Composition comprising camellia japonica callus-derived exosome as active ingredient for improving skin condition
A Camellia japonica callus-derived exosome composition addresses the lack of multi-functional skin benefits in existing products by inhibiting specific skin health markers, offering comprehensive skin improvement through anti-inflammatory, antioxidant, and regenerative effects.
Patent Information
- Application Number
- PCT/KR2024/014255
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-29
- Filing Date
- 2024-09-23
- Publication Date
- 2025-07-03
AI Technical Summary
Current cosmetic and pharmaceutical compositions lack the ability to simultaneously provide anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, wound healing, skin barrier improvement, and atopic dermatitis improvement using exosomes derived from Camellia japonica callus.
A composition containing Camellia japonica callus-derived exosomes, characterized by their ability to inhibit nitric oxide production, reduce UV-generated reactive oxygen species, inhibit extracellular melanin production, and regulate gene expressions related to inflammation and skin health, is developed for use in cosmetics and pharmaceuticals.
The composition exhibits excellent anti-inflammatory, antioxidant, whitening, anti-wrinkle, moisturizing, skin regeneration, wound healing, skin barrier improvement, and atopic dermatitis improvement effects, demonstrating high biocompatibility and effectiveness.
Smart Images

Figure 00000023_0000 
Figure 00000024_0000 
Figure 00000025_0000
Abstract
Description
Composition for improving skin condition containing exosomes derived from camellia callus as an active ingredient
[0001] The present invention relates to a composition for improving skin condition, which comprises exosomes derived from camellia japonica callus as an active ingredient.
[0002]
[0003] The aging process occurs throughout the body, and skin also ages with age. Wrinkles are the most important and common sign of aging skin, serving as a benchmark for assessing the degree of aging. Recently, with improving living standards and growing interest in skin care, interest in skin aging has grown. While preventing skin aging is impossible, various efforts are being made to slow down and delay the process and its signature symptom, wrinkles.
[0004] Skin aging is categorized as intrinsic or extrinsic, depending on the underlying cause. The loss of the extracellular matrix (ECM) within the dermis, composed of collagen, elastin, fibronectin, and proteoglycans, is recognized as the primary cause of intrinsic skin aging. Dermal aging deteriorates the function of the ECM, resulting in thinning, flattening, wrinkles, decreased elasticity, and the development of atrophy and dryness. Furthermore, the skin aging process also causes a decline in the function of skin appendages such as hair, sweat glands, and sebaceous glands, delaying wound healing caused by external stimuli.
[0005] UV rays, an exogenous factor, have been reported to promote melanin production when exposed to UV rays, leading to skin aging and damage. Furthermore, free radicals generated through UV rays and respiration can damage skin cells and tissues. Excessive free radicals disrupt the body's antioxidant defense system, leading to inflammation, erythema, burns, immunosuppression, and DNA damage, all of which ultimately accelerate skin aging. Furthermore, exogenous and endogenous stimuli decrease the moisture content of the stratum corneum and natural moisturizing factors, reducing skin hydration and worsening dryness. This, in turn, can lead to skin barrier destruction. This imbalance alters the physical and chemical properties of the skin, resulting in symptoms such as wrinkles, pigmentation, decreased hydration, and skin barrier destruction, as well as inflammation and reduced cell regeneration.
[0006] Therefore, to delay and suppress skin aging, an antioxidant defense system capable of suppressing and efficiently removing excess reactive oxygen species not only within the body but also within the skin is necessary. Accordingly, interest in materials for skin improvement is steadily increasing, and research is ongoing on natural materials for skin barrier protection and anti-aging. While demand for natural products for commercial use is increasing, plants are an unsustainable resource, requiring stable harvests. Therefore, plant tissue culture is a highly valuable technology for industrial use because it is not affected by external factors such as location, temperature, and other factors, and allows for stable, continuous production. These advantages are actively being utilized in the fields of cosmetics, health functional foods, and pharmaceuticals, utilizing mass propagation and the development of transgenic plants.
[0007]
[0008] Camellia japonica is an evergreen tree belonging to the genus Camellia in the family Theaceae. About 100 species of Camellia trees are distributed in Southeast Asia, and one species is known to be distributed in the southern part of Korea. In addition, cultivars with changed flower shapes, colors, and leaves of Camellia are widely used as ornamental trees in Korea. It grows up to 3 to 7 meters in height and mainly grows in the mountains and fields of Jeju Island and the southern region of Korea. Camellia seeds contain 9.1 to 11.5% saturated fatty acids, 85.6 to 89.4% oleic acid, and 1.3 to 2.9% linoleic acid, which are unsaturated fatty acids. It is a non-drying oil with a high oleic acid content, and has been used as hair oil, precision machine oil, and cooking oil since ancient times. It is said that the flowers are ground into powder and used to treat burns in the Compendium of Materia Medica. Research on the ingredients is mainly being conducted in Japan, and it has been reported that the medicinal ingredients of Camellia include camelin, pipecolic acid, eugenol, camelliagenin A, B, tubakisaponin, triterpene, tannin, benzenoid, steroid, flavonoid, and phenylpropanoid from the leaves, seeds, and flowers. In Japan, dried Camellia buds are used in folk medicine as a hemostatic for hemoptysis and hemoptysis, and the red flowers are powdered and taken with urination, ginger juice, and alcohol. Its physiological activities such as antiprotozoal action, antispasmodic action, tartar formation inhibition effect, alcohol absorption inhibition, and skin whitening action have been reported.
[0009] Exosomes have recently been utilized in various fields, including biotechnology, pharmaceuticals, and cosmetics manufacturing. Exosomes are tiny membrane-bound vesicles secreted from various cells, including mammals, bacteria, and plants. Exosomes are extracellular vesicles (EVs) measuring 50-200 nm in size and act as intercellular communication agents. These nanosized exosomes can transport membrane proteins that are not water-soluble. Membrane proteins are proteins contained within a phospholipid bilayer, and because they are hydrophobic, they are typically difficult to transport between cells via the bloodstream. In contrast, exosomes are composed of a phospholipid bilayer, allowing them to transport membrane proteins. By enclosing their contents within a phospholipid bilayer, exosomes protect their contents from external degradants. They also easily penetrate cells and perform various physiological and pathological functions, such as immune responses and signaling. Due to these characteristics, exosomes have recently been widely used in cosmetic compositions. Accordingly, research on extracting exosomes is actively being conducted.
[0010] Recently, research has been conducted on the various effects of plant-derived exosomes. Unlike animal cells, plants possess a cell wall in addition to a cell membrane. A space is formed between the cell walls, called the apoplast. In the apoplast, not only nutrients and water are transported, but numerous extracellular vesicles (EVs) or nanovesicles called exosomes accumulate. Like animal-derived exosomes, plant-derived exosomes contain nucleic acids (DNAs / RNAs), proteins (cytokines, growth factors, etc.), and, in particular, a variety of plant-specific secondary metabolites. Furthermore, plants possess a diverse range of lipids. Compared to animal-derived exosomes, plant-derived exosomes have a more diverse lipid composition and higher lipid content, suggesting a range of physiological activities. Plant-derived exosomes are natural products or vegan derivatives that can be actively absorbed by heterogeneous animal cells, and are more biocompatible than synthetic carriers, so research is expanding into key materials using them.
[0011] Human cell-derived extracellular vesicles have limited functionality, and mass production requires significant costs and equipment. Furthermore, they use animal-derived substances like fetal bovine serum (FBS), raising safety concerns. In contrast, plant-derived exosomes are free from stability issues, and thus, if their physiological activity is elucidated, they could be valuable as functional foods, pharmaceuticals, and cosmetics.
[0012] Research is expanding on extracting various plant-derived substances using calli and producing useful substances such as exosomes through them. In Korea, Korean Patent Publication No. 10-2023-0144973, “High-yield production method of plant-derived exosomes and functional high-purity exosomes produced thereby,” Korean Patent Publication No. 10-2461314, “Composition for improving skin condition comprising exosomes derived from apple callus,” and Korean Patent Publication No. 10-2023-0063541, “Method for producing nano exosomes derived from aloe peel callus and composition for improving skin comprising nano exosomes derived from aloe peel callus produced thereby,” etc. are disclosed.
[0013] However, there is currently no research on a cosmetic or pharmaceutical composition that can simultaneously provide anti-inflammation, antioxidant, whitening, anti-wrinkle, moisturizing, skin regeneration, wound healing, skin barrier improvement, atopic dermatitis improvement, and skin soothing effects using exosomes obtained from Camellia japonica callus.
[0014]
[0015] Accordingly, the present inventors have discovered that exosomes derived from Camellia japonica can simultaneously impart anti-inflammation, antioxidant, whitening, anti-wrinkle, moisturizing, skin regeneration, wound healing, skin barrier improvement, atopic dermatitis improvement, and skin soothing effects because they have the activity of inhibiting nitric oxide production, reducing UV-generated reactive oxygen species, inhibiting extracellular melanin production, inhibiting MMP-1 (Matrix metalloproteinase-1) gene expression, increasing Aquaporin 3 (AQP3) gene expression, reducing intercellular gaps, increasing Filaggrin gene expression, inhibiting TARC (Thymus and Activation-regulated Chemokine) production, and decreasing Vascular Endothelial Growth Factor (VEGF) gene expression, and have completed the present invention.
[0016]
[0017] The purpose of the present invention is to provide a composition for improving skin condition, which contains exosomes derived from camellia callus as an active ingredient.
[0018] Another object of the present invention is to provide a cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement and skin soothing, or a pharmaceutical composition for anti-inflammation, atopic dermatitis improvement, wound healing and wound healing promotion, containing camellia callus-derived exosomes as an active ingredient.
[0019]
[0020] In order to achieve the above-mentioned purpose, the present invention provides a cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement, and skin soothing, which contains camellia callus-derived exosomes as an active ingredient.
[0021] In the present invention, the camellia callus-derived exosome is characterized by being separated and purified from callus derived from camellia or a culture solution of callus.
[0022] In the present invention, the callus is characterized in that it is derived from any one part selected from the group consisting of flowers, leaves, stems, roots, seeds, and fruits of camellia.
[0023] In the present invention, the exosome is characterized in that it is separated from at least one selected from the group consisting of callus-derived exosomes, callus fragments, and callus extracts.
[0024] In the present invention, the exosomes are characterized as extracellular vesicles having an average diameter of 50 to 200 nm.
[0025] In the present invention, the composition is characterized in that it is any one selected from the group consisting of shampoo, soap, rinse, surfactant-containing cleansing, skin, toner, cream, lotion, emulsion, serum, essence, suspension, emulsion, ointment, tonic, treatment, conditioner, paste, gel, oil, wax, spray, aerosol, mist, and powder.
[0026] In addition, the present invention provides a pharmaceutical composition for anti-inflammation, atopic dermatitis improvement, wound healing, and wound healing promotion, which contains camellia callus-derived exosomes as an active ingredient.
[0027] In the present invention, the composition is characterized in that it is administered or treated by injection, microneedling, iontophoresis, application, or a combination thereof.
[0028] In the present invention, the composition is characterized in that it is one selected from the group consisting of a liquid formulation, a patch formulation, an injection formulation, an infusion formulation, and a spray formulation.
[0029]
[0030] Camellia callus-derived exosomes provided by the present invention have nitric oxide production inhibition activity, UV-induced reactive oxygen species reduction activity, extracellular melanin production inhibition activity, MMP-1 (Matrix metalloproteinase-1) gene expression inhibition activity, Aquaporin 3 (AQP3) gene expression increase activity, intercellular gap reduction, filaggrin gene expression increase activity, TARC (Thymus and Activation-regulated Chemokine) production inhibition activity, and Vascular Endothelial Growth Factor (VEGF) gene expression decrease activity, and thus have excellent anti-inflammatory, antioxidant, whitening, anti-wrinkle, moisturizing, skin regeneration, wound healing, skin barrier improvement, atopic dermatitis improvement, and skin soothing effects, and thus are used as cosmetics for anti-inflammation, atopic dermatitis improvement, wound healing, and skin soothing. It is excellent in its effectiveness as a pharmaceutical composition for promotion.
[0031]
[0032] Figure 1 is a drawing showing the process of inducing camellia callus and mass-producing callus through liquid culture.
[0033] Figure 2 is a drawing showing the results of measuring the size and concentration of exosomes of Examples 1-1 to 1-3, Example 2, Example 3, and Comparative Example 1 using a nanoparticle tracking analyzer (NTA, Particle Metrix) device.
[0034] Fig. 3 is a photograph of the exosomes of Examples 1-1 to 1-3 and Comparative Example 1 taken using a transmission electron microscope (TEM). Fig. 4 is a drawing showing the results of confirming cell activity in mouse macrophages (RAW 264.7), mouse melanoma (B16F10), human keratinocytes (HaCaT), and human fibroblasts (CCD-986sk) of Examples 1-1 to 1-3 and Comparative Example 1 according to the present invention.
[0035] FIG. 5 is a drawing showing the results of confirming cell activity in mouse macrophages (RAW 264.7), mouse melanoma (B16F10), human keratinocytes (HaCaT), and human fibroblasts (CCD-986sk) of Examples 2, 3, and 1-3 according to the present invention.
[0036] Figure 6 is a drawing showing the degree of nitric oxide production in mouse macrophages (RAW 264.7) to confirm the anti-inflammatory effect of Examples 1-1 to 1-3 and Comparative Example 1 according to the present invention.
[0037] FIG. 7 is a diagram showing the degree of nitric oxide production in mouse macrophages (RAW 264.7) to confirm the anti-inflammatory effect of Examples 2, 3, and 1-3 according to the present invention.
[0038] Figure 8 is a drawing showing the results of confirming the intracellular antioxidant effect of Examples 1-1 to 1-3 and Comparative Example 1 according to the present invention in human keratinocytes (HaCaT).
[0039] Figure 9 is a drawing showing the degree of melanin production in mouse melanoma (B16F10) to confirm the whitening effect of Examples 1-1 to 1-3 and Comparative Example 1 according to the present invention.
[0040] FIG. 10 is a drawing showing the degree of melanin production in mouse melanoma (B16F10) to confirm the whitening effect of Examples 2, 3, and 1-3 according to the present invention.
[0041] FIG. 11 is a drawing showing the level of mRNA expression of Matrix metalloproteinase-1 (MMP-1) in human fibroblasts (CCD-986sk) to confirm the anti-wrinkle effect of Examples 1-1 to 1-3 and Comparative Example 1 according to the present invention.
[0042] FIG. 12 is a drawing showing the level of mRNA expression of matrix metalloproteinase-1 (MMP-1) in human fibroblasts (CCD-986sk) to confirm the anti-wrinkle effect according to Examples 2, 3, and 1-3 of the present invention.
[0043] FIG. 13 is a drawing showing the results of confirming the level of aquaporin 3 (AQP3) mRNA expression in human keratinocytes (HaCaT) to confirm the moisturizing effect of Examples 1-1 to 1-3 and Comparative Example 1 according to the present invention.
[0044] Figure 14 is a drawing showing the results of a wound healing test conducted on human fibroblasts (CCD-986sk) to confirm the wound healing effect according to Examples 1-1 to 1-3 and Comparative Example 1 according to the present invention.
[0045] FIG. 15 is a drawing showing the results of confirming the level of mRNA expression of filaggrin (FLG) in human keratinocytes (HaCaT) to confirm the skin barrier improvement effect according to Examples 1-1 to 1-3 and Comparative Example 1 according to the present invention.
[0046] Figure 16 is a drawing showing the results of confirming the production amount of TARC (Thymus and Activation-regulated Chemokine) in human keratinocytes (HaCaT) to confirm the atopic improvement effect according to Examples 1-1 to 1-3 and Comparative Example 1 according to the present invention.
[0047] FIG. 17 is a drawing showing the results of confirming the expression level of VEGF (Vascular Endothelial Growth Factor) gene in human keratinocytes (HaCaT) to confirm the skin irritation improvement effect according to Examples 1-1 to 1-3 and Comparative Example 1 according to the present invention.
[0048]
[0049] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.
[0050] Throughout this specification, whenever a part is said to "include" a component, this does not mean that it excludes other components, but rather that it may include other components, unless otherwise specifically stated.
[0051] As used herein, the term "callus" refers to a disorganized mass of various plant cells, which generally contain cells with typical functions. Furthermore, callus can be formed from various parts of a plant, such as flowers, leaves, stems, roots, seeds, and fruits. Callus formation and induction are typically performed according to methods officially recognized in the field. More specifically, such callus formation and induction can be achieved by culturing plant tissue or explants thereof in a tissue culture medium.
[0052] The term “exosomes” as used herein refers to nano-sized vesicles having a membrane structure secreted or released from plant cells or plant stem cells into the extracellular space, and may preferably be extracellular vesicles having an average particle size of 50 to 200 nm.
[0053] The term “extracellular vesicles” as used herein is a general term for membrane-structured vesicles secreted by cells for intercellular signaling, including exosomes, microvesicles, and apoptotic bodies.
[0054]
[0055] Therefore, according to one embodiment of the present invention, the present invention relates to a cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement, and skin soothing, comprising camellia callus-derived exosomes as an active ingredient.
[0056] According to one embodiment of the present invention, the camellia callus-derived exosome may be separated and purified from a callus derived from camellia or a culture solution of callus.
[0057] The above callus may be derived from any one part selected from the group consisting of flowers, leaves, stems, roots, seeds and fruits of Camellia japonica.
[0058] According to one embodiment of the present invention, the exosome may be isolated from at least one selected from the group consisting of callus-derived exosomes, callus fragments, and callus extracts.
[0059] Methods for obtaining exosomes from plants include plant callus-derived exosomes, plant juice-derived exosomes, and plant material pulverized exosomes. However, in the present invention, plant callus-derived exosomes were used as the active ingredient. As a result of confirming the activity of exosomes through various methods, such as plant juice-derived exosomes and plant material pulverized exosomes, it was confirmed that when exosomes isolated from cells induced outside of plant callus culture were isolated, the activity was excellent because the main core components of plant cells were preserved in these exosomes.
[0060] According to one embodiment of the present invention, the exosomes may be extracellular vesicles having an average diameter of 50 to 200 nm.
[0061] According to one embodiment of the present invention, the composition may be any one selected from the group consisting of shampoo, soap, rinse, surfactant-containing cleansing, skin, toner, cream, lotion, emulsion, serum, essence, suspension, emulsion, ointment, tonic, treatment, conditioner, paste, gel, oil, wax, spray, aerosol, mist and powder, and more preferably, it may be a lotion or a cream.
[0062] In the cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement and skin soothing comprising the camellia callus-derived exosome of the present invention as an active ingredient, the camellia callus-derived exosome is added to the composition in an amount of 1.0X10 8 1.0X10 12 It may be contained in a particle / mL concentration, preferably 2.0X10 9 2.0X10 10 It may be contained in a particle / mL concentration, but is not limited thereto, as long as it contains an effective amount capable of providing the desired camellia callus-derived exosomes.
[0063] The cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement and skin soothing, which contains the camellia callus-derived exosome of the present invention as an effective ingredient, may appropriately blend ingredients commonly used in cosmetic compositions, such as moisturizers, antioxidants, oily ingredients, ultraviolet absorbers, emulsifiers, surfactants, thickeners, alcohols, powdery ingredients, coloring agents, aqueous ingredients, water, various skin nutrients, etc., as needed, within a range that does not impair the effects of the present invention.
[0064] The cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement and skin soothing comprising the camellia callus-derived exosome of the present invention as an active ingredient may be used by mixing together with a conventionally used skin improvement agent and / or moisturizer, in addition to the camellia callus-derived exosome, as long as the effect (e.g., anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement, skin soothing, etc.) is not impaired.
[0065] The cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement and skin soothing comprising the camellia callus-derived exosome of the present invention as an active ingredient can be applied in various forms, such as a patch, a mask pack, a mask sheet, a cream, a tonic, an ointment, a suspension, an emulsion, a paste, a lotion, a gel, an oil, a pack, a spray, an aerosol, a mist, a foundation, a powder, and a blotting paper.
[0066] The cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement and skin soothing comprising the camellia callus-derived exosome of the present invention as an active ingredient can be used for the purposes of anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement, skin soothing, etc., and the cosmetic formulation can be manufactured into any formulation commonly manufactured in the art. For example, it can be formulated into a patch, a mask pack, a mask sheet, an emollient toner, a nourishing toner, an astringent toner, a nourishing cream, a massage cream, an eye cream, a cleansing cream, an essence, an eye essence, a cleansing lotion, a cleansing foam, a cleansing water, a sunscreen, a lipstick, a soap, a shampoo, a surfactant-containing cleanser, a bath agent, a body lotion, a body cream, a body oil, a body essence, a body cleanser, a hair dye, a hair tonic, etc., but is not limited thereto.
[0067] The cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement and skin soothing comprising the camellia callus-derived exosome of the present invention as an active ingredient comprises ingredients commonly used in cosmetic compositions, and may include conventional auxiliary agents such as antioxidants, stabilizers, solubilizers, vitamins, pigments and fragrances, and carriers. In addition, in each formulation for the cosmetic composition, other ingredients can be appropriately selected and combined without difficulty by those skilled in the art depending on the type or purpose of use of the cosmetic composition.
[0068] As described above, camellia callus-derived exosomes have the activity of inhibiting nitric oxide production, reducing UV-generated reactive oxygen species, inhibiting extracellular melanin production, inhibiting MMP-1 (Matrix metalloproteinase-1) gene expression, increasing Aquaporin 3 (AQP3) gene expression, reducing intercellular gaps, increasing Filaggrin gene expression, inhibiting TARC (Thymus and Activation-regulated Chemokine) production, and decreasing Vascular Endothelial Growth Factor (VEGF) gene expression, and therefore have excellent anti-inflammatory, antioxidant, whitening, anti-wrinkle, moisturizing, skin regeneration, wound healing, improving skin barrier, improving atopic dermatitis, and skin soothing effects, and therefore are used as cosmetics for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, improving skin barrier, improving atopic dermatitis, and skin soothing, or anti-inflammation, improving atopic dermatitis, wound healing, and wound healing. It is highly effective as a pharmaceutical composition for promotion. Furthermore, it is less likely to contain impurities than simple extracts or culture solutions.
[0069]
[0070] In addition, the present invention relates to a pharmaceutical composition for anti-inflammation, atopic dermatitis improvement, wound healing, and wound healing promotion, which comprises camellia callus-derived exosomes as an active ingredient.
[0071] According to one embodiment of the present invention, the composition is characterized in that it is administered or treated by injection, microneedling, iontophoresis, application or a combination thereof.
[0072] According to one embodiment of the present invention, the composition may be any one selected from the group consisting of a liquid formulation, a patch formulation, an injection formulation, an infusion formulation, and a spray formulation.
[0073] When used as a pharmaceutical composition for anti-inflammation, atopic dermatitis improvement, wound healing and wound healing promotion of the present invention, it may include a pharmaceutically acceptable carrier, excipient or diluent. Examples of the carrier, excipient and diluent include, but are not limited to, lactose, dextrose, trehalose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium carbonate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, the effective amount of the pharmaceutical composition of the embodiment of the present invention means the amount required for administration to expect the anti-inflammation, atopic dermatitis improvement, wound healing and wound healing promotion effects.
[0074] Therefore, the camellia callus-derived exosome provided by the present invention has an activity of inhibiting nitric oxide production, an activity of reducing UV-generated reactive oxygen species, an activity of inhibiting extracellular melanin production, an activity of inhibiting MMP-1 (Matrix metalloproteinase-1) gene expression, an activity of increasing Aquaporin 3 (AQP3) gene expression, an activity of reducing gaps between cells, an activity of increasing Filaggrin gene expression, an activity of inhibiting TARC (Thymus and Activation-regulated Chemokine) production, and an activity of decreasing Vascular Endothelial Growth Factor (VEGF) gene expression, and therefore has excellent anti-inflammatory, antioxidant, whitening, anti-wrinkle, moisturizing, skin regeneration, wound healing, skin barrier improvement, atopic dermatitis improvement, and skin soothing effects, and therefore is used as a cosmetic for anti-inflammatory, antioxidant, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement, and skin soothing or an anti-inflammatory, atopic dermatitis improvement, wound healing, and wound It is excellent in its effectiveness as a pharmaceutical composition for promoting healing.
[0075]
[0076] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, as the gist of the present invention is not limited by them.
[0077]
[0078] <Example 1> Introduction of camellia in vitro and callus induction
[0079] Camellia japonica used in the present invention was collected in October from Yeosu, Jeollanam-do, and then soaked in 95% ethanol for 60 seconds, disinfected with a disinfectant solution (50% bleach + 0.1% Tween-20) for 20 minutes, and then washed with sterilized water at least three times. For the washed leaf tissue, 2 x 2 mm sized explants were made with a sharp knife, and the callus induction rate was tested according to the combination of 2,4-D (2,4-Dichlorophenoxyacetic acid, Sigma-Aldrich) and 6-BA (6-Benzylaminopurine solution, Sigma-Aldrich) as plant growth regulators. When comparing the effects of combinations of growth regulators on callus formation rate and proliferation rate, the medium containing 0.3 mg / L of 2,4-Dichlorophenoxyacetic acid and 1 mg / L of 6-Benzylaminopurine as growth regulators showed significantly higher callus formation rate and proliferation rate than the 2 mg / L of 2,4-Dichlorophenoxyacetic acid, an auxin hormone, and 0.2 mg / L of Kinetin, a cytokinin hormone studied in the comparative example. This suggests that the types and amounts of growth regulators used in this study were optimal for rapid callus formation and proliferation. Table 1 below shows the formation and proliferation rates of Camellia japonica callus according to growth regulators. Callus was induced by dark culture under growth chamber conditions of 25±2℃ and 60% humidity in basic MS medium containing 3% sucrose as a carbon source and 0.4% Gelrite as a medium solidifying agent. The callus induction status was observed under a microscope (Zoom Stereo Microscope Head & Dual light, KS-306). Excellent cell lines were selected through 2 to 3 subcultures at 4-week intervals on solid medium. 2,4-D (2,4-Dichlorophenoxyacetic acid, Sigma-Aldrich) concentration 0.The culture was cultured in liquid form in a 10 L bioreactor at a temperature of 25±2℃ with an air supply of 0.2 vvm for 4 weeks in MS liquid medium containing 3 mg / L, 6-BA (6-Benzylaminopurine solution, Sigma-Aldrich) and 1 mg / L hormone (Fig. 1).
[0080] Base MSSucrose(%)Cytokinin(mg / L)Auxin(mg / L) a Callus induction rate (%) b Callus growthrate6-BAKinetin2,4-DA1X31.00.00.398.3+++B1X30.00.22.033.3+
[0081] a Callus induction rate was defined as: callus induction rate (%) = (number of explants produced callus / total number of explants cultured)×100%.
[0082] b The callus growth rate was recorded per day basis of callus induction and graded by comparison in three categories as very good (+++), average (++), bad (+).
[0083]
[0084] <Example 1-1> Isolation of callus exosomes from camellia leaves
[0085] In Example 1, the callus culture derived from camellia leaves harvested after mass cultivation was filtered to separate the callus and the culture medium, and only the callus was obtained. 20 wt% of the obtained callus and 80 wt% of sterilized distilled water were mixed and then ground to obtain a ground solution. The obtained ground solution was centrifuged to remove impurities. It was centrifuged sequentially at 1,000 to 2,000 xg for 10 minutes and at 3,000 to 4,000 xg for 10 to 20 minutes, and only the supernatant was collected, excluding the pellet layer. The supernatant obtained in this process was centrifuged at 10,000 to 15,000 xg for 30 to 60 minutes using an ultracentrifuge, and the supernatant was filtered to separate and remove the residue to further increase the purity of the obtained supernatant. The exosomes present in the highly pure supernatant were centrifuged at 100,000–150,000 xg for 2–4 hours using an ultracentrifuge, and the exosomes were precipitated into a pellet layer. The final pellet layer of exosomes was resuspended in sterile distilled water to disperse them, producing exosomes. Finally, the exosomes were sterilized through a 0.2 ㎛ syringe filter to produce the final camellia callus-derived exosomes.
[0086]
[0087] <Example 1-2> Exosome isolation from callus culture derived from camellia leaves
[0088] After mass cultivation in Example 1, the harvested camellia callus culture was filtered to separate the callus and culture medium, and only the culture medium was obtained. Exosomes were prepared from the obtained culture medium using the same method as in Example 1-1.
[0089]
[0090] <Example 1-3> Isolation of exosomes from a mixture of callus and culture medium derived from camellia leaves
[0091] In Example 1, the camellia callus culture harvested after mass cultivation was filtered to separate the callus and the culture medium. Then, 20 wt% of the callus and 80 wt% of the culture medium were mixed and pulverized to obtain a pulverized solution. The obtained pulverized solution was used to prepare exosomes using the same method as in Example 1-1.
[0092]
[0093] <Example 2> Isolation of callus exosomes derived from camellia flowers
[0094] Camellia flowers were introduced in vitro using the same method as in Example 1 to induce callus, and then cultured in a final 10 L bioreactor. After mass cultivation, the harvested camellia flower callus cultures were filtered to separate callus and culture medium. 20 wt% of callus and 80 wt% of culture medium were mixed and then pulverized to obtain a pulverized solution. Exosomes were prepared from the obtained pulverized solution using the same method as in Example 1-1.
[0095]
[0096] <Example 3> Isolation of callus exosomes derived from camellia seeds
[0097] Camellia seeds were introduced in vitro using the same method as in Example 1 to induce callus, and then cultured in a final 10 L bioreactor. After mass cultivation, the harvested camellia seed callus cultures were filtered to separate callus and culture medium. 20 wt% of callus and 80 wt% of culture medium were mixed and then pulverized to obtain a pulverized solution. Exosomes were prepared from the obtained pulverized solution using the same method as in Example 1-1.
[0098]
[0099] <Comparative Example 1> Isolation of exosomes from camellia leaves
[0100] In Example 1, 20 wt% of disinfected and washed camellia leaves and 80 wt% of sterilized distilled water were mixed and then ground to obtain a ground solution. The ground solution thus obtained was used to obtain exosomes using the same method as in Example 1-1.
[0101]
[0102] <Experimental Example 1> Confirmation of exosome particles
[0103] For quantitative and physical evaluation of the exosomes isolated in Examples 1-1 to 1-3, Examples 2, 3, and Comparative Example 1, analysis was performed using a nanoparticle tracking analyzer (NTA, Particle Metrix). The nanoparticle tracking analyzer (NTA) is equipment for measuring the number and size of exosome particles, and the Zetaview Zeta potential model from Particle Metrix was used. For measurement, the exosome solution was diluted in sterile distilled water at an appropriate ratio, and the laser wavelength was set to 488 nm and the electrical conductivity was measured at 1.00 μS / cm.
[0104] As a result, as shown in Fig. 2, the number of particles and particle size were confirmed, and the high purity of the particles could be confirmed through the SPAN value. Based on the number of particles confirmed in this way, the dilution to a concentration of 2.0E+9 particles / ml was used as 100% in the experiment.
[0105] Meanwhile, to analyze the morphology of Examples 1-1 to 1-3 and Comparative Example 1, analysis was performed using a transmission electron microscope (JEOL, JEM 1010). Specifically, 10 μL of the separated samples of Examples 1-1 to 1-3 and Comparative Example 1 were deposited on a carbon-coated copper grid at room temperature for 1 to 5 minutes. For negative staining of exosomes, they were contrasted with 2% uranyl acetate for 1 to 2 minutes. The stained exosomes were photographed using a transmission electron microscope.
[0106] As a result, as shown in Fig. 3, it was confirmed that the shape of the exosome was spherical with a phospholipid bilayer membrane.
[0107]
[0108] <Experimental Example 2> Cytotoxicity Evaluation: WST-1 Assay
[0109] For the in-vitro efficacy experiments of Examples 1-1 to 1-3, Examples 2, 3, and Comparative Example 1, each cell line was treated at different concentrations to confirm whether it had toxicity for each cell line.
[0110] Cytotoxicity experiments were conducted on mouse macrophages (RAW 264.7), mouse melanoma cells (B16F10), human keratinocytes (HaCaT), and human fibroblasts (CCD-986sk). RAW 264.7, B16F10, and HaCaT cells were cultured in DMEM (Dulbecco's Modified Essential Medium) containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S), respectively, and CCD-986sk cells were cultured in IMDM (Iscove's Modified Dulbecco's Medium) containing 10% FBS and 1% P / S at 37°C in an incubator with 5% carbon dioxide. The cultured cells were dispensed into a 96-well plate at an appropriate concentration for each cell and cultured in an incubator at 37°C and 5% carbon dioxide environment to attach to the plate. After 24 hours, the medium was replaced with a medium diluted by concentrations from 0 to 10% of Examples 1-1 to 1-3, Examples 2, Example 3, and Comparative Example 1, and cultured. After 24 hours, the medium was removed, and 10% WST-1 reagent was treated to each plate well. After reacting in the incubator for 2 hours, the absorbance value was measured at 450 nm using an ELISA Reader (BioTeck, US), and the cell viability was confirmed according to the following mathematical equation 1.
[0111]
[0112] [Mathematical Formula 1]
[0113] Cell viability (%) = [Absorbance of sample treatment group / Absorbance of blank treatment group] × 100
[0114]
[0115] As a result, as shown in Fig. 4, Fig. 4a shows the results of cytotoxicity evaluation for mouse macrophages (RAW 264.7), Fig. 4b shows the results of cytotoxicity evaluation for mouse melanoma cells (B16F10), Fig. 4c shows the results of cytotoxicity evaluation for human keratinocytes (HaCaT), and Fig. 4d shows the results of cytotoxicity evaluation for human fibroblasts (CCD-986sk). When Examples 1-1 to 1-3 and Comparative Example 1 were treated to RAW 264.7, B16F10, HaCaT, and CCD-986sk, no cytotoxicity was observed at any concentration treated.
[0116] In addition, as shown in Fig. 5, the cytotoxicity evaluation results for mouse macrophages (RAW 264.7), mouse melanoma cells (B16F10), human keratinocytes (HaCaT), and human fibroblasts (CCD-986sk) of Examples 1-3, 2, and 3, which are exosomes isolated from calli induced by each part of Camellia japonica, confirmed that no cytotoxicity was exhibited at any concentration treated.
[0117]
[0118] <Experimental Example 3> Anti-inflammatory efficacy test: Nitric oxide production inhibition activity
[0119] In order to investigate the anti-inflammatory effects of Examples 1-1 to 1-3, Examples 2, 3, and Comparative Example 1, the amount of nitric oxide (NO), an indicator of inflammatory response, was measured using mouse macrophage RAW 264.7 cells.
[0120] RAW 264.7 cells were seeded at 2 × 10 per well in a 24-well plate.5 After dividing into the number of cells, the cells were cultured for 24 hours in an incubator with 5% carbon dioxide at 37°C to allow them to attach. The samples were diluted and prepared by concentration in DMEM medium containing 1 μg / ml of lipopolysaccharide (LPS), an inflammatory factor that promotes NO production. As a positive control, 50 μM N-Monomethyl-L-arginine acetate salt (L-NMMA) was diluted and prepared. After removing the culture medium from the cultured cells, the diluted samples prepared by concentration were treated with Examples 1-1 to 1-3, Examples 2, Example 3, and Comparative Example 1 and the positive control, and cultured for 24 hours in an incubator with 5% carbon dioxide at 37°C. After the culture was completed, the culture medium was collected and dispensed into a 96-well plate at 100 ㎕ per well. Then, 50 ㎕ of Griess reagent A (Naphthylethylene-diamine buffer) and 50 ㎕ of Griess reagent B (Sulfanilamide buffer) were added in equal amounts, and the total 200 ㎕ was reacted for 10 minutes, and the absorbance was measured at 540 nm. The amount of nitric oxide (NO) produced was confirmed through a standard curve created using nitrite diluted at various concentrations.
[0121]
[0122] As a result, as shown in Fig. 6, the amount of NO production was reduced by Examples 1-1 to 1-3 and Comparative Example 1, and it was confirmed that the NO production inhibition activity of Examples 1-1 to 1-3 was superior to that of Comparative Example 1. In particular, when treated at a concentration of 10%, Example 1-1 showed a 54.19% NO production reduction effect, Example 1-2 showed a 49.85% NO production reduction effect, Example 1-3 showed a 56.73% NO production reduction effect, and Comparative Example 1 showed a 20.27% NO production reduction effect.
[0123] In addition, as shown in Fig. 7, the NO production inhibition effect of Examples 1-3, 2, and 3, which are exosomes isolated from calli induced by each part of camellia, was confirmed, and it was confirmed that the amount of NO production was reduced. When each example was treated at a concentration of 10%, Examples 1-3 showed a 55.90% NO production reduction effect, Example 2 showed a 31.83% NO production reduction effect, and Example 3 showed a 29.52% NO production reduction effect. Among them, it was confirmed that Examples 1-3 had an outstanding NO production inhibition effect.
[0124]
[0125] <Experimental Example 4> Antioxidant Efficacy Test: Test to Confirm Reduction of Intracellular Reactive Oxygen Species (ROS)
[0126] In order to confirm the antioxidant effect of Examples 1-1 to 1-3 and Comparative Example 1, the intracellular antioxidant effect was confirmed using the H2DCFDA experimental method in HaCaT cells, which are human keratinocytes.
[0127] HaCaT cells were seeded at 1×10 in 96-well plates. 4 After dividing into the number of cells, the cells were cultured in an incubator at 37°C and 5% carbon dioxide environment for 24 hours to attach, and then replaced with serum-free medium and cultured for 24 hours. Afterwards, the cells were reacted with 5 mM CM-H2DCFDA at 37°C for 30 minutes, and then treated with 2 μM Trolox as a positive control group and cultured in an incubator at 37°C and 5% carbon dioxide environment for 1 hour. Next, UVB was irradiated at 500 mJ / cm 2 After treatment to induce the production of reactive oxygen species, the mixture was incubated for 1 hour in an incubator at 37°C and containing 5% carbon dioxide. After completion of the reaction, the fluorescence intensity was measured at an excitation wavelength of 488 nm and an emission wavelength of 528 nm, and the antioxidant activity was evaluated according to the following mathematical formula 2.
[0128]
[0129] [Equation 2]
[0130] Intracellular reactive oxygen species production (%) = Fluorescence intensity of the sample-treated group / Fluorescence intensity of the blank-treated group × 100
[0131]
[0132] As a result, as shown in Fig. 8, it was confirmed that the active oxygen generated by UV was reduced by Examples 1-1 to 1-3 and Comparative Example 1, and it was confirmed that the active oxygen reduction effect of Examples 1-1 to 1-3 was better than that of Comparative Example 1. In particular, when treated at a concentration of 10%, Example 1-1 showed an active oxygen reduction effect of 34.87%, Example 1-2 showed 33.03%, Example 1-3 showed 37.33%, and Comparative Example 1 showed 28.80%.
[0133]
[0134] <Experimental Example 5> Whitening Efficacy Test: Analysis of Extracellular Melanin Content
[0135] In order to confirm the whitening effect of Examples 1-1 to 1-3, Examples 2, 3 and Comparative Example 1, a test to measure extracellular melanin production (Extracellular Melanin Contents) was conducted using mouse melanoma B16F10 cells.
[0136] B16F10 cells were seeded at 3 × 10 per well in a 24-well plate. 4After dividing into the number of cells, the cells were cultured for 24 hours in an incubator at 37°C and 5% carbon dioxide environment to attach. Examples 1-1 to 1-3, Examples 2, 3 and Comparative Example 1 were diluted and prepared by concentration in DMEM medium (phenol red-free) containing α-MSH (α-Melanocyte Stimulation Hormone) to induce melanin production in cells. As a positive control, β-Arbutin was diluted to a concentration of 200 μg / ml and prepared. After removing the culture medium of the cultured cells, the samples prepared by diluting by concentration and the positive control were treated and reacted for 48 to 72 hours in an incubator at 37°C and 5% carbon dioxide environment. When the culture was completed, the culture solution was recovered, centrifuged, dispensed into a 96-well plate, and the absorbance at 490 nm was measured to calculate the rate of melanin production secreted into the extracellular space according to the following mathematical formula 3.
[0137]
[0138] [Equation 3]
[0139] Melanin production rate (%) = Melanin amount in sample treatment group / Melanin amount in blank treatment group × 100
[0140]
[0141] As a result, as shown in Fig. 9, the amount of melanin secreted extracellularly was reduced by Examples 1-1 to 1-3 and Comparative Example 1, and it was confirmed that the extracellular melanin reduction effect of Examples 1-1 to 1-3 was superior to that of Comparative Example 1. In particular, when treated at a concentration of 10%, the extracellular melanin reduction effect was confirmed to be 32.81% for Example 1-1, 33.60% for Example 1-2, 34.60% for Example 1-3, and 22.80% for Comparative Example 1.
[0142] In addition, as shown in Fig. 10, the amount of melanin secreted extracellularly by the treatment of Examples 1-3, 2, and 3, which are exosomes isolated from calli induced by each part of camellia, was confirmed to decrease in the amount of melanin secreted in all of them, and when each example was treated at a concentration of 10%, Examples 1-3 showed an extracellular melanin secretion reduction effect of 35.87%, Example 2 showed an extracellular melanin secretion reduction effect of 25.92%, and Example 3 showed an extracellular melanin secretion reduction effect of 23.82%. Among them, it was confirmed that Examples 1-3 showed the most outstanding effect of decreasing the amount of extracellular melanin secretion.
[0143]
[0144] <Experimental Example 6> Wrinkle improvement efficacy test: Measurement of MMP-1 mRNA expression level
[0145] In order to investigate the wrinkle improvement effect of Examples 1-1 to 1-3, Examples 2, 3, and Comparative Example 1, the mRNA expression level of Matrix Metalloproteinase-1 (MMP-1), a collagen-decomposing enzyme, was measured using human fibroblasts.
[0146] CCD-986sk cells, human fibroblasts, were seeded in 24-well plates at a density of 2 × 10 per well. 4 After dividing the cells into the number of cells, they were cultured in an incubator at 37°C and 5% carbon dioxide for 24 hours to attach the cells. After removing the culture medium, DPBS was added and UVA was irradiated at 1 J / cm 2Examples 1-1 to 1-3, Examples 2, 3 and Comparative Example 1, which were diluted to an appropriate concentration in serum-free medium after irradiation with an intensity, were treated and reacted. As a positive control, hTGF-β (human Tumor Growth Factor-β) was treated at a concentration of 5 ng / mL. Afterwards, RNA was extracted from the cells treated with each sample according to the protocol of the NucleoSpin RNA kit of Macherey-Nagel. The extracted RNA was quantified as total RNA at 260 nm using Nanodrop, and then cDNA was synthesized in an amplifier using an appropriate amount of RNA. The synthesized cDNA was subjected to real-time polymerase chain reaction in a real-time PCR machine using a mixture containing target gene-specific primers and cyanine dye CyberGreen (SYBR Green supermix), thereby finally evaluating the level of expression of the target gene. The primer sequences and reaction conditions of the target gene are shown in Table 2 below, and the expression level of the gene was finally analyzed through correction for the β-actin gene.
[0147] Sequence number Gene sequence Reaction conditions 1 MMP-1 Forward 5' - CCCAGCGACTCTAGAAACAC - 3' After polymerase activation at 95°C for 10 minutes, polymerization reaction was performed for 35 cycles under the conditions of denaturation at 95°C for 15 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds 2 Reverse 5' - GCCTCCCATCATTCTTCAGG - 3' 3 β-actin Forward 5' - CATGAAGTGTGACGTGGACA - 3' 4 Reverse 5' - CAGGGCAGTGATCTCCTTCT - 3'
[0148] As a result, as shown in Fig. 11, it was confirmed that the expression level of MMP-1 was reduced in a concentration-dependent manner by Examples 1-1 to 1-3 and Comparative Example 1, and it was confirmed that the MMP-1 reduction activity of Examples 1-1 to 1-3 was superior to that of Comparative Example 1. In particular, when treated at a concentration of 10%, the MMP-1 reduction effect was confirmed to be 35.39% for Example 1-1, 33.62% for Example 1-2, 38.61% for Example 1-3, and 18.36% for Comparative Example 1 compared to the untreated group.
[0149] In addition, as shown in Fig. 12, the MMP-1 mRNA expression levels of Examples 1-3, 2, and 3, which are exosomes isolated from calli induced by each part of the camellia tree, were confirmed. When each Example was treated at a concentration of 10%, Examples 1-3 showed a 38.61%, Example 2 showed a 27.00%, and Example 3 showed a 24.00% MMP-1 mRNA expression reduction effect. Among them, it was confirmed that Examples 1-3 showed the most outstanding MMP-1 mRNA expression reduction effect.
[0150]
[0151] <Experimental Example 7> Skin moisturizing activity test: Measurement of Aquaporin-3 (AQP-3) mRNA expression level
[0152] In order to confirm the moisturizing improvement effect of Examples 1-1 to 1-3 and Comparative Example 1, the level of aquaporin 3 (AQP3) mRNA expression was confirmed using human keratinocyte HaCaT cells.
[0153] Human keratinocyte HaCaT cells were seeded at 1 × 10 per well in a 24-well plate. 5After dividing into the number of cells, the cells were cultured in an incubator at 37℃ and 5% carbon dioxide for 24 hours to attach. After that, Examples 1-1 to 1-3 and Comparative Example 1, diluted to an appropriate concentration in serum-free medium, were treated and reacted for 24 hours. After that, RNA was extracted according to the protocol of the NucleoSpin RNA kit of Macherey-Nagel. The extracted RNA was quantified as total RNA at 260 nm using Nanodrop, and then cDNA was synthesized in an amplifier using an appropriate amount of RNA. The target gene expression level was finally evaluated by performing real-time polymerase chain reaction in a real-time PCR machine using a mixture of target gene-specific primers and cyanine dye Cyber Green (SYBR Green supermix) added to the synthesized cDNA. The primer sequences and reaction conditions of the target genes are shown in Table 3 below, and the expression level of the genes was finally analyzed through correction for the β-actin gene.
[0154] Sequence number Gene sequence Reaction conditions 5 AQP3 Forward 5' - AGACAGCCCCTTCAGGATTT - 3' After polymerase activation at 95°C for 10 minutes, polymerization reaction was performed for 35 cycles under the conditions of denaturation at 95°C for 15 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds. 6 Reverse 5' - TCCCTTGCCCTGAATATCTG - 3' 7 β-actin Forward 5' - CATGAAGTGTGACGTGGACA - 3' 8 Reverse 5' - CAGGGCAGTGATCTCCTTCT - 3'
[0155]
[0156] As a result, as shown in Fig. 13, it was confirmed that the expression amount of AQP-3 increased in a concentration-dependent manner in Examples 1-1 to 1-3 and Comparative Example 1, and it was confirmed that the expression increasing activity of AQP-3 in Examples 1-1 to 1-3 was superior to that in Comparative Example 1. In particular, when treated at a concentration of 10%, it was confirmed that Example 1-1 increased by 45.18%, Example 1-2 increased by 41.63%, Example 1-3 increased by 46.28%, and Comparative Example 1 increased by 14.87% compared to the untreated group.
[0157]
[0158] <Experimental Example 8> Skin regeneration and wound healing improvement efficacy test: Wound Healing assay
[0159] To investigate the skin regeneration and wound healing effects of Examples 1-1 to 1-3 and Comparative Example 1, a wound healing assay was performed using human fibroblasts.
[0160] Human fibroblasts, CCD-986sk, were seeded at 5 × 10 per well in a 24-well plate with Wound Healing Insert. 4 After dividing into the number of cells, they were cultured in an incubator at 37℃ and 5% carbon dioxide for 24 hours. After confirming that the cells had grown more than 80% on the plate, the Wound Healing Insert was removed and washed with DPBS. After treating Examples 1-1 to 1-3 and Comparative Example 1 diluted to an appropriate concentration in serum-free medium and reacting for 48 hours, the degree to which the artificially created gaps between cells were filled was confirmed under a microscope to confirm cell mobility, and the cell gap recovery (Invaded Area) was calculated according to the following mathematical formula 4.
[0161]
[0162] [Equation 4]
[0163] Invaded Area (%) = 100 - (Area of sample treatment group / Area of blank treatment group) × 100
[0164]
[0165] As a result, as shown in Fig. 14, it was confirmed that the cell gap was narrowed by Examples 1-1 to 1-3 and Comparative Example 1, and the cell gap recovery rate of Examples 1-1 to 1-3 was better than that of Comparative Example 1, confirming that there was an effect of improving skin regeneration and wound healing. In particular, when each sample was treated at a concentration of 10%, it was confirmed that the gap between cells was reduced by 57.67% for Example 1-1, 71.81% for Example 1-2, 72.22% for Example 1-3, and 24.03% for Comparative Example 1.
[0166]
[0167] <Experimental Example 9> Skin Barrier Improvement Effect Test: Measurement of Filaggrin mRNA Expression Level
[0168] In order to confirm the skin barrier improvement effect of Examples 1-1 to 1-3 and Comparative Example 1, the mRNA expression level of filaggrin (FLG) was measured using human keratinocytes.
[0169] Human keratinocyte HaCaT cells were seeded at 1×10 per well in a 24-well plate. 5After dividing into the number of cells, the cells were cultured in an incubator at 37°C and 5% carbon dioxide for 24 hours to attach. After that, Examples 1-1 to 1-3 and Comparative Example 1, diluted to an appropriate concentration in serum-free medium, were treated and reacted for 24 hours. After that, RNA was extracted according to the protocol of the NucleoSpin RNA kit of Macherey-Nagel. The extracted RNA was quantified as total RNA at 260 nm using Nanodrop, and then cDNA was synthesized in an amplifier using an appropriate amount of RNA. The target gene expression level was finally evaluated by performing real-time polymerase chain reaction in a real-time PCR machine using a mixture of target gene-specific primers and cyanine dye Cyber Green (SYBR Green supermix) added to the synthesized cDNA. The primer sequences and reaction conditions of the target genes are shown in Table 4 below, and the expression level of the genes was finally analyzed through correction for the β-actin gene.
[0170]
[0171] Sequence number Gene sequence Reaction conditions 9 FLG Forward 5'- GCTGAAGGAACTTCTGGAAAAG - 3' After polymerase activation at 95°C for 10 minutes, polymerization reaction was performed for 35 cycles under the conditions of denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. 10 Reverse 5'- GCCAACTTGAATACCATCAGAAG - 3' 11 β-actin Forward 5'- CATGAAGTGTGACGTGGACA - 3' 12 Reverse 5'- CAGGGCAGTGATCTCCTTCT - 3'
[0172]
[0173] As a result, as shown in Fig. 15, it was confirmed that the expression amount of FLG increased in a concentration-dependent manner in Examples 1-1 to 1-3 and Comparative Example 1, and that the FLG expression increasing activity of Examples 1-1 to 1-3 was superior to that of Comparative Example 1. In particular, when treated at a concentration of 10%, it was confirmed that Example 1-1 increased by 31.59%, Example 1-2 increased by 32.89%, Example 1-3 increased by 35.35%, and Comparative Example 1 increased by 15.29% compared to the untreated group.
[0174]
[0175] <Experimental Example 10> Atopic dermatitis improvement: TARC production inhibition test
[0176] In order to confirm the atopic improvement effect of Examples 1-1 to 1-3 and Comparative Example 1, a test to confirm the production amount of TARC (Thymus and Activation-regulated Chemokine) was conducted using HaCaT cells, which are human keratinocytes.
[0177] HaCaT was seeded at 1×10 per well in a 24-well plate. 5After dividing into the number of cells, the cells were cultured for 24 hours in an incubator with 37℃ and 5% carbon dioxide environment to attach. Examples 1-1 to 1-3 and Comparative Example 1 were diluted and prepared by concentration in serum-free DMEM medium containing 10 ng / ml concentration of inflammatory factors TNF-α and INF-γ. As a positive control group, TGF-β (Transforming Growth Factor-β) was diluted to a concentration of 10 ng / ml, and then the culture medium of the cultured cells was removed. The diluted Examples 1-1 to 1-3 and Comparative Example 1 and the positive control group were treated and cultured for 24 hours in an incubator with 37℃ and 5% carbon dioxide environment. The culture medium after culture was completed was recovered and the amount of TARC produced was measured. At this time, to measure the amount of TARC produced, ELISA analysis was performed according to the protocol of the ELISA kit (Biolegend, 441104). The amount of TARC produced was converted into a percentage using the standard curve of TARC obtained through ELISA analysis.
[0178]
[0179] As a result, as shown in Fig. 16, it was confirmed that the amount of TARC produced was reduced by Examples 1-1 to 1-3 and Comparative Example 1, and it was confirmed that the TARC production reduction activity of Examples 1-1 to 1-3 was superior to that of Comparative Example 1. In particular, when treated at a concentration of 10%, Example 1-1 showed a TARC production reduction effect of 21.21%, Example 1-2 showed a TARC production reduction effect of 21.68%, Example 1-3 showed a TARC production reduction effect of 23.62%, and Comparative Example 1 showed a TARC production reduction effect of 11.82%.
[0180]
[0181] <Experimental Example 11> Skin soothing and improvement effect test: Measurement of VEGF mRNA expression level
[0182] In order to confirm the skin soothing improvement effect of Examples 1-1 to 1-3 and Comparative Example 1, the mRNA expression level of vascular endothelial growth factor (VEGF) was measured using human keratinocyte HaCaT cells.
[0183] Human keratinocyte HaCaT cells were seeded at 1 × 10 per well in a 24-well plate. 5 After dividing the cells into equal numbers, they were cultured in an incubator at 37°C and 5% carbon dioxide for 24 hours to attach the cells. Afterwards, for skin stimulation conditions, UVA was applied at 0.5 J / cm 2 The concentrations were investigated. Then, Examples 1-1 to 1-3 and Comparative Example 1, diluted to an appropriate concentration in serum-free medium, were treated and reacted for 24 hours. Afterwards, RNA was extracted according to the protocol of the NucleoSpin RNA kit from Macherey-Nagel. Total RNA was quantified at 260 nm using Nanodrop, and cDNA was synthesized in an amplifier using an appropriate amount of RNA. The synthesized cDNA was subjected to real-time polymerase chain reaction in a real-time PCR machine using a mixture containing target gene-specific primers and cyanine dye CyberGreen (SYBR Green supermix), thereby finally evaluating the expression level of the target gene. The primer sequences and reaction conditions of the target genes are shown in Table 5 below, and the expression level of the gene was finally analyzed through correction for the β-actin gene.
[0184] Sequence number Gene sequence Reaction conditions 13 VEGF Forward 5' - CATCCAATCGAGACCCTGGT - 3' After polymerase activation at 95°C for 10 minutes, polymerization reaction was performed for 35 cycles under the conditions of denaturation at 95°C for 15 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds. 14 Reverse 5' - ATCTCTCCTATGTGCTGGCC - 3' 15 β-actin Forward 5' - CATGAAGTGTGACGTGGACA - 3' 16 Reverse 5' - CAGGGCAGTGATCTCCTTCT - 3'
[0185]
[0186] As a result, as shown in Fig. 17, it was confirmed that the mRNA expression level of VEGF was decreased in a concentration-dependent manner in Examples 1-1 to 1-3 and Comparative Example 1, and it was confirmed that the mRNA expression reduction activity of VEGF in Examples 1-1 to 1-3 was superior to that in Comparative Example 1. In particular, when treated at a concentration of 10%, it was confirmed that Example 1-1 decreased by 34.62%, Example 1-2 decreased by 31.16%, Example 1-3 decreased by 37.44%, and Comparative Example 1 decreased by 12.36% compared to the untreated group.
[0187]
[0188] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.
[0189]
[0190] The camellia callus-derived exosomes provided by the present invention have excellent anti-inflammatory, antioxidant, whitening, anti-wrinkle, moisturizing, wound healing, skin barrier improvement, atopic dermatitis improvement, and skin soothing effects, and therefore can be usefully applied to cosmetics for anti-inflammatory, antioxidant, whitening, anti-wrinkle, moisturizing, skin barrier improvement, atopic dermatitis improvement, and skin soothing, or pharmaceutical compositions for anti-inflammation, atopic dermatitis improvement, wound healing, and wound healing promotion.
Claims
1. A cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement and skin soothing, containing camellia callus-derived exosomes as an effective ingredient.
2. In the first paragraph, the camellia callus-derived exosome is characterized in that it is separated and purified from callus derived from camellia or a culture solution of callus, and is a cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement, and skin soothing.
3. In the second paragraph, the callus is characterized in that it is derived from any one part selected from the group consisting of flowers, leaves, stems, roots, seeds, and fruits of camellia japonica, and is a cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement, and skin soothing.
4. A cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement and skin soothing, characterized in that in the first paragraph, the exosome is separated from at least one selected from the group consisting of callus-derived exosome, callus fragment and callus extract.
5. A cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement and skin soothing, characterized in that the exosomes in the first paragraph are extracellular vesicles having an average diameter of 50 to 200 nm.
6. In the first paragraph, the composition is characterized in that it is any one selected from the group consisting of shampoo, soap, rinse, surfactant-containing cleansing, skin, toner, cream, lotion, emulsion, serum, essence, suspension, emulsion, ointment, tonic, treatment, conditioner, paste, gel, oil, wax, spray, aerosol, mist, and powder. A cosmetic composition for anti-inflammation, anti-oxidation, whitening, anti-wrinkle, moisturizing, skin regeneration, skin barrier improvement, atopic dermatitis improvement, and skin soothing.
7. A pharmaceutical composition for anti-inflammation, atopic dermatitis improvement, wound healing and wound healing promotion, containing camellia callus-derived exosomes as an active ingredient.
8. A pharmaceutical composition for anti-inflammation, atopic dermatitis improvement, wound healing and wound healing promotion, characterized in that the composition in claim 7 is administered or treated by injection, microneedling, iontophoresis, application or a combination thereof.
9. A pharmaceutical composition for anti-inflammation, atopic dermatitis improvement, wound healing and wound healing promotion, characterized in that the composition in paragraph 7 is any one selected from the group consisting of a liquid formulation, a patch formulation, an injection formulation, an infusion formulation and a spray formulation.
Citation Information
Patent Citations
Cage for use in ball bearing assembly and ball bearing assembly including same
KR1020240166132A
composition for improving skin condition comprising exosome derived from Malus domestica fruit callus
KR102461314B1
Apparatus for modulating all-optical based on two-color excited-state absorption and operating method thereof
KR102736153B1
Composition for skin improvement comprising green tea plant cell-derived exosomes as an active ingredient
KR102248258B1
New composition comprising exosomes derived from Edelweiss as an active ingredient
KR102296494B1