuticle layer, or root elongation is maintained or promoted under conditions of being exposed to drought stress.

5. A composition for promoting the expression of the DREB2A gene, ERD1 gene, RD29A gene, NCED3 gene, LEA gene, or RD29B gene, comprising N-acetylglutamic acid or a salt or solvate thereof as an active ingredient.

6. The composition according to any one of claims 1 to 5, wherein the plant is not a genetically modified plant of the N-acetylglutamic acid gene and a gene that induces the expression of the gene.

7. The composition according to any one of claims 1 to 5, wherein the plant is a dicotyledonous plant or a monocotyledonous plant.

8. A method for producing a plant having drought stress tolerance, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant.

9. The method according to claim 8, wherein the drought stress tolerance is exerted under conditions of being exposed to drought stress.

10. The method according to claim 8 or 9, wherein the plant to which N-acetylglutamic acid or a salt or solvate thereof is applied is not a genetically modified plant of the N-acetylglutamic acid gene and a gene that induces the expression of the gene.

11. The method according to claim 8 or 9, wherein the plant is a dicotyledonous plant or a monocotyledonous plant.

12. A method for imparting drought stress tolerance to a plant, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant.

13. The method according to claim 12, wherein the drought stress tolerance is exerted under conditions of being exposed to drought stress.

14. The method according to claim 12 or 13, wherein the plant to which N-acetylglutamic acid or a salt or solvate thereof is applied is not a genetically modified plant of the N-acetylglutamic acid gene and a gene that induces the expression of the gene.

15. The method according to claim 12 or 13, wherein the plant is a dicotyledonous plant or a monocotyledonous plant.

Images