Method for screening for strain producing itaconic acid with high yield using itaconic acid auxotrophic system and use thereof

Abstract

The present invention relates to: a method for screening for a strain producing itaconic acid with high yield, using an itaconic acid auxotrophic system; and use thereof. The method for screening for a strain producing itaconic acid with high yield, according to an embodiment of the present invention, and a strain producing itaconic acid with high yield screened by the method, have improved itaconic acid productivity compared to wild-type strains, and thus can be used in various ways in enzyme engineering and industrial fields, such as synthetic resins, latexes, and food additives, in which itaconic acid is used.

Description

Screening method for high-producing itaconic acid strains using itaconic acid auxotrophic system and use thereof

[0001] The present invention relates to a screening method for a high-producing itaconic acid strain using an itaconic acid nutrient requirement system and its use.

[0002] Itaconic acid is a five-carbon dicarboxylic acid. Its structural properties make it an industrially useful precursor for the synthesis of polymers such as plastics and latex. Due to this potential, it was selected as one of the Top 12 bio-based platform chemicals by the United States Department of Energy in 2004.

[0003] Biological production of itaconic acid can be achieved using Aspergillus terreus, a strain that naturally produces itaconic acid. However, the fermentation process is complex and expensive due to the strain's specific characteristics. Furthermore, Aspergillus terreus is difficult to genetically modify, and its byproduct production is difficult to control, leading to high purification costs.

[0004] Research is underway to develop recombinant strains for efficient itaconic acid production. Initially, attempts have been made to produce itaconic acid using microorganisms, such as Escherichia coli, for which strain characteristics and genetic engineering methods are well-known. Representatively, itaconic acid production in E. coli was confirmed through heterologous expression of cis-aconitate decarboxylase (CAD) from Aspergillus terreus. However, the enzyme activity is significantly lower than that of Aspergillus terreus, making it uneconomical. Furthermore, the recombinant E. coli strains for itaconic acid production prefer glucose, making it relatively expensive compared to other carbon sources, making it uneconomical.

[0005] In order to solve the above problems, the inventors of the present invention introduced a pathway that decomposes itaconic acid present in Pseudomonas aeruginosa and converts it into pyruvate and acetyl-CoA, based on the characteristic that gluconeogenesis is possible only through intermediates obtained after passing through the TCA cycle when acetic acid is used as a carbon source. As a result, an itaconic acid auxotrophic system was constructed in which gluconeogenesis occurs only through the decomposition of itaconic acid produced by the strain itself, not through the TCA cycle, and a method for screening a high itaconic acid-producing strain was developed using this, thereby completing the present invention.

[0006] Accordingly, the purpose of the present invention is to provide a screening method for a high-producing itaconic acid strain using an itaconic acid nutrient requirement system.

[0007] Another object of the present invention is to provide a high-producing itaconic acid strain selected by the screening method for the high-producing itaconic acid strain.

[0008] Another object of the present invention is to provide a method for producing itaconic acid using an itaconic acid high-producing strain selected by the screening method for the itaconic acid high-producing strain.

[0009] The terminology used herein is for the purpose of description only and should not be construed as limiting. The singular expression includes the plural expression unless the context clearly indicates otherwise. In this specification, the terms "comprises" or "has" and the like are intended to specify the presence of a feature, number, step, operation, component, part, or combination thereof described in the specification, but should be understood to not preclude the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.

[0010] Additionally, unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiments pertain. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and shall not be interpreted in an idealized or overly formal sense unless explicitly defined herein.

[0011] In the present invention, duplicate content or terms have been omitted to avoid excessive complexity of this specification.

[0012]

[0013] In order to achieve the above object, according to one aspect of the present invention, a method for screening a high-producing itaconic acid strain is provided, comprising the following steps:

[0014] (a) a step of deleting a gene encoding a gluconeogenic enzyme in a wild type strain;

[0015] (b) a step of producing an itaconic acid nutrient-requiring strain by introducing a gene encoding an enzyme involved in the itaconic acid degradation pathway; and

[0016] (c) A step of introducing a genetic mutation into the itaconic acid nutrient-requiring strain manufactured in the above step (b), and then comparing the growth rate with that of the itaconic acid nutrient-requiring strain to which the genetic mutation has not been introduced.

[0017] In one embodiment of the present invention, the gene encoding the gluconeogenic enzyme of step (a) may be at least one selected from the group consisting of the maeA (malic enzyme A) gene represented by the base sequence of SEQ ID NO: 1, the maeB (malic enzyme B) gene represented by the base sequence of SEQ ID NO: 2, and the pckA (phosphoenolpyruvate carboxykinase) gene represented by the base sequence of SEQ ID NO: 3.

[0018] The above maeA is the NAD+-dependent malate dehydrogenase (malic enzyme A) gene. NAD+-dependent malate dehydrogenase is an enzyme that converts malate into pyruvate and carbon dioxide while reducing NAD+ to NADH. The NADH reduced through this process serves as an energy source in gluconeogenesis, providing the reducing power essential for the subsequent reaction that converts pyruvate to phosphoenolpyruvate (PEP).

[0019] The above maeB is a NADP+-dependent malate dehydrogenase (malic enzyme B) gene. NADP+-dependent malate dehydrogenase refers to an enzyme that reduces NADP+ to NADPH in the reaction that converts malate into pyruvate and carbon dioxide. The NADPH reduced through this process is also mainly involved in maintaining intracellular reducing power, similar to NADH.

[0020] The above pckA gene is a phosphoenolpyruvate carboxykinase gene, which is an enzyme that converts oxaloacetate into phosphoenolpyruvate. This enzyme is mainly found in gluconeogenesis and plays a key role in maintaining blood sugar levels through glucose synthesis in energy-deficient states. pckA switches the intracellular carbon flow toward gluconeogenesis and plays an essential role in maintaining blood sugar levels in the liver in energy-deficient states.

[0021] In addition, in one embodiment of the present invention, the gene encoding the enzyme involved in the itaconic acid degradation pathway of step (b) may be a gene derived from Pseudomonas aeruginosa, and more specifically, may be at least one selected from the group consisting of the ict (itaconate CoA transferase) gene represented by the base sequence of SEQ ID NO: 4, the ich (itaconyl-CoA hydratase) gene represented by the base sequence of SEQ ID NO: 5, and the ccl (citramalyl-CoA lyase) gene represented by the base sequence of SEQ ID NO: 6.

[0022] The above ict is the itaconate-CoA transferase gene. Itaconate-CoA transferase is the first enzyme to act in the itaconic acid degradation pathway, combining itaconic acid and CoA to form itaconyl-CoA. This process activates itaconic acid, making it available for subsequent metabolic reactions, thereby enabling efficient use of carbon in energy metabolism.

[0023] The above ich is the itaconyl-CoA hydratase gene, and itaconyl-CoA hydratase is an enzyme that converts itaconyl-CoA, produced by the action of ict, into (S)-citramalyl-CoA through a hydration reaction. This process adjusts the carbon skeleton of itaconic acid to a form suitable for the next metabolic step, so that it can be used as a substrate for subsequent reactions.

[0024] The above ccl is the (S)-citramalyl-CoA lyase gene. (S)-citramalyl-CoA lyase acts in the final step of the itaconic acid degradation pathway, and is an enzyme that catalyzes the reaction that breaks down (S)-citramalyl-CoA into acetyl-CoA and pyruvate. This process allows cells to efficiently utilize carbon in energy metabolism by providing metabolites that can be directly used for energy production or biosynthesis.

[0025]

[0026] According to another aspect of the present invention, a high-producing itaconic acid strain selected by the screening method for the high-producing itaconic acid strain is provided.

[0027] The above itaconic acid high-producing strain shows a clear difference in growth rate when an itaconic acid nutrient requirement system is introduced compared to an itaconic acid nutrient requirement strain to which no genetic mutation has been introduced, and thus it can be confirmed that it is a high itaconic acid producing strain.

[0028]

[0029] According to another aspect of the present invention, a method for producing itaconic acid is provided, comprising the step of culturing an itaconic acid high-producing strain selected by the screening method for the itaconic acid high-producing strain.

[0030] The medium and other culture conditions used for culturing the microorganism of the present invention may be any medium commonly used for culturing Escherichia microorganisms, but must adequately satisfy the requirements of the strain of the present invention. Preferably, the strain of the present invention is cultured under aerobic conditions in a conventional medium containing appropriate carbon sources, nitrogen sources, amino acids, vitamins, etc., while controlling temperature, pH, etc.

[0031] In a preferred embodiment of the present invention, the medium may include acetic acid as a carbon source. Inorganic compounds such as sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate may be used, and amino acids, vitamins, and appropriate precursors may also be included. These media or precursors may be added to the culture in batch or continuous mode.

[0032] During cultivation, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture. Furthermore, foaming can be suppressed during cultivation using antifoaming agents such as fatty acid polyglycol esters. Furthermore, to maintain aerobic conditions in the culture, oxygen or oxygen-containing gas can be injected into the culture. To maintain both anaerobic and aerobic conditions, nitrogen, hydrogen, or carbon dioxide can be injected without gas injection.

[0033] The temperature of the culture medium can be usually set to 27°C to 37°C, preferably 30°C to 35°C. The culture period can continue until the desired amount of useful substance is produced, and preferably, the culture can be performed for 10 to 100 hours.

[0034] The itaconic acid produced in the above culturing step of the present invention may include a step of further purifying or recovering itaconic acid, and a method of recovering itaconic acid from a strain or culture may be a method known in the art, such as centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC, but is not limited to these examples.

[0035] The above recovery step may include a purification process, and a person skilled in the art may select and utilize one of several known purification processes as needed.

[0036] A method for screening a high-producing strain of itaconic acid according to one embodiment of the present invention and a high-producing strain of itaconic acid selected thereby have improved itaconic acid productivity compared to a wild-type strain, and thus can be utilized in various industrial fields such as enzyme engineering and synthetic resins, latex, and food additives in which itaconic acid is utilized.

[0037] Figure 1 is a schematic diagram showing the manufacturing process of an itaconic acid nutrient requirement system according to one embodiment of the present invention.

[0038] Figure 2 is a diagram showing the results of verifying the designed itaconic acid nutrient requirement system by adding itaconic acid at a concentration of 0.5 to 2 g / L and measuring the absorbance at 600 nm to confirm the optical density.

[0039] Figure 3 is a diagram showing the results of selecting a high-producing itaconic acid strain through an itaconic acid nutrient requirement system among several strains that have introduced various mutations.

[0040] Hereinafter, the present invention will be described in more detail through examples. The following examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0041]

[0042] Before writing the examples, the genes of sequence numbers 1 to 6 of the present invention are shown in Table 1 below.

[0043] 서열번호설명염기서열1maeA 유전자tgacggacaagatgccgaacctgctacctttccagaccaaactggtgcagaagcgcgaaaacctcagtgactgggataccgacagcgatgtgttgtcactgctggatgtggtgcgcaatgtaaaaccagatattctgattggcgtctcaggacagaccgggctgtttacggaagagatcattcgtgagatgcataaacactgtccgcgtccgatcgtgatgccgctgtctaacccgacgtcacgcgtggaagccacaccgcaggacattatcgcctggaccgaaggtaacgcgctggtcgccactggcagcccgtttaatccagtggtatggaaagataaaatctaccctatcgcccagtgtaacaacgcctttattttcccaggcatcgggctgggtgttattgcttccggcgcgtcacgtatcaccgatgagatgctgatgtcagcaagtgaaacgcttgctcagtattcgccgctggtgctgaacggcgaaggtctggtactaccggaactgaaagatattcagaaagtctcccgcgcaattgcgtttgcggttggcaaaatggcgcagcagcaaggcgtggcggtgaaaacgtctgccgaagctctgcaacaggccattgatgataatttctggcaagccgaataccgcgactaccgccgtacctccatctaa2maeB 유전자ccgtatgccggacagccctttgaaaggttctgccaatattctggtgatgccgaacatggaagctgcccgcattagttacaacttactgcgcgtttccagctcggaaggtgtgactgtcggtccggtgctgatgggcgtggcgaaaccggttcacgtgttaacgccgatcgcatcggtgcgtcgtatcgtcaacatggtggcgctggccgtggttgaagcgcaaacccaaccgctgtaa3pckA유전자tcgataacattgttaagccggtttccaaagcgggccacgcgactaaggttatcttcctgactgctgatgctttcggcgtgttgccgccggtttctcgcctgactgccgatcaaacccagtatcacttcctctctggcttcaccgccaaactggccggtactgagcgtggcatcaccgaaccgacgccaaccttctccgcttgcttcggcgcggcattcctgtcgctgcacccgactcagtacgcagaagtgctggtgaaacgtatgcaggcggcgggcgcgcaggcttatctggttaacactggctggaacggcactggcaaacgtatctcgattaaagatacccgcgccattatcgacgccatcctcaacggttcgctggataatgcagaaaccttcactctgccgatgtttaacctggcgatcccaaccgaactgccgggcgtagacacgaagattctcgatccgcgtaacacctacgcttctccggaacagtggcaggaaaaagccgaaaccctggcgaaactgtttatcgacaacttcgataaatacaccgacacccctgcgggtgccgcgctggtagcggctggtccgaaactgtaa4ict 유전자ggacctccatcgacagcccggccgggcgcctgccggcgttgttgccgccggccagcagcagcgccttcgttccgcgcatggatgcggtgccggcgctgggcggcgacagcgacgcgctgcttgccgaactgggctgtaccgcggccgatatccagcgcctgcgcgcgaccggaacggtatga5ich유전자atgagtgagtccgctttcgccccctggatcggtcgccaggaagaaacccacgatcaattgagccgcaacctggtcaagcgcatcgccgccaccttcggcgagccgaccccggcccacggcgaagcgctgccgccgctctggcactgggcgttcttccaggacccggtggaggccgccggcctcggcgtcgacggccacccggcgcgcggcggtttcctgccgccggcggacgatcgcaaccgcatgtgggccggcgggcgcctggagttccaccagccgctgcgggtcggcggcgaggccagccgcacctcgaccatcctccgggtcgaggagaagcacggtcgcagcggcgcgctgctgttcgtcaccctgcgccacgactaccgccaggacggccaactggcgctgagcgaagagcacgacatcgtctaccgcgaaccgaccccgcccaagctcggcggtaccgaggccttgcccgagggcgactggcgcgaggcgctggagcccgatccggtgttgctgttccgctactcggcggtgactttcaacggccaccgcattcactacgactgcaccgatgccgaaggctatccgggcctggtggtgcacggtccgctgatcgccaccctggccctgcgcgcgttctgccgggccaatccgcaggcgcgcctgcgtcgcttcgcctatcgcggcctgcgcccgctgatctgtcccgagccgttcgaggtcggcggccgcctgctcgctgccggcaaggccgaggtatgggtcggcaatggcgccggcctggcccagcgcggcgacgtggaattcgactga6ccl유전자atgaaccgacagatcgtgcgcagcgcgctgttcgtcccggcgacccgcccggagcggatccccaaggcccttgccagcggcgccgaccgggtcatcgtcgacctcgaggatgcggtggaggaggggctgaaggtcgaggcgcgggccaatctccggcgtttcctcgtcgatacgccggaagcccgggtgctggtgcggatcaacgcggcggagcatcccgggcatgccgacgacctggcgctgtgccgcgaccacgccggagtgatcggcctgctcctgccgaaagtggagagcgccgcccaggtgcgccacgccgccgtggccagcggcaagccggtctggcccatcgtcgagagtgcccgcggccttgccgcgctgggcgagatcgccgccgccgcgggggtcgagcggctgtccttcggcagcctcgacctggccctggacctcgatctcaacagcggcagcaacgcagccgaacagattctcggtcacgcccgttacgcactgctcctgcaaacgcgcctggcaggcctggcgccgccgctggacggcgtctatccggcgatccagaaccgtgccggactggtcgaggcagtgcgcttcgctcgcgacatgggcttcggcgggttgctgtgcatccatccgagccaggtcgagccgatccaccagacattgatgccgagtcccgcggaactggagtgggcgcgtcgggtggcagaggccggcgcctccggtgccggcgtcttcgtggtcgacggcgagatggtcgacgcgccggtgctggggcgcgcgcgacgcctgctggagcgggccggggagggtggctga

[0044]

[0045] 실시예 1. 이타콘산 영양요구 시스템의 구축

[0046] Based on the premise that gluconeogenesis is possible only through the supply of PEP and pyruvate obtained through the TCA cycle when acetic acid is selected as the sole carbon source, an itaconic acid auxotrophic system was created.

[0047] First, maeA (NAD+-dependent malate dehydrogenase gene, SEQ ID NO: 1), maeB (NADP+-dependent malate dehydrogenase gene, SEQ ID NO: 2), and pckA (phosphoenolpyruvate carboxykinase gene, SEQ ID NO: 3), which are involved in gluconeogenesis using malate and oxaloacetate, were deleted from the wild-type strain.

[0048] More specifically, the three genes were commonly deleted using lambda red recombination. First, a gene fragment with homology to the 50 base pairs at both ends of the coding sequence of the corresponding gene and containing the kanamycin resistance gene in the middle was amplified using PCR. The amplified sequence was purified using an appropriate method and introduced into the Mach strain by electroporation. Colonies were obtained through a recovery process. Among the obtained colonies, colony PCR was used to amplify primers that can bind near the target gene, and the deletion of each gene was confirmed by comparing the band size through electrophoresis. Using this method, maeA, maeB, and pck were sequentially deleted to construct the MABC strain.

[0049] Afterwards, by overexpressing ict (itaconate-CoA transferase gene, sequence number 4), ich (itaconyl-CoA hydratase, sequence number 5), and ccl ((S)-citramaleyl-CoA lyase gene, sequence number 6) involved in the itaconic acid degradation pathway derived from Pseudomonas aeruginosa in MABC, an itaconic acid auxotrophic system was created in which gluconeogenesis occurs only by pyruvate and acetyl-CoA produced by the itaconic acid degradation pathway.

[0050] More specifically, after extracting the genome of P. aeruginosa, PCR was performed with primers designed to bind near ict, ich, and ccl, and to include the J23108 promoter sequence at the 5' end and the b1001 terminator at the 3' end of the gene, respectively, to obtain the amplified fragment of each gene. After purification using an appropriate method, Gibson assembly was performed so that the three genes could be assembled after template removal and purification using the Dpn1 enzyme. After introducing the assembly mixture into the Mach strain, plasmids were extracted from the obtained colonies, the sequences were confirmed, and the successfully assembled plasmids were introduced into the MABC strain to construct an itaconic acid auxotrophic system. A schematic diagram of the construction of the itaconic acid auxotrophic system constructed in this way is shown in Fig. 1.

[0051]

[0052] Example 2. Validation of the Itaconic Acid Nutritional Requirement System

[0053] To verify the constructed itaconic acid nutrient requirement system, itaconic acid was added at a concentration of 0.5 to 2 g / L and the absorbance at 600 nm (OD 600 ) was measured to confirm the optical density, and the results are shown in Fig. 2.

[0054] As shown in Figure 2, as the amount of itaconic acid added increases, the OD 600 We confirmed that the values ​​increased significantly. In other words, we were able to confirm that the constructed itaconic acid nutrient requirement system provides growth benefits proportional to the amount of itaconic acid in the medium. This suggests that strains that produce high levels of itaconic acid may exhibit even faster growth rates.

[0055]

[0056] Example 3. Selection of high-producing itaconic acid strains using an itaconic acid nutrient requirement system.

[0057] In order to confirm whether the itaconic acid auxotrophic system constructed in Example 1 can effectively select a high itaconic acid producing strain in vivo, the MABC wild type strain and the strains in which various mCad variants (199m, 105, MC) with different itaconic acid titers were introduced into the MABC strain were mixed in equal ratios and then OD 600 An enrichment test was conducted by enriching fresh medium every time this became 1, and the results are shown in Figure 3.

[0058] As shown in Figure 3, it was confirmed that the 199m mutant with the highest itaconic acid titer occupied most of the population in the final round.

[0059]

[0060] While specific aspects of the present invention have been described in detail, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0061] The method for screening a high-producing strain of itaconic acid according to one embodiment of the present invention and the high-producing strain of itaconic acid selected through the method have improved itaconic acid productivity compared to a wild-type strain, and thus can be utilized in various industrial fields such as enzyme engineering and synthetic resins, latex, and food additives in which itaconic acid is utilized, and thus have industrial applicability.

Claims

1. (a) A step of deleting a gene encoding a gluconeogenic enzyme in a wild-type strain; (b) a step of producing an itaconic acid nutrient strain by introducing a gene encoding an enzyme involved in the itaconic acid degradation pathway; and (c) a step of introducing a genetic mutation into the itaconic acid auxotrophic strain manufactured in the step (b) and then comparing the growth rate with that of an itaconic acid auxotrophic strain to which the genetic mutation has not been introduced; a screening method for an itaconic acid high-producing strain, comprising:

2. In paragraph 1, A method for screening an itaconic acid high-producing strain, wherein the gene encoding the gluconeogenic enzyme of the step (a) is at least one selected from the group consisting of a maeA (malic enzyme A) gene represented by the base sequence of sequence number 1, a maeB (malic enzyme B) gene represented by the base sequence of sequence number 2, and a pckA (phosphoenolpyruvate carboxykinase) gene represented by the base sequence of sequence number 3.

3. In paragraph 1, A method for screening an itaconic acid high-producing strain, wherein a gene encoding an enzyme involved in the itaconic acid decomposition pathway of the above step (b) is a gene derived from Pseudomonas aeruginosa.

4. In paragraph 1, A method for screening an itaconic acid high-producing strain, wherein the gene encoding an enzyme involved in the itaconic acid degradation pathway of the step (b) is at least one selected from the group consisting of an ict (itaconate CoA transferase) gene represented by the base sequence of SEQ ID NO: 4, an ich (itaconyl-CoA hydratase) gene represented by the base sequence of SEQ ID NO: 5, and a ccl (citramalyl-CoA lyase) gene represented by the base sequence of SEQ ID NO:

6.

5. A high-producing itaconic acid strain selected by the screening method of clauses 1 to 4.

6. A method for producing itaconic acid, comprising: a step of culturing an itaconic acid-producing strain of clause 5.

Images