Selective inhibitors of t cell activation

SITAs target XPO1 at Cys528 to treat T cell-mediated disorders by minimizing nuclear export disruption, addressing the limitations of broad XPO1 inhibition in existing treatments and reducing side effects.

WO2025145182A1PCT designated stage expired Publication Date: 2025-07-03CASE WESTERN RESERVE UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/062318
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-06
Filing Date
2024-12-30
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Existing treatments for T cell-mediated disorders and dysregulated T-cell activation, such as autoimmune diseases, often cause significant cell death and disruption of essential cellular functions due to broad inhibition of exportin-1 (XPO1) activities, including nuclear export, centrosome, and centromere functions.

Method used

Development of Selective Inhibitors of Transcription Activation (SITAs) that target XPO1 at Cys528, minimizing impact on nuclear export and cellular functions while disrupting chromatin localization, thereby treating T cell-mediated disorders with reduced side effects.

Benefits of technology

SITAs effectively suppress IL-2 production and transcriptional activity of AP-1 and NFAT, providing therapeutic benefits for autoimmune disorders with minimal impact on cell viability and normal cellular functions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024062318_03072025_PF_FP_ABST
    Figure US2024062318_03072025_PF_FP_ABST
Patent Text Reader

Abstract

A compound as described in formula (I), (II), (III), (IV), (V), (VI), (VII), and (VIII) for use as a selective inhibitor of transcription activation (SITA).
Need to check novelty before this filing date? Find Prior Art

Description

SELECTIVE INHIBITORS OF T CELL ACTIVATIONRELATED APPLICATION

[0001] This application claims priority from U.S. Provisional ApplicationNos. 63 / 615,884, filed December 29, 2023, 63 / 627,975 filed February 1, 2024, and 63 / 668,179, filed July 6, 2024, the subject matter of which are incorporated herein by reference in their entirety.GOVERNMENT FUNDING

[0002] This invention was made with government support under AI171104 awarded by the National Institutes of Health. The government has certain rights in the invention.SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on December 24, 2024, is named CWR-032898WO-ORD.st.26 and is 7,342 bytes in size.BACKGROUND

[0004] Exportin- 1 (XPO1 / CRM1) recognizes a leucine-rich ‘Nuclear Export Sequence’ to traffic hundreds of protein cargoes from the nucleus to the cytoplasm. The naturally occurring small molecule Leptomycin B, which covalently targets XPO1 at Cys528 to occlude binding of Nuclear Export Sequences, established that blocking XPOl’s nuclear export function broadly induced cell death. Subsequent efforts led to Selinexor, the first “Selective Inhibitor of Nuclear Export” to win FDA approval as a cancer chemotherapy.While XPOl ’s role in nuclear export has been widely studied, this protein also plays a role in chromosomal structure, centrosome duplication, and centromere assembly. XPO1 can also be aberrantly recruited to chromatin in cancer cells due to oncogenic chromosomal translocations involving known XPO1 cargoes.SUMMARY

[0005] Embodiments described herein relate to compounds and methods of treating a T cell mediated disorder or a disorder associated with dysregulated T-cell activation in a subject in need thereof. We identified XPO1 as the target by which many small molecules inhibit T cell activation and established a class of XPO1 modulators, herein termed Selective Inhibitorsof Transcriptional Activation (SITAs), that show distinct properties from established Selective Inhibitors of Nuclear Export (SINEs). Like SINEs, SITAs target XPO1 at Cys528 and disrupt XPOl’s chromatin localization; however, SITAs demonstrate minimal impact on XPO1 -mediated nuclear export, centrosome and centromere functions, and cell death. SITAs are often significantly lower in molecular weight than SINEs and likely occupy a substantially smaller portion of the XPO1 NES-binding groove. As a result, SITAs may not fully disrupt some of XPO1 ’s protein-protein interactions, particularly those of particularly high affinity or whose productive interactions with XPO1 include contacts beyond the NES- binding groove. Overall, SITAs extend the existing diversity among XPO1 C528-targeting small molecules, which includes SINEs as well as molecules that induce rapid proteasomal degradation of XPO1 to enable therapeutic targeting of XPO1 beyond oncology to include treatment of T cell-driven autoimmune disorders.

[0006] Accordingly, in some embodiments, a method of treating a T cell mediated disorder or a disorder associated with dysregulated T-cell activation in a subject in need thereof includes administering to the subject a therapeutically effective amount of at least one exportin-1 (XPO1) modulator that is a selective inhibitor of transcription activation (SITA). The SITA can target XPO1 at Cys528 and disrupt XPO1 ’s chromatin localization with minimal impact on XPO1 -mediated nuclear export, centrosome and centromere functions, and cell death.

[0007] Other embodiments relate to a compound of formula (I) and particularly to its use as a SITA. The compound of formula (I) can have the structure: or a pharmaceutically acceptable salt, tautomer, or solvatethereof, wherein:A isX1and X5are each independently C(H) or N;X2, X3, and X4are each independently C(R10) or N;R1is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R2is absent, oxo, -OH, or alkoxy;R3is H, alkyl, or haloalkyl;R4is absent, alkyl, haloalkyl, or alkynyl, preferably, if X1is C(H) and R5is absent;R5is absent, alkyl, alkynyl, halogen, or haloalkyl;R6is absent, alkynyl, halogen, -N(R11)2, alkyl, haloalkyl, -alkynylene- alkylene-alkoxy, cycloalkyl optionally substituted with one or more R12, heterocyclyl optionally substituted with one or more R12, aryl optionally substituted with one or more R12, or heteroaryl optionally substituted with one or more R12;R7is absent, halogen, haloalkyl, N(Rn)2, cycloalkyl optionally substituted with one or more R12, heterocyclyl optionally substituted with one or more R12, aryl optionally substituted with one or more R12, heteroaryl optionally substituted with one or more R12;R8is absent, haloalkyl or cycloalkyl optionally substituted with one or more R12;R9is absent or halogen, cycloalkyl optionally substituted with one or more R12; each R10is H, halogen, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more R12; each R11is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R11together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing anadditional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl each of which is optionally substituted with one or more R12; each R12is halogen, alkyl, or alkoxy; andR13is absent, halogen, alkyl, haloalkyl, or alkynyl.

[0008] In some embodiments, R1is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R2is oxo.

[0009] In some embodiments, R1is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R2is oxo.

[0010] In some embodiments, R1is absent and R2is absent or C1-C6alkoxy.

[0011] In some embodiments, R1is absent and R2is absent or methoxy.

[0012] In some embodiments, R3is H or C1-C6alkyl.

[0013] In some embodiments, R3is H or methyl.

[0014] In some embodiments, R4is absent, C1-C6alkyl, C1-C6haloalkyl, or C1-C6alkynyl if X1is C(H) and R5is absent;

[0015] In some embodiments, R4is absent, ethynyl, or -CF3.

[0016] In some embodiments, R5is absent, C1-C6alkyl, C1-C6alkynyl, halogen, or Ci-Ce haloalkyl.

[0017] In some embodiments, R5is absent, ethynyl, F, or -CF3.

[0018] In some embodiments, R6is absent, C1-C6alkynyl, halogen, -N(R11)2, C1-C6alkyl, C1-C6haloalkyl, -alkynylene-alkylene-alkoxy, 3- to 7-membered ring cycloalkyl optionally substituted with one or more R12, 4- to 8-membered, mono- or bi-heterocyclyl optionally substituted with one or more R12, 6- to 10-membered aryl optionally substituted with one or more R12, or 5- to 8-membered heteroaryl optionally substituted with one or more R12.

[0019] In some embodiments, R6is -N(H)CI-C6 alkyl, -alkynylene-alkylene-alkoxy, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, or piperidinyl each of which is optionally substituted with one or more R12.

[0020] In some embodiments, R6is Cl or F, or -N(H)CH3, cyclopropyl, cyclobutyl, cyclopentyl, -alkynylene-alkylene-alkoxyeach of which is optionally substituted with one or more R12.

[0021] In some embodiments, R7is a halogen or C1-C3 haloalkyl, -N(H)alkyl, -N(Ci- Ce alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), thiophenyl, pyrrolidinyl, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, phenyl, or piperidinyl each of which is optionally substituted with one or more R12.

[0022] In some embodiments, R7is a Cl, F, or -CF3, or -N(H) C1-C6alkyl,-N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, phenyl, each of which is optionally substituted with one or more R12.

[0023] In some embodiments, R8is absent, C1-C6haloalkyl or C3-C8 cycloalkyl optionally substituted with one or more R12.

[0024] In some embodiments, R9is absent or halogen, C3-C8 cycloalkyl optionally substituted with one or more R12.

[0025] Other embodiments relate to a compound of formula (II) and particularly to its use as a SITA. The compound of formula (II) can have the structure of:or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:X1is C(H) or N;R1is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R2is absent, oxo, -OH, or alkoxy;R3is H, alkyl, or haloalkyl;R4is absent, alkyl, haloalkyl, or alkynyl if X1is C(H) and R5is absent;R5is absent, alkyl, alkynyl, halogen, or haloalkyl;R6is absent, alkynyl, halogen, -N(R11)2, alkyl, haloalkyl, -alkynylene-alkylene-alkoxy, cycloalkyl optionally substituted with one or more R12, heterocyclyl optionally substituted with one or more R12, aryl optionally substituted with one or more R12, or heteroaryl optionally substituted with one or more R12; each R11is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R11together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl each of which is optionally substituted with one or more R12; and each R12is halogen, alkyl, or alkoxy.

[0026] In some embodiments, R1is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R2is oxo.

[0027] In some embodiments, R1is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R2is oxo.

[0028] In some embodiments, R1is absent and R2is absent or C1-C6alkoxy.

[0029] In some embodiments, R1is absent and R2is absent or methoxy.

[0030] In some embodiments, R3is H or C1-C6alkyl.

[0031] In some embodiments, R3is H or methyl.

[0032] In some embodiments, R4is absent, C1-C6alkyl, C1-C6haloalkyl, or C1-C6alkynyl if X1is C(H) and Rsis absent;

[0033] In some embodiments, R4is absent, ethynyl, or -CF3.

[0034] In some embodiments, R5is absent, C1-C6alkyl, C1-C6alkynyl, halogen, or Ci-Ce haloalkyl.

[0035] In some embodiments, R5is absent, ethynyl, F, or -CF3.

[0036] In some embodiments, R6is absent, Ci-Csalkynyl, halogen, -N(R11)2, Ci-Cc, alkyl, C1-C6haloalkyl, -alkynylene-alkylene-alkoxy, 3- to 7-membered ring cycloalkyl optionally substituted with one or more R12, 4- to 8-membered, mono- or bi-heterocyclyl optionally substituted with one or more R12, 6- to 10-membered aryl optionally substituted with one or more R12, or 5- to 8-membered heteroaryl optionally substituted with one or more R12.

[0037] In some embodiments, R6is -N(H)CI-C6 alkyl, -alkynylene-alkylene-alkoxy, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, or piperidinyl each of which is optionally substituted with one or more R12.

[0038] In some embodiments, R6is Cl or F, or -N(H)CH3, cyclopropyl, cyclobutyl,each of which is optionally substituted with one or more R12.

[0039] In some embodiments, R1is C1-C6alkyl, Ci-G, haloalkyl, or C3-C7 cycloalkyl, R2is oxo, R3is H or C1-C6alkyl, R4is absent, R5is C1-C6alkyl, C1-C6alkynyl, halogen, or C1-C6haloalkyl, and R6is Cl or F, or -N(H)CH3, cyclopropyl, cyclobutyl, cyclopentyl, -each of which is optionally substituted with one or more R12.

[0040] In other embodiments, R1is C1-C6alkyl, C1-C6haloalkyl, or C3-C7 cycloalkyl,R2is oxo, R3is H or methyl, R4is absent, R5is C1-C6haloalkyl, and R6is -N(H)CH3, cyclopropyl, cyclobutyl, cyclopentyl, -alkynylene-alkylene-alkoxyeach ofwhich is optionally substituted with one or more R12.

[0041] Other embodiments relate to a compound of formula (III) and particularly to its use as a SITA. The compound of formula (III) can have the structure of:or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:R1is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R2is absent, oxo, -OH, or alkoxy;R3is H, alkyl, or haloalkyl;R7is absent, halogen, haloalkyl, N(Rn)2, cycloalkyl optionally substituted with one or more R12, heterocyclyl optionally substituted with one or more R12, aryl optionally substituted with one or more R12, heteroaryl optionally substituted with one or more R12; each R11is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R11together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl each of which is optionally substituted with one or more R12; each R12is halogen, alkyl, or alkoxy; andR13is absent, halogen, alkyl, haloalkyl, or alkynyl.

[0042] In some embodiments, R1is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R2is oxo.

[0043] In some embodiments, R1is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R2is oxo.

[0044] In some embodiments, R1is absent and R2is absent or C1-C6alkoxy.

[0045] In some embodiments, R1is absent and R2is absent or methoxy.

[0046] In some embodiments, R3is H or C1-C6alkyl.

[0047] In some embodiments, R3is H or methyl.

[0048] In some embodiments, R7is a halogen or C1-C3 haloalkyl, -N(H)alkyl, -N(Ci-Cc alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), thiophenyl, pyrrolidinyl, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, phenyl, or piperidinyl each of which is optionally substituted with one or more R12.

[0049] In some embodiments, R7is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(C1-C6alkyl)-3- to 6- membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, pheny, each of which is optionally substituted with one or moreR .

[0050] In some embodiments, R1is C1-C6alkyl, C1-C6haloalkyl, or C3-C7 cycloalkyl, R2is oxo, R3is H or C1-C6alkyl, R7is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(CI-C6alkyl)-3- to 6- membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, phenyl,, each of which is optionally substituted with one or moreR12, and R13is absent.

[0051] Other embodiments relate to a compound of formula (IV) and particularly to its use as a SITA. The compound of formula (IV) can have the structure of:( ) or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:X2, X3, and X4are each independently C(R10) or N;R1is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R2is absent, oxo, -OH, or alkoxy;R3is H, alkyl, or haloalkyl;R8is absent, haloalkyl or cycloalkyl optionally substituted with one or more R12;R9is absent or halogen, cycloalkyl optionally substituted with one or more R12; each R10is H, halogen, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more R12; each R11is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R11together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl each of which is optionally substituted with one or more R12; and each R12is halogen, alkyl, or alkoxy.

[0052] In some embodiments, R1is C1-C6alkyl, Ci-Cs haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R2is oxo.

[0053] In some embodiments, R1is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R2is oxo.

[0054] In some embodiments, R1is absent and R2is absent or C1-C6alkoxy.

[0055] In some embodiments, R1is absent and R2is absent or methoxy.

[0056] In some embodiments, R3is H or C1-C6alkyl.

[0057] In some embodiments, R3is H or methyl.

[0058] In some embodiments, R8is absent, C1-C6haloalkyl or C3-C8cycloalkyl optionally substituted with one or more R12.

[0059] In some embodiments, R9is absent or halogen, C3-C8cycloalkyl optionally substituted with one or more R12.

[0060] In some embodiments, R1is C i -C<> alkyl, Ci-Q, haloalkyl, or C3-C7 cycloalkyl, R2is oxo, R3is H or methyl, R8is C1-C6haloalkyl or C3-C8 cycloalkyl optionally substituted with one or more R12, R9is absent or Cr-Cs cycloalkyl optionally substituted with one or more R12, and each R10is absent, H, halogen, haloalkyl, or cycloalkyl optionally substituted with one or more R12.

[0061] Other embodiments relate to a compound of formula (V) and particularly to its use as a S1TA. The compound of formula (V) can have the structure: or a pharmaceutically acceptable salt, tautomer, orsolvate thereof, wherein:A1isa dashed line (e.g., — or -) is an optional bond;X5, X6, Xs, X9and X10are each independently C(H) or N;X7is C, C(H), N;X11, X12, X13, and X14are each independently C, C(H), N, or N(H);R14is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R15is absent, oxo, -OH, or alkoxy;R16is H, alkyl, or haloalkyl;R17is absent, alkyl, haloalkyl, or halogen;R18is absent, haloalkyl, or alkynyl;R19is absent, alkyl, alkynyl, halogen, or haloalkyl;R20is absent, alkynyl, halogen, alkyl, haloalkyl, -N(R27)2, -alkynylene- alkylene-alkoxy, cycloalkyl optionally substituted with one or more R28, heterocyclyl optionally substituted with one or more R28, aryl optionally substituted with one or more R28, or heteroaryl optionally substituted with one or more R28;R21is absent, alkoxy, halogen, haloalkyl, N(R27)2, cycloalkyl optionally substituted with one or more R28, heterocyclyl optionally substituted with one or more R28, aryl optionally substituted with one or more R28, heteroaryl optionally substituted with one or more R28;R22is absent, H, halogen, haloalkyl, or cycloalkyl optionally substituted with one or more R28;R23is absent, H, halogen, alkoxy, -alkylene-alkyl, or alkynyl;R24is absent or cycloalkyl optionally substituted with one or more R28;R25is absent, H, or halogen;R26is absent, haloalkyl, cycloalkyl optionally substituted with one or more R28, or heteroaryl optionally substituted with one or more R28; each R27is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R27together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl each of which is optionally substituted with one or more R28; andR28is halogen, alkyl, or alkoxy.

[0062] In some embodiments, R14is Ci-Cc, alkyl, Ci-Cs haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R15is oxo.

[0063] In some embodiments, R14is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R15is oxo.

[0064] In some embodiments, R14is absent and R15is absent, -OH, or C1-C6alkoxy.

[0065] In some embodiments, R14is absent and R15is absent, -OH, or methoxy.

[0066] In some embodiments, R16is H or Ci-Cs alkyl.

[0067] In some embodiments, R16is H or methyl.

[0068] In some embodiments, R17is absent, C1-C6alkyl, C1-C6haloalkyl, or halogen.

[0069] In some embodiments, R18is absent, C1-C6 haloalkyl, or C1-C6 alkynyl.

[0070] In some embodiments, R19is absent, C1-C6alkyl, C1-C6alkynyl, halogen, or Ci-Ce haloalkyl.

[0071] In some embodiments, R20is absent, C1-C6alkynyl, halogen, C1-C6alkyl, C1-C6haloalkyl, -N(R27)2, -alkynylene-alkylene-alkoxy, 3- to 7-membered ring cycloalkyl optionally substituted with one or more R28, 4- to 8-membered, mono- or bi-heterocyclyl optionally substituted with one or more R28, 6- to 10-membered aryl optionally substituted with one or more R28, or 5- to 8-membered heteroaryl optionally substituted with one or more R28.

[0072] In some embodiments, R20is -N(H)Ci-Cs alkyl, -alkynylene-alkylene-alkoxy, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, or piperidinyl each of which is optionally substituted with one or more R28.

[0073] In some embodiments, R20is Cl or F, or -N(H)CHs, cyclopropyl, cyclobutyl, cyclopentyl, -alkynylene-alkylene-alkoxy, each of which is optionally substituted withone or more R28.

[0074] In some embodiments, R21is a halogen or alkoxy, C1-C3 haloalkyl, -N(H)alkyl, -N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), thiophenyl, pyrrolidinyl, azetidinyl, spirocyclic azetidinyl,pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, phenyl, or piperidinyl each of which is optionally substituted with one or more R28.

[0075] In some embodiments, R21is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(CI-C6 alkyl)-3- to 6- membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, phenyl,, each of which is optionally substituted with one or moreR28.

[0076] In some embodiments, R22is absent, H, halogen, C1-C6haloalkyl, C1-C6cycloalkyl optionally substituted with one or more R28.

[0077] Ins some embodiments, R23is absent, H, halogen, C1-C6alkoxy, -C1-C6alkylene-C1-C6alkyl, or Ci-G, alkynyl.

[0078] In some embodiments, R24is absent or C1-C6cycloalkyl optionally substituted with one or more R28.

[0079] In some embodiments, R25is absent, H, or halogen.

[0080] In some embodiments, R26is absent, haloalkyl, C1-C6cycloalkyl optionally substituted with one or more R28, or C1-C6heteroaryl optionally substituted with one or more R28.

[0081] Other embodiments relate to a compound of formula (VI) and particularly to its use as a SITA. The compound of formula (VI) can have the structure of:or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:X5and X6are each independently C(H) or N;X7is C, C(H), N;R14is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R1Sis absent, oxo, -OH, or alkoxy;R16is H, alkyl, or haloalkyl;R17is absent, alkyl, haloalkyl, or halogen;R18is absent, haloalkyl, or alkynyl;R19is absent, alkyl, alkynyl, halogen, or haloalkyl;R20is absent, alkynyl, halogen, alkyl, haloalkyl, -N(R27)2, -alkynylene- alkylene-alkoxy, cycloalkyl optionally substituted with one or more R28, heterocyclyl optionally substituted with one or more R28, aryl optionally substituted with one or more R28, or heteroaryl optionally substituted with one or more R28; each R27is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R27together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl each of which is optionally substituted with one or more R28; andR28is halogen, alkyl, or alkoxy.

[0082] In some embodiments, R14is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R15is oxo.

[0083] In some embodiments, R14is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R15is oxo.

[0084] In some embodiments, R14is absent and R15is absent, -OH, or C1-C6alkoxy.

[0085] In some embodiments, R14is absent and R15is absent, -OH, or methoxy.

[0086] In some embodiments, R16is H or C1-C6alkyl.

[0087] In some embodiments, R16is H or methyl.

[0088] In some embodiments, R17is absent, C1-C6alkyl, C1-C6haloalkyl, or halogen.

[0089] In some embodiments, R18is absent, C1-C6haloalkyl, or C1-C6alkynyl.

[0090] In some embodiments, R19is absent, C1-C6alkyl, C1-C6alkynyl, halogen, or Ci-Ce haloalkyl.

[0091] In some embodiments, R20is absent, C1-C6, alkynyl, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -N(R27)2, -alkynylene-alkylene-alkoxy, 3- to 7-membered ring cycloalkyl optionally substituted with one or more R28, 4- to 8-membered, mono- or bi-heterocyclyl optionally substituted with one or more R28, 6- to 10-membered aryl optionally substituted with one or more R28, or 5- to 8-membered heteroaryl optionally substituted with one or more R28.

[0092] In some embodiments, R20is -N(H)Ci-G, alkyl, -alkynylene-alkylene-alkoxy, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, or piperidinyl each of which is optionally substituted with one or more R28.

[0093] In some embodiments, R20is Cl or F, or -N(H)CH3, cyclopropyl, cyclobutyl,each of which is optionally substituted with one or more R28.

[0094] Other embodiments relate to a compound of formula (VII) and particularly to its use as a SITA. The compound of formula (VII) can have the structure of:or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:X8, X9and X10are each independently C(H) or N;R14is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R15is absent, oxo, -OH, or alkoxy;R16is H, alkyl, or haloalkyl;R21is absent, alkoxy, halogen, haloalkyl, N(R27)2, cycloalkyl optionally substituted with one or more R28, heterocyclyl optionally substituted with one or more R28, aryl optionally substituted with one or more R28, heteroaryl optionally substituted with one or more R28; each R27is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R27together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl each of which is optionally substituted with one or more R28; andR28is halogen, alkyl, or alkoxy.

[0095] In some embodiments, R14is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R15is oxo.

[0096] In some embodiments, R14is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R15is oxo.

[0097] In some embodiments, R14is absent and R15is absent, -OH, or C1-C6alkoxy.

[0098] In some embodiments, R14is absent and R1Sis absent, -OH, or methoxy.

[0099] In some embodiments, R16is H or C1-C6alkyl.

[0100] In some embodiments, R16is H or methyl.

[0101] In some embodiments, R21is a halogen or alkoxy, C1-C3 haloalkyl, -N(H)alkyl, -N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), thiophenyl, pyrrolidinyl, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, phenyl, or piperidinyl each of which is optionally substituted with one or more R28.

[0102] In some embodiments, R21is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(CI-C6 alkyl)-3- to 6- membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, phenyl,each of which is optionally substituted with one or moreR28.

[0103] Other embodiments relate to a compound of formula (VIII) and particularly to its use as a SITA. The compound of formula (VIII) can have the structure of:) or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein: a dashed line (e.g., — or -) is an optional bond;X5is C(H) or N;X11, X12, X13, and X14are each independently C, C(H), N, or N(H);R14is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R15is absent, oxo, -OH, or alkoxy;R16is H, alkyl, or haloalkyl;R22is absent, H, halogen, haloalkyl, or cycloalkyl optionally substituted with one or more R28;R23is absent, H, halogen, alkoxy, -alkylene-alkyl, or alkynyl;R24is absent or cycloalkyl optionally substituted with one or more R28;R25is absent, H, or halogen;R26is absent, haloalkyl, cycloalkyl optionally substituted with one or more R28, or heteroaryl optionally substituted with one or more R28; each R27is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R27together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing anadditional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl each is optionally substituted with one or more R28; andR28is halogen, alkyl, or alkoxy.

[0104] In some embodiments, R14is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R1Sis oxo.

[0105] In some embodiments, R14is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R15is oxo.

[0106] In some embodiments, R14is absent and R15is absent, -OH, or C1-C6alkoxy.

[0107] In some embodiments, R14is absent and R1Sis absent, -OH, or methoxy.

[0108] In some embodiments, R22is absent, H, halogen, C1-C6 haloalkyl, C1-C6cycloalkyl optionally substituted with one or more R28.

[0109] Ins some embodiments, R23is absent, H, halogen, C1-C6alkoxy, -C1-C6alkylene-C1-C6alkyl, or Ci-G, alkynyl.

[0110] In some embodiments, R24is absent or C1-C6cycloalkyl optionally substituted with one or more R28.

[0111] In some embodiments, R25is absent, H, or halogen.

[0112] In some embodiments, R26is absent, haloalkyl, C1-C6cycloalkyl optionally substituted with one or more R28, or C1-C6heteroaryl optionally substituted with one or more R28.

[0113] Other embodiments relate to a pharmaceutical composition comprising a compound, pharmaceutically acceptable salt, tautomer, or solvate thereof as described herein.

[0114] In some embodiments, the composition can be used in treating a T cell mediated disorder or a disorder associated with dysregulated T-cell activation in a subject in need thereof

[0115] In some embodiments, the compound is an exportin- 1 (XPO1) modulator that is a selective inhibitor of transcription activation (SIT A).

[0116] In some embodiments, the SITA targets XPO1 at Cys528 and disrupts XPOl ’s chromatin localization with minimal impact on XPO1 -mediated nuclear export, centrosome and centromere functions, and cell death.

[0117] In other embodiments, the SITA suppresses IL2 production and transcriptional activity of AP- 1 and NFAT.

[0118] In some embodiments, the T cell mediated disorder or the disorder associated with dysregulated T-cell activation is an autoimmune disorder, and the SITA can be administered to the subject at an amount effective to treat the autoimmune disorder

[0119] In some embodiments, the SITA can be administered to the subject to treat at least one of achlorhydra autoimmune active chronic hepatitis, acute disseminated encephalomyelitis, acute hemorrhagic leukoencephalitis, Addison’s disease, agammaglobulinemia, alopecia areata, Alzheimer’s disease, amyotrophic lateral sclerosis, ankylosing spondylitis, anti-gbm / tbm nephritis, antiphospholipid syndrome, antisynthetase syndrome, aplastic anemia, arthritis, atopic allergy, atopic dermatitis, autoimmune cardiomyopathy, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome, autoimmune peripheral neuropathy, autoimmune polyendocrine syndrome, autoimmune progesterone dermatitis, autoimmune thrombocytopenia purpura, autoimmune uveitis, balo disease / balo concentric sclerosis, bechets syndrome, Berger's disease, Bickerstaff’s encephalitis, blau syndrome, bullous pemphigoid, castleman's disease, chagas disease, chronic fatigue immune dysfunction syndrome, chronic inflammatory demyelinating polyneuropathy, chronic lyme disease, chronic obstructive pulmonary disease, churg-strauss syndrome, cicatricial pemphigoid, coeliac disease, cogan syndrome, cold agglutinin disease, cranial arteritis, crest syndrome, Crohns disease, Cushing's syndrome, Dego's disease, Dercum's disease, dermatitis herpetiformis, dermatomyositis, diabetes mellitus type 1, Dressier's syndrome, discoid lupus erythematosus, eczema, endometriosis, enthesitis-related arthritis, eosinophilic fasciitis, epidermolysis bullosa acquisita, essential mixed cryoglobulinemia, evan’s syndrome, fibrodysplasia ossificans progressive, fibromyalgia, fibromyositis, fibrosing aveolitis, gastritis, gastrointestinal pemphigoid, giant cell arteritis, glomerulonephritis, Goodpasture's syndrome, graft-versus-host disease (GVHD), Graves’ disease, Guillain-barre syndrome (gbs), Hashimoto’s encephalitis, Hashimoto’s thyroiditis, henoch-schonlein purpura, hidradenitis suppurativa, Hughes syndrome, inflammatory bowel disease (IBD), idiopathic inflammatory demyelinating diseases, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura, iga nephropathy, inflammatory demyelinating polyneuopathy, interstitial cystitis, irritable bowel syndrome (ibs), Kawasaki's disease, lichen planus, Lou Gehrig’s disease, lupoid hepatitis, lupus erythematosus, meniere's disease, microscopic polyangiitis, mixed connective tissue disease, morphea, multiple myeloma, multiple sclerosis,myasthenia gravis, myositis, narcolepsy, neuromyelitis optica, neuromyotonia, occular cicatricial pemphigoid, opsoclonus myoclonus syndrome, ord thyroiditis, Parkinson’s disease, pars planitis, pemphigus, pemphigus vulgaris, pernicious anaemia, polymyalgia rheumatic, polymyositis, primary biliary cirrhosis, primary sclerosing cholangitis, progressive inflammatory neuropathy, psoriasis, psoriatic arthritis, raynaud phenomenon, relapsing polychondritis, Reiter’s syndrome, rheumatoid arthritis, rheumatoid fever, sarcoidosis, schizophrenia, Schmidt syndrome, Schnitzler syndrome, scleritis, scleroderma, Sjogren's syndrome, spondyloarthropathy, sticky blood syndrome, still's disease, stiff person syndrome, sydenham chorea, sweet syndrome, takayasu’s arteritis, temporal arteritis, transplant rejection, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease, undifferentiated spondyloarthropathy, vasculitis, vitiligo, Wegener's granulomatosis, Wilson’s syndrome, Wiskott-Aldrich syndrome, hypersensitivity reactions of the skin, atherosclerosis, ischemia-reperfusion injury, myocardial infarction, or restenosis.

[0120] Still other embodiments, relate to a composition for use in treating graft-versus- host disease or transplant rejection in a subject in need thereof. The composition can include at least one exportin- 1 (XPO1) modulator that is a selective inhibitor of transcription activation (SITA), wherein the SITA targets XPO1 at Cys528 and disrupts XPOl ’s chromatin localization with minimal impact on XPO 1 -mediated nuclear export, centrosome and centromere functions, and cell death.

[0121] In some embodiments, the SITA suppresses IL2 production and transcriptional activity of AP- 1 and NF AT.

[0122] In some embodiments, the SITA can include a compound as described herein.BRIEF DESCRIPTION OF THE DRAWINGS

[0123] Figs. l(A-G) illustrate SP100030 and SPC-839 are potent inhibitors of T cell activation. A) Transcriptional activity of AP-1 and NF AT luciferase reporter constructs in Jurkat T-ALL cells activated with PMA / Ionomycin and treated with SP100030 (top) and SPC-839 (bottom). SP100030, n = 12 wells (3 independent experiments), SPC-839, n = 8 wells (2 independent experiments). Red asterisks indicate electrophilic site for covalent addition. B) IL2 expression assayed using RT-qPCR (SP100030, n = 12 wells from 3 independent experiments; SPC-839, n = 8 wells from 2 independent experiments), ELISA (SP 100030, n = 8 wells, 2 experiments; SPC-839, n = 8 wells, 2 experiments), and aluciferase reporter driven by the IL-2 promoter (SP100030, n = 12 wells, 3 experiments; SPC-839, n = 8 wells, 2 experiments) in Jurkat cells activated with PMA / Iono and treated with SP100030 (top) and SPC-839 (bottom). C) Gene expression (TPM) of IL3 and CSF2 following RNA sequencing of Jurkat cells treated as indicated (n = 3 biological replicates). D) Genes upregulated at least 10-fold in Jurkat cells upon treatment with PMA / Iono by RNA- sequencing are broadly downregulated by SP100030 treatment. Heatmap represents foldchange versus the PMA / Iono-activated condition, with three independent samples averaged for each condition. Five example genes that were suppressed and five example genes that were not suppressed by SP100030 are provided. E) IL2 expression assayed using RT-qPCR (SP 100030, n = 8 wells, 2 experiments; SPC-839, n = 8 wells, 2 experiments) in Jurkat cells activated with anti-CD3 / anti-CD28 and treated with SP100030 and SPC-839. F) IL2 and CSF2 expression assayed using RT-qPCR in primary mouse splenocytes activated with anti- CD3 / anti-CD28 and treated with SP100030 and SPC-839 (SP 100030, n = 8 wells, 2 experiments; SPC-839, n = 8 wells, 2 experiments). G) Human primary PBMCs were activated with anti-CD3 / anti-CD28 antibodies and treated with SP100030 and SPC-839 prior to measurement of IL2 mRNA via RT-qPCR (SP100030, n = 12 wells, 3 experiments; SPC- 839, n = 12 wells, 3 experiments). All assays were performed 6h after stimulation.

[0124] Figs. 2(A-N) illustrate targeting XPO1 at C528 suppresses T cell activation phenotypes. A,B) IL2 expression assayed using RT-qPCR (n = 2 independent experiments) and a luciferase reporter driven by the IL2 promoter (n = 3 independent experiments) in Jurkat cells activated with PMA / Iono and treated with SP-Alkyne (A) or SPC-Alkyne (B). Red asterisks indicate electrophilic site for covalent addition. C) In-gel fluorescence detection of proteins covalently labeled following treatment with the indicated concentrations of SP-Alkyne or SPC-Alkyne (representative of 2 independent experiments). D) Chemoproteomics analyses of lysates treated with SP-Alkyne or SPC-Alkyne. Each dot represents a protein detected following treatment with both SP-Alkyne and SPC-Alkyne, and percent reduction refers to the extent of signal loss when excess SP 100030 or SPC-839 was added prior to treatment with SP-Alkyne or SPC-Alkyne, respectively. XPO1 was the only target protein whose interactions with SP-Alkyne and SPC-Alkyne could be fully suppressed by SP100030 and SPC-839. E) In-gel fluorescence detection of recombinant human XPO1 with 1 μM SP-Alkyne and SPC-Alkyne with and without 10 μM Selinexor co-treatment. F) IL2 expression assayed using RT-qPCR following siRNA knockdown of XPO1 (n = 2independent experiments) with associated Western blot (representative of 2 independent experiments). G-I) IL2 expression assayed using RT-qPCR (Selinexor and SI 09, n = 2 independent experiments; Leptomycin, n = 4 wells) and a luciferase reporter driven by the IL-2 promoter (Leptomycin, n = 4 wells; S109, n = 3 independent experiments; Selinexor, n = 2 independent experiments) in Jurkat cells activated with PMA / Ionomycin and treated with Selinexor (g), Leptomycin B (h), or SI 09 (i). Asterisks indicate electrophilic site for covalent addition. J) Scatter plot of RNA-Seq transcriptional changes induced by Selinexor (1 μM) compared to the transcriptional changes induced by SP100030 (1 μM). K) In-gel fluorescence labeling of XPO 1 in Jurkat cells expressing wild type XPO 1 and Jurkat cells with homozygous expression of XPO1 C528S using SP-Alkyne (1 μM), SPC-Alkyne (300 nM), and Sel-Alkyne (1 μM). L) Transcriptional activity of an AP-1 luciferase reporter construct in XPO1 C528S Jurkat cells activated with PMA / Iono and treated with SP100030 (orange) or SPC-839 (blue) (n = 2 independent experiments, with at least 4 wells per concentration per experiment). Compare potencies with those shown in Fig. 1 A. M,N) IL2 expression assayed using RT-qPCR (SP100030, n=2; SPC-839, n = 2) in wild-type (gray bars) or XPO1 C528S (blue bars) Jurkat cells activated with PMA / Iono and treated with the indicated concentrations of SP100030 (left) and SPC-839 (right).

[0125] Figs. 3(A-F) illustrate SINEs and SITAs have divergent functional effects on XPO1 and cell viability. A,B) IL2-Luciferase activity (Bright-Glo) and cell viability (CellTiter-Glo) following treatment with the indicated concentrations of the SINEs Selinexor and Leptomycin B (A) or the SITAs SP100030, SPC-839, CW0134, and CW2158 (b) for 6h (IL2) or 24 h (cell viability) in Jurkat cells (Selinexor, n = 3 [IL2], 3 [cell viability]; Leptomycin, n = 1,2; SP100030, n = 3,3; SPC-839, n = 3,3; CW0134, n = 2,3; CW2158, n = 3,2) Red asterisks indicate electrophilic site for covalent addition. C,D) Subcellular localization reported as the % nuclear export inhibition (DMSO = 0%, 3 nM Leptomycin B = 100%) using immunofluorescence detection of RANBP1 (C) or IKBCX (D) following treatment of U-2 OS cells for 6h with the indicated concentrations of SINEs and SITAs (n = 3 independent experiments per compound per concentration). E) Representative images of immunofluorescence staining for RANBP1 in U-2 OS cells following the indicated small molecule treatments. Scale bar, 50 μm. F) Western blots for pT199 Nucleophosmin or pT3 Histone H3 following treatment for 24h with the indicated concentrations of the SINE Selinexor or SITAs SP 100030 and CW2158 with co-treatment of 1 μM nocodazole(representative of 2 independent experiments). The concentration at which each small molecule suppresses IL2 expression by 50% is marked in red (see panel 3a above Table 1).

[0126] Figs. 4(A-J) illustrate XPO1 associates with transcriptionally active genomic loci in a cell type-dependent manner. A,B) Western blots for FOS, JUN, NFAT1, and their phosphorylated forms using nuclear lysates following treatment for 6 h with 1 μM of SP100030, Selinexor, SPC-839, or 1 nM Leptomycin B (each panel is representative of 2 independent experiments). C) Genome browser view of XPO1, XPO1-FLAG, and H3K27Ac in Jurkats and primary CD3+T cells at the IL2 upstream enhancer and promoter as assayed using CUT&RUN (representative tracks from Jurkat XPO1, n = 3; Jurkat FLAG, n = 1; Jurkat H3K27Ac, n = 2; CD3+ XPO1, n = 2; CD3+ H3K27Ac, n = 2). D) Gene ontology analysis of the most highly enriched biological processes for XPO1 peaks in primary human CD3+T cells. E) Venn diagram of XPO1 peaks identified across five different cell lines. F) Gene ontology analysis of the most enriched biological processes for XPO1 peaks obtained uniquely in Jurkat cells. G) RNA-Seq expression (TPM) of genes in Jurkat cells stratified by whether an XPO1 peak was present at each gene. H) Cumulative density function of the correlation between XPO1 peaks with H3K27Ac or H3K9Me3 peaks (black line) compared to the null density function (blue line), highlighting strong enrichment of XPO1 peaks with H3K27Ac peaks. I) Distribution of all Jurkat XPO1 peaks and Jurkat- specific XPO1 peaks binned according to distance from the transcription start site. J) Genes upregulated more than 10-fold following PMA / Iono stimulation are more likely to be bound by XPO1 (hypergeometric test p-value = 8.93xl0'5).

[0127] Figs. 5(A-J) illustrate targeted XPO1 depletion from chromatin leads to transcriptional changes at associated loci. A) Genome browser view of XPO1, FOS, and NFAT1 localization in Jurkat cells at the IL21R locus (representative tracks from XPO1, n = 3; FOS, n = 2; NF ATI, n = 2). B) Genome browser view of XPO1 and NF ATI localization in CD3+ T cells at the IL21R locus (representative tracks from XPO1, n = 2; NFAT1, n = 2). C) Genome browser view of XPO1 and NFAT1 localization in Jurkat cells with homozygous expression of XPO 1 C528S at the CRT AM locus (representative tracks from XPO 1 , n = 1 ; NFAT1, n = 1). SP100030 and Selinexor were used at 1 μM. D) Venn diagram overlap of genes that have at least one of each chromatin factor in Jurkat or in CD3+ T cells. E) Global profiles of XPO1, FOS, and NF ATI peaks with and without SP100030 treatment in Jurkat. F) Global profiles of XPO1 and NFAT1 peaks with and without SP100030 treatment inCD3+ T cells. G) Global profiles of XPO1 and NFAT1 peaks with and without SP100030 treatment in Jurkat cells with homozygous expression of XPO1 C528S. H) Genome-wide differential binding of NF ATI peaks between cells activated with PMA / Iono and those that were also treated with SP100030. I) Venn diagram overlap of genes that were suppressed by SP100030 or Selinexor on RNA-Seq (log2FC < -1 ; p-adj. < 0.05) with NFAT1 -responsive genes that were upregulated by PMA / Iono on RNA-Seq (log2FC > 1 ; p-adj. < 0.05). Enrichment was calculated as the percentage of genes suppressed by SP100030 or Selinexor that were NFAT1 -responsive divided by the percentage of NFAT1 -responsive genes across the genome. J) Expression (TPM) of all NFAT1 -responsive genes from panel (i) that were upregulated by PMA / Iono treatment (log2FC > 1) under activated conditions, SP100030 treatment, or Selinexor treatment.

[0128] Figs. 6(A-F) illustrate SP100030 suppresses T cell-driven immunological disease with less toxicity. A) Labeling of XPO 1 in the lungs by alkynyl probes following five daily IP injections (n = 2 mice per condition). B) RT-qPCR of cytokines in the spleen of BALB / c mice collected on day 7 following stem cell transplantation and daily IP injections of 10 mg / kg SP100030 across two independent experiments (Naive, n = 10; Vehicle, n = 10; SP100030, n = 11). C) Quantification of CD4+ and CD8+ T cells in the bone marrow with representative flow cytometry plots (Naive, n = 10; Vehicle, n = 10; SP100030, n = 11). D) Representative liver immunohistochemistry staining of CD3+ cells at 500 μm and 200 μm with quantification. E) Complete blood count measurements of total leukocytes, neutrophils, and platelets in mice treated with vehicle, Selinexor, or SP 100030 (n - 5 per group). F) Serum chemistry measurement of alkaline phosphatase and alanine transaminase in mice treated with vehicle, Selinexor, or SP100030 (n = 5 per group; n = 4 for SP100030 group in ALT measurement).

[0129] Figs. 7(A-D) illustrate A) Transcriptional activity of an NF-KB luciferase reporter construct in Jurkat T cells activated with PMA / Ionomycin and treated with SP100030 and SPC-839 (SP100030, n=3 independent experiments, SPC-839, n=2 independent experiments, with at least 4 wells per concentration per experiment). B) Gene expression (TPM) of XCL2 and TNF following RNA sequencing of Jurkat cells treated as indicated (n=3 biological replicates). C) Gene set enrichment analysis performed on transcripts suppressed by SP 100030 treatment identified gene sets relating to T cell activation. D) Human primary PBMCs were activated with PMA lonomycin and treated withSP100030 prior to measurement of IL2 mRNA via RT-qPCR (n = 4 wells from one experiment).

[0130] Figs. 8(A-R) illustrate the effects of SP-OH, a hydrolyzed analog of SP100030, on IL2 transcript levels (left, n = 4 wells) or the transcriptional activity of AP- 1 and NF-KB luciferase reporter constructs (right, n = 4 wells) in Jurkat cells activated with PMA / Iono. B) Evaluation of analogs of SPC-839 that retain (CW01 10) or reduce (CW01 lO-FE) the citraconimide electrophile. Analogs were evaluated for effects on IL2 transcript levels (n = 4 wells) in Jurkat cells activated with PMA / Iono. C,D) Transcriptional activity of AP-1 and NFAT luciferase reporter constructs in Jurkat cells activated with PMA / Iono and treated with SP-Alkyne (C, n = 2 independent experiments in each assay) and SPC-Alkyne (D, n = 4 wells in each assay). E) In-gel fluorescence detection of proteins covalently labeled following cellular treatment with Selinexor-Alkyne and SP100030 (10 pM) or SPC-839 (10 μM). Representative of 2 independent experiments. Arrow, 120 kDa. F) In-gel fluorescence detection of proteins covalently labeled following cellular treatment with SP-Alkyne or SPC- Alkyne (1 μM) with and without Selinexor co-treatment (10 μM). Representative of 2 independent experiments. Arrow, 120 kDa. Asterisks indicate electrophilic site for covalent addition, and red “NONE” indicates absence of electrophilic moiety. G) IL2 and XPO1 expression assayed using RT-qPCR following treatment with an independent pool of XPO1- targeting siRNA (n = 2 independent experiments). H-J) Transcriptional activity of an AP-1 luciferase reporter construct in Jurkat T-ALL cells activated with PMA / Iono and treated with Selinexor (g), Leptomycin B (h), or SI 09 (i). Effects on wild-type cells are in black, while effects on XPO1 C528S mutant cells are in red (n = 4 wells). K) Transcriptional activity of an NFAT luciferase reporter construct in Jurkat T-ALL cells activated with PMA / Iono and treated with Selinexor, Leptomycin B, or S109 (n = 4 wells). L) Volcano plot highlighting differential effects observed in RNAseq data of PMA / Iono-stimulated Jurkat cells treated with SP100030 or Selinexor. Only 4 genes are differentially expressed (logzFC > 1, p < 0.05). M) Sanger sequencing confirms heterozygous and homozygous introduction of the XPO1 C528S mutation into Jurkat cells. N) Cell viability following treatment with the indicated concentrations of Selinexor in wild-type or XPO1 C528S Jurkat cells (n=3 independent experiments). O) Fold change of IL2 mRNA following PM A lonomycin between wild type and XPO1 C528S Jurkat cells. P-R) IL2 expression assayed using RT-qPCR in wild-type Jurkat cells or XPO1 C528S Jurkat cells activated with PMA / Iono and treated with Leptomycin B (O), S109 (P), or Selinexor (Q) (n = 2 independent experiments).

[0131] Figs. 9(A-M) illustrate A) IL2-Luciferase activity (Bright-Glo) and cell viability (CellTiter-Glo) following treatment with the indicated concentrations of the SINE SI 09 in Jurkat cells (n = 3 independent experiments). B) Cell viability (CellTiter-Glo) following treatment with the indicated concentrations of the SINEs Selinexor, SI 09, and Leptomycin B in XPO1 C528S Jurkat cells (Selinexor, n = 3 independent experiments; SP100030, S109, Leptomycin B, n = 4 wells). C) IL2 expression (IL2 qPCR, left) and cell viability (CellTiter- Glo, right) following treatment with the indicated concentrations of Selinexor or SP 100030 in MOLT-4, a second T-ALL cell line (n = 4 wells). D,E) Cell viability (CellTiter-Glo) following treatment with the indicated concentrations of Selinexor and SP100030 for 72h in U-2 OS osteosarcoma cells (f) or 24 h in MM1.S multiple myeloma cells (g) (n = 4 wells). F) Western blot for XPO1 following treatment for 24 h with the following XPO1 -targeting small molecules: SP100030, Selinexor, S109, SPC-839, CW2158, CW1175, CW0134 (5 μM each, representative of 2 independent experiments) in Jurkat cells. G) Western blot for XPO1 following treatment with S109 (1 μM) and Selinexor (1 μM) for the indicated times in Jurkat cells. H) Subcellular localization reported as the % nuclear export inhibition (DMSO = 0%, 3 nM Leptomycin B = 100%) using immunofluorescence detection of IKBO. following treatment of U-2 OS cells for 6h with the indicated concentrations of SINEs and SITAs (n = 3 independent experiments per compound per concentration). I) Subcellular localization reported as the % nuclear export inhibition (DMSO - 0%, 3 nM Leptomycin B = 100%) using immunofluorescence detection of RANBP1 following treatment of HeLa cells for 6 h with the indicated concentrations of SINEs and SITAs (n = 2 independent experiments per compound per concentration). J) Representative images of immunofluorescence staining for RANBP1 in HeLa cells following the indicated small molecule treatments. Scale bar, 50 μm. K) LC / MS-MS-based analysis of protein abundance in the nucleus of Jurkat cells treated with 1 μM SP100030 for 6 h. L) Western blots for pT199 Nucleophosmin or pT3 Histone H3 following treatment for 24 h with 1 μM nocodazole and the indicated concentrations of the SINE S109 and Leptomycin B or SITAs CW0134 and SPC-839 (representative of 2 independent experiments) in Jurkat cells. The concentration at which each small molecule suppresses IL2 expression by 50% is marked in red. M) Western blot for pT199 Nucleophosmin or pT3 Histone H3 in WT Jurkat or XPO1 C528S Jurkat cells followingtreatment for 24 h with 1 μM nocodazole and the following XPO1 -targeting small molecules: SP100030 (1 μM), Selinexor (1 (1M), S109 (1 μM), Leptomycin B (1 nM).

[0132] Figs. 10(A-K) illustrate A) Western blot of phospho-ERK and phospho-p38 after 6 h treatment with 1 μM of the indicated inhibitor. B) Electrophoretic mobility shift assay of Jurkat nuclear lysates binding to a fluorescent-tagged oligonucleotide of the consensus API binding sequence. Western blot of FOS provided as a loading normalization control. C) Genome browser view of XPO1 in Jurkat cells (CUT&RUN) indicating overlap with chromatin marks H3K27Ac, H3K4Me3, CTCF (GSE68976), H3K9Me3 (GSE162605), and H3K27Me3 (GSE23080) (representative tracks from XPO1, n = 3; H3K27Ac, n = 2; H3K4Me3, n = 2; CTCF, H3K9Me3, HK27Me3, n = 1). CUT&RUN for FLAG in XPO1- FLAG Jurkat cells is also shown (n = 1). D) Gene ontology analysis of the most highly enriched biological processes for all XPO1 peaks identified in Jurkat cells. E) Genome browser view of XPO1 at the HOXB9 locus in Jurkat, CD3+T cells, and Loucy cells. F) Genome browser view at select cell-type specific loci in Jurkat (CD2S), THP-1 (TLR2), U-2 OS (MYL2), and at a shared locus (eIF4E) profiled using CUT&RUN. G) Gene ontology analysis of most highly enriched biological processes for XPO1 peaks specific to THP-1, U-2 OS, or the core set (refer to Venn diagram in Fig. 4E). H) RNA-Seq expression (obtained from the Cancer Cell Line Encyclopedia) of genes in THP-1 and U-2 OS stratified based on whether an XPO1 peak was present at each gene. I) Cumulative density function of the correlation between XPO1 peaks with H3K4Me3, CTCF, or H3K27Me3 peaks (black line) compared to the expected density function (blue line). J) Venn diagram of overlap between XPO1 and H3K27Ac peaks in Jurkat and CD3+T cells. K) XPO1 is enriched at genes that are unexpressed in basal Jurkat (TPM < 1) but strongly expressed (TPM > 10) following PMA / Iono stimulation (5% of XPOl-bound genes, 1.2% of non-XPOl -bound genes).

[0133] Figs. 1 l(A-I) illustrate A) Genome browser view of the chromatin localization of XPO1, FOS, and NFAT1 at the IL2 locus in Jurkat cells (representative tracks from XPO1, n = 3; FOS, n = 2; NFAT1, n = 2). B) Genome browser view of the chromatin localization of XPO1 and NFAT1 at the IL2 locus in primary T cells (representative tracks from XPO1, n = 2; NF ATI, n = 2). C) Genome browser view of XPO1 and NF ATI localization in Jurkat cells with homozygous expression of XPO1 C528S (representative tracks from XPO1, n - 1 ; NFAT1, n = 1). SP100030 and Selinexor were used at 1 μM. D) Global profiles of JUN, ATF2, RelA, NFAT2, and NFAT4 with and without 1 μM SP100030 treatment (n = 1 pertranscription factor). E) Cumulative density function of the correlation between XPO1 peaks with NF ATI peaks in Jurkat cells (black line) compared to the expected density (blue line). F) Gene ontology analysis of the most highly enriched biological processes associated with XPO1 peaks depleted by SP 100030 treatment in CD3+ primary T cells. G) Western blot detection of the nuclear abundance of NFAT2 and RelA / p65 6 h after treatment with 1 μM of SP100030, Selinexor, SPC-839, or 1 nM Leptomycin B. H) Venn diagram overlap of genes that were upregulated by SP100030 or Selinexor on RNA-Seq (log2FC > 1; p-adj. < 0.05) with NFAT1 -responsive genes that were suppressed by PMA / Iono on RNA-Seq (logzFC < - 1; p-adj. < 0.05). Enrichment was calculated as the percentage of genes upregulated by SP100030 or Selinexor that were NFAT1 -responsive divided by the percentage of NFAT1- responsive genes across the genome. I) Expression (TPM) of all NFAT1 -responsive genes from panel (h) that were suppressed by PMA / Iono treatment (logzFC < -1) under activated conditions, SP100030 treatment, or Selinexor treatment.

[0134] Figs. 12(A-D) A) Top transcription factor motifs enriched in XPO1 binding sites (n = 3 sets of XPO1 peaks). B) Genome browser view of XPO1, ETS-1, RUNX1, and RUNX3 localization in Jurkat cells at the CSF2 locus (representative tracks for ETS-1, n = 1; RUNX1, n = 1 ; RUNX3, n = 2). C) Global profiles of XPO1, ETS-1, RUNX1, and RUNX3 peaks with and without SP100030 treatment in Jurkat cells. SP100030 was used at 1 μM. D) Western blot for RUNX3 in the nuclear cell lysate 6 h following treatment with 1 μM of the indicated small molecules.

[0135] Figs. 13(A-E) illustrate A) RT-qPCR of cytokines associated with bleomycin- induced pulmonary fibrosis from two independent experiments (Vehicle, n = 11; 10 mg / kg SP100030, n = 1 1 ; 30 mg / kg SP100030, n = 6). B) Labeling of XPO1 in the lungs by alkynyl probes following five daily IP injections (n = 2 mice per condition). C) In-gel fluorescence of spleen and lung samples for Selinexor-treated mice followed by ex vivo treatment of cellular suspensions with respective alkynyl probes. D) RT-qPCR of cytokines in the spleen of BALB / c mice collected on day 7 following stem cell transplantation and daily IP injections (naive, n = 10; vehicle, n = 10; SP100030, n = 11). E) Quantification of CD4+ and CD8+ T cells in the spleen (Naive, n = 10; Vehicle, n = 10; SP100030, n = 11) and peripheral blood (Naive, n = 4; Vehicle, n = 5; SP100030, n = 4).

[0136] Figs. 14(A-B) illustrate A) Representative flow cytometry plots for CD4 and CD8 T cells in the spleen and peripheral blood. B) Representative flow cytometry plots depicting the gating strategy for selecting live singlet cells, lymphoid cells, T cells, and single positive CD4 or CD8 T cells.

[0137] Fig. 15 illustrates a summary of existing XPO1 -targeting SINEs and SITAs and typical cell-based assay profiles for each class.

[0138] Figs. 16(A-D) illustrate comparison of SINEs and SITAs in high-throughput bioluminescent assays. A,B) IL2 luciferase activity (6h) and cell viability (24h) in Jurkat cells treated with the indicated concentrations of SINEs Selinexor and SI 09 (n=3 independent experiments for each assay per drug). C,D) IL2 luciferase activity (6h) and cell viability (24h) in Jurkat cells treated with the indicated concentrations of SITAs SPC-839 and SP100030 (n=3 independent experiments for each assay per analog).

[0139] Figs. 17(A-E) illustrate KPT-8602 and SP 100030 analog 11 result in divergent XPO1 -dependent cellular phenotypes. A) % nuclear export inhibition of RANBP1 (0% = DMSO, 100% = 10 nM Leptomycin B) in U-2 OS cells following treatment with indicated concentrations of KPT-8602 and SITA analog 11 for 6h (n=3 independent experiments with two wells per experiment). B) Representative immunofluorescence images for RANBP1 with treatment of SINE and SITA analogs at indicated concentrations (Scale bar, 50 μm). C) Detection of XPO1 by in-gel fluorescence following treatment with Selinexor-alkyne (1 iiM) and increasing concentrations of KPT- 8602 (17) and 11 (n=2 independent experiments). D) RT-qPCR detection of IL2 expression, normalized to GAPDH, in wild-type Jurkat cells and Jurkat cells expressing XPO1C528Sactivated with PMA / Iono and treated with 300 nM KPT- 8602 (17), and 1 μM 11 (n=2 independent experiments, with four wells per experiment). E) Cell viability of wild- type Jurkat cells Jurkat cells expressing XPO1C528Sfollowing treatment with indicated concentration of KPT-8602 (17) and 11 for 24 h (n=2 experiments per analog).

[0140] Figs. 18(A-E) illustrate KPT-8602 and SPC-839 analog 22 result in divergent XPO1 -dependent cellular phenotypes. A) % nuclear export inhibition of RANBP1 (0% = DMSO, 100% = 10 nM Leptomycin B) in U-2 OS cells following treatment with indicated concentrations of KPT-8602 and SITA analog 22 for 6h (n=3 independent experiments with two wells per experiment). B) Representative immunofluorescence images for RANBP1 with treatment of SINE and SITA analogs at indicated concentrations (Scale bar, 50 μm). C) Detection of XPO1 by in-gel fluorescence following treatment with Selinexor-alkyne (1 μM)and increasing concentrations of 22 (n=2 independent experiments). D) RT-qPCR detection of IL2 expression, normalized to GAPDH, in wild-type Jurkat cells (yellow) and Jurkat cells expressing XPO1C528Sactivated with PMA / Iono and treated with 1 μM 22 (n=2 independent experiments, with four wells per experiment). E) Cell viability of wild-type Jurkat cells Jurkat cells expressing XPO1C528Sfollowing treatment with indicated concentration of 22 for 24 h (n=2 experiments per analog).

[0141] Figs. 19(A-D) illustrate Modification to the electrophile alters cellular activity. A) Western blot measurement of XPO1 degradation following the indicated treatment (1 μM each except 10 μM for 49) for 24 h. B) Western blot measurement of XPO 1 degradation upon co-treatment with the indicated small molecules (1 μM each except 10 μM for 49) with pevonedistat (50 nM) for 24 h. C) Cell viability following treatment with 45 and co-treatment with 50 nM pevonedistat (n=2 independent experiments). D) Western blot measurement of XPO 1 degradation following the indicated treatment for 24 h. Each Western blot is representative of 2 independent experiments.

[0142] Fig. 20 illustrates PK and PD of SITA leads, CW8001 (compound 27, Table 9) and CW1175 (compound 16, Table 9) supports in vivo evaluation.

[0143] Fig. 21 illustrates an initial animal model of graft versus host disease (GvHD).

[0144] Figs. 22(A-C) illustrate optimized SITAs, B-001 (compound 27, Table 9), are efficacious in an in vivo model of graft versus host disease.

[0145] Figs. 23(A-C) illustrate independent replication of CW8001 (compound 27, Table 9), CW1175 (compound 16, Table 9), and SP100030 (compound 1, Table 9).

[0146] Figs. 24(A-D) illustrate SITAs, CW8001 (compound 27, Table 9) and CW1175 (compound 16, Table 9), induce modest cytopenias relative to Selinexor.DETAILED DESCRIPTION

[0147] While the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the presently disclosed subject matter.

[0148] As used herein, the verb “comprise” as is used in this description and in the claims and its conjugations are used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. The presentinvention may suitably “comprise”, “consist of”, or “consist essentially of”, the steps, elements, and / or reagents described in the claims.

[0149] It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely", "only" and the like in connection with the recitation of claim elements, or the use of a "negative" limitation.

[0150] The term “pharmaceutically acceptable” means suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit / risk ratio, and effective for their intended use within the scope of sound medical judgment.

[0151] The term “pharmaceutically acceptable salts” include those obtained by reacting the active compound functioning as a base, with an inorganic or organic acid to form a salt, for example, salts of hydrochloric acid, sulfuric acid, phosphoric acid, methanesulfonic acid, camphorsulfonic acid, oxalic acid, maleic acid, succinic acid, citric acid, formic acid, hydrobromic acid, benzoic acid, tartaric acid, fumaric acid, salicylic acid, mandelic acid, carbonic acid, etc. Those skilled in the art will further recognize that acid addition salts may be prepared by reaction of the compounds with the appropriate inorganic or organic acid via any of a number of known methods. The term “pharmaceutically acceptable salts” also includes those obtained by reacting the active compound functioning as an acid, with an inorganic or organic base to form a salt, for example salts of ethylenediamine, N-methyl- glucamine, lysine, arginine, ornithine, choline, N,N’-dibenzylethylenediamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, diethylamine, piperazine, tris-(hydroxymethyl)-aminomethane, tetramethylammonium hydroxide, triethyl amine, dibenzylamine, ephenamine, dehydroabietylamine, N-ethylpiperidine, benzylamine, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, ethylamine, basic amino acids, and the like. Non limiting examples of inorganic or metal salts include lithium, sodium, calcium, potassium, magnesium salts and the like.

[0152] Additionally, the salts of the compounds described herein, can exist in either hydrated or unhydrated (the anhydrous) form or as solvates with other solvent molecules. Non-limiting examples of hydrates include monohydrates, dihydrates, etc. Nonlimiting examples of solvates include ethanol solvates, acetone solvates, etc.

[0153] The term "solvates" means solvent addition forms that contain either stoichiometric or non-stoichiometric amounts of solvent. Some compounds have a tendency to trap a fixed molar ratio of solvent molecules in the crystalline solid state, thus forming a solvate. If the solvent is water the solvate formed is a hydrate, when the solvent is alcohol, the solvate formed is an alcoholate. Hydrates are formed by the combination of one or more molecules of water with one of the substances in which the water retains its molecular state as H2O, such combination being able to form one or more hydrate.

[0154] The compounds and salts described herein can exist in several tautomeric forms, including the enol and imine form, and the keto and enamine form and geometric isomers and mixtures thereof. Tautomers exist as mixtures of a tautomeric set in solution. In solid form, usually one tautomer predominates. Even though one tautomer may be described, the present application includes all tautomers of the present compounds. A tautomer is one of two or more structural isomers that exist in equilibrium and are readily converted from one isomeric form to another. This reaction results in the formal migration of a hydrogen atom accompanied by a switch of adjacent conjugated double bonds. In solutions where tautomerization is possible, a chemical equilibrium of the tautomers will be reached. The exact ratio of the tautomers depends on several factors, including temperature, solvent, and pH. The concept of tautomers that are interconvertable by tautomerizations is called tautomerism.

[0155] Of the various types of tautomerism that are possible, two are commonly observed. In keto-enol tautomerism a simultaneous shift of electrons and a hydrogen atom occurs.

[0156] Tautomerizations can be catalyzed by: Base: 1. deprotonation; 2. formation of a delocalized anion (e.g., an enolate); 3. protonation at a different position of the anion; Acid: 1. protonation; 2. formation of a delocalized cation; 3. deprotonation at a different position adjacent to the cation.

[0157] The terms below, as used herein, have the following meanings, unless indicated otherwise:“Amino” refers to the -NH2 radical.“Cyano” refers to the -CN radical.“Halo” or “halogen” refers to bromo, chloro, fluoro or iodo radical. “Hydroxy” or “hydroxyl” refers to the -OH radical.“Imino” refers to the =NH substituent.“Nitro” refers to the -NO2 radical.“Oxo” refers to the =0 substituent.“Thioxo” refers to the =S substituent.

[0158] “Alkyl” or “alkyl group” refers to a fully saturated, straight or branched hydrocarbon chain radical having from one to twelve carbon atoms, and which is attached to the rest of the molecule by a single bond. Alkyls comprising any number of carbon atoms from 1 to 12 are included. An alkyl comprising up to 12 carbon atoms is a C1-C12 alkyl, an alkyl comprising up to 10 carbon atoms is a C1-C10 alkyl, an alkyl comprising up to 6 carbon atoms is a C1-C6 alkyl and an alkyl comprising up to 5 carbon atoms is a C1-C5 alkyl. A Ci- C5 alkyl includes C5 alkyls, C4 alkyls, C3 alkyls, C2 alkyls and Ci alkyl (i.e., methyl). A Ci- Ce alkyl includes all moieties described above for C1-C5 alkyls but also includes Ce alkyls. A C1-C10 alkyl includes all moieties described above for C1-C5 alkyls and C1-C6alkyls, but also includes C7, Cs, C9 and C10 alkyls. Similarly, a C1-C12 alkyl includes all the foregoing moieties, but also includes Cn and C12 alkyls. Non-limiting examples of C1-C12 alkyl include methyl, ethyl, n-propyl, i-propyl, sec-propyl, n-butyl, i-butyl, sec-butyl, t-butyl, n-pentyl, t- amyl, n-hexyl, n-heptyl, n-octyl, n-nonyl, n-decyl, n-undecyl, and n-dodecyl. Unless stated otherwise specifically in the specification, an alkyl group can be optionally substituted.

[0159] “Alkylene” or “alkylene chain” refers to a fully saturated, straight or branched divalent hydrocarbon chain radical, and having from one to twelve carbon atoms. Nonlimiting examples of C1-C12 alkylene include methylene, ethylene, propylene, n-butylene, ethenylene, propenylene, n-butenylene, propynylene, n-butynylene, and the like. The alkylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond. The points of attachment of the alkylene chain to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless stated otherwise specifically in the specification, an alkylene chain can be optionally substituted.

[0160] “Alkenyl” or “alkenyl group” refers to a straight or branched hydrocarbon chain radical having from two to twelve carbon atoms, and having one or more carbon-carbon double bonds. Each alkenyl group is attached to the rest of the molecule by a single bond. Alkenyl group comprising any number of carbon atoms from 2 to 12 are included. An alkenyl group comprising up to 12 carbon atoms is a C2-C12 alkenyl, an alkenyl comprisingup to 10 carbon atoms is a C2-C10 alkenyl, an alkenyl group comprising up to 6 carbon atoms is a C2-C6 alkenyl and an alkenyl comprising up to 5 carbon atoms is a C2-C5 alkenyl. A C2- C5 alkenyl includes C5 alkenyls, C4 alkenyls, C3 alkenyls, and C2 alkenyls. A C2-C6 alkenyl includes all moieties described above for C2-C5 alkenyls but also includes G, alkenyls. A C2- C10 alkenyl includes all moieties described above for C2-C5 alkenyls and C2-C6 alkenyls, but also includes C7, Cs, C9 and C10 alkenyls. Similarly, a C2-C12 alkenyl includes all the foregoing moieties, but also includes Ci 1 and C12 alkenyls. Non-limiting examples of C2-C12 alkenyl include ethenyl (vinyl), 1 -propenyl, 2-propenyl (allyl), iso-propenyl, 2-methyl-l- propenyl, 1-butenyl, 2-butenyl, 3-butenyl, 1 -pentenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl, 1- hexenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, 5-hexenyl, 1 -heptenyl, 2-heptenyl, 3-heptenyl, 4- heptenyl, 5-heptenyl, 6-heptenyl, 1-octenyl, 2-octenyl, 3-octenyl, 4-octenyl, 5-octenyl, 6- octenyl, 7-octenyl, 1-nonenyl, 2-nonenyl, 3-nonenyl, 4-nonenyl, 5-nonenyl, 6-nonenyl, 7- nonenyl, 8-nonenyl, 1-decenyl, 2-decenyl, 3-decenyl, 4-decenyl, 5-decenyl, 6-decenyl, 7- decenyl, 8-decenyl, 9-decenyl, 1 -undecenyl, 2-undecenyl, 3-undecenyl, 4-undecenyl, 5- undecenyl, 6-undecenyl, 7 -undecenyl, 8-undecenyl, 9-undecenyl, 10-undecenyl, 1 -dodecenyl, 2-dodecenyl, 3-dodecenyl, 4-dodecenyl, 5-dodecenyl, 6-dodecenyl, 7-dodecenyl, 8- dodecenyl, 9-dodecenyl, 10-dodecenyl, and 11 -dodecenyl. Unless stated otherwise specifically in the specification, an alkyl group can be optionally substituted.

[0161] “Alkenylene” or “alkenylene chain” refers to a straight or branched divalent hydrocarbon chain radical, having from two to twelve carbon atoms, and having one or more carbon-carbon double bonds. Non- limiting examples of C2-C12 alkenylene include ethene, propene, butene, and the like. The alkenylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond. The points of attachment of the alkenylene chain to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless stated otherwise specifically in the specification, an alkenylene chain can be optionally substituted.

[0162] “Alkynyl” or “alkynyl group” refers to a straight or branched hydrocarbon chain radical having from two to twelve carbon atoms, and having one or more carbon-carbon triple bonds. Each alkynyl group is attached to the rest of the molecule by a single bond. Alkynyl group comprising any number of carbon atoms from 2 to 12 are included. An alkynyl group comprising up to 12 carbon atoms is a C2-C12 alkynyl, an alkynyl comprising up to 10 carbon atoms is a C2-C10 alkynyl, an alkynyl group comprising up to 6 carbon atoms is a C2-C6alkynyl and an alkynyl comprising up to 5 carbon atoms is a C2-C5 alkynyl. A C2-C5 alkynyl includes C5 alkynyls, C4 alkynyls, C3 alkynyls, and C2 alkynyls. A C2-G, alkynyl includes all moieties described above for C2-C5 alkynyls but also includes Ce alkynyls. A C2-C10 alkynyl includes all moieties described above for C2-C5 alkynyls and C2-C6 alkynyls, but also includes C7, Cs, C9 and C10 alkynyls. Similarly, a C2-C12 alkynyl includes all the foregoing moieties, but also includes Cn and C12 alkynyls. Non-limiting examples of C2-C12 alkenyl include ethynyl, propynyl, butynyl, pentynyl and the like. Unless stated otherwise specifically in the specification, an alkyl group can be optionally substituted.

[0163] “Alkynylene” or “alkynylene chain” refers to a straight or branched divalent hydrocarbon chain radical, having from two to twelve carbon atoms, and having one or more carbon-carbon triple bonds. Non-limiting examples of C2-C12 alkynylene include ethynylene, propargylene and the like. The alkynylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond. The points of attachment of the alkynylene chain to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless stated otherwise specifically in the specification, an alkynylene chain can be optionally substituted.

[0164] “Alkoxy” refers to a radical of the formula -ORawhere Rais an alkyl, alkenyl or alknyl radical as defined above containing one to twelve carbon atoms. Unless stated otherwise specifically in the specification, an alkoxy group can be optionally substituted.

[0165] “Alkylamino” refers to a radical of the formula -NHRaor -NRaRawhere each Rais, independently, an alkyl, alkenyl or alkynyl radical as defined above containing one to twelve carbon atoms. Unless stated otherwise specifically in the specification, an alkylamino group can be optionally substituted.

[0166] “Alkylcarbonyl” refers to the -C(=O)Ramoiety, wherein Rais an alkyl, alkenyl or alkynyl radical as defined above. A non-limiting example of an alkyl carbonyl is the methyl carbonyl (“acetal”) moiety. Alkylcarbonyl groups can also be referred to as “Cw-Czacyl” where w and z depicts the range of the number of carbon in Ra, as defined above. For example, “C1-C10 acyl” refers to alkylcarbonyl group as defined above, where Rais C1-C10 alkyl, C2-C10 alkenyl, or C2-C10 alkynyl radical as defined above. Unless stated otherwise specifically in the specification, an alkyl carbonyl group can be optionally substituted.

[0167] “Aryl” refers to a hydrocarbon ring system radical comprising hydrogen, 6 to 18 carbon atoms and at least one aromatic ring. For purposes of this invention, the aryl radicalcan be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which can include fused or bridged ring systems. Aryl radicals include, but are not limited to, aryl radicals derived from phenyl (benzene), aceanthrylene, acenaphthylene, acephenanthrylene, anthracene, azulene, chrysene, fluoranthene, fluorene, as-indacene, .v-indacene, indane, indene, naphthalene, phenalene, phenanthrene, pleiadene, pyrene, and triphenylene. Unless stated otherwise specifically in the specification, the term “aryl” is meant to include aryl radicals that are optionally substituted.

[0168] “Aralkyl” or “arylalkyl” refers to a radical of the formula -Rt>-Rcwhere Rb is an alkylene group as defined above and Rcis one or more aryl radicals as defined above.Aralkyl radicals include, but are not limited to, benzyl, diphenylmethyl and the like. Unless stated otherwise specifically in the specification, an aralkyl group can be optionally substituted.

[0169] “Aralkenyl” or “arylalkenyl” refers to a radical of the formula -Rb-Rcwhere Rb is an alkenylene group as defined above and Rcis one or more aryl radicals as defined above. Unless stated otherwise specifically in the specification, an aralkenyl group can be optionally substituted.

[0170] “Aralkynyl” or “arylalkynyl” refers to a radical of the formula -Rb-Rcwhere Rb is an alkynylene group as defined above and Rcis one or more aryl radicals as defined above. Unless stated otherwise specifically in the specification, an aralkynyl group can be optionally substituted.

[0171] “Carbocyclyl,” “carbocyclic ring” or “carbocycle” refers to a ring structure, wherein the atoms which form the ring are each carbon. Carbocyclic rings can comprise from 3 to 20 carbon atoms in the ring. Carbocyclic rings include aryls and cycloalkyl. Cycloalkenyl and cycloalkynyl as defined herein. Unless stated otherwise specifically in the specification, a carbocyclyl group can be optionally substituted.

[0172] “Cycloalkyl” refers to a stable non-aromatic monocyclic or polycyclic fully saturated hydrocarbon radical consisting solely of carbon and hydrogen atoms, which can include fused, bridged, or spiral ring systems, having from three to twenty carbon atoms, preferably having from three to ten carbon atoms, and which is attached to the rest of the molecule by a single bond. Monocyclic cycloalkyl radicals include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic cycloalkyl radicals include, for example, adamantyl, norbornyl, decalinyl,7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like. Unless otherwise stated specifically in the specification, a cycloalkyl group can be optionally substituted.

[0173] “Cycloalkenyl” refers to a stable non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms, having one or more carbon-carbon double bonds, which can include fused, bridged, or spiral ring systems, having from three to twenty carbon atoms, preferably having from three to ten carbon atoms, and which is attached to the rest of the molecule by a single bond. Monocyclic cycloalkenyl radicals include, for example, cyclopentenyl, cyclohexenyl, cycloheptenyl, cycloctenyl, and the like. Polycyclic cycloalkenyl radicals include, for example, bicyclo[2.2.1]hept-2-enyl and the like. Unless otherwise stated specifically in the specification, a cycloalkenyl group can be optionally substituted.

[0174] “Cycloalkynyl” refers to a stable non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms, having one or more carbon-carbon triple bonds, which can include fused, bridged, or spiral ring systems, having from three to twenty carbon atoms, preferably having from three to ten carbon atoms, and which is attached to the rest of the molecule by a single bond. Monocyclic cycloalkynyl radicals include, for example, cycloheptynyl, cyclooctynyl, and the like. Unless otherwise stated specifically in the specification, a cycloalkynyl group can be optionally substituted.

[0175] “Cycloalkylalkyl” refers to a radical of the formula -Rb-Rd where Rb is an alkylene, alkenylene, or alkynylene group as defined above and Rd is a cycloalkyl, cycloalkenyl, cycloalkynyl radical as defined above. Unless stated otherwise specifically in the specification, a cycloalkylalkyl group can be optionally substituted.

[0176] “Haloalkyl” refers to an alkyl radical, as defined above, that is substituted by one or more halo radicals, as defined above, e.g., trifluoromethyl, difluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1 ,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1 ,2-dibromoethyl, and the like. Unless stated otherwise specifically in the specification, a haloalkyl group can be optionally substituted.

[0177] “Haloalkenyl” refers to an alkenyl radical, as defined above, that is substituted by one or more halo radicals, as defined above, e.g., 1 -fluoropropenyl, 1,1-difluorobutenyl, and the like. Unless stated otherwise specifically in the specification, a haloalkenyl group can be optionally substituted.

[0178] “Haloalkynyl” refers to an alkynyl radical, as defined above, that is substituted by one or more halo radicals, as defined above, e.g., 1-fluoropropynyl, 1 -fluorobutynyl, and the like. Unless stated otherwise specifically in the specification, a haloalkynyl group can be optionally substituted.

[0179] “Heterocyclyl,” “heterocyclic ring” or “heterocycle” refers to a stable 3- to 20-membered non-aromatic, partially aromatic, or aromatic ring radical which consists of two to twelve carbon atoms and from one to six heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur. Heterocyclycl or heterocyclic rings include heteroaryls as defined below. Unless stated otherwise specifically in the specification, the heterocyclyl radical can be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which can include fused, bridged, and spiral ring systems; and the nitrogen, carbon or sulfur atoms in the heterocyclyl radical can be optionally oxidized; the nitrogen atom can be optionally quaternized; and the heterocyclyl radical can be partially or fully saturated. Examples of such heterocyclyl radicals include, but are not limited to, aziridinyl, oextanyl, dioxolanyl, thienyl[l,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl,1 , 1 -dioxo-thiomorpholinyl, pyridine-one, and the like. The point of attachment of the heterocyclyl, heterocyclic ring, or heterocycle to the rest of the molecule by a single bond is through a ring member atom, which can be carbon or nitrogen. Unless stated otherwise specifically in the specification, a heterocyclyl group can be optionally substituted.

[0180] “Heterocyclylalkyl” refers to a radical of the formula -Rb-Rewhere Rb is an alkylene group as defined above and Reis a heterocyclyl radical as defined above. Unless stated otherwise specifically in the specification, a heterocyclylalkyl group can be optionally substituted.

[0181] “Heterocyclylalkenyl” refers to a radical of the formula -Rb-Rewhere Rb is an alkenylene group as defined above and Reis a heterocyclyl radical as defined above. Unless stated otherwise specifically in the specification, a heterocyclylalkenyl group can be optionally substituted.

[0182] “Heterocyclylalkynyl” refers to a radical of the formula -Rb-Rewhere Rb is an alkynylene group as defined above and Reis a heterocyclyl radical as defined above. Unless stated otherwise specifically in the specification, a heterocyclylalkynyl group can be optionally substituted.

[0183] ‘W-heterocyclyl” refers to a heterocyclyl radical as defined above containing at least one nitrogen and where the point of attachment of the heterocyclyl radical to the rest of the molecule is through a nitrogen atom in the heterocyclyl radical. Unless stated otherwise specifically in the specification, a 7V-heterocyclyl group can be optionally substituted.

[0184] “Heteroaryl” refers to a 5- to 20-membered ring system radical one to thirteen carbon atoms and one to six heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur, as the ring member. For purposes of this invention, the heteroaryl radical can be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which can include fused or bridged ring systems, wherein at least one ring containing a heteroatom ring member is aromatic. The nitrogen, carbon or sulfur atoms in the heteroaryl radical can be optionally oxidized and the nitrogen atom can be optionally quatemized. Examples include, but are not limited to, azepinyl, acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzodioxolyl, benzofuranyl, benzooxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[£][l,4]dioxepinyl, 1 ,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl (benzothiophenyl), benzotriazolyl, benzo[4,6]imidazo[l,2-a]pyridinyl, carbazolyl, cinnolinyl, dibenzofuranyl, dibenzothiophenyl, furanyl, furanonyl, isothiazolyl, imidazolyl, indazolyl, indolyl, indazolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranyl, 1-oxidopyridinyl, 1 -oxidopyrimidinyl, 1-oxidopyrazinyl, 1-oxidopyridazinyl, 1 -phenyl- 177-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrazolopyridine, quinazolinyl, quinoxalinyl, quinolinyl, quinuclidinyl, isoquinolinyl, tetrahydroquinolinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, and thiophenyl (i.e., thienyl). Unless stated otherwise specifically in the specification, a heteroaryl group can be optionally substituted.

[0185] ‘W- hetero ary I” refers to a heteroaryl radical as defined above containing at least one nitrogen and where the point of attachment of the heteroaryl radical to the rest of themolecule is through a nitrogen atom in the heteroaryl radical. Unless stated otherwise specifically in the specification, an A^-heteroaryl group can be optionally substituted.

[0186] “Heteroarylalkyl” refers to a radical of the formula -Rb-Rf where Rb is an alkylene chain as defined above and Rf is a heteroaryl radical as defined above. Unless stated otherwise specifically in the specification, a heteroarylalkyl group can be optionally substituted.

[0187] “Heteroarylalkenyl” refers to a radical of the formula -Rb-Rf where Rb is an alkenylene, chain as defined above and Rf is a heteroaryl radical as defined above. Unless stated otherwise specifically in the specification, a heteroarylalkenyl group can be optionally substituted.

[0188] “Heteroarylalkynyl” refers to a radical of the formula -Rb-Rf where Rb is an alkynylene chain as defined above and Rf is a heteroaryl radical as defined above. Unless stated otherwise specifically in the specification, a heteroarylalkynyl group can be optionally substituted.

[0189] “Thioalkyl” refers to a radical of the formula -SRawhere Rais an alkyl, alkenyl, or alkynyl radical as defined above containing one to twelve carbon atoms. Unless stated otherwise specifically in the specification, a thioalkyl group can be optionally substituted.

[0190] The term “substituted” used herein means any of the above groups (e.g., alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, alkoxy, alkylamino, alkylcarbonyl, thioalkyl, aryl, aralkyl, carbocyclyl, cycloalkyl, cycloalkenyl, cycloalkynyl, cycloalkylalkyl, haloalkyl, heterocyclyl, 2V-heterocyclyl, heterocyclylalkyl, heteroaryl, / V-heteroaryl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, etc.) wherein at least one hydrogen atom is replaced by a bond to a non-hydrogen atoms such as, but not limited to: a halogen atom such as F, Cl, Br, and I; an oxygen atom in groups such as hydroxyl groups, alkoxy groups, and ester groups; a sulfur atom in groups such as thiol groups, thioalkyl groups, sulfone groups, sulfonyl groups, and sulfoxide groups; a nitrogen atom in groups such as amines, amides, alkylamines, dialkylamines, arylamines, alkylarylamines, diarylamines, N- oxides, imides, and enamines; a silicon atom in groups such as trialkylsilyl groups, dialkylarylsilyl groups, alkyldiarylsilyl groups, and triarylsilyl groups; and other heteroatoms in various other groups. “Substituted” also means any of the above groups in which one or more hydrogen atoms are replaced by a higher-order bond (e.g., a double- or triple-bond) to a heteroatom, such as oxygen in oxo, carbonyl, carboxyl, and ester groups; and nitrogen ingroups such as imines, oximes, hydrazones, and nitriles. For example, “substituted” includes any of the above groups in which one or more hydrogen atoms are replaced with -NRgRh, -NRgC(=O)Rh, -NRgC(=O)NRgRh, -NRgC(=O)ORh, -NRgSO2Rh, -OC(=O)NRgRh, -ORg, -SRg, -SORg, -SO2Rg, -OSO2Rg, -SO2ORg, =NSO2Rg, and -SO2NRgRh.“Substituted” also means any of the above groups in which one or more hydrogen atoms are replaced with -C(=O)Rg, -C(=O)ORg, -C(=O)NRgRh, -CH2SO2Rg, -CH2SO2NRgRh. In the foregoing, Rgand Rh are the same or different and independently hydrogen, alkyl, alkenyl, alkynyl, alkoxy, alkylamino, thioalkyl, aryl, aralkyl, cycloalkyl, cycloalkenyl, cycloalkynyl, cycloalkylalkyl, haloalkyl, haloalkenyl, haloalkynyl, heterocyclyl, X-heterocyclyl, heterocyclylalkyl, heteroaryl, jV-heteroaryl and / or heteroarylalkyl. “Substituted” further means any of the above groups in which one or more hydrogen atoms are replaced by a bond to an amino, cyano, hydroxyl, imino, nitro, oxo, thioxo, halo, alkyl, alkenyl, alkynyl, alkoxy, alkylamino, thioalkyl, aryl, aralkyl, cycloalkyl, cycloalkenyl, cycloalkynyl, cycloalkylalkyl, haloalkyl, haloalkenyl, haloalkynyl, heterocyclyl, / / -heterocyclyl, heterocyclylalkyl, heteroaryl, / / -heteroaryl and / or heteroarylalkyl group. In addition, each of the foregoing substituents can also be optionally substituted with one or more of the above substituents.

[0191] As used herein, the symbol “(hereinafter can be referred to as “a point of attachment bond”) denotes a bond that is a point of attachment between two chemical entities, one of which is depicted as being attached to the point of attachment bond and the other of which is not depicted as being attached to the point of attachment bond. For example, ” indicates that the chemical entity “A” is bonded to another chemicalentity via the point of attachment bond. Furthermore, the specific point of attachment to the non-depicted chemical entity can be specified by inference. For example, the compound, wherein X isinfers that the point of attachment bond is the bond by which X is depicted as being attached to the phenyl ring at the ortho position relative to fluorine.

[0192] The phrases "parenteral administration" and "administered parenterally" are art- recognized terms, and include modes of administration other than enteral and topical administration, such as injections, and include, without limitation, intravenous, intramuscular, intrapleural, intravascular, intrapericardial, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intra-articular, subcapsular, subarachnoid, intraspinal and intrastemal injection and infusion.

[0193] The term "treating" is art-recognized and includes inhibiting a disease, disorder or condition in a subject, e.g., impeding its progress; and relieving the disease, disorder or condition, e.g., causing regression of the disease, disorder and / or condition. Treating the disease or condition includes ameliorating at least one symptom of the particular disease or condition, even if the underlying pathophysiology is not affected.

[0194] The term "preventing" is art-recognized and includes stopping a disease, disorder or condition from occurring in a subject, which may be predisposed to the disease, disorder and / or condition but has not yet been diagnosed as having it. Preventing a condition related to a disease includes stopping the condition from occurring after the disease has been diagnosed but before the condition has been diagnosed.

[0195] A "patient," "subject," or "host" to be treated by the subject method may mean either a human or non-human animal, such as a mammal, a fish, a bird, a reptile, or an amphibian. Thus, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig or rodent. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. In one aspect, the subject is a mammal. A patient refers to a subject afflicted with a disease or disorder.

[0196] The terms "prophylactic” or “therapeutic" treatment is art-recognized and includes administration to the host of one or more of the subject compositions. If it is administered prior to clinical manifestation of the unwanted condition (e.g., disease or other unwanted state of the host animal) then the treatment is prophylactic, i.e., it protects the host against developing the unwanted condition, whereas if it is administered after manifestation of the unwanted condition, the treatment is therapeutic (i.e., it is intended to diminish, ameliorate, or stabilize the existing unwanted condition or side effects thereof).

[0197] The terms "therapeutic agent", "drug", "medicament" and "bioactive substance" are art-recognized and include molecules and other agents that are biologically, physiologically, or pharmacologically active substances that act locally or systemically in a patient or subject to treat a disease or condition. The terms include without limitation pharmaceutically acceptable salts thereof and prodrugs. Such agents may be acidic, basic, or salts; they may be neutral molecules, polar molecules, or molecular complexes capable of hydrogen bonding; they may be prodrugs in the form of ethers, esters, amides and the like that are biologically activated when administered into a patient or subject.

[0198] The phrase "therapeutically effective amount" or “pharmaceutically effective amount” is an art-recognized term. In certain embodiments, the term refers to an amount of a therapeutic agent that produces some desired effect at a reasonable benefit / risk ratio applicable to any medical treatment. In certain embodiments, the term refers to that amount necessary or sufficient to eliminate, reduce or maintain a target of a particular therapeutic regimen. The effective amount may vary depending on such factors as the disease or condition being treated, the particular targeted constructs being administered, the size of the subject or the severity of the disease or condition. One of ordinary skill in the art may empirically determine the effective amount of a particular compound without necessitating undue experimentation. In certain embodiments, a therapeutically effective amount of a therapeutic agent for in vivo use will likely depend on a number of factors, including: the rate of release of an agent from a polymer matrix, which will depend in part on the chemical and physical characteristics of the polymer; the identity of the agent; the mode and method of administration; and any other materials incorporated in the polymer matrix in addition to the agent.

[0199] The term "ED50" is art-recognized. In certain embodiments, ED50 means the dose of a drug, which produces 50% of its maximum response or effect, or alternatively, the dose, which produces a pre-determined response in 50% of test subjects or preparations. The term "LD50" is art-recognized. In certain embodiments, LD50 means the dose of a drug, which is lethal in 50% of test subjects. The term "therapeutic index" is an art-recognized term, which refers to the therapeutic index of a drug, defined as LD50 / ED50.

[0200] The terms "IC50," or “half maximal inhibitory concentration” is intended to refer to the concentration of a substance (e.g., a compound or a drug) that is required for 50%inhibition of a biological process, or component of a process, including a protein, subunit, organelle, ribonucleoprotein, etc.

[0201] "Optional" or "optionally" means that the subsequently described circumstance may or may not occur, so that the description includes instances where the circumstance occurs and instances where it does not. For example, the phrase "optionally substituted" means that a non-hydrogen substituent may or may not be present on a given atom, and, thus, the description includes structures wherein a non-hydrogen substituent is present and structures wherein a non-hydrogen substituent is not present.

[0202] Throughout the description, where compositions are described as having, including, or comprising, specific components, it is contemplated that compositions also consist essentially of, or consist of, the recited components. Similarly, where methods or processes are described as having, including, or comprising specific process steps, the processes also consist essentially of, or consist of, the recited processing steps. Further, it should be understood that the order of steps or order for performing certain actions is immaterial so long as the compositions and methods described herein remains operable. Moreover, two or more steps or actions can be conducted simultaneously.

[0203] All percentages and ratios used herein, unless otherwise indicated, are by weight.

[0204] Embodiments described herein relate to compounds and methods of treating a T cell mediated disorder or a disorder associated with dysregulated T-cell activation in a subject in need thereof. We identified XPO1 as the target by which many small molecules inhibit T cell activation and established a class of XPO1 modulators, herein termed Selective Inhibitors of Transcriptional Activation (SITAs), that show distinct properties from established Selective Inhibitors of Nuclear Export (SINEs). Like SINEs, SITAs target XPO1 at Cys528 and disrupt XPOl’s chromatin localization; however, SITAs demonstrate minimal impact on XPO1 -mediated nuclear export, centrosome and centromere functions, and cell death. SITAs are often significantly lower in molecular weight than SINEs and likely occupy a substantially smaller portion of the XPO1 NES-binding groove. As a result, SITAs may not fully disrupt some of XPO1 ’s protein-protein interactions, particularly those of particularly high affinity or whose productive interactions with XPO1 include contacts beyond the NES- binding groove. Overall, SITAs extend the existing diversity among XPO1 C528-targeting small molecules, which includes SINEs as well as molecules that induce rapid proteasomaldegradation of XPO1 to enable therapeutic targeting of XPO1 beyond oncology and to treat T cell-driven autoimmune disorders.

[0205] Accordingly, in some embodiments, a method of treating a T cell mediated disorder or a disorder associated with dysregulated T-cell activation in a subject in need thereof includes administering to the subject a therapeutically effective amount of at least one exportin- 1 (XPO1) modulator that is a selective inhibitor of transcription activation (SITA). The SITA targets XPO1 at Cys528 and disrupts XPOl ’s chromatin localization with minimal impact on XPO1 -mediated nuclear export, centrosome and centromere functions, and cell death.

[0206] In some embodiments, the SIT A suppresses IL2 production and transcriptional activity of AP- 1 and NFAT.

[0207] Other embodiments relate to a compound of formula (I) and particularly to its use as a SITA. The compound of formula (I) can have the structure:or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:A isX1and X5are each independently C(H) or N;X2, X3, and X4are each independently C(R10) or N;R1is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R2is absent, oxo, -OH, or alkoxy;R3is H, alkyl, or haloalkyl;R4is absent, alkyl, haloalkyl, or alkynyl, preferably, if X1is C(H) and R5is absent;Rsis absent, alkyl, alkynyl, halogen, or haloalkyl;R6is absent, alkynyl, halogen, -N(R11)2, alkyl, haloalkyl, -alkynylene- alkylene-alkoxy, cycloalkyl optionally substituted with one or more R12, heterocyclyl optionally substituted with one or more R12, aryl optionally substituted with one or more R12, or heteroaryl optionally substituted with one or more R12;R7is absent, halogen, haloalkyl, N(Rn)2. cycloalkyl optionally substituted with one or more R12, heterocyclyl optionally substituted with one or more R12, aryl optionally substituted with one or more R12, heteroaryl optionally substituted with one or more R12;R8is absent, haloalkyl or cycloalkyl optionally substituted with one or more R12;R9is absent or halogen, cycloalkyl optionally substituted with one or more R12; each R10is H, halogen, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more R12; each R11is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R11together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl each is optionally substituted with one or more R12; each R12is halogen, alkyl, or alkoxy; andR13is absent, halogen, alkyl, haloalkyl, or alkynyl.

[0208] In some embodiments, R1is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R2is oxo.

[0209] In some embodiments, R1is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R2is oxo.

[0210] In some embodiments, R1is absent and R2is absent or C1-C6alkoxy.

[0211] In some embodiments, R1is absent and R2is absent or methoxy.

[0212] In some embodiments, R3is H or C1-C6alkyl.

[0213] In some embodiments, R3is H or methyl.

[0214] In some embodiments, R4is absent, C1-C6, alkyl, Ci-Cn haloalkyl, or C1-C6 alkynyl if X1is C(H) and R5is absent;

[0215] In some embodiments, R4is absent, ethynyl, or -CF3.

[0216] In some embodiments, R5is absent, C1-C6alkyl, Ci -G> alkynyl, halogen, or Ci-Ce haloalkyl.

[0217] In some embodiments, R5is absent, ethynyl, F, or -CF3.

[0218] In some embodiments, R6is absent, C1-C6alkynyl, halogen, -N(R11)2, C1-C6alkyl, C1-C6haloalkyl, -alkynylene-alkylene-alkoxy, 3- to 7-membered ring cycloalkyl optionally substituted with one or more R12, 4- to 8-membered, mono- or bi-heterocyclyl optionally substituted with one or more R12, 6- to 10-membered aryl optionally substituted with one or more R12, or 5- to 8-membered heteroaryl optionally substituted with one or more R12.

[0219] In some embodiments, R6is -N(H)CI-C6 alkyl, -alkynylene-alkylene-alkoxy, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, or piperidinyl each of which is optionally substituted with one or more R12.

[0220] In some embodiments, R6is Cl or F, or -N(H)CH3, cyclopropyl, cyclobutyl, cyclopentyl, -alkynylene-alkylene-alkoxy,each of which is optionally substituted with one or more R12.

[0221] In some embodiments, R7is a halogen or C1-C3 haloalkyl, -N(H)alkyl, -N(Ci- Ce alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), thiophenyl, pyrrolidinyl, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, phenyl, or piperidinyl each of which is optionally substituted with one or more R12.

[0222] In some embodiments, R7is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, phenyeach of which is optionally substituted with one or moreR12.

[0223] In some embodiments, R8is absent, C1-C6haloalkyl or C3-C8 cycloalkyl optionally substituted with one or more R12.

[0224] In some embodiments, R9is absent or halogen, C3-C8 cycloalkyl optionally substituted with one or more R12.

[0225] Other embodiments relate to a compound of formula (II) and particularly to its use as a SITA. The compound of formula (II) can have the structure of:or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:X1is C(H) or N;R1is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R2is absent, oxo, -OH, or alkoxy;R3is H, alkyl, or haloalkyl;R4is absent, alkyl, haloalkyl, or alkynyl if X1is C(H) and R5is absent;R5is absent, alkyl, alkynyl, halogen, or haloalkyl;R6is absent, alkynyl, halogen, -N(R11)2, alkyl, haloalkyl, -alkynylene-alkylene-alkoxy, cycloalkyl optionally substituted with one or more R12, heterocyclyl optionally substituted with one or more R12, aryl optionally substituted with one or more R12, or heteroaryl optionally substituted with one or more R12; each R11is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R11together with the N atom to which they are attached can form a 4- to 8-membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl each is optionally substituted with one or more R12; and each R12is halogen, alkyl, or alkoxy.

[0226] In some embodiments, R1is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R2is oxo.

[0227] In some embodiments, R1is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R2is oxo.

[0228] In some embodiments, R1is absent and R2is absent or C1-C6alkoxy.

[0229] In some embodiments, R1is absent and R2is absent or methoxy.

[0230] In some embodiments, R3is H or C1-C6alkyl.

[0231] In some embodiments, R3is H or methyl.

[0232] In some embodiments, R4is absent, C1-C6alkyl, C1-C6haloalkyl, or C1-C6alkynyl if X1is C(H) and R5is absent;

[0233] In some embodiments, R4is absent, ethynyl, or -CF3.

[0234] In some embodiments, R5is absent, C1-C6alkyl, C1-C6alkynyl, halogen, or Ci-Ce haloalkyl.

[0235] In some embodiments, R5is absent, ethynyl, F, or -CF3.

[0236] In some embodiments, R6is absent, C1-C6alkynyl, halogen, -N(R11)2, C1-C6alkyl, C1-C6haloalkyl, -alkynylene-alkylene-alkoxy, 3- to 7-membered ring cycloalkyl optionally substituted with one or more R12, 4- to 8-membered, mono- or bi-heterocyclyl optionally substituted with one or more R12, 6- to 10-membered aryl optionally substituted with one or more R12, or 5- to 8-membered heteroaryl optionally substituted with one or more R12.

[0237] In some embodiments, R6is -N(H)CI-C6 alkyl, -alkynylene-alkylene-alkoxy, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, or piperidinyl each of which is optionally substituted with one or more R12.

[0238] In some embodiments, R6is Cl or F, or -N(H)CH3, cyclopropyl, cyclobutyl, cyclopentyl, -alkynylene-alkylene-alkoxy,each of which is optionally substituted with one or more R12.

[0239] In some embodiments, R1is C1-C6alkyl, C1-C6haloalkyl, or C3-C7 cycloalkyl, R2is oxo, R3is H or C1-C6alkyl, R4is absent, R5is C1-C6alkyl, CI-CG alkynyl, halogen, or C1-C6haloalkyl, and R6is Cl or F, or -N(H)CH3, cyclopropyl, cyclobutyl, cyclopentyl, - alkynylene-alkylene-alkoxy,each of which is optionally substituted with one or more R12.

[0240] In other embodiments, R1is C1-C6alkyl, C1-C6haloalkyl, or C3-C7 cycloalkyl,R2is oxo, R3is H or methyl, R4is absent, R5is C1-C6haloalkyl, and R6is -N(H)CH3, cyclopropyl, cyclobutyl, cyclopentyl, -alkynylene-alkylene-alkoxyeach of which is optionally substituted with one or more R12.

[0241] In some embodiments, the compound of formula (II) is selected from:thereof.

[0242] Other embodiments relate to a compound of formula (III) and particularly to its use as a SITA. The compound of formula (III) can have the structure of:tautomer, or solvate thereof, wherein:R1is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R2is absent, oxo, -OH, or alkoxy;R3is H, alkyl, or haloalkyl;R7is absent, halogen, haloalkyl, N(Rn)2. cycloalkyl optionally substituted with one or more R12, heterocyclyl optionally substituted with one or more R12, aryl optionally substituted with one or more R12, heteroaryl optionally substituted with one or more R12;each R11is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R11together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl each is optionally substituted with one or more R12; each R12is halogen, alkyl, or alkoxy; andR13is absent, halogen, alkyl, haloalkyl, or alkynyl.

[0243] In some embodiments, R1is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R2is oxo.

[0244] In some embodiments, R1is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R2is oxo.

[0245] In some embodiments, R1is absent and R2is absent or C1-C6alkoxy.

[0246] In some embodiments, R1is absent and R2is absent or methoxy.

[0247] In some embodiments, R3is H or C1-C6alkyl.

[0248] In some embodiments, R3is H or methyl.

[0249] In some embodiments, R7is a halogen or C1-C3 haloalkyl, -N(H)alkyl, -N(Ci- Ce alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), thiophenyl, pyrrolidinyl, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, phenyl, or piperidinyl each of which is optionally substituted with one or more R12.

[0250] In some embodiments, R7is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(C1-C6alkyl)-3- to 6- membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, phenyleach of which is optionally substituted with one or more R12.

[0251] In some embodiments, R1is C1-C6alkyl, Ci-C(> haloalkyl, or C3-C7 cycloalkyl, R2is oxo, R3is H or C1-C6alkyl, R7is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(CI-C6alkyl)-3- to 6- membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, phenyleach of which is optionally substituted with one or moreR12, and R13is absent.

[0252] In some embodiments, the compound of formula (III) is selected from:or solvate thereof.

[0253] Other embodiments relate to a compound of formula (IV) and particularly to its use as a S1TA. The compound of formula (IV) can have the structure of:or apharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:X2, X3, and X4are each independently C(R10) or N;R1is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R2is absent, oxo, -OH, or alkoxy;R3is H, alkyl, or haloalkyl;R8is absent, haloalkyl or cycloalkyl optionally substituted with one or more R12;R9is absent or halogen, cycloalkyl optionally substituted with one or more R12; each R10is H, halogen, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more R12; each R11is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R11together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl each is optionally substituted with one or more R12; and each R12is halogen, alkyl, or alkoxy.

[0254] In some embodiments, R1is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R2is oxo.

[0255] In some embodiments, R1is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R2is oxo.

[0256] In some embodiments, R1is absent and R2is absent or C1-C6alkoxy.

[0257] In some embodiments, R1is absent and R2is absent or methoxy.

[0258] In some embodiments, R3is H or C1-C6alkyl.

[0259] In some embodiments, R3is H or methyl.

[0260] In some embodiments, R8is absent, C1-C6haloalkyl or C3-C8 cycloalkyl optionally substituted with one or more R12.

[0261] In some embodiments, R9is absent or halogen, C3-C8 cycloalkyl optionally substituted with one or more R12.

[0262] In some embodiments, R1is C1-C6alkyl, Ci-G, haloalkyl, or C3-C7 cycloalkyl, R2is oxo, R3is H or methyl, R8is C1-C6haloalkyl or C3-C8 cycloalkyl optionally substituted with one or more R12, R9is absent or C3-C8 cycloalkyl optionally substituted with one or more R12, and each R10is absent, H, halogen, haloalkyl, or cycloalkyl optionally substituted with one or more R12.

[0263] In some embodiments, the compound of formula (IV) is selected from:salt, tautomer, or solvate thereof.

[0264] Still other embodiments relate to a compound having the following structures and particularly to their use as a SITA. The compounds can have the structure of:salt, tautomer, or solvate thereof.

[0265] Other embodiments relate to a compound of formula (V) and particularly to its use as a SITA. The compound of formula (V) can have the structure:or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:A1is:a dashed line (e.g., — or — ) is an optional bond;X5, X6, X8, X9and X10are each independently C(H) or N;X7is C, C(H), N;X11, X12, X13, and X14are each independently C, C(H), N, or N(H);R14is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R1Sis absent, oxo, -OH, or alkoxy;R16is H, alkyl, or haloalkyl;R17is absent, alkyl, haloalkyl, or halogen;R18is absent, haloalkyl, or alkynyl;R19is absent, alkyl, alkynyl, halogen, or haloalkyl;R20is absent, alkynyl, halogen, alkyl, haloalkyl, -N(R27)2, -alkynylene- alkylene-alkoxy, cycloalkyl optionally substituted with one or more R28, heterocyclyl optionally substituted with one or more R28, aryl optionally substituted with one or more R28, or heteroaryl optionally substituted with one or more R28;R21is absent, alkoxy, halogen, haloalkyl, N(R27)2. cycloalkyl optionally substituted with one or more R28, heterocyclyl optionally substituted with one or more R28, aryl optionally substituted with one or more R28, heteroaryl optionally substituted with one or more R28;R22is absent, H, halogen, haloalkyl, or cycloalkyl optionally substituted with one or more R28;R23is absent, H, halogen, alkoxy, -alkylene-alkyl, or alkynyl;R24is absent or cycloalkyl optionally substituted with one or more R28;R25is absent, H, or halogen;R26is absent, haloalkyl, cycloalkyl optionally substituted with one or more R28, or heteroaryl optionally substituted with one or more R28; each R27is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R27together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl is each optionally substituted with one or more R28; andR28is halogen, alkyl, or alkoxy.

[0266] In some embodiments, R14is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R15is oxo.

[0267] In some embodiments, R14is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R15is oxo.

[0268] In some embodiments, R14is absent and R15is absent, -OH, or C1-C6alkoxy.

[0269] In some embodiments, R14is absent and R15is absent, -OH, or methoxy.

[0270] In some embodiments, R16is H or C1-C6alkyl.

[0271] In some embodiments, R16is H or methyl.

[0272] In some embodiments, R17is absent, C1-C6alkyl, C1-C6haloalkyl, or halogen.

[0273] In some embodiments, R18is absent, C1-C6haloalkyl, or C1-C6alkynyl.

[0274] In some embodiments, R19is absent, C1-C6alkyl, C1-C6alkynyl, halogen, or Ci-Ce haloalkyl.

[0275] In some embodiments, R20is absent, C1-C6alkynyl, halogen, C1-C6alkyl, C1-C6haloalkyl, -N(R27)2, -alkynylene-alkylene-alkoxy, 3- to 7-membered ring cycloalkyl optionally substituted with one or more R28, 4- to 8-membered, mono- or bi-heterocyclyl optionally substituted with one or more R28, 6- to 10-membered aryl optionally substituted with one or more R28, or 5- to 8-membered heteroaryl optionally substituted with one or more R28.

[0276] In some embodiments, R20is -N(H)Ci-G, alkyl, -alkynylene-alkylene-alkoxy, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, or piperidinyl each of which is optionally substituted with one or more R28.

[0277] In some embodiments, R20is Cl or F, or -N(H)CH% cyclopropyl, cyclobutyl, cyclopentyl, -alkynylene-alkylene-alkoxy,each of which is optionally substituted with one or more R28.

[0278] In some embodiments, R21is a halogen or alkoxy, C1-C3 haloalkyl, -N(H)alkyl, -N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), thiophenyl, pyrrolidinyl, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, phenyl, or piperidinyl each of which is optionally substituted with one or more R28.

[0279] In some embodiments, R21is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(C1-C6alkyl)-3- to 6- membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, phenyeach of which is optionally substituted with one or moreR28.

[0280] In some embodiments, R22is absent, H, halogen, C1-C6haloalkyl, C1-C6cycloalkyl optionally substituted with one or more R28.

[0281] Ins some embodiments, R23is absent, H, halogen, C1-C6alkoxy, -C1-C6alkylene-C1-C6alkyl, or C1-C6alkynyl.

[0282] In some embodiments, R24is absent or Ci-Cc cycloalkyl optionally substituted with one or more R28.

[0283] In some embodiments, R25is absent, H, or halogen.

[0284] In some embodiments, R26is haloalkyl, C1-C6 cycloalkyl optionally substituted with one or more R28, or C1-C6heteroaryl optionally substituted with one or more R28.

[0285] Other embodiments relate to a compound of formula (VI) and particularly to its use as a SITA. The compound of formula (VI) can have the structure of:or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:X5and X6are each independently C(H) or N;X7is C, C(H), N;R14is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R15is absent, oxo, -OH, or alkoxy;R16is H, alkyl, or haloalkyl;R17is absent, alkyl, haloalkyl, or halogen;R18is absent, haloalkyl, or alkynyl;R19is absent, alkyl, alkynyl, halogen, or haloalkyl;R20is absent, alkynyl, halogen, alkyl, haloalkyl, -N(R27)I, -alkynylene- alkylene-alkoxy, cycloalkyl optionally substituted with one or more R28, heterocyclyl optionally substituted with one or more R28, aryl optionally substituted with one or more R28, or heteroaryl optionally substituted with one or more R28; each R27is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R27together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl is each optionally substituted with one or more R28; andR28is halogen, alkyl, or alkoxy.

[0286] In some embodiments, R14is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R15is oxo.

[0287] In some embodiments, R14is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R15is oxo.

[0288] In some embodiments, R14is absent and R15is absent, -OH, or C1-C6alkoxy.

[0289] In some embodiments, R14is absent and R15is absent, -OH, or methoxy.

[0290] In some embodiments, R16is H or C1-C6alkyl.

[0291] In some embodiments, R16is H or methyl.

[0292] In some embodiments, R17is absent, C1-C6alkyl, Ci -Cohaloalkyl, or halogen.

[0293] In some embodiments, R18is absent, C1-C6haloalky 1, or C1-C6alkynyl.

[0294] In some embodiments, R19is absent, C1-C6alkyl, C1-C6alkynyl, halogen, or Ci-C6 haloalkyl.

[0295] In some embodiments, R20is absent, C1-C6alkynyl, halogen, C1-C6alkyl, C1-C6haloalkyl, -N(R27)2, -alkynylene-alkylene-alkoxy, 3- to 7-membered ring cycloalkyl optionally substituted with one or more R28, 4- to 8-membered, mono- or bi-heterocyclyl optionally substituted with one or more R28, 6- to 10-membered aryl optionally substituted with one or more R28, or 5- to 8-membered heteroaryl optionally substituted with one or more

[0296] In some embodiments, R20is -N(H)C1-C6alkyl, -alkynylene-alkylene-alkoxy, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, or piperidinyl each of which is optionally substituted with one or more R28.

[0297] In some embodiments, R20is Cl or F, or -Nil 1)0 h, cyclopropyl, cyclobutyl,each of which is optionally substituted withone or more R28.

[0298] In some embodiments, the compound of formula (VI) is selected from:a pharmaceutically acceptable salt, tautomer, or solvate thereof.

[0299] Other embodiments relate to a compound of formula (VII) and particularly to its use as a SITA. The compound of formula (VII) can have the structure of:) or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:X8, X9and X10are each independently C(H) or N;R14is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R15is absent, oxo, -OH, or alkoxy;R16is H, alkyl, or haloalkyl;R21is absent, alkoxy, halogen, haloalkyl, N(R27)2, cycloalkyl optionally substituted with one or more R28, heterocyclyl optionally substituted with one or more R28, aryl optionally substituted with one or more R28, heteroaryl optionally substituted with one or more R28; each R27is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R27together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl is each optionally substituted with one or more R28; andR28is halogen, alkyl, or alkoxy.

[0300] In some embodiments, R14is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R15is oxo.

[0301] In some embodiments, R14is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R15is oxo.

[0302] In some embodiments, R14is absent and R15is absent, -OH, or C1-C6alkoxy.

[0303] In some embodiments, R14is absent and R1Sis absent, -OH, or methoxy.

[0304] In some embodiments, R16is H or C1-C6alkyl.

[0305] In some embodiments, R16is H or methyl.

[0306] In some embodiments, R21is a halogen or alkoxy, C1-C3 haloalkyl, -N(H)alkyl, -N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), thiophenyl, pyrrolidinyl, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, phenyl, or piperidinyl each of which is optionally substituted with one or more R28.

[0307] In some embodiments, R21is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(CI-C6 alkyl)-3- to 6- membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, phenyl,, each of which is optionally substituted with one or moreR28.

[0308] In some embodiments, the compound of formula (VII) is selected from:acceptable salt, tautomer, or solvate thereof.

[0309] Other embodiments relate to a compound of formula (VIII) and particularly to its use as a SITA. The compound of formula (VIII) can have the structure of: or a pharmaceutically acceptablesalt, tautomer, or solvate thereof, wherein: a dashed line (e.g., — or — ) is an optional bond;X5is C(H) or N;X11, X12, X13, and X14are each independently C, C(H), N, or N(H);R14is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R15is absent, oxo, -OH, or alkoxy;R16is H, alkyl, or haloalkyl;R22is absent, H, halogen, haloalkyl, or cycloalkyl optionally substituted with one or more R28;R23is absent, H, halogen, alkoxy, -alkylene-alkyl, or alkynyl;R24is absent or cycloalkyl optionally substituted with one or more R28;R25is absent, H, or halogen;R26is absent, haloalkyl, cycloalkyl optionally substituted with one or more R28, or heteroaryl optionally substituted with one or more R28; each R27is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R27together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl is each optionally substituted with one or more R28; andR28is halogen, alkyl, or alkoxy.

[0310] In some embodiments, R14is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R15is oxo.

[0311] In some embodiments, R14is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R15is oxo.

[0312] In some embodiments, R14is absent and R1Sis absent, -OH, or C1-C6alkoxy.

[0313] In some embodiments, R14is absent and R15is absent, -OH, or methoxy.

[0314] In some embodiments, R22is absent, H, halogen, C1-C6haloalkyl, C1-C6cycloalkyl optionally substituted with one or more R28.

[0315] Ins some embodiments, R23is absent, H, halogen, C1-C6alkoxy, -C1-C6alkylene-C1-C6alkyl, or Ci-O, alkynyl.

[0316] In some embodiments, R24is absent or C1-C6cycloalkyl optionally substituted with one or more R28.

[0317] In some embodiments, R25is absent, H, or halogen.

[0318] In some embodiments, R26is absent, haloalkyl, C I-CA cycloalkyl optionally substituted with one or more R28, or C1-C6heteroaryl optionally substituted with one or more R28.or a pharmaceutically acceptable salt, tautomer, or solvate thereof.

[0320] Still other embodiments relate to a compound having the following structures and particularly to their use as a SITA. The compounds can have the structure of:pharmaceutically acceptable salt, tautomer, or solvate thereof.

[0321] To evaluate the SINE / SITA behavior of the compounds of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), two established luminescence-based assays were performed as described in the Examples. First, a Jurkat-based IL2 luciferase reporter assay was used to assess the potency with which the compounds suppress XPO1 -dependent upregulation of IL2. Second, a CellTiter-Glo (CTG) viability assay of Jurkat cells was performed to assess the cytotoxicity of the compounds. Compounds having comparable potency for both these assays defines SINE behavior as was previously observed for the SINE, Selinexor.Conversely, diminished potency for cell killing relative to suppression of IL2 upregulation is characteristic of SITAs.

[0322] In some embodiments, the IC50 of the CTG cell viability assay of Jurkat cells (nM) relative to the IC50 Luciferase IL2 Suppression of Jurkat cells (nM), i.e., CTG / IL2 differential response, of compounds of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) is at least about 1 or more, at least about 2, at least about 3 or more, at least about 4 or more, at least about 5 or more, at least about 6 or more, at least about 7 or more, at least about 8 ormore, at least about 9 or more, at least about 10 or more, at least about 11 or more, at least about 12 or more, at least about 13 or more, at least about 14 or more, at least about 15 or more, at least about 16 or more, at least about 17 or more, at least about 18 or more, at least about 19 or more, at least about 20 or more, at least about 25 or more, at least about 30 or more, at least about 35 or more, at least about 40 or more, at least about 45 or more, at least about 50 or more, at least about 55 or more, at least about 60 or more, at least about 65 or more, at least about 70 or more, at least about 75 or more, at least about 80 or more, at least about 85 or more, at least about 90 or more, at least about 95 or more, at least about 100 or more, at least about 200 or more, at least about 300 or more, at least about 400 or more, or at least about 500 or more.

[0323] In some embodiments, the EC50 of the CTG cell viability assay of Jurkat cells (nM) relative to the EC50 Luciferase IL2 Suppression of Jurkat cells (nM), i.e., CTG / IL2 differential response, of compounds of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) is at least about 1 or more, at least about 2, at least about 3 or more, at least about 4 or more, at least about 5 or more, at least about 6 or more, at least about 7 or more, at least about 8 or more, at least about 9 or more, at least about 10 or more, at least about 11 or more, at least about 12 or more, at least about 13 or more, at least about 14 or more, at least about 15 or more, at least about 16 or more, at least about 17 or more, at least about 18 or more, at least about 19 or more, at least about 20 or more, at least about 25 or more, at least about 30 or more, at least about 35 or more, at least about 40 or more, at least about 45 or more, at least about 50 or more, at least about 55 or more, at least about 60 or more, at least about 65 or more, at least about 70 or more, at least about 75 or more, at least about 80 or more, at least about 85 or more, at least about 90 or more, at least about 95 or more, at least about 100 or more, at least about 200 or more, at least about 300 or more, at least about 400 or more, or at least about 500 or more.

[0324] In other embodiments, CTG / IL2 differential response of a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) is at least about 2 times greater than Selinexor and S109, at least about 3 times greater than Selinexor and SI 09, at least about 4 times greater than Selinexor and S109, at least about 5 times greater than Selinexor and S109, at least about 6 times greater than Selinexor and S109, at least about 7 times greater than Selinexor and S109, at least about 8 times greater than Selinexor and S109, at least about 9 times greater than Selinexor and S109, at least about 10 times greater than Selinexor and S109, at leastabout 11 times greater than Selinexor and SI 09, at least about 12 times greater than Selinexor and S109, at least about 13 times greater than Selinexor and S109, at least about 14 times greater than Selinexor and S109, at least about 15 times greater than Selinexor and SI 09, at least about 16 times greater than Selinexor and S109, at least about 17 times greater than Selinexor and S109, at least about 18 times greater than Selinexor and S109, at least about 19 times greater than Selinexor and S 109, at least about 20 times greater than Selinexor and S109, at least about 25 times greater than Selinexor and S109, at least about 30 times greater than Selinexor and S109, at least about 35 times greater than Selinexor and S109, at least about 40 times greater than Selinexor and SI 09, at least about 45 times greater than Selinexor and S109, at least about 50 times greater than Selinexor and S109, at least about 55 times greater than Selinexor and SI 09, at least about 60 times greater than Selinexor and S109, at least about 65 times greater than Selinexor and S109, at least about 70 times greater than Selinexor and S109, at least about 75 times greater than Selinexor and S109, at least about 80 times greater than Selinexor and S 109, at least about 85 times greater than Selinexor and S109, at least about 90 times greater than Selinexor and S109, at least about 95 times greater than Selinexor and S109, at least about 100 times greater than Selinexor and S109, at least about 200 times greater than Selinexor and S109, at least about 300 times greater than Selinexor and S109, at least about 400 times greater than Selinexor and S109, or at least about 500 times greater than Selinexor and S109.

[0325] The SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein can be used for the treatment and / or prevention of a T cell mediated disorder or a disorder associated with dysregulated T-cell activation. The term "T cell mediated disease" or "T cell mediated disorder" refers to diseases and disorders in which an aberrant immune reaction involves T cell-mediated immune mechanisms, as opposed to humoral immune mechanisms. T cell mediated diseases contemplated by the present application also include T cell mediated autoimmune diseases or disorders. The language "autoimmune disorder" is intended to include disorders in which the immune system of a subject reacts to autoantigens, such that significant tissue or cell destruction occurs in the subject. The term "autoantigen" is intended to include any antigen of a subject that is recognized by the immune system of the subject. The terms "autoantigen" and "self-antigen" are used interchangeably herein. The term "self" as used herein is intended to mean any component ofa subject and includes molecules, cells, and organs. Autoantigens may be peptides, nucleic acids, or other biological substances. T cell mediated disorder can be an autoimmune disorder and the SITA can be administered to the subject at an amount effective to treat the autoimmune disorder.

[0326] For example, the SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein can be administered to a subject to treat autoimmune conditions or diseases, such as inflammatory diseases, including but not limited to at least one of achlorhydra autoimmune active chronic hepatitis, acute disseminated encephalomyelitis, acute hemorrhagic leukoencephalitis, Addison’s disease, agammaglobulinemia, alopecia areata, Alzheimer’s disease, amyotrophic lateral sclerosis, ankylosing spondylitis, anti-gbm / tbm nephritis, antiphospholipid syndrome, antisynthetase syndrome, aplastic anemia, arthritis, atopic allergy, atopic dermatitis, autoimmune cardiomyopathy, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome, autoimmune peripheral neuropathy, autoimmune polyendocrine syndrome, autoimmune progesterone dermatitis, autoimmune thrombocytopenia purpura, autoimmune uveitis, balo disease / balo concentric sclerosis, bechets syndrome, Berger’s disease, Bickerstaff’s encephalitis, blau syndrome, bullous pemphigoid, castleman's disease, chagas disease, chronic fatigue immune dysfunction syndrome, chronic inflammatory demyelinating polyneuropathy, chronic lyme disease, chronic obstructive pulmonary disease, churg-strauss syndrome, cicatricial pemphigoid, coeliac disease, cogan syndrome, cold agglutinin disease, cranial arteritis, crest syndrome, Crohns disease, Cushing’s syndrome, Dego's disease, Dercum's disease, dermatitis herpetiformis, dermatomyositis, diabetes mellitus type 1, Dressier's syndrome, discoid lupus erythematosus, eczema, endometriosis, enthesitis-related arthritis, eosinophilic fasciitis, epidermolysis bullosa acquisita, essential mixed cryoglobulinemia, evan's syndrome, fibrodysplasia ossificans progressive, fibromyalgia, fibromyositis, fibrosing aveolitis, gastritis, gastrointestinal pemphigoid, giant cell arteritis, glomerulonephritis, Goodpasture's syndrome, graft-versus-host disease (GVHD), Graves' disease, Guillain-barre syndrome (gbs), Hashimoto’s encephalitis, Hashimoto's thyroiditis, henoch-schonlein purpura, hidradenitis suppurativa, Hughes syndrome, inflammatory bowel disease (IBD), idiopathic inflammatory demyelinating diseases, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura, iga nephropathy, inflammatory demyelinatingpolyneuopathy, interstitial cystitis, irritable bowel syndrome (ibs), Kawasaki's disease, lichen planus, Lou Gehrig’s disease, lupoid hepatitis, lupus erythematosus, meniere's disease, microscopic polyangiitis, mixed connective tissue disease, morphea, multiple myeloma, multiple sclerosis, myasthenia gravis, myositis, narcolepsy, neuromyelitis optica, neuromyotonia, occular cicatricial pemphigoid, opsoclonus myoclonus syndrome, ord thyroiditis, Parkinson’s disease, pars planitis, pemphigus, pemphigus vulgaris, pernicious anaemia, polymyalgia rheumatic, polymyositis, primary biliary cirrhosis, primary sclerosing cholangitis, progressive inflammatory neuropathy, psoriasis, psoriatic arthritis, raynaud phenomenon, relapsing polychondritis, Reiter’s syndrome, rheumatoid arthritis, rheumatoid fever, sarcoidosis, schizophrenia, Schmidt syndrome, Schnitzler syndrome, scleritis, scleroderma, Sjogren's syndrome, spondyloarthropathy, sticky blood syndrome, still's disease, stiff person syndrome, sydenham chorea, sweet syndrome, takayasu’s arteritis, temporal arteritis, transplant rejection, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease, undifferentiated spondyloarthropathy, vasculitis, vitiligo, Wegener's granulomatosis, Wilson’s syndrome, Wiskott-Aldrich syndrome, hypersensitivity reactions of the skin, atherosclerosis, ischemia-reperfusion injury, myocardial infarction, or restenosis.

[0327] The SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein can also be used for the prevention or treatment of the acute rejection of transplanted organs where administration of a therapeutic described herein, may occur during the acute period following transplantation or as long-term post transplantation therapy.

[0328] In still other embodiments, the SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein can be administered to the subject at an amount effective to treat graft- versus-host disease or transplant rejection.

[0329] In yet other embodiments, the SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein can be administered to a subject to mitigate bone marrow graft rejection, to enhance bone marrow graft engraftment, to enhance engraftment of a hematopoietic stem cell graft, or an umbilical cord blood stem cell graft, to enhance engraftment of a hematopoietic stem cell graft, or an umbilical cord stem cell graft, and / or todecrease the number of units of umbilical cord blood required for transplantation into the subject. The administration can be, for example, following treatment of the subject or the marrow of the subject with radiation therapy, chemotherapy, or immunosuppressive therapy.

[0330] In other embodiments, the SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein can be administered to a recipient of a bone marrow transplant, of a hematopoietic stem cell transplant, or of an umbilical cord blood stem cell transplant, in order to decrease the administration of other treatments or growth factors.

[0331] In further embodiments, the SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein can be administered to a subject or to a tissue graft of a subject to mitigate graft rejection, to enhance graft engraftment, to enhance graft engraftment following treatment of the subject or the marrow of the subject with radiation therapy, chemotherapy, or immunosuppressive therapy.

[0332] The SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein can be provided in a pharmaceutical composition depending on the pathological condition or disorder being treated. A pharmaceutical composition containing the SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein as an active ingredient may be manufactured by mixing the SITA or compound with a pharmaceutically acceptable carrier(s) or an excipient(s) or diluting the SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein with a diluent in accordance with conventional methods. The pharmaceutical composition may further contain fillers, anti-cohesives, lubricants, wetting agents, flavoring agents, emulsifying agents, preservatives and the like. The pharmaceutical composition may be formulated into a suitable formulation in accordance with the methods known to those skilled in the art so that it can provide an immediate, controlled or sustained release of the SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein after being administered into a mammal.

[0333] In some embodiments, the pharmaceutical composition may be formulated into a parenteral or oral dosage form. The solid dosage form for oral administration may be manufactured by adding excipient, if necessary, together with binder, disintegrants, lubricants, coloring agents, and / or flavoring agents, to the SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein and shaping the resulting mixture into the form of tablets, sugar-coated pills, granules, powder or capsules. The additives that can be added in the composition may be ordinary ones in the art. For example, examples of the excipient include lactose, sucrose, sodium chloride, glucose, starch, calcium carbonate, kaolin, microcrystalline cellulose, silicate and the like. Exemplary binders include water, ethanol, propanol, sweet syrup, sucrose solution, starch solution, gelatin solution, carboxymethylcellulose, hydroxypropyl cellulose, hydroxypropyl starch, methylcellulose, ethylcellulose, shellac, calcium phosphonate and polypyrrolidone. Examples of the disintegrant include dry starch, sodium arginate, agar powder, sodium bicarbonate, calcium carbonate, sodium lauryl sulfate, stearic monoglyceride and lactose. Further, purified talc, stearates, sodium borate, and polyethylene glycol may be used as a lubricant; and sucrose, bitter orange peel, citric acid, tartaric acid, may be used as a flavoring agent. In some embodiments, the pharmaceutical composition can be made into aerosol formulations (e.g., they can be nebulized) to be administered via inhalation.

[0334] The SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein may be combined with flavoring agents, buffers, stabilizing agents, and the like and incorporated into oral liquid dosage forms such as solutions, syrups or elixirs in accordance with conventional methods. One example of the buffers may be sodium citrate. Examples of the stabilizing agents include tragacanth, acacia and gelatin.

[0335] In some embodiments, the SITA or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein described herein may be incorporated into an injection dosage form, for example, for a subcutaneous, intramuscular or intravenous route by adding thereto pH adjusters, buffers, stabilizing agents, relaxants, topical anesthetics. Examples of the pH adjusters and the buffers include sodium citrate, sodium acetate and sodium phosphate. Examples of the stabilizing agents include sodium pyrosulfite, EDTA, thioglycolic acid andthiolactic acid. The topical anesthetics may be procaine HC1, lidocaine HC1 and the like. The relaxants may be sodium chloride, glucose and the like.

[0336] In other embodiments, the SIT A or a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt, tautomer, or solvate thereof described herein described herein may be incorporated into suppositories in accordance with conventional methods by adding thereto pharmaceutically acceptable carriers that are known in the art, for example, polyethylene glycol, lanolin, cacao butter or fatty acid triglycerides, if necessary, together with surfactants such as Tween.

[0337] The route(s) of administration will be readily apparent to the skilled artisan and will depend upon any number of factors including the type and severity of the disease being treated, the type and age of the veterinary or human patient being treated, and the like.

[0338] The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology and pharmaceutics. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single-dose or multi-dose unit.

[0339] Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions, which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs.

[0340] In some embodiments, an effective amount (i.e., dose) of the pharmaceutical composition or compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt or solvate thereof described herein to be administered to a subject can be determined depending upon, for example, age, body weight, symptom, thedesired therapeutic effect, the route of administration, and the duration of the treatment. Exemplary doses can be from about 0.01 to about 1000 mg, by oral administration.Examples of dose ranges can include from a minimum dose of about 0.01, 0.10, 0.50, 1, 5, 10, 25, 50, 100, 125, 150, 200, or 250 mg to a maximum dose of about 300, 400, 500, 600, 700, 800, 900, or 1000 mg, wherein the dose range can include from any one of the foregoing minimum doses to any one of the foregoing maximum doses. Specific examples of particular effective amounts contemplated via oral administration can include about 0.02, 0.03, 0.04, 0.05, 0.10, 0.15, 0.20, 0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73,74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275,280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365,370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455,460, 465, 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545,550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635,640, 645, 650, 655, 660, 665, 670, 675, 680, 685, 690, 695, 700, 705, 710, 715, 720, 725,730, 735, 740, 745, 750, 755, 760, 765, 770, 775, 780, 785, 790, 795, 800, 805, 810, 820,825, 830, 835, 840, 845, 850, 855, 860, 865, 870, 875, 880, 885, 890, 895, 900, 905, 910,915, 920, 925, 930, 935, 940, 945, 950, 955, 960, 965, 970, 975, 980, 985, 990, 995, 1000 mg or more. The oral dose can be administered once daily, twice daily, three times daily, or more frequently.

[0341] The dose of the compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), or a pharmaceutically acceptable salt or solvate thereof described herein for use in parenteral administration (e.g., intravenous administration) is generally from about 0.01 to about 300 mg / kg body weight. Examples of dose ranges can include from a minimum dose of about 0.01, 0.10, 0.50, 1, 5, 10, 25, 50, or 100 mg / kg body weight to a maximum dose of about 125, 150, 175, 200, 250, 275, or 300 mg / kg body weight, wherein the dose range can include from any one of the foregoing minimum doses to any one of the foregoing maximum doses. Specific examples of effective amounts contemplated include about 0.02, 0.03, 0.04,0.05, 0.10, 0.15, 0.20, 0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300 mg / kg body weight or more. Continuous intravenous administration is also contemplated for from 1 to 24 hours per day to achieve a target concentration from about 0.01 mg / L blood to about 100 mg / L blood. Exemplary dose ranges can include from a minimum dose of about 0.01, 0.10, 0.25, 0.50, 1, 5, 10, or 25 mg / L blood to a maximum dose of about 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 100 mg / L, wherein an exemplary dose ranges can include from any one of the foregoing minimum doses to any one of the foregoing maximum doses. Specific examples of particular effective amounts contemplated via this route include about 0.02, 0.03, 0.04, 0.05, 0.10, 0.15, 0.20, 0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58,59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83,84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 mg / L blood or more. The dose to be used can depend upon various conditions, and there may be cases wherein doses lower than or greater than the ranges specified above are used.

[0342] The regimen of administration may affect what constitutes an effective amount. The therapeutic formulations may be administered to the patient either prior to or after the onset of acute or post-acute withdrawal. Further, several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection. Further, the dosages of the therapeutic formulations may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.

[0343] Actual dosage levels of the active ingredients in the pharmaceutical compositions may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

[0344] A medical doctor, e.g., physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical compositionrequired. For example, the physician or veterinarian could start doses of the compounds employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

[0345] The invention is further illustrated by the following examples, which are not intended to limit the scope of the claims.Example 1

[0346] In this Example, we demonstrate SP100030 and SPC-839 suppress T cell activation by targeting XPO1. In contrast to existing XPO1 -targeting small molecules, such as Leptomycin B and Selinexor, SP100030 and SPC-839 establish a class of XPO1 modulators with minimal impact on nuclear export and cell viability. Rather, we demonstrate that XPO1 has a chromatin binding function that is selectively impaired by SP 100030 and SPC-839. XPO1 associates with chromatin at hundreds of genes, including co-localizing with NF-KB / AP-1 / NFAT at genes upregulated during T cell activation. SP100030 diminishes the chromatin occupancy of both XPO1 and multiple NF AT factors to impair transcriptional activation at these loci. In vivo studies demonstrate that SP100030 directly engages XPO1 at doses that suppress inflammatory phenotypes in two disease models but lacks the cytopenic effects of Selinexor. This work defines a broad chromatin-binding and transcription factor regulatory role for XPO1 and demonstrates that this role is essential for activation of T cells. Moreover, our studies establish a class of XPO1 modulators whose unique ability to disrupt only a subset of XPOl’s cellular functions can enable therapeutic targeting of XPO1 beyond oncology, including in autoimmune disease.Materials and MethodsStatistical Analysis

[0347] All statistical analyses were performed in GraphPad Prism unless otherwise stated. Replicate description is described in the associated figure legends. No data distributions were assumed for any of the statistical tests. The Mann- Whitney two-sided test was used for single comparisons or multiple comparisons between two groups. For cases of multiple groups are compared to a single control group, the one-way ANOVA followed by Dunn’s multiple comparisons test was used after assessing for normality using both theShapiro-Wilk test and the Kolmogorov-Smirnov test. All p-values less than 0.05 are considered as significant and reported as exact values.Study Approval

[0348] All animal studies were approved by the Case Western Reserve University Institutional Animal Care and Use Committee. De-identified donor blood was obtained from the Case Western Reserve University Hematopoietic Biorepository, which maintains an active Institutional Review Board protocol to enable recruitment of donors and collection / distribution of de-identified blood to research investigators.Cell lines and reagents

[0349] Cell lines were incubated at 37°C with 5% CO2 under humidified conditions. Jurkat E6-1 (TIB- 152), MOLT-4 (CRL-1582), THP-1 (TIB-202), MM. IS (CRL-2974), Loucy (CRL-2629), U-2 OS (HTB-96), and HeLa (CRM-CCL-2) cell lines were all purchased from ATCC. Jurkat NF-KB reporter cell line and IL2 promoter reporter cell line were purchased from BPS Bioscience (NF-KB: 60651; IL2: 60481), and the Jurkat NFAT reporter cell line was purchased from InvivoGen (jktl-nfat). Jurkat, MOLT-4, THP-1, MM. IS, and Loucy cell lines were maintained in glutamine-containing RPMI-1640 supplemented with 10% fetal bovine serum (FBS), 1% penicillin / streptomycin, and 10 mM HEPES. U-2 OS was maintained in McCoy’s 5a medium supplemented with 10% FBS and 1 % penicillin / streptomycin, and HeLa cells were maintained in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin.Isolation of PBMCs and CD3+T cells

[0350] Whole human blood collected by the Case Western Reserve University Hematopoietic Biorepository and Cellular Therapy core facility was layered onto Lymphoprep density gradient medium (STEMCELL Technologies 07851) inside of a SeμMate tube (STEMCELL Technologies, 85450). The mixture was centrifuged and total PBMCs were isolated according to manufacturer’s instructions. Following isolation of PBMCs, the cells were incubated with ammonium chloride red blood cell lysis buffer (eBioscience, 00-4333-57) for 5 minutes at 25°C to remove erythrocytes prior to resuspension in glutamine-containing RPMI-1640 supplemented with 10% fetal bovine serum (FBS), 1% penicillin / streptomycin, and 10 mM HEPES for subsequent assays. To isolate CD3+T cells,whole human blood was incubated with RosetteSep Human T Cell Enrichment Cocktail (STEMCELL Technologies, 15061) for 10 minutes at 25 °C prior to layering onto Lymphoprep. siRNA and plasmid delivery

[0351] Pooled siRNA targeting XPO1 was purchased from Dharmacon (ON- TARGETplus siRNA SMARTPool) and Thermo Fisher Scientific (Silencer Select S14937, s 14938, sl4939). Pooled siRNA non-targeting control was purchased from Dharmacon (ON- TARGETplus Non-targeting Pool). Plasmid expressing firefly luciferase driven by the activity of the AP-1 promoter was obtained from Promega (E4111). siRNA and AP-1 plasmid was delivered to Jurkat cells via electroporation using the Lonza 4D-Nucleofector system using the SE Cell Line 4D-Nucleofector Kit according to manufacturer’ s instructions. Cells were allowed to recover for 48-96 hours after siRNA electroporation prior to being plated for RT-qPCR, or were used immediately for AP-1 luciferase assays following plasmid electroporation.Cellular activation

[0352] Human cells (PBMCs or Jurkats) were activated with either a cocktail of PMA (50 nM, Cayman Chemical) and lonomycin (1 μM, Cayman Chemical) or a combination of 1 pg / mL anti-human CD3 (eBioscience, OKT3) and 3 pg / mL anti-human CD28 (eBioscience, CD28.2) in soluble form. For cells derived from mice, a combination of 1 pg / mL UltraLeaf anti-mouse CD3 (BioLegend, Clone 17A2) and 3 pg / mL UltraLeaf anti-mouse CD28 (Biolegend, Clone 37.51) was used.Luciferase assay

[0353] Jurkat reporter cell lines or cells transfected with the AP-1 plasmid were plated at a density of 25,000 cells in 50 μL culture in 96-well or 384-well plates. Cells were activated with PMA and lonomycin as described above and treated with inhibitors for 6 hours at 37°C. 50 μL of Bright-Glo Luciferase Assay System (Promega) was added to each well for cells expressing firefly luciferase driven by NF-KB, AP-1, and IL2 promoter activities and the contents mixed on an orbital shaker at 25°C for 15 minutes. Luminescence was recorded using Biotek Synergy Neo2 microplate reader. For the Jurkat NFAT reporter cell line, 50 μL of Quanti-Luc (InvivoGen) was added to 10 μL of the culture media 6 hours after activation.RT-qPCR

[0354] 500,000 cells were plated in 1 mL of culture media and activated for 6 hours at37°C using PMA / Ionomycin or anti-CD3 / anti-CD28 as described above. RNA from each sample was collected using QIAGEN RNEasy Kit (QIAGEN, 74106) according to manufacturer’s instructions. RNA quality and quantity was assessed with a Nanodrop Spectrophotometer, and cDNA was made using High-Capacity RNA-to-cDNA Kit (Applied Biosystems, 4387406). Exon-spanning Taqman primers used in this study included the following: GAPDH (Hs02786624_gl, Mm99999915_gl), XPO1 (Hs00185645_ml), IL2 (Hs00174114_ml, Mm00434256_ml), CSF2 (Mm01290062_ml), IFNG (Mm01168134_ml), IL4 (Mm00445259_ml), IL13 (Mm00434204_ml), CCL2 (Mm00441242_ml), CCL3 (Mm00441259_gl), IL6 (Mm00446190_ml), IL1B (Mm00434228_ml), CXCL1 (Mm04207460_ml), and TNF (Mm00443258_ml). Detection of relative transcript levels by quantitative PCR was achieved using the QuantStudio 7 Flex System. All results were normalized relative to GAPDH control.IL2 ELISA assay

[0355] Jurkat cells or human PBMCs were plated at a density of 1 million cells in 1 mL of culture media. Cells were activated with PMA / Ionomycin (Jurkat) or anti-CD3 / anti-CD28 (PBMCs) as described above with and without inhibitor treatment for 24 hours at 37°C. Cell culture media was aspirated and used as input for IL2 Human Instant ELISA Kit (Invitrogen, BMS221INST) according to manufacturer’s instructions. Colorimetric develoμment of each sample was measured using Biotek Synergy Neo2 microplate reader.Transcriptomics analysis

[0356] The RNA for at least 1 million Jurkat cells was isolated per sample as described in RT-qPCR. Cells were treated with 1 μM of SP100030 or 1 μM Selinexor. Samples were submitted to Genewiz for quality control using Nanodrop, RNA Qubit, and Agilent TapeStation system followed by polyA selection and library preparation. Libraries were sequenced with paired-end 150bp reads with a depth of 30 million reads per sample. To analyze gene expression changes, reads were aligned to the hg38 genome build using kallisto vO.46.1. The transcripts were quantified in transcript per million (TPM), which was further processed into gene-level TPM abundance using tximport. Differential gene expressionanalysis was conducted using edgeR v3.36.0, and significant genes were called based on an adjusted p-value less than 0.05 with a log2FC greater than 1. Gene set enrichment analysis was generated from the c2.cp.keg database using 1000 permutations. Additional RNA-Seq gene expression data for HeLa, THP-1, Loucy, and U-2 OS were obtained from the Cancer Cell Line Encyclopedia.Small molecule synthesis and validation

[0357] Small molecules purchased for this study included SP100030 (Tocris Bioscience, 5309), Selinexor (Selleckchem, S7252), Leptomycin B (Cayman Chemical, 10004976), Cyclosporin A (Cayman Chemical, 12088), and Sotrastaurin (Selleckchem, S2791). All other small molecules mentioned in this study were synthesized, with their purity and identity validated using1H NMR and LC-MS. Methods and characterization of newly synthesized small molecules are found in the supplementary Chemical Characterization section.In- gel fluorescence

[0358] Jurkat cells were plated at a density of 500,000 cells in 1 mL of culture media and treated with alkyne-functionalized small molecules (SP- Alkyne, SPC-Alkyne, Selinexor- Alkyne) and competitors for 1 hour at 37°C. After incubation, the cells were washed twice with PBS and resuspended in PBS containing Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific, 78440). Cells were lysed with the Fisher Scientific Sonic Dismembrator Model 60 using 15 x 1 second pulses at power level 3 and 4°C. Protein concentrations were quantified using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, 23225) and colorimetic develoμment was measured using Biotek Synergy Neo2 microplate reader. Recombinant XPO1 used for in- gel fluorescence was purchased from Abnova (H00007514-P01). After normalizing for protein concentration for SDS-PAGE, the following was added to 20.75 μL of protein lysate to initiate click chemistry: (1) 1.5 μL of 20% SDS, (2) 0.5 μL of 5 mM Cy3.5-azide (Kerafast, FLP358), (3) 0.5 μL of 50 mM TCEP, (4) 1.25 μL of 1 mM TBTA, and (5) 0.5 μL of 50 mM CuSCL. After incubation at 25 °C for 1 hour, reducing agent (Invitrogen, B009) and sample loading buffer (Invitrogen, B007) were added to each sample. Samples were resolved on 4%-12% gradient gels (Invitrogen, NW04122BOX) and fluorescence was captured on the LLCOR Odyssey Fc Imaging System.Chemoproteomics Affinity Enrichment

[0359] 10 million Jurkat cells were plated in a T175 flask. Cells were treated with 1 μM SP- Alkyne (with and without 10 μM SP 100030), or 200 nM SPC- Alkyne (with and without 10 μM SPC-839) for 1 hour at 37°C. After incubation, cells were washed twice with PBS and resuspended in 1 mL PBS containing Halt Protease and Phosphatase Inhibitor Cocktail. The cells were lysed with the Fisher Scientific Sonic Dismembrator Model 60 using two rounds of 20 x 1 second pulses at power level 4 and 4°C. To initiate click chemistry, the following was added to each sample: (1) 20 μL of 20% SDS, (2) 10 uL 5 mM biotin-PEG4-azide (Invitrogen, B10184), (3) 20 uL of 50 mM TCEP, (4) 60 uL of 1 mM TBTA, and (5) 0.5 μL of 50 mM CuSO4. After incubation at 25°C for 1 hour, the samples were precipitated in 10 mL of acetone at -20°C overnight. Protein was pelleted at 4000xg at 4°C for 20 minutes, washed 3 times with 2 mL of cold acetone, then allowed to air dry for 1 hour. The protein pellet was then resuspended in 100 mM Tris pH 8.0 supplemented with 0.1% SDS. Excess biotin was removed from each sample using Zeba Spin Desalting Columns (Thermo Fisher Scientific, 89891). Afterwards, each sample was incubated with 100 μL of streptavidin magnetic beads (Thermo Fisher Scientific, 88816) overnight at 4°C. After discarding flowthrough, the beads were washed three times and the samples were eluted at 90°C for 5 minutes using SDS-PAGE loading buffer containing reducing agent.Liquid Chromatography Tandem Mass Spectrometry

[0360] Samples were reduced with 10 mM dithiothreitol (DTT) and precipitated with 10 volumes of 10% trichloroacetic acid in acetone overnight. Samples were washed three times with cold acetone before reducing with 10 mM DTT in 3 M urea followed by alkylation with 25 mM iodoacetamide. Lysyl endopeptidase (Wako Chemicals USA, 12505061) was added for 1 hour followed by the addition of trypsin overnight at 37°C. Samples were analyzed on an Orbitrap Eclipse mass spectrometer (Thermo Electron, San Jose, CA) equipped with a Waters nanoACQUITY LC system (Waters, Taunton, MA). Peptides were desalted in a trap column (180 μm x 20 mm, packed with C18 Symmetry, 5μm, 100A, Waters, Taunton, MA) and subsequently resolved on a reversed phase column (75μm x 250 mm nano column, packed with C18 BEH130, 1.7μm, 130A (Waters, Taunton, MA). Liquid chromatography was carried out at ambient temperature at a flow rate of 300 nL / min using a gradient mixture of 0.1% formic acid in water (solvent A) and 0.1% formic acid inacetonitrile (solvent B). The gradient employed ranged from 1 to 60% solvent B over 90 min Nanospray was conducted in positive ion mode with a voltage of 2.4 kV. A full scan was obtained for eluted peptides in the range of 375-1500 atomic mass units followed by twenty- five data dependent MS / MS scans. MS / MS spectra were generated by collision- induced dissociation of the peptide ions at normalized collision energy of 35% to generate a series of b- and y-ions as major fragments. LC / MS / MS results were analyzed in Mascot (version 2.4.1) (Matrix Science, London, UK) using the human Uniprot database (20432 proteins) with the following search settings: trypsin enzyme specificity; mass accuracy window for precursor ion, 25 pμm; mass accuracy window for fragment ions, 0.8Da; variable modifications including carbamidomethylation of cysteine, 1 missed cleavage and oxidation of methionine.Generating XPO1 C528S cells with CRISPR / Cas9

[0361] The XPO1 C528S mutation was introduced as previously described with modifications. The Cys528Ser donor oligonucleotide was synthesized by IDT with the following sequence (intended mutations lower case): 5’- GCTAAATAAGTATTATGTTGTTACAATAAATAATACAAATTTGTCTTATTTACAG GATCTATTAGGATTATcaGAACAGAAgcGcGGCAAAGATAATAAAGCTATTATTGC ATCAAATATCATGTACATAGTAGG-3’ (SEQ ID NO. 1). Guide RNA oligonucleotide was synthesized by Synthego with default modifications containing the following sequence: 5’-GGAUUAUGUGAACAGAAAAG-3’ (SEQ ID NO: 2). Recombinant SpCas9-2NLS purchased from Synthego was mixed with the guide and the donor template for 10 minutes at room temperature to allow for ribonucleoprotein complex formation (10 μmol Cas9: 10 μmol sgRNA:20 μmol donor template, per million cells). The mixture was then added to 10 million Jurkat cells and delivered using electroporation as described above. After electroporation, the cells were allowed to proliferate for 72 hours prior to selection for resistant clones using 100 nM of Selinexor. After 14 days of selection, the surviving cells were cultured further. Once the surviving cells had grown sufficiently, they were plated in 96-well plates at a density of 0.5 cells per well to isolate single cell-derived colonies containing the desired Cys528Ser mutation.Generating endogenously FLAG-tagged XPO1 cells

[0362] C-terminal fusion of FLAG at the endogenous XPO1 locus in Jurkat cells was achieved using the CETCH-Seq protocol published by Savic et al. pFETCh_Donor (EMM0021) was a gift from Eric Mendenhall & Richard M. Myers (Addgene plasmid # 63934 ; http: / / n2t.net / addgene:63934 ; RRID:Addgene_63934). In brief, the pFETCH donor plasmid was digested with Bsal and BBsI, purified with the Qiagen PCR purification kit (Qiagen 28104), and then integrated with gB locks bearing homology with the 3’ sequences of XPO1 in a Gibson assembly. Guide RNA oligonucleotide was synthesized by Synthego with default modifications containing the following sequence: 5’- UCUCUGCAACUCGUUAGCAG-3’ (SEQ ID NO: 3). Recombinant SpCas9-2NLS was mixed with the guide as described above, and both the donor plasmid and the ribonucleoprotein complex was introduced into Jurkat cells by electroporation. After 3 days, cells were selected using 750 pg / mL of G418 to isolate successfully edited clones.DNA extraction and Sanger sequencing

[0363] Following isolation of single cell derived colonies described above, genomic DNA was collected using the QIAGEN DNEasy Blood & Tissue Kit (QIAGEN, 69504) according to manufacturer’s instructions. The target site containing the intended mutation in XPO1 was amplified using PCR with the following primers as described previously: fwd: 5’- TCTGCCTCTCCGTTGCTTTC (SEQ ID NO: 4), rev: 5’-CCAATCATGTACCCCACAGCT (SEQ ID NO: 5). After PCR amplification, Sanger sequencing was performed using the following primers: fwd: δ’-TGTGTTGGGCAATAGGCTCC (SEQ ID NO: 6), rev: δ’- GGCATTTTTGGGCTATTTTAATGAAA (SEQ ID NO: 7).Cell viability assay

[0364] Jurkat, MOLT-4, MM1.S cells were plated at a density of 25,000 cells in 50 μL culture media in 96-well or 384-well plates and incubated at 37°C with inhibitors to mirror conditions in luciferase assays. For U-2 OS cells, 5,000 cells in 50 μL in 96-well plates was used. After 24 hours (72 hours for U-2 OS), 5 μL of CellTiter-Glo 2.0 (Promega) was added to each well and the contents mixed on an orbital shaker at 25°C for 15 minutes. Luminescence was recorded using Biotek Synergy Neo2 microplate reader.Subcellular fractionation

[0365] Jurkat cell pellets were collected for lysate preparation as described above. The cytoplasmic and nuclear fractions were isolated using the abeam nuclear extraction kit (abl 13474) according to manufacturer’s instructions. In brief, cell pellets were resuspended in pre-extraction buffer to isolate the nuclear pellet. Subsequently, the nuclear pellet was sonicated in the extraction buffer using the Fisher Scientific Sonic Dismembrator Model 60 using 10 x 1 second pulses at power level 2 and 4°C. The nuclear lysate fraction was obtained following removal of nuclear debris via centrifugation. LC-MS / MS identification of nuclear proteins was performed using methods described above.Western immunoblotting

[0366] Protein lysate preparation and quantification were performed as described above for in-gel fluorescence. Protein gel transfer onto PVDF membrane was achieved with the iBlot2 Dry Transfer System (Thermo Fisher Scientific), and membranes were blocked with the Pierce Protein-Free T20 Blocking Buffer (Thermo Fisher Scientific, 37571). Primary antibodies used to probe membranes included the following: anti-Beta Actin (Sigma-Aldrich, A3854), anti-XPOl (Bethyl Laboratories, A300-469A), anti-NFATl (Cell Signaling Technologies, 5861), anti-phospho-T199 NPM (Cell Signaling Technologies, 3541), anti- phospho-T3 H3 (Cell Signaling Technologies, 13576), anti-H3 (Cell Signaling Technologies, 4499), anti-FOS (Cell Signaling Technologies, 2250), anti-phospho-S32 FOS (Cell Signaling Technologies, 5348), anti-JUN (Cell Signaling Technologies, 9165), anti-phospho-S73 JUN (Cell Signaling Technologies, 3270), anti-NFAT2 (Cell Signaling Technologies, 8032), anti- RelA / p65 (Cell Signaling Technologies, 8242), anti-ETSl (Cell Signaling Technologies, 14069), anti-RUNXl / AMLl (Cell Signaling Technologies, 4334), anti-RUNX3 / AML2 (Cell Signaling Technologies, 9647), anti-phospho-T202-Y204 ERK1 / 2 (Cell Signaling Technologies, 4377), and anti-phospho-T180-Y182 p38 (Cell Signaling Technologies, 4511). Following incubation with secondary antibody conjugated to horseradish peroxidase (Cell Signaling Technologies, 7074), membranes were developed using either the SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific, 34580) or the SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 34095). Membranes were imaged using the LI-COR Odyssey Fc Imaging System.Nuclear export inhibition immunofluorescence and analysis

[0367] U-2 OS cells were plated at a density of 4,000 cells in 50 μL of media in a black, clear-bottom 96-well plate (Perkin Elmer, 50-209-9831) and allowed to attach overnight. Cells were then treated with respective inhibitors for 6 hours. Cells were fixed, washed, and stained with either anti-RanBPl (abeam, ab97659) or anti-lKBa (Cell Signaling Technologies, 4814) and DAPI (Sigma-Aldrich, D8417), then imaged using the Operetta High Content Imaging and Analysis System (Perkin Elmer), with 7 fields captured per well at 20X magnification. Images were analyzed using the Harmony software on the Columbus data server (Perkin Elmer). In brief, live cells were identified and their nuclear regions established using DAPI staining. Around those nuclear regions, the cytoplasmic region was defined according to the region of RanBPl or iKBa staining non-overlapping with the nucleus. The nuclear-to-cytoplasmic ratio of total signal intensity for RanBPl or IKBCX staining was calculated based on these criteria, with untreated wells being normalized to 0% and 3 nM Leptomycin B being set to 100%.Electrophoretic mobility shift assay

[0368] IRDye 700 AP-1 Consensus Oligonucleotide and the Odyssey EMSA Kit were both purchased from LI-COR. Nuclear protein lysates were collected according to methods described above, and the EMSA reaction was setup according to manufacturer’s instructions. The samples were resolved with Native PAGE using Novex WedgeWell 8 to 16% Tris- Glycine gradient gels (Invitrogen, XP08160BOX) and a Tris-Glycine buffer system (Invitrogen, LC2672). In-gel fluorescence detection of the IRDye 700 AP-1 Consensus Oligonucleotide was captured using the LI-COR Odyssey Fc Imaging System.CUT&RUN sample preparation

[0369] CUT&RUN samples were prepared using the CUTANA ChIC / CUT&RUN Kit (Epicypher 14-1048) according to manufacturer’s instructions. Cells were treated with 1 μM of SP100030, Selinexor, or SPC-839. 500,000 cells were fixed in culture media supplemented with 1% formaldehyde for 1 minute prior to quenching with 125 mM glycine. Cells were then permeabilized, bound to concanavalin A magnetic beads, and incubated overnight with 0.5 pg of antibodies at 4°C. Primary antibodies used in this work included: anti-XPOl (Bethyl Laboratories, A300-469A), anti-NFATl (Cell Signaling Technologies, 5861), anti-FOS (Cell Signaling Technologies, 2250), anti-JUN (Cell Signaling Technologies, 9165), anti-ATF2 (Cell Signaling Technologies, 35031), anti-NFAT2 (Cell Signaling Technologies, 8032), anti-NFAT4 (Cell Signaling Technologies, 4998), anti-RelA / p65 (Cell Signaling Technologies, 8242), anti-ETSl (Cell Signaling Technologies, 14069), anti-RUNXl / AMLl (Cell Signaling Technologies, 4334), anti-RUNX3 / AML2 (Cell Signaling Technologies, 9647), anti-H3K27Ac (abeam, ab4729), anti-H3K4Me3 (Epicypher, 13-0041 ), anti-FLAG (Cell Signaling Technologies, 14793), and non-targeting IgG control (Epicypher, 13-0042). After overnight incubation and washing to remove excess antibodies, protein A / G MNase was added to the antibody-bound beads and activated with calcium at 4°C for 2 hours to cleave target-bound genomic DNA. After quenching the cleavage reaction, the samples were de-crosslinked under proteinase K treatment, CUT&RUN DNA isolated with column chromatography, and libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs). Libraries were sequenced on the Illumina NovaSeq 6000 with paired-end 150 bp reads at a read depth of 10 million paired-end reads per sample.Peak calling and analysis

[0370] To identify peaks in CUT&RUN samples, raw reads were quality and adaptor trimmed using Trim Galore! Version 0.6.7. Trimmed reads were then aligned to the hg38 genome build using bowtie2 version 2.4.5. Duplicate reads were filtered using Picard MarkDuplicates version 2.18.2.3. RPGC-normalized bigwig and bedgraph files were generated using the bamcoverage function in deeptools version 3.4.3. Peaks were called using SEACR version 1.3 under stringent conditions and normalized to the respective IgG control or using MACS2 version 2.2.7.1 using a q-value cutoff of 0.001. Peak-gene assignments, gene ontology analysis, and peak location distribution for peaks were analyzed using GREAT. The intersect function in bedtools version 2.30.0 was used to determine the overlap of peaks between different cell types and markers presented in this study and to generate high-confidence consensus peak sets among biological replicates for XPO1, FOS, and NFAT1. Venn diagrams and overlaps are visualized using the eulerr package in R or using the following webtool: (http: / / bioinformatics.psb.ugent.be / webtools / Venn / ).Additionally, cumulative density functions that reflect the overlap in occupancy sites between two markers was assessed using the GenometriCorr package. Finally, global aggregate plots for different chromatin markers were generated using the computeMatrix and plotProfilesfunctions in deeptools. For the aggregate plots, RPGC -normalized bigwig files were used for the score files, and the consensus peak set for the respective factors was used as the region file. In addition to data generated in this work, raw ChlP-Seq reads in Jurkat cells for different chromatin marks were obtained from Gene Expression Omnibus (CTCF, GSE68976; H3K9Me3, GSE162605; H3K27Me3, GSE23080). For these data, RPGC- normalized bigwig files were generated in the same way as described above, and peaks were called using MACS2 using their respective input controls at a q-value cutoff of 0.01. Motif enrichment analysis for XPO1 was performed using HOMER v4.11 with the hg38 genome build using peaks that were called with MACS2.Differential binding analysis

[0371] NF ATI CUT&RUN under basal, PMA / Iono activated, and SP100030 treatment was performed in duplicate in Jurkat cells. Differential binding analysis between the activated group and SP 100030 group was performed on NF ATI consensus peaks using the Diffbind package version 2.10.0. Functional peaks were defined according to differentially expressed genes obtained from transcriptomic analysis (log2FC > 1 between PMA / Iono vs. basal).Animal studies

[0372] The Case Western Reserve University Institutional Animal Care & Use Committee reviewed and approved all of the studies and protocols described in this study. To induce pulmonary fibrosis, 8- week-old female C57BL / 6 mice were injected with 100 mg / kg bleomycin retro-orbitally. To induce graft versus host disease, 8-week-old BALB / c mice were dosed with 9 Gy of radiation and received a combination of 1 .5 million total bone marrow cells and 150,000 splenic T cells from C57BL / 6 donors via retro-orbital injection. All therapeutic treatments were delivered via intraperitoneal injections using the following formulation: 10% EtOH, 5% Kolliphor EL (Sigma- Aldrich, C5135), 85% D5W (Dextrose 5% in Water; Dextrose, Sigma- Aldrich, D9434). After euthanization, complete blood count was performed using the Hemavet 950FS Hematology Analyzer. Serum was submitted to University Hospitals Cleveland Medical Center for a comprehensive metabolic panel. The bone marrow, spleen, and lung tissues were homogenized using BeadBug 6 PositionHomogenizer to collect RNA and protein lysates for processing using the methods described previously.Flow cytometry

[0373] Peripheral blood was collected after isoflurane inhalation via cardiac puncture or via submandibular vein puncture. Splenocytes were collected by mincing spleens through a 40 μm filter, and bone marrow cells were collected by flushing hind limb bones. After lysing red blood cells using ammonium chloride buffer (eBioscience, 00-4333-57), cellularity was measured using trypan blue and cells were stained with antibodies and fixed with 1 % paraformaldehyde. Data were collected using an LSR II flow cytometer (BD Biosciences) and analysis performed using FlowJo version 10.8.2 (Treestar). Antibodies against the following were used in this study: CDl lb (BioLegend, Clone MI / 70), CD45R / B220 (BioLegend, Clone RA3-6B2), CD3e (BioLegend, Clone 500A2), CD4 (BioLegend, Clone RM4-4), and CD8 (BioLegend, Clone 53-6.7). Cells were first gated for live cells and singlets using forward and side scatter, and lymphoid cells were then selected based on absence of CD1 lb. T cells were gated by their absence of CD45R / B220 and presence of CD3E, followed by measurement of populations that are single positive for either CD4 or CD8.Liver histology

[0374] The left median lobe of each mouse liver was collected and fixed in 10% neutral buffered formalin for 24 hours before transferring into PBS. Samples were submitted to Histowiz for immunohistochemistry staining for CD3+ cells and for image quantification.ResultsSP100030 and SPC-839 are potent inhibitors of T cell activation

[0375] Previous phenotypic screens used Jurkat T-ALL cells to establish that SP100030 and SPC-839 block AP-1 / NF-KB activity and suppress T cell activation, and later studies demonstrated the efficacy of these molecules in in vivo models of autoimmune disease. We first confirmed that SP 100030 and SPC-839 suppressed luciferase reporter constructs for AP- 1 and NF-KB in cells activated with phorbol 12-myristate 13-acetate and ionomycin (PMA / Iono)(Fig. 1 A, Fig. 7A). The transcriptional activity of NF AT, which is known to cooperate with AP- 1 and NF-KB to drive T cell activation, was also suppressed with potencycomparable to that for AP-1 (Fig. 1A). We also confirmed that SP100030 and SPC-839 inhibited IL2 expression, a canonical marker of T cell activation, as assayed using RT-qPCR, ELISA, and an IL2 reporter construct (Fig. IB). Beyond IL2, RNA-sequencing revealed that a large majority of genes upregulated at least 10-fold in response to PMA / Iono were suppressed by SP 100030 treatment, indicating a broad inhibitory effect on T cell activation (Fig. 1C,D, Fig. 7B,C). Additionally, comparable effects were observed whether cells were activated with PMA / Iono (Fig. 1 A-D) or anti-CD3 and anti-CD28 antibodies (Fig. IE). Further, SP100030 and SPC-839 also potently inhibited activation of primary mouse splenocytes (anti-CD3 / anti-CD28) and primary human peripheral blood mononuclear cells (PBMCs; anti-CD3 / anti-CD28 and PMA / Iono)(Fig. 1F,G, Fig. 7D). These studies establish that SP100030 and SPC-839 broadly suppress transcriptional responses to T cell activation across mouse and human T cells.SP100030 and SPC-839 target XPO1 at Cysteine 528 to suppress T Cell Activation

[0376] Although structurally unrelated, SP 100030 and SPC-839 show similar cellular activities and contain thiol-reactive electrophilic functional groups, suggesting they may covalently target a common cellular protein (Fig. 1 A,B). Analogs that removed these electrophilic functional groups did not suppress IL2 production, supporting that SP100030 and SPC-839 likely function by covalent labeling (Fig. 8A,B). To facilitate identification of cellular targets of SP100030 and SPC-839, we synthesized alkynyl derivatives SP-Alkyne and SPC- Alkyne that comparably suppressed IL2 production and AP-1 and NF AT reporters (Fig. 2A,B; Fig. 8C,D). Click chemistry in SPC-Alkyne-treated cell lysates conjugated cyanine to SPC-Alkyne-labeled proteins; subsequent in-gel fluorescence detection revealed that SPC-Alkyne labeled predominantly one protein of ca. 120 kDa at concentrations as low as 12 nM (Fig. 2C). Using a similar approach, SP-Alkyne labeled multiple cellular proteins, including one prominent band at 120 kDa that was labeled at concentrations as low as 37 nM (Fig. 2C).

[0377] To identify proteins labeled by SP-Alkyne and SPC-Alkyne in cells in an unbiased fashion, treated cells were lysed and subjected to click chemistry to conjugate biotin to alkyne-labeled proteins. Affinity chromatography was then used to isolate biotinylated proteins. Subsequent LC-MS / MS proteomic analysis revealed Exportin- 1 (XPO1 / CRM1 ; MW = 121 kDa) as the lone protein targeted by both SP-Alkyne and SPC-Alkyne whoselabeling could be suppressed fully by competition by SP100030 and SPC-839 (Fig. 2D).Both SP- Alkyne and SPC- Alkyne covalently labeled recombinant XPO1, and this interaction was suppressed by pre-treatment with Selinexor, the FDA-approved chemotherapeutic that covalently labels XPO1 at Cys 528 (Fig. 2E). In cells, an alkyne-functionalized Selinexor (Sei- Alkyne) selectively labeled XPO1 as reported previously, but this labeling was abrogated by pretreatment with SP100030 or SPC-839 (Fig. 8E). Likewise, pre-treatment of cells with Selinexor suppressed the 120 kDa band observed for both SP- Alkyne and SPC- Alkyne, further strengthening that these molecules all label Cys528 (Fig. 8F).

[0378] Multiple orthogonal approaches were next used to assess whether targeting XPO1 impacts T cell activation phenotypes. First, knockdown of XPO1 with two distinct pools of siRNA led to suppression of IL2 expression (Fig. 2F, Fig. 8G). Additionally, three established XPO1 C528-targeting small molecules, including Selinexor, S109, and the natural product Leptomycin B, all suppressed AP-1 and NF AT reporters and the expression of IL2 (Fig. 2G-I; Fig. 8H-K). All molecules’ potency in these assays mirrored their potency for covalently targeting XPO1 as measured using in-gel fluorescence). Moreover, RNA sequencing revealed the transcriptional landscape of activated Jurkat cells treated with Selinexor was remarkably similar to those treated with SP 100030, highlighting that a canonical inhibitor of XPO 1 induces the same broad suppression of the transcriptional program of T cell activation as SP100030 (Fig. 2J, Fig. 8L).

[0379] Gold standard’ evidence that a cellular protein is the functional target of a small molecule entails demonstrating that expression of an allele of the putative target protein that resists modulation by the small molecule suppresses the molecule’s cellular phenotypes. To further establish that SP100030, SPC-839, and other XPO 1 -targeting small molecules impair T cell activation by modulating XPO1, we used CRISPR / Cas9 to introduce the XPO1 Cys528Ser (C528S) mutation, which eliminates the nucleophilic thiol needed for covalent labeling. We first confirmed previous reports that this allele provides resistance to the cytotoxic effects of Selinexor and other XPO 1 -targeting small molecules (Fig. 8M,N). Additionally, PMA / Iono induced comparable upregulation of IL2 in WT and XPO1 C528S cells (Fig. 80). SP- Alkyne, SPC-Alkyne, and SeL Alkyne did not label XPO1 in cells homozygous for the C528S allele, providing further evidence that these molecules all covalently label C528 (Fig. 2K). Critically, SP100030, SPC-839, Leptomycin B, Selinexor, and S 109 all lost the ability to suppress both IL2 production and AP-1 transcriptional activityin cells expressing the C528S mutation (Fig. 2L-N; Fig. 8P-R). These data conclusively establish that multiple structural classes of small molecules suppress T cell activation by covalently targeting XPO1 at Cys528.Structurally distinct XPQ1 inhibitors exhibit divergent cellular activity profiles

[0380] Previously established small molecules targeting XPO1 are cytotoxic, and we confirmed that the XPO1 Cys528-targeting ‘Selective Inhibitors of Nuclear Export’ (SINEs) Leptomycin B, Selinexor, and S 109 induced cell death at potencies comparable to their cellular labeling of XPO1 and their suppression of IL2 in T cells (Fig. 3A, Fig. 9A). Cytotoxicity for all three molecules was lost in XPO1 C528S mutant cells, confirming XPO1- mediated cell death (Fig. 9B). In contrast to SINEs, past studies characterizing SP100030 and SPC-839 did not note cytotoxic effects in cell culture or in vivo models. In fact, we observed that these molecules only induced cell death at doses significantly higher than EC50 values for covalent labeling of XPO1 or suppression of IL2 expression, suggesting that SP100030 and SPC-839 have pharmacological effects on XPO1 that are distinct from SINEs despite targeting the same cysteine residue (Fig. 3B). Additional series of small molecules were also identified that showed an even more striking ‘low cytotoxicity’ profile, including CW0134 and CW2158 (Fig. 3b). In a second T-ALL cell line, SP100030 also suppressed IL2 upregulation substantially more potently than cell viability, while Selinexor showed comparable potency in these two assays (Fig. 9C). SP100030 also showed broadly lower cytotoxicity than Selinexor across additional cancer cell lines (Fig. 9D,E). Together, these observations indicate that in contrast to SINEs, a subset of small molecules targeting XPO1 at Cys528 demonstrate a novel ‘low cytotoxicity’ profile. To distinguish such molecules from SINEs, we refer to such molecules here as Selective Inhibitors of Transcriptional Activation (SITAs).

[0381] Since a subset of SINEs including S 109 and Selinexor have been shown to induce degradation of XPO1, we next evaluated how SINEs and SITAs impact XPO1 stability. In Jurkat cells, S109 induced near-complete degradation XPO1 protein within 8 hours, consistent with past reports (Fig. 9F,G). Although Selinexor has previously been noted to induce degradation of XPO1, particularly after more than 24h of treatment, we did not note significant loss of XPO1 after 24h (Fig. 9F). In contrast to S109, none of four tested SITAs functioned as a degrader of XPO1, including CW0134 which differs from S109 onlyby removal of a methyl group (Fig. 9F). These results confirm a third class of XPO1- targeting small molecules, i.e., SINEs that induce degradation of XPO1, and highlight that structural differences as slight as a methyl group can dictate whether C528-targeting ligands induce rapid degradation of XPO1.

[0382] We next evaluated whether the distinct cellular phenotypes observed for SINEs and SITAs stem from differential effects on XPO1 function. We first assessed the inhibition of nuclear export of established XPO1 client proteins by various XPO1 -targeting small molecules. For the SINEs Leptomycin and Selinexor, we observed nuclear retention of RANBP1 and IKBa that largely mirrored the potency with which these molecules covalently label XPO1 (Fig. 3C-E). Interestingly, Leptomycin B induced a stronger nuclear retention phenotype than Selinexor in two cell lines and multiple XPO1 cargo proteins (Fig. 3C,E; Fig. 9H-J). In contrast to these SINEs, the SITAs CW2158, CW0134, SP100030, and SPC- 839 showed modest effects on nuclear retention of these cargo proteins, and only at concentrations above EC50 values required for covalent labeling of XPO1 (Fig 3C-E, Fig. 9H). SITAs also had muted effects on nuclear export relative to SINEs in a second cell line (Fig. 91, J). As an unbiased approach, we performed LC / MS-MS-based proteomic quantitation of nuclear protein levels following SP100030 treatment and noted only a few proteins retained in the nucleus (Fig. 9K). Together these data indicate that SITAs have broadly inferior effects on XPOl’s nuclear export function compared with SINEs.

[0383] In addition to mediating nuclear export, XPO1 also participates in proteinprotein interactions that regulate centromere formation and centrosome duplication during mitosis. We next evaluated phosphorylation of Histone H3 Threonine 3 as a marker of appropriate localization of the chromosomal passenger complex to the centromere, which is known to depend on XPO1 binding to Survivin. We also monitored levels of phospho- Nucleophosmin (T199), a pre-requisite marker of centrosomal duplication, a phenotype that had previously been linked to Leptomycin B. The SINEs Selinexor, Leptomycin, and SI 09 abrogated both pT3 Histone H3 and pT199 Nucleophosmin levels with comparable potency as observed for covalent labeling of XPO1 and other XPO1 -dependent phenotypes including cell death (Fig. 3F, Fig. 9L). These treatments had no effect in XPO1 C528S-expressing cells, confirming that these effects result from direct targeting of XPO1 (Fig. 9M). In contrast to SINEs, four structurally diverse SITAs were unable to diminish pT3 Histone H3 and pT199 Nucleophosmin levels until concentrations substantially higher than EC 50 valuesrequired to covalently target XPO1 in cells, indicating that SITAs do not impair XPOl ’s functions at the centromere or centrosome (Fig. 3F, Fig. 9L). Together, these diverse assays of XPO1 cellular function demonstrate that XPO1 modulators can have broadly distinct effects on XPO1 function in cells, with the novel SITA profile uniquely able to suppress T cell activation phenotypes while having muted effects on cell viability and XPOl’s functions in nuclear export, centromere assembly, and centrosome duplication. XPO1 is a bona fide chromatin factor in T cells and other cell lineages

[0384] To evaluate the mechanism by which XPO1 inhibitors suppress T cell activation, we first assessed the effect of inhibitors on cytoplasmic signaling events that mediate T cell activation. In contrast to the PKC-0 inhibitor sotrastaurin, upstream kinase signaling events were intact following SP100030 or Selinexor treatment (Fig. 10A). Additionally, the nuclear localization of AP-1 and NFAT proteins was unaffected by SP100030, SPC-839, Leptomycin B, or Selinexor, and AP-1 factors retained activating post- translational modifications and bound a consensus DNA sequence despite SP 100030 treatment (Fig. 4A,B Fig. 10B). These data indicate that XPO1 -targeting small molecules do not suppress T cell activation by preventing the appropriate nuclear localization of AP- 1 or NFAT factors.

[0385] The muted impact of SITAs on nuclear export and centrosome / centromere function suggested that SITAs might modulate other cellular functions of XPO1 to suppress T cell activation. Recent work has demonstrated that despite lacking a DNA-binding domain, XPO 1 localizes to chromatin at HOX cluster loci in leukemias driven by chromosomal translocations of nucleoporin proteins that interact with XPO1. Additionally, Selinexor treatment in these cells has been shown to diminish the chromatin binding of XPO 1 and downregulate expression of HOXB genes. We hypothesized XPO1 could have similar chromatin-dependent functions in T cells, despite their lack of nucleoporin translocations, and that loss of XPO 1 from chromatin following small-molecule treatment may explain the failure to upregulate T cell activation genes like JL2. We used CUT&RUN, a recently- developed method that often enables enhanced sensitivity relative to ChlPseq, to profile XPOl’s chromatin interactions in T cells and other cell types. In both primary human T cells and Jurkat cells, several thousand XPO I peaks were obtained, including at genes canonically upregulated during T cell activation like IL2 (Fig. 4C, Fig. 10C). Comparable peak intensityand localization were observed after stimulation with PMA / Iono in Jurkat cells, while peak intensity broadly increased in primary T cells (Fig. 4C). After associating XPO1 peaks in primary CD3+T cells and Jurkat cells with genes, gene ontology analysis revealed significant enrichment for terms relating to T cell activation / differentiation, further indicating XPO1 localizes to genes upregulated during T cell activation (Fig. 4D, Fig. 10D). Critically, highly overlapping peaks were obtained using an anti-FLAG antibody in Jurkat cells edited to express XPO1-FLAG, strongly corroborating results obtained using our anti-XPOl antibody (Fig. 4C, Fig. IOC).

[0386] Interestingly, we did not identify XPO1 peaks in Jurkat cells at the HOXB locus, whereas we confirmed HOXB as a dominant site of XPO 1 localization in Loucy cells (Fig. 10E). To assess whether XPO1 may bind chromatin in a cell type-dependent manner, we performed CUT&RUN profiling of XPO1 in four additional cell lines. 20 to 40 percent of XPO1 peaks found in each cell line were unique to that cell line, and each cell line’s unique XPO1 binding sites enriched for genes with distinct biological processes (Fig. 4E, Fig. 10F,G). In Jurkat, unique XPO1 binding sites were enriched in genes relating to T cell activation (Fig. 4F). Over 2,000 common XPO1 binding sites shared by all five cell lines were also identified; this ‘Shared’ XPO1 gene set enriched for biological functions expected of all cell types including “transcription” and “translation” (Fig. 4E, Fig. 10F,G). Notably, across these five lines, genes associated with an XPO1 peak were expressed roughly two-fold higher than genes lacking an XPO1 peak (Fig. 4H, Fig. 10H). ’Shared’ genes were expressed at even higher levels, further supporting XPO1 as a chromatin factor associated with actively transcribed loci in different cell lineages (Fig. 4G, Fig. 10H).

[0387] We next evaluated whether XPO1 might overlap with other well-studied chromatin marks. No enrichment of XPO1 was observed with marks associated with inactive chromatin, (H3K9Me3 and H3K27Me3), and low enrichment was observed with the boundary factor CTCF (Fig. 4H, Fig. 10C, I). In contrast, XPO1 showed clear enrichment with H3K4Me3, which marks active promoter regions, and strongest enrichment with H3K27Ac, a mark associated with active promoter and enhancer regions (Fig. 4H, Fig. 101). More than 95% of loci marked with XPO1 in Jurkat cells directly overlapped with an H3K27Ac peak, including at IL2 (Fig. 10J). Interestingly, while XPO1 peaks were observed both at sites close to transcription start sites and at more distal regulatory regions, the subset of peaks detected uniquely in Jurkat cells were preferentially found at distal sites, suggestingthat XPO1 ’s cell type-specific interactions favor enhancer elements (Fig. 41). Additionally, we noted that a small number of genes marked with XPO1 and H3K27Ac were nonetheless expressed at very low levels at Jurkat cells (TPM < 1), including IL2. These genes were more likely to be strongly upregulated following stimulation with PMA / Iono than genes lacking an XPO1 peak (Fig. 10K). In fact, any gene was more likely to be upregulated tenfold following PMA / Iono stimulation if marked with XPO1 , further indicating that XPO1 localizes to genes poised for rapid upregulation following T cell activation (Fig. 4J). Together these data establish XPO1 as a bona fide chromatin-binding factor that localizes to active and poised genes in a cell-type dependent manner, including at a wide range of T cell activation genes.Disruption of XPO1 ’s chromatin localization also disrupts localization of NFAT at genes upregulated by T cell activation

[0388] Since XPO1 occupied many genes in resting T cells that become upregulated following activation, we evaluated whether XPO1 might overlap with other transcription factors (TFs) known to drive this transcriptional program. We used CUT&RUN to profile the genome occupancy of multiple AP- 1 and NF-KB TFs in Jurkat cells following PMA / Iono stimulation; since these factors cooperate with NFAT family TFs to drive transcription of many T cell activation genes, we also profiled NFAT1, NFAT2, and NFAT4 (Fig. 5A-C, Fig. 11 A-D). These TFs precisely co-localized with XPO1 across thousands of genomic loci, including the promoter and upstream regulatory regions of IL2 (Fig. 5A-C, Fig. 11 A-C). Remarkably, more than 80% of the genes associated with NFAT1 peaks or FOS peaks contained a co-localized XPO1 peak, including at IL2 and many other genes upregulated during T cell activation (Fig. 5D, Fig. HE). Comparable overlap was also observed in primary human T cells, where 90% of genes associated with NF ATI were also associated with XPO1 following stimulation, further highlighting the strong overlap between XPO1, NFAT, and AP-1 factors in T cells (Fig. 5D).

[0389] Previously the SINE Selinexor has been shown to dissociate XPO1 from chromatin and diminish HOXB gene transcription in leukemia cells harboring oncogenic chromosomal translocations of nucleoporin genes. We next asked whether chromatin interactions for XPO 1 or TFs that drive T cell activation change following small moleculetargeting of XPO1 at C528. In primary human T cells, SP100030 treatment reduced XPOl ’schromatin occupancy, both at specific loci associated with T cell activation and genomewide, by more than 50% after 6 hours of treatment (Fig. 5B,F, Fig. 1 IB). Genes associated with loci at which XPO1 occupancy was reduced by SP100030 treatment were also enriched with functional annotations relating to T cell activation (Fig. HF). Comparable reductions in XPOl’s chromatin occupancy, both at loci associated with T cell activation and genomewide, were also observed in Jurkat cells (Fig. 5A,E, Fig. 11 A). Critically, SP100030 did not alter XPO1 occupancy in Jurkat cells with homozygous expression of the XPO1 C528S allele, providing compelling evidence that altered XPO 1 chromatin occupancy results from direct covalent labeling of at C528 (Fig. 5C,G, Fig. 11C).

[0390] We considered that XPOl ’s chromatin localization prior to PMA / Iono stimulation may be necessary for additional TFs to co-localize and promote transcription during T cell activation. However, in Jurkat cells treated with SP100030, no decrease in genome occupancy was observed for four AP-1 and NF-KB factors (Fig. 5A,E, Fig. 11A,D). In contrast, chromatin occupancy of NFAT1 was severely compromised following SP100030 and Selinexor treatment, both genome-wide and at loci like IL2 and IL21R (Fig. 5A,B,E, Fig. 11 A,B). Reductions in chromatin occupancy were also observed for NFAT2 and NFAT4 (Fig. 1 ID). Notably, although the chromatin localization of these NF AT TFs was strongly diminished, treatment with SP100030, Selinexor, SPC-839, or Leptomycin did not alter the abundance of NF ATI and NFAT2 in the nucleus (Fig. 4B, Fig. 11G). SP100030 treatment also severely impaired NFATl’s chromatin occupancy in human CD3+cells, indicating that loss of XPO1 from chromatin strongly disrupts NFAT’s chromatin localization in primary T cells as well (Fig. 5B,F, Fig. 1 IB). Critically, SP100030 did not abrogate NF ATI occupancy in Jurkat cells with homozygous expression of the XPO1 C528S allele, indicating that NFAT1 chromatin localization is also dependent on targeting of XPO1 at C528 (Fig. 5C,G, Fig. 11C).

[0391] Prior work using genetic manipulations or the drug cyclosporine has established that loss of NFAT activity severely impairs T cell activation, suggesting dissociation of NFAT from chromatin may contribute to the lack of transcriptional upregulation seen following SP100030 treatment. To assess whether SP100030 modulates transcription via XPO1 in an NFAT 1 -dependent manner in Jurkat cells, we focused our analysis on dynamic NFAT1 peaks that were gained upon PMA / Iono activation and lost with SP100030 treatment. Genome-wide, SP100030 depleted NFAT1 binding from 1,817 sites by more than two-fold,whereas it increased NFAT1 binding at only 9 sites (Fig. 5H). These 1,817 sites were associated with more than 300 “NFAT1 -responsive genes” that showed at least a two-fold change in expression following PMA / Iono activation of Jurkat cells. These NF ATI - responsive genes were roughly 10-fold overrepresented among genes that were significantly modulated by SP 100030 or Selinexor compared to their representation across the genome (Fig. 51, Fig. 1 1H). SP100030 and Selinexor also globally blunted the transcriptional changes of the more than 300 NF ATI -responsive genes following PMA / Iono activation. Fig. 5J, Fig. 111). Together, these studies support targeting XPO1 at C528 as an indirect approach to prevent the chromatin localization and transcriptional activity of NFAT during T cell activation.

[0392] Since XPO1 lacks DNA-binding domains, we next used TF motif analysis as an unbiased tool to discover TFs likely to co-occupy chromatin with XPO1. Among XPO1- occupied sites, we found that the ETS:RUNX motif was among the most significantly enriched (Fig. 12A). To further investigate this result, we performed CUT&RUN profiling of ETS-1, RUNX1, and RUNX3 in Jurkat cells to assess their co-localization with XPO1 and whether their chromatin occupancy might be altered by SP100030 treatment. Similar to NFAT factors, ETS-1, RUNX1, and RUNX3 precisely co-localized with XPO1 both at the CSF2 locus and at thousands of loci across the genome (Fig. 12B,C). Among these three ETS / RUNX factors, the chromatin occupancy of RUNX3 was diminished by SP 100030 while ETS-1 and RUNX1 were unaffected. Notably, RUNX3 was detected in the nucleus at levels similar to cells that were not treated with XPO1 modulators (Fig. 12D). Together, these data highlight that XPO1 preferentially occupies genomic loci containing EST / RUNX motifs and reveal RUNX3 as an additional TF whose chromatin occupancy is diminished by targeting XPO1 at C528.SP100030 Suppresses Immunological Disease with Minimal Cytotoxicity

[0393] SP 100030 has demonstrated efficacy in animal models of inflammatory disease, including rheumatoid arthritis, pulmonary fibrosis, and transplant rejection. We first sought to validate the previously-reported efficacy of SP 100030 in the bleomycin- induced model of idiopathic pulmonary fibrosis, in which T cells are established to contribute to disease progression. Using established therapeutic doses of 10 and 30 mg / kg, mice treated with SP100030 for seven days demonstrated dose-dependent suppression of a panel of cytokinesassociated with disease progression (Fig. 13A). Critically, we also established that these therapeutic doses resulted in dose-dependent target engagement with XPO1 in lung and spleen using alkynyl analog SP-Alkyne (Fig. 6A, Fig. 13B). Pre-treatment of mice with Selinexor abrogated SP-Alkyne and Selinexor- Alkyne labeling of XPO1 in homogenized tissue, further establishing that these molecules target XPO1 in vivo (Fig. 13C). These findings indicate that SP 100030 directly targets XPO1 in vivo at doses validated to be efficacious in a disease model.

[0394] We next sought to assess the efficacy of SP100030 and Selinexor in a model of graft- versus-host disease (GvHD), which results directly from pathological T cell activation. We used an established model in which lethally-irradiated B ALB / c mice are infused with a mixture of bone marrow cells and splenic T cells from C57BL / 6 donors. Notably, daily treatment with Selinexor (10 mg / kg) was rapidly lethal in this context, precluding further analysis of its efficacy. In contrast, mice treated daily with 10 mg / kg SP100030 for seven days saw significant decreases in a panel of cytokines produced by T cells in both the bone marrow and the spleen, suggesting that the efficacy observed in pulmonary fibrosis extends to efficacy in GvHD (Fig. 6B, Fig. 13D). Additionally, consistent with a past report, flow cytometry revealed decreases in CD8+T cells and increases in CD4+T cells and in the bone marrow, spleen, and peripheral blood following SP 100030 treatment (Fig. 6C, Fig. 13E, Fig. 14A,B). Furthermore, immunohistochemistry identified fewer CD3+T cells in the liver upon SP100030 treatment, consistent with reduced T cell infiltration (Fig. 6D). These results demonstrate that SP 100030 targets XPO1 in vivo and suppresses multiple measures of T cell- driven pathology / inflammation in GvHD.

[0395] Clinical use of Selinexor is significantly limited by severe toxicities including neutropenia and thrombocytopenia. We next compared the cytotoxic effects of Selinexor and SP100030 in healthy mice using complete blood counts and clinical chemistry as measures of in vivo toxicity. In contrast to the lethality observed in our GvHD model, five daily doses of Selinexor at 10 mg / kg were tolerated in healthy mice but induced marked leukopenia, neutropenia, and modest thrombocytopenia (Fig. 6E). Additionally, serum chemistry analysis revealed significantly elevated AST and alkaline phosphatase following Selinexor treatment, suggestive of damage to the liver parenchyma (Fig. 6F). In contrast, despite comparable XPO1 engagement (Fig. 6A), SP 100030 demonstrated modest leukopenia with no changes to neutrophils and platelets (Fig. 6E). Additionally, AST and alkaline phosphatase levels wereunaffected by SP 100030 treatment (Fig. 6F). These findings suggest that the diminished cytotoxicity of SP100030 and other SITAs relative to SINEs in cultured cells extends to diminished in vivo measures of toxicity and highlight SITAs as promising tools for the study and treatment of inflammatory diseases.Example 2

[0396] The Selective Inhibitor of Nuclear Export, Selinexor (1), was FDA-approved in 2019 as anticancer chemotherapy for patients with relapsed multiple myeloma. Selinexor’ s (Z)-substituted acrylamide electrophile targets Cys528 of Exportin-1 (XPO1 / CRM1), blocks XPOl’s RanGTP-dependent nuclear-to-cytoplasmic export function, and induces cell death (Fig. 1). Other series of SINEs include the highly potent but toxic natural product Leptomycin B (2)10and the dimethyl maleimides S109 (3) and felezonexor (4), which rapidly induce proteasomal degradation of XPO1 (Fig. 1) The p300 inhibitor C646 (5) was also recently reported to induce cytotoxicity and certain other cellular phenotypes via rapid degradation of XPOl (Fig. 15).

[0397] XPO1 also has biological roles beyond nuclear export, including regulation of the centromere and centrosome and localization to chromatin, where it regulates the chromatin occupancy of transcription factors. We demonstrated that certain small molecules can function as partial antagonists of XPOl, selectively impairing XPOl ’s chromatin localization with minimal impact on nuclear export, centromere / centrosome function, and cell viability (Fig. 15). SP100030 (6) and SPC-839 (7), molecules identified by phenotypic screening decades earlier as blocking T cell activation, in fact directly target XPO1 at Cys528 (Fig. 15). As a result, these molecules impaired XPOl’s chromatin occupancy along with the chromatin localization of NF AT transcription factors necessary for T cell activation. However, SP100030, SPC839, and related molecules like CW0134 (8) unexpectedly had muted effects on nuclear export and cytotoxicity (Fig. 15). We termed these molecules, which leverage electrophilic moieties distinct from those found in SINEs, ‘Selective Inhibitors of Transcriptional Activation’, or SITAs. The mechanism by which SITAs target the same Cys528 residue as SINEs but induce distinct cellular phenotypes remains unclear but may involve distinct binding sites in the vicinity of Cys528, different induced conformations of XPOl, differential reversibility of the covalent interaction with XPO1, or other factors.

[0398] Here we characterize sets of analogs of 5 structurally diverse series of small molecule XPO1 modulators: Selinexor, SP100030, SPC-839, CW0134, and S109. Analogs that maintain the electrophilic functionality of these probes but vary substituents distal to the electrophilic moiety often show substantial changes in potency but uniformly maintain the pharmacological activity of the parent molecule. In contrast, even subtle modifications to the electrophilic moiety can transform a SITA to a SINE or to an XPO1 degrader. This extensive characterization of diverse Cys528-targeting small molecules represents a unique case in which the electrophilic moiety itself strongly influences the pharmacological effects of targeting XPO1.Methods

[0399] All commercially available reagents were used as received unless stated otherwise. Reactions were performed at ambient temperature unless otherwise noted. All air- or moisture-sensitive reactions utilized dry solvents, oven-dried glassware, and an argon atmosphere. TLC employed glass plates coated with a 250 μm layer of silica and a UV indicator. TLC plates were visualized with a UV lamp at 254 nm. Flash column chromatography was performed using 230-400 mesh silica gel and a gradient elution. Chemical shifts (5) were calibrated to TMS (0 pμm) or the residual NMR solvent at ambient temperature.N-(3,5-bis(trifluoromethyl)phenyl)-2-chloro-4-(trifluoromethyl)pyrimidine-5-carboxamide (6)

[0400] To a solution of 51 (1000 mg, 4.08 mmol) in EtOAc (55 mL), 52 (1216 mg, 5.31 mmol), and Amberlyst A21 (1000 mg) was added under inert atmosphere at room temperature for 25 h. The reaction mixture was concentrated under reduced pressure. To the residue, water (50 ml) was added, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 100% EtOAc in Hexanes) to provide 6 (1047 mg, 2.39 mmol, 59% yield) as a white solid.1H NMR (500 MHz, CDCh) 8 9.57 (s, 1H), 9.01 (s, 1H), 8.16 (s, 2H), 7.71 (s, 1H).N-(2-carbamoyl-3-methoxyphenyl}thiophene-2-carboxannde (59)

[0401] To a solution of 58 (776 ng, 4.67 mmol) in THF (20 mL), 2-Thiophenecarbonyl chloride (1 g, 7 mmol) was added under inert atmosphere at room temperature for 24 h. Tothe solution, water (20 mL) was added, and the product was extracted with DCM. The combined organic layers were washed with brine, and dried over Na2SO4, filtered, and concentrated under reduced pressure to afford, 59, a yellow solid which was used in the following step without further purification.5-methoxy-2-( thiophen-2-yl)quinazolin-4( 3H)-one ( 60)

[0402] To a solution of 59 in MeOH (50 mL), 4M NaOH in water (50 mL, 200 mmol) was added under inert atmosphere at 100°C for 27 h. To the solution saturated NH4CI in water (50 mL) was added, and the product was extracted with DCM. The combined organic layers were washed with brine, and dried over Na2SO4, filtered, and concentrated under reduced pressure to afford, 60, a yellow solid which was used in the following step without further purification.4-chloro-5-methoxy-2-(thiophen-2-yl)quinazoline (61 )

[0403] To 60, POCI3 (25 mL) was added under inert atmosphere at 100°C for 1 h. To reaction, toluene (100 mL) was added and concentrated under reduced atmosphere. To the residue, water (30 mL) was added, and the product was extracted with DCM. The combined organic layers were washed with brine, and dried over Na2SO4, filtered, and concentrated under reduced pressure to afford, 61, a yellow solid which was used in the following step without further purification.4-hydrazineyl-5-methoxy-2-( thiophen-2-yl)quinazoline ( 62 )

[0404] To a solution of 61 in THF (28 mL), 35% by weight hydrazine (2 mL, 14 mmol) was added under inert atmosphere at room temperature for 2 h. To reaction, water (30 mL) was added, and the product was extracted with DCM. The combined organic layers were washed with brine, and dried over Na2SO4, filtered, and concentrated under reduced pressure to afford a yellow residue. The residue was purified by silica flash chromatography (50% to 100% EtOAc in Hexanes) to provide 62 (827 mg, 3.0 mmol, 65% yield over 4 steps).1 -(( 5-methoxy-2-( thiophen-2-yl)quinazolin-4-yl)amino)-3 -methyl- lH-pyrrole-2, 5 -dione (7)

[0405] To a solution of 62 (73 mg, 0.27 mmol) in CHCh (5.4 mL), Citraconic anhydride (30 mg, 0.27 mmol) was added under inert atmosphere at 61 °C for 15 h. The solution was cooled to room temperature, water (20 mL) was added, and the product wasextracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 100% EtOAc in Hexanes) to provide 7 (61 mg, 0.17 mmol, 62% yield) as a white solid.]H NMR (500 MHz, CD2C12) 5 9.39 (s, 1H), 7.84 - 7.79 (m, 1H), 7.60 - 7.52 (m, 1H), 7.43 (d, J = 8.4 Hz, 1H), 7.38 (d, J = 4.9 Hz, 1H), 7.07 (ddt, J = 4.9, 3.5, 1 .5 Hz, 1 H), 6.63 (d, J = 8.5 Hz, 2H), 3.84 (d, J = 2.5 Hz, 3H), 2.26 (t, J = 1 .6 Hz, 3H). l-((6-chloro-5-(trifluoromethyl}T)yridin-2-yl}amino}-3-methyl-lH-T)yrrole-2,5-dione (8)

[0406] To a solution of 86 (3.3 mL, 30.7 mmol) in Ethanol (100 mL), was carefully added hydrazine hydrate solution (11.4 mL, 153.4 mmol). The reaction mixture was stirred at room temperature. After 5 h the reaction mixture was partially concentrated, and water (100 mL) was added to precipitate out the products. The precipitate was filtered and washed with water, dried under vacuum to afford a beige solid. The crude compound was purified by flash column chromatography (0 to 100% EtOAc in Hexanes) on silica to afford 2-chloro-6- hydrazineyl-3-(trifluoromethyl)pyridine (2.62 g, 12.4 mmol, 40% yield).

[0407] To a solution of 2-chloro-6-hydrazineyl-3-(trifluoromethyl)pyridine (100 mg, 0.47 mmol) in CHCI3 (10 mL), was added Citraconic anhydride (53 mg, 0.47 mmol) under inert atmosphere at 61 °C for 16 h. This solid was then heated in glacial acetic acid at 70°C for 2 hr. The reaction mixture was then poured into ice-cold water and a white solid was filtered. The crude product was purified by flash column chromatography (Hexanes / Ethyl acetate) on silica to give 8 (31 mg, 37% yield) as a white solid. TLC (Hexanes: Ethyl acetate, 2:1 v / v): Rf= 0.33;1H NMR (500 MHz, CDCI3): δ 7.79 -7.81 (d, 1H), 6.80 (brs, 1H), 6.52 (s, 1H), 6.51-6.52 (d, 1H), 2.20 (s, 3H).N-( 3, 5-bis( trifluoromethyl)phenyl )-6-chloro-4-( trifluoromethyl jnicotinamide ( 9 )

[0408] To a solution of 6-chloro-4-(trifluoromethyl)nicotinic acid (226 mg, 1 mmol) and DMF (4 μL, 0.05 mmol) in DCM (2 mL), (COClh (175.1 μL, 2 mmol) was added dropwise under inert atmosphere at room temperature for 1 h to generate 56. The reaction mixture was concentrated under reduced pressure. To the residue resuspended in DMF (2 mL), Na2CO3 (210 mg, 2 mmol) and 52 (229.13 mg, 1 mmol) was added dropwise under inert atmosphere at room temperature for 16 h and concentrated under reduced pressure. To the residue, water (25 ml) was added, and the product was extracted with DCM. Thecombined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 75% EtOAc in Hexanes) to provide 9 (15 mg, 0.034 mmol, 7.7% yield) as a white solid.1H NMR (500 MHz, CDC13) 5 8.74 (s, 1H), 8.09 (s, 2H), 7.91 (s, 1H), 7.73 (s, 1H), 7.71 (s, 1H).N-( 3, 5-bis( trifluoromethyl }phenyl )-2-chloro-4-methylpyrimidine-5-carboxamide (10)

[0409] To a solution of 2-chloro-4-methylpyrimidine-5-carboxylic acid (100 mg, 0.58 mmol) and DMF (4 μL, 0.05 mmol) in DCM (1.2 mL), (COC1)2 (100 μL, 1.16 mmol) was added dropwise under inert atmosphere at room temperature for 1 h to generate 57. The reaction mixture was concentrated under reduced pressure. To the residue resuspended in DMF (1.2 mL), NazCCL (123 mg, 1.16 mmol) and 52 (266 mg, 2 mmol) was added dropwise under inert atmosphere at room temperature for 16 h and concentrated under reduced pressure. To the residue, water (25 ml) was added, and the product was extracted with DCM. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 75% EtOAc in Hexanes) to provide 10 (20 mg, 0.052 mmol, 9.0% yield) as a white solid.1H NMR (500 MHz, CDCI3) 5 8.50 (s, 1H), 8.11 (s, 2H), 7.81 (s, 1H), 7.63 (s, 1H), 2.62 (s, 3H).2-chloro-N-(3-fluoro-5-( trifluoromethyl)phenyl)-4-( trifluoromethyl)pyrimidine-5- carboxamide ( 11 )

[0410] To a solution of 51 (103 mg, 0.42 mmol) in DMF (0.56 mL), Na^COs (59 mg, 0.56 mmol) and 54 (50 mg, 0.28 mmol) was added under inert atmosphere at room temperature for 24 h and concentrated under reduced pressure. To the residue, water (25 ml) was added, and the product was extracted with DCM. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 50% EtOAc in Hexanes) to provide 11 (41 mg, 0.11 mmol, 39% yield) as a white solid.]H NMR (500 MHz, CDCI3) 5 8.99 (s, 1H), 8.54 (s, 1H), 7.76 (d, 7 = 9.8 Hz, 1H), 7.51 (s, 1H), 7.20 (d, 7 = 8.1 Hz, 1H).2-chloro-N-( 3, 5 -difluorophenyl )-4-( trifluoromethyl )pyrimidine-5-carboxamide (12)

[0411] To a solution of 51 (200 mg, 0.82 mmol) in DMF (1.6 mL), Na2CO3(173 mg, 1 .63 mmol) and 53 (105 mg, 0.82 mmol) was added under inert atmosphere at room temperature for 18 h and concentrated under reduced pressure. To the residue, water (25 ml) was added, and the product was extracted with DCM. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 75% EtOAc in Hexanes) to provide 12 (87.3 mg, 0.26 mmol, 32% yield) as a white solid.1H NMR (500 MHz, CDCh) 5 9.02 (s, 1H), 7.60 (s, 1H), 7.19 (d, 7 = 7.6 Hz, 2H), 6.75 - 6.67 (m, 1H).2-chloro-N-phenyl-4-( trifluoromethyl )pyrimidine-5 -carboxamide (13)

[0412] To a solution of 51 (220 mg, 0.9 mmol) in DMF (1.8 mL), K2CO3(187 mg, 1.35 mmol) and 55 (92 mg, 1 mmol) was added dropwise under inert atmosphere at room temperature for 24 h and concentrated under reduced pressure. To the residue, water (20 ml) was added, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 50% EtOAc in Hexanes) to provide 13 (110 mg, 0.36 mmol, 41% yield) as a white solid.1H NMR (500 MHz, DMSO) 5 10.82 (s, 1H), 9.42 (s, 1H), 7.72 - 7.62 (m, 2H), 7.40 (t, 7 = 7.9 Hz, 2H), 7. 18 (t, 7 = 7.4 Hz, 1H).4-Chloro-2-(2-thienyl) quinazoline (64)

[0413] A solution of 63 (50 mg, 0.22 mmol) in POCh (3 mL) was placed in a pressure reactor at 120°C for 19 h and cooled to 0°C. The solution was diluted in toluene (5 mL) and concentrated under reduced pressure. To the residue, saturated NaHCCL solution (10 ml) was added slowly, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica chromatography (0 to 75% EtOAc in Hexanes) to yield 64 (48 mg, 0.19 mmol, 88% yield) as a yellow solid.4-hydrazineyl-2-( thiophen-2-yl )quinazoline ( 65 )

[0414] To a solution of 64 (45 mg, 0.18 mmol) in THF (3 mL), hydrazine (46 μL, 1.5 mmol), K2CO3 (40 mg, 0.18 mmol) was added under inert atmosphere at 66°C for 21 h. Tothe solution, water (10 mL) was added, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na^SCd, filtered, and concentrated under reduced pressure to afford a whitish-yellow solid, 65, that was used without further purification.3 -methyl- 1 -((2-( thiophen -2 -yl )quinazolin-4-yl )amino )-l H-pyrrole-2,5-dione (19)

[0415] To 65 in CHCh (3 mL), citraconic anhydride (53 mg, 0.48 mmol) was added under inert atmosphere at 61 °C for 19 h. The solution was cooled to room temperature, water (20 mL) was added, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 100% EtOAc in Hexanes) to provide 19 (6 mg, 0.019 mmol, 10% yield over 2 steps) as a white solid. TLC (Hexanes: Ethyl acetate, 2:1 v / v): Rf=0.43;1H NMR (500 MHz, CDCI3) 5 8.17 (s, 1H), 7.85 (s, 1H), 7.77 (d, J = 8.4 Hz, 1H), 7.70 - 7.63 (m, 2H), 7.41 (d, J = 4.9 Hz, 1H), 7.23 (t, J = 7.6 Hz, 1H), 7. 10 (q, J = 3.4 Hz, 1H), 6.69 - 6.65 (m, 1H), 2.30 (d, 7 = 2. 1 Hz, 3H). m / z: [M+H]+calcd. for C17H12N4O2S, 336.06; found, 337.02.4-hydrazmeyl-2-( trifluoromethyl)quinazolme (71 )

[0416] A solution of 68 (50 mg, 0.23 mmol) in POCI3 (3 mL) was placed in a pressure reactor at 120°C for 19 h and cooled to 0°C. The solution was diluted in toluene (5 mL) and concentrated under reduced pressure. To the residue, saturated NaHC'CL solution (10 ml) was added slowly, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica chromatography (0 to 100% EtOAc in Hexanes) to yield 4- chloro-2-(trifluoromethyl)quinazoline (18.8 mg, 0.08 mmol, 35% yield) as a white solid.

[0417] To a solution of 4-chloro-2-(trifhioromethyl)quinazoline (18.8 mg, 0.08 mmol) in THF (3 mL), hydrazine (10.4 μL, 0.32 mmol) and K2CO3 (17 mg, 0.12 mmol) was added under inert atmosphere at 66°C for 18 h. To the solution, water (10 mL) was added, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure to afford a whitish- yellow solid, 71 , that was used without further purification.3-methyl-l-((2-(trifliioromethyl)auinazolin-4-yl)amino)-lH-pyrrole-2,5-dione (20)

[0418] To 71 in CHCI3 (3 mL), Citraconic anhydride (9 mg, 0.08 mmol) was added under inert atmosphere at 61 °C for 21 h. The solution was cooled to room temperature, water (20 mL) was added, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 100% EtOAc in Hexanes) to provide 20 (10.4 mg, 0.032 mmol, 40% yield over 2 steps) as a white solid. TEC (Hexanes: Ethyl acetate, 2:1 v / v): Rf=0.20;1H NMR (500 MHz, CDCh): δ 8.56 (brs, 1H), 7.82 - 7.83 (d, 1H), 7.75 - 7.78 (t, 1H), 7.69 - 7.71 (d, 1H), 7.39 - 7.42 (t, 1H), 6.62 (s, 1H), 2.26 (s, 3H).2-( trifluoromethyl)pyrido[4,3-dlpyrimidin-4-ol ( 69)

[0419] A solution of 66 (500 mg, 3.65 mmol) in trifluoroacetic anhydride (4 mL) was stirred at 80°C for 12 h. The reaction mixture was concentrated under reduced pressure to yield 69 as a yellow solid which was used without further purification.4-hydrazineyl-2-( trifluoromethyl)pyrido[ 4,3-dlpyrimidine ( 72 )

[0420] A solution of 69 (600 mg, 2.79 mmol) in POCI3 (8.25 g, 53.80 mmol) was stirred at 90°C for 1 h. The reaction mixture was concentrated under reduced pressure. The residue was diluted with EtOAc (5 mL) and poured into saturated NaHCO3 solution (10 mL) and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by prep-TLC (SiO2, Petroleum ether : Ethyl acetate = 1 :1, Rt(Pl)=0.72) to afford 4-chloro-2- (trifhioromethyl)pyrido[4,3-d]pyrimidine (42 mg, 0.17 mmol, 6.00% yield) as a yellow solid.

[0421] To a solution of 4-chloro-2-(trifluoromethyl)pyrido[4,3-d]pyrimidine (42 mg, 0.18 mmol) in EtOH (1 mL) was added N2H4 H2O (190 mg, 3.23 mmol). The mixture was stirred at 20°C for 10 min under inert atmosphere. The reaction mixture was concentrated under reduced pressure. Water (5 mL) was added to residue and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to afford a yellow solid, 72, which was used without further purification.3-methyl-l-((2-(trifluoromethyl)pyrido[4,3-d]pyrimidin-4-yl)amino)-lH-pyrrole-2,5-dione (21)

[0422] To a solution of 72 (40 mg, 0.17 mmol) and Citraconic anhydride (20 mg, 0.17 mmol) in toluene (1 mL) was stirred at 110°C for 1 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (HC1 condition, column: Phenomenex Luna 80*30mm*3um; mobile phase: [water (HC1) - ACN]; ACN: 25%-65%, 8 min). The residue was further purified by prep-HPLC (HC1 condition, column: Phenomenex Luna 80*30mm*3um; mobile phase: [water (HC1) - ACN]; ACN: 10%-50%, 8 min) to afford 21 (2.6 mg, 7.3 μmol, 4.2% yield) as a yellow solid. LCMS (ESI) [M + H]+ = 454.1. ‘H NMR (400 MHz DMSO): δ pμm 11.88 - 12.20 (m, 1 H) 9.88 (s, 1 H) 9.03 (d, J=5.87 Hz, 1 H) 7.94 (d, J=5.75 Hz, 1 H) 7.01 (d, J=1 .71 Hz, 1 H) 2.14 (d, J=1.47 Hz, 3 H).2-( trifluoromethyl)pyridof2,3-d]pyrmidip-4-ol (70)

[0423] A solution of 67 (500 mg, 3.65 mmol) in trifluoroacetic anhydride (5 mL) was stirred at 80°C for 12 hrs. The reaction mixture was concentrated under reduced pressure to remove solvent to afford 70 as a yellow solid.4-hydrazineyl-2-( trifluoromethyl)pyrido[ 2, 3-d Ipyrimidine ( 73 )

[0424] A solution of 70 (100 mg, 0.46 mmol) in POCh (2 mL) was stirred at 110°C for 12 h. The reaction mixture was poured into saturated NaHCCh (5 mL) solution and extracted with EtOAc. The combined organic layers were dried over anhydrous NtoSCU. filtered and concentrated under reduced pressure to afford 4-chloro-2-(trifluoromethyl)pyrido[2,3- dlpyrimidine as a brown oil.

[0425] To a solution of 4-chloro-2-(trifluoromethyl)pyrido[2,3-d]pyrimidine (60 mg, 0.26 mmol) in EtOH (2 mL) was added N2H4 H2O (45 mg, 0.77 mmol) at 20°C. The mixture was stirred at 20°C for 10 min under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was diluted with H2O (3 mL) and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to afford a yellow solid, 73, which was used without further purification.3-methyl-l-((2-(trifluoromethyl)pyrido[2,3-d]pyrimidin-4-yl)amino)-lH-pyrrole-2,5-dione (22)

[0426] A solution of 73 (40 mg, 0.17 mmol) and Citraconic anhydride (20 mg, 0.17 mmol, 15.65 uL) in toluene (1 mL) was stirred at 110°C for 1 h under inert atmosphere. The reaction mixture was filtered and purified by prep-HPLC (HC1 condition, column: Phenomenex Luna 80*30mm*3um; mobile phase: [water (HC1) - ACN]; ACN: δ%-35%, 8 min) to afford 22 (26 mg, 17 yield) as a yellow solid. LCMS (ESI) [M + H]+ = 324.1.1H NMR (400 MHz DMSO): δ pμm 11.75 (br s, 1 H) 9.29 (dd, J=4.31 , 1.69 Hz, 1 H) 8.95 (dd, J=8.32, 1.69 Hz, 1 H) 7.90 (dd, J=8.25, 4.38 Hz, 1 H) 6.99 (d, J=1.75 Hz, 1 H) 2.14 (d, J=1.75 Hz, 3 H).13C NMR (100 MHz, DMSO-de): δ 169.5, 168.4, 162.3, 158.9, 158.0, 154.5, 154.2, 145.8, 133.5, 127.6, 125.0, 121.1 , 118.4, 109.0, 11.7. Exact mass calcd. for C13H9F3N5O2 [M+H]: 324.0708; found: 324.0708.2,5-bis( trifluoromethyl)quinazolin-4-ol (82)

[0427] To a solution of 80 (500 mg, 2.5 mmol) and pyridine (970 mg, 12.3 mmol) in acetonitrile (5 mL) was added trifluoroacetic anhydride (1540 g, 7.4 mmol) at 0°C. The mixture was stirred at 20°C for 2 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica flash chromatography (0% to 30% EtOAc in petroleum ether) to afford 82 (650 mg, 2.23 mmol, 91 % yield) as a yellow solid.4-hydrazineyl-2,5-bis( trifluoromethyppuinazoline ( 84)

[0428] A solution of 82 (150 mg, 0.53 mmol) and Lawesson’s reagent (430 mg, 1.06 mmol) in toluene (2 mL) was stirred at 110°C for 12 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (neutral condition, column: Phenomenex Cl 8 75*30mm*3um; mobile phase: [water (NH3H2O+NH4HCO3) - ACN]; ACN%: 10%-50%, 8 min) to afford 2,5- bis(trifluoromethyl)quinazoline-4-thiol (200 mg, 0.57 mmol, 25% yield) as a yellow solid.

[0429] A solution of 2,5-bis(trifluoromethyl)quinazoline-4-thiol (100 mg, 335.34 umol) in EtOH (1 mL) was added hydrazine hydrate (209.84 mg, 3.35 mmol, 203.73 uL, 80% purity) at 20°C. The mixture was stirred at 20°C for 2 hrs under inert atmosphere. The reaction mixture was concentrated under vacuum to afford 84 was obtained as a yellow oil and used directly without further purification.1-(( 2,5-bis( trifluoromethyl)guinazolin-4-yl )amino )-3-methyl-l H-pyrrole-2, 5-dione ( 23 )

[0430] To a solution of 84 (130 mg, 0.44 mmol) and Citraconic anhydride (49 mg, 0.439 mmol) in toluene (1 mL) was stirred at 110°C for 1 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by prep- HPLC (HC1 condition, column: Phenomenex luna Cl 8 80*40mm*3 μm; mobile phase: [water (HC1) - ACN]; ACN%: 45%-75%, 7 min). The residue was purified by prep-HPLC (HC1 condition, column: Phenomenex luna C18 80*40mm*3 μm; mobile phase: [water (HC1) - ACN]; ACN%: δ0%-70%, 7 min) to afford 23 (1.2 mg, 2.54 μmol, 0.58% yield) as a yellow solid. LCMS (ESI) [M + H]+ = 391.0. H NMR (400 MHz CD3OD): δ pμm 8.23 - 8.37 (m, 2 H) 8.08 - 8.17 (m, 1 H) 6.71 (d, J=1.63 Hz, 1 H) 2.17 (d, J=1.75 Hz, 3 H).2-amino-6-bromobenzaniide (74}

[0431] To 2-amino-6-bromobenzoic acid (5 g, 23 mmol) in DMF (50 mL), NH4CI (3.7 g, 69 mmol) and Hexafluorophosphate Azabenzotriazole Tetramethyl Uronium (10.6 g, 27.8 mmol) and N,N-Diisopropylethylamine (9 g, 69 mmol) were added. The mixture was stirred at 20°C for 12 h. The reaction mixture was diluted with water (100 m) and extracted with EtOAc. The combined organic layers were washed with brine, dried over anhydrous N toSCh, filtered and concentrated under reduced pressure to give a residue. The residue was purified by silica flash chromatography (0% to 10% methanol in DCM, 90% petroleum ether) to afford 74 (480 mg, 2.2 mmol, 9% yield) as a white solid.5-bromo-2-(trifluoromethyl}guinazolin-4-ol (76)

[0432] To a solution of 74 (430 mg, 2 mmol) in ACN (5 mL), pyridine (790 mg, 10 mmol) was added at 0°C followed by addition of Trifluoroacetic anhydride (1.26 g, 6 mmol). The mixture was stirred at 20°C for 2 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica flash chromatography (0% to 30% EtOAc in petroleum ether) to afford 76 (480 mg, 1.6 mmol, 80% yield) as a white solid. 5-cyclopropyl-2-(trifluoromethyl)quinazolin-4-ol (78)

[0433] To a solution of 76 (460 mg, 1.6 mmol) and cyclopropylboronic acid (162 mg, 1.9 mmol) in dioxane (1 mL), Pd(dppf)CL CH2C12 (128 mg, 0.156 mmol) and K3PO4 (2.00 g, 9.42 mmol) were added. The mixture was stirred at 80 °C for 12 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified bysilica flash chromatography (0 to 5% EtOAc in petroleum ether) to afford 78 (157 mg, 0.60 mmol, 38% yield) as a yellow solid. l-(( 5-cyclopropyl-2-( trifluoromethyl )quinazolin-4-yl )amino )-3 -methyl- 1 H-pyrrole-2, 5-dione (24)

[0434] A solution of 78 (120 mg, 0.47 mmol) and Lawesson’s reagent (190 mg, 0.47 mmol) in dioxane (2 mL) was stirred at 100 °C for 12 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by preparatory silica TLC (25% EtOAc in petroleum ether) to afford 5-cyclopropyl-2-(trifluoromethyl)quinazoline-4- thiol as a yellow solid (97 mg, 0.35 mmol, 74% yield). To a solution of this solid (77 mg, 0.28 mmol) in EtOH (1 mL), hydrazine hydrate (420 mg, 6.7 mmol) was added. The mixture was stirred at 80°C for 2 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by preparatory silica TLC (25% EtOAc in petroleum ether) to afford 5-cyclopropyl-4-hydrazineyL2-(trifluoromethyl)quinazoline (35 mg, 0.130 mmol, 46% yield) as a yellow oil. A solution of this oil (25 mg, 0.093 mmol) was mixed with toluene (1 mL) and stirred at 110°C for 1 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (HC1 condition, column: Phenomenex Luna 80*30mm*3um; mobile phase: [water (HC1) - ACN]; ACN%: 40%-85%, 8 min) to afford 24 (13 mg, 0.032 mmol, 35% yield) as a white solid. LCMS (ESI) [M + H]+ = 363.1.1H NMR (400 MHz DMSO): 8 pμm 7.78 - 7.94 (m, 2 H) 7.68 (br d, J=5.62 Hz, 1 H) 6.72 (s, 1 H) 2.54 - 2.70 (m, 1 H) 2.18 (s, 3 H) 1.32 (br d, J=8.31 Hz, 2 H) 1.04 (br d, J=5.01 Hz, 2 H).7-bromo-2-( trifluoromethyl )quinazolin-4-ol ( 77 }

[0435] To a solution of 75 (500 mg, 2.3 mmol) and pyridine (920 mg, 11.6 mmol) in ACN (5 mL), Trifluoroacetic anhydride (1.47 g, 7.0 mmol) was added at 0°C. The mixture was stirred at 20°C for 3 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica flash chromatography (0% to 5% EtOAc in petroleum ether) to afford 77 (660 mg, 2.2 mmol, 95% yield) as a white solid.7-cyclopropyl-2-( trifluoromethyl)quinazolin-4-ol (79)

[0436] To a solution of 77 (600 mg, 2.05 mmol) and cyclopropylboronic acid (211 mg, 2.46 mmol) in dioxane (6 mL), K3PO4 (2.61 g, 12.3 mmol) and Pd(dppf)C12 CH2Ch (167 mg,0.205 mmol) were added. The mixture was stirred at 80°C for 12 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica flash chromatography (0% to 2% EtOAc in petroleum ether) to afford 79 (350 mg, 1.18 mmol, 58% yield) as a white solid. l-((7-cyclopropyl-2-(trifluoromethyl)quinazolin-4-yl)amino)-3-methyl-lH-pyrrole-2,5-dione (25)

[0437] A solution of 79 (140 mg, 0.550 mmol) and Lawesson’s reagent (223 mg, 0.551 mmol) in dioxane (1 mL) was stirred at 100°C for 12 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by preparatory silica TLC (33.3% EtOAc in petroleum ether) to afford 7-cyclopropyl-2-(trifluoromethyl)quinazoline-4- thiol as a yellow solid (90 mg, 0.28 mmol, 51% yield). To a solution of this yellow solid (20 mg, 0.074 mmol) in EtOH (1 mL), hydrazine hydrate (40 mg, 0.64 mmol) was added. The mixture was stirred at 80°C for 6 h under inert atmosphere. The reaction mixture was concentrated under vacuum to afford a crude yellow solid (20 mg). This crude yellow solid and Citraconic anhydride (8.4 mg, 0.075 mmol) were combined in toluene (1 mL) and was stirred at 110°C for 1 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (HC1 condition, column: Phenomenex Luna 80*30mm*3um; mobile phase: [water (HC1) - ACN]; ACN%: 35%-55%, 8 min) to afford 25 (5.1 mg, 13 μmol, 17% yield) as a yellow solid. LCMS (ESI) [M + H]+ = 363.0. H NMR (400 MHz CD3OD) 5 pμm 8.15 (d, J=8.75 Hz, 1 H) 7.66 (s, 1 H) 7.51 (br d, J=8.63 Hz, 1 H) 6.71 (s, 1 H) 2.18 (s, 4 H) 1.15 - 1.26 (m, 2 H) 0.90 - 0.99 (m, 2 H).8-fluoro-2-(trifluoromethyl)quiTiazolitt-4-ol (83)

[0438] To a solution of 81 (500 mg, 3.24 mmol) in ACN (5 mL), Trifluoroacetic anhydride (2.04 g, 9.73 mmol) and pyridine (1.28 g, 16.2 mmol) were added at 0°C. The mixture was stirred at 20°C for 3 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica flash chromatography (0% to 10% Methanol in DCM, 90% petroleum) to afford 83 (620 mg, 2.59 mmol, 80% yield) as a yellow oil.8-fluoro-4-hydrazineyl-2-( trifluoromethyDquinazoline ( 85)

[0439] A solution of 83 (100 mg, 0.43 mmol) and Lawesson’s reagent (174 mg, 0.430 mmol) in toluene (2 mL) was stirred at 100 °C for 12 h. The reaction mixture wasconcentrated under reduced pressure. The residue was purified by silica flash chromatography (25% EtOAc in petroleum ether) to afford 8-fluoro-2- (trifluoromethyl)quinazoline-4-thiol as a yellow solid (65 mg, 0.215 mmol, 50% yield). To a solution of this yellow solid (65 mg, 0.262 mmol) in EtOH (1 mL), hydrazine hydrate (290 mg, 4.92 mmol) was added and the mixture was stirred at 80°C for 2 h under inert atmosphere. The mixture was concentrated under reduced pressure. The residue was purified by preparatory silica TLC (50% EtOAc in petroleum ether) to afford 85 (30 mg, 0.122 mmol, 47 % yield) as a pale yellow solid. l-(( 8- fliioro-2-(trifluoromethyi)quinaz,olin-4-yl)amino)-3-methyl-lH-pyrrole-2, 5-dione (26)

[0440] A solution of 85 (20 mg, 0.081 mmol) and Citraconic anhydride (9.11 mg, 0.081 mmol) in toluene (1 mL) was stirred at 110°C for 1 h under inert atmosphere. The reaction was concentrated under reduced pressure. The residue was purified by Prep-HPLC (HC1 condition) (column: Phenomenex Luna 8O*3Omm*3 μm; mobile phase: [water (HCl)-ACN]; ACN%: 30%-60%, 8 min) to afford 26 (18 mg, 0.045 mmol, 56% yield) as a white solid. LCMS (ESI) [M + H]+ = 340.9.1H NMR (400 MHz DMSO): δ pμm 11.56 (s, 1 H) 8.28 (d, J=8.55 Hz, 1 H) 7.93 - 8.02 (m, 1 H) 7.84 - 7.92 (m, 1 H) 6.99 (d, J=1.32 Hz, 1 H) 2.13 (s, 3 H).13C NMR (100 MHz, DMSO-tfe): 169.7, 168.5, 160.3, 158.5, 156.0, 151.7, 151.4, 145.8, 139.3, 139.2, 130.2, 130.1, 127.6, 121.2, 120.3, 120.2, 119.4, 118.4, 115.0, 11.7. Exact mass calcd. for C14H9F4N4O2 [M+H]: 341.0662; Found, 341.0674. l-(( 6-chloro-5-( trifluoromethyl )pyridin-2-yl )( methyl )amino )-3-methyl-lH-pyrrole-2, 5-dione (27)

[0441] To a solution of 86 (1 g, 4.63 mmol) in NMP (1 mL), Diisopropylethylamine (598 mg, 4.63 mmol) and methylhydrazine (1 g, 8.68 mmol) at 20°C. The mixture was stirred at 20°C for 1 hr. The reaction mixture was diluted with water (20 mL) and extracted with EtOAc. The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by silica flash chromatography (0% to 10% EtOAc in petroleum ether) to afford 2- chloro-6-(l-methylhydrazineyl)-3-(trifluoromethyl)pyridine (600 mg, 2.66 mmol, 57% yield) as a yellow solid.

[0442] A solution of 2-chloro-6-(l-methylhydrazineyl)-3-(trifluoromethyl)pyridine (300 mg, 1.33 mmol) and Citraconic anhydride (149 mg, 1.33 mmol) in toluene (1 mL) wasstirred at 100°C for 1 h under inert atmosphere. The reaction mixture was filtered. The residue was purified by Prep-HPLC (HC1 condition, column: Phenomenex Luna C18 75*30mm*3 μm; mobile phase: [H20(0.04% HC1)-ACN]; gradient: ACN: 40%-70%, 8.0 min) to afford 27 (62.7 mg, 0.17 mmol, 13% yield) as a yellow gum. LCMS (ESI) [M + H]+ = 320.0 / 322.01H NMR (400 MHz CD3OD): 6 pμm 7.91 (d, J = 8.8 Hz, 1H), 6.77 (br d, J = 8.9 Hz, 1 H), 6.63 (q, J = 1.8 Hz, 1H), 3.41 (s, 3H), 2.14 (d, J = 1.8 Hz, 3H).13C NMR (100 MHz, DMSO-tL): 168.9, 167.8, 159.7, 146.7, 145.6, 139.5, 127.5, 127.1, 124.8, 122.1, 119.4, 114.8, 114.5, 114.1, 113.8, 105.5, 11.7. Exact mass calcd. for [M+H]: 320.0414; found: 320.0409.3-methyl-l-((5-(trifluoromethyl)pyridin-2-yl)ammo)-lH-pyrrole-2,5-dione (28)

[0443] To 87 (976 mg, 5.5 mmol), 35% by weight hydrazine (2.6 mL) was added under inert atmosphere at 110°C for 21 h, then cooled to room temperature, and had water (20 mL) added to it. The product was extracted with EtOAc and combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure as a yellow oil, which was used in the next step without further purification.

[0444] To a solution of this oil in CHCh (27.5 mL), Citraconic anhydride (926 mg, 8.26 mmol) was added under inert atmosphere at 61 °C for 15 h, then cooled to room temperature, water (40 mL) was added, and the product was extracted with DCM. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 50% EtOAc in Hexanes) to provide 28 (522.2 mg, 1.93 mmol, 35% yield) as a white solid.1H NMR (500 MHz, CDCI3) 5 8.38 (dt, 7 = 2.2, 1.0 Hz, 1H), 7.7O (dd, 7 = 8.7, 2.3 Hz, 1H), 7.12 (s, 1H), 6.65 (d, 7 = 8.7 Hz, 1H), 6.50 (q, 7 = 1.9 Hz, 1H), 2.18 (d, 7 = 1.8 Hz, 3H). l-((6-chloropyridin-2-yl)ammo)-3-methyl-lH-pyrrole-2, 5-dione (29)

[0445] To 88 (5 g, 33 mmol), 35% by weight hydrazine (15 mL) was added under inert atmosphere at 110°C for 28 h, then cooled to 0°C, affording a yellow precipitate. The product was washed with 0°C water which was used in the next step without further purification.

[0446] To the residue in CHCI3 (50 mL), Citraconic anhydride (1180 mg, 8.26 mmol) was added under inert atmosphere at 61 °C for 18 h, then cooled to room temperature, water(200 mL) was added, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 50% EtOAc in Hexanes) to provide 29 (2900 mg, 12.2 mmol, 37% yield) as a white solid. H NMR (500 MHz, CDCI3) 5 7.45 (t, J = 7.9 Hz, 1H), 7.38 (s, 1H), 6.81 (d, J = 7.6 Hz, 1H), 6.48 (q, J = 1 .8 Hz, 1 H), 6.44 (d, J = 8.2 Hz, 1 H), 2. 17 (d, J = 1 .9 Hz, 3H).6-chloro-2,3-bis( trifluoromethyltpyridine ( 89)

[0447] To a solution of 2,3-bis(trifluoromethyl)pyridine (1 g, 4.65 mmol) in TFA (5 mL), 30% by weight H2O2 (1.8 g, 15.88 mmol, 1.53 mL) was added. The mixture was stirred at 70°C for 1 h. The reaction mixture was poured into 10% by weight Na2SOs (20 mL) and extracted with EtOAc. The combined organic layers were washed with NaHCOs, dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to afford 2,3- bis(trifluoromethyl)pyridine-l -oxide as a yellow solid. POOL (3.29 g, 21.46 mmol) was added, and the solution was stirred at 90°C for 12 h. The reaction mixture was concentrated under reduced pressure. The residue was diluted with EtOAc (10 mL), then the mixture was poured into saturated NaHCOs solution (10 mL). The mixture was extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by silica flash chromatography (100% petroleum ether) to afford 89 (120 mg, 0.48 mmol, 13% yield) as a colorless oil.6-hydrazineyl-2,3-bis( trifluoromethyl)pyridine (94)

[0448] To a solution of 89 (120 mg, 0.48 mmol) in EtOH (1 mL), hydrazine hydrate (270 mg, 4.31 mmol) was added at 20 °C. The mixture was stirred at 80°C for 1 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure to remove solvent. The residue was diluted with water (2 mL) and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by preparatory silica TLC (33.3% EtOAc in petroleum ether) to afford 94 (95 mg, 0.39 mmol, 81% yield) as a yellow solid.l-((5,6-bis(trifluoromethyl)pyridin-2-yl)amino)-3-methyl-lH-pyrrole-2,5-dione (30)

[0449] A solution of 94 (80 mg, 0.33 mmol) and Citraconic anhydride (37 mg, 0.33 mmol) in toluene (1 mL) was stirred at 110 °C for 1 h under inert atmosphere. The reaction mixture was filtered. The residue was purified by Prep-HPLC (HC1 condition, column: Phenomenex Luna C18 75*30mm*3um; mobile phase: [H2O (0.04% HC1)-ACN]; gradient: ACN: 40%-70%, 8.0 min) to afford 30 (47 mg, 0.124 mmol, 38% yield) as a white solid. LCMS (ESI) [M + H]+ = 340.0.1H NMR (400 MHz CD3OD): δ pμm 8.07 (d, J = 8.9 Hz, 1H), 7.05 (d, J = 8.8 Hz, 1H), 6.72 - 6.56 (m, 1H), 2.14 (d, J = 1.8 Hz, 3H).13C NMR (100 MHz, DMSO-de): 169.9, 168.8, 158.9, 158.7, 158.5, 145.5, 143.3, 142.9, 139.1, 127.4, 127.2, 124.8, 124.7, 122.1, 122.0, 119.4, 115.5, 115.2, 114.9, 114.5, 110.7, 11.6. Exact mass calcd. for C12H8F6N3O2 [M+H]: 340.0521; found: 340.0524.6-hydrazineyl-2, 3 -bis( trifluoromethyi )pyridine ( 94 )

[0450] To a solution of 86 (3 g, 13.9 mmol) in EtOH (20 mL), hydrazine hydrate (1.53 g, 24.5 mmol) was added at 20°C. The mixture was stirred at 80°C for 12 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica flash chromatography (0% to 1% EtOAc in petroleum ether) to afford 94 (1.73 g, 7.93 mmol, 57% yield) as a white solid. tert-butyl 2-( 6-chloro-5-( trifluorornethyl)pyridin-2-yl)hydrazine-l -carboxylate ( 92 )

[0451] To a solution of 94 (450 mg, 2.13 mmol) in THF (5 mL), TEA (430 mg, 4.25 mmol) was added at 0°C followed by addition of BOC2O (928.39 mg, 4.25 mmol). The mixture was stirred at 20°C for 12 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica flash chromatography (5% EtOAc in petroleum ether) to afford 92 (400 mg, 1.28 mmol, 60% yield) as a yellow solid. tert-butyl 2-( 6-cyclopropyl-5-( trifluoromethyi )pyridin-2-yl ihydrazine-l -carboxylate ( 93 )

[0452] To a solution of 92 (300 mg, 0.96 mmol) in toluene (5 mL) and water (0.5 mL), cyclopropylboronic acid (165 mg, 1.93 mmol), K3PO4 (613 mg, 2.89 mmol), Pd(OAc)2 (21.61 mg, 0.096 mmol) and PPI13 (25.3 mg, 96.3 mmol) were added. The mixture was stirred at 100°C for 12 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica flash chromatography (5% EtOAc in petroleum ether) to afford 93 (65 mg, 0.205 mmol, 21% yield) as a yellow solid.l-((6-cvclopropyl-5-(trifluoromethyl)pyridin-2-yl)amino)-3-methyl-lH-pyrrole-2,5-dione (31 )

[0453] To a solution of 93 (65 mg, 0.205 mmol) in DCM (2 mL), ZnBt2 (231 mg, 1.02 mmol) was added. The mixture was stirred at 20°C for 2 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by preparatory silica TLC (16.6% EtOAc in petroleum ether) to afford 2-cyclopropyl-6-hydrazineyl-3- (trifluoromethyl)pyridine as a brown solid (30 mg, 0.14 mmol, 67% yield). This brown solid (30 mg, 0.134 mmol) was dissolved in toluene (1 mL) followed by addition of Diisopropylethylamine (18 mg, 0.14 mmol) and Citraconic anhydride (15 mg, 0.14 mmol). The mixture was stirred at 110°C for 2 h under inert atmosphere. The residue was purified by Prep-HPLC (column: Phenomenex Luna C18 75*30mm*3 μm; mobile phase: [H2O (0.04%HCl)-ACN]; gradient: ACN: δ0%-80%, 8.0 min) to afford 31 (7.1 mg, 0.020 mmol, 15% yield) as a white solid. LCMS (ESI) [M + H]+ = 312.3.JH NMR (400 MHz CD3OD) 8 pμm 7.70 (d, 7=8.63 Hz, 1 H) 6.63 (q, 7=1.75 Hz, 1 H) 6.53 (d, 7=8.63 Hz, 1 H) 2.14 (d, 7=1.88 Hz, 4 H) 0.84 - 0.89 (m, 2 H) 0.79 (br s, 2 H).N-(2-carbamoyl-3-methoxyphenyl}thiophene-2-carboxamide (59}

[0454] To a solution of 58 (776 mg, 4.67 mmol) in THF (20 mL), 2-Thiophenecarbonyl chloride (1 g, 7 mmol) was added under inert atmosphere at room temperature for 24 h. To the solution, water (20 mL) was added, and the product was extracted with DCM. The combined organic layers were washed with brine, and dried over Na2SO4, filtered, and concentrated under reduced pressure to afford, 59, a yellow solid which was used in the following step without further purification.5-methoxy-2-(thiophen-2-yl}quinazolin-4(3H)-one (60)

[0455] To a solution of 59 in MeOH (50 mL), 4M NaOH in water (50 mL, 200 mmol) was added under inert atmosphere at 100°C for 27 h. To the solution saturated NH4CI in water (50 mL) was added, and the product was extracted with DCM. The combined organic layers were washed with brine, and dried over Na2SO4, filtered, and concentrated under reduced pressure to afford, 60, a yellow solid which was used in the following step without further purification.4-chloro-5-methoxy-2-(thiophen-2-yl)puipaz.oline (61 )

[0456] To 60, POCh 2(25 mL) was added under inert atmosphere at 100°C for 1 h. To reaction, toluene (100 mL) was added and concentrated under reduced atmosphere. To the residue, water (30 mL) was added, and the product was extracted with DCM. The combined organic layers were washed with brine, and dried over Na2SO4, filtered, and concentrated under reduced pressure to afford, 61, a yellow solid which was used in the following step without further purification.4-hydrazineyl-5-methoxy-2-( thiophen-2-yl)quinazoline ( 62 )

[0457] To a solution of 61 in THF (28 mL), 35% by weight hydrazine (2 mL, 14 mmol) was added under inert atmosphere at room temperature for 2 h. To reaction, water (30 mL) was added, and the product was extracted with DCM. The combined organic layers were washed with brine, and dried over Na2SO4, filtered, and concentrated under reduced pressure to afford a yellow residue. The residue was purified by silica flash chromatography (50% to 100% EtOAc in Hexanes) to provide 62 (827 mg, 3.0 mmol, 65% yield over 4 steps).1-((5-methoxy-2-(thiophen-2-yl)quinazolin-4-yl)amino)-lH-pyrrole-2,5-dione (32)

[0458] To a solution of 62 (50 mg, 0.18 mmol) in CHCI3 (4.7 mL), maleic anhydride (27 mg, 0.28 mmol) was added under inert atmosphere at 61 °C for 17 h. The reaction mixture was concentrated under reduced pressure then dissolved in a minimal amount glacial acetic acid then cooled to 0°C. A white precipitate formed which was dried and purified by silica flash chromatography (25% to 100% EtOAc in Hexanes) to provide 32 (12.2 mg, 0.035 mmol, 19% yield) a white solid.1H NMR (500 MHz, CDCI3) 5 9.28 (s, 1H), 7.81 (d, J= 3.6 Hz, 1H), 7.62 (t, 7 = 8.1 Hz, 1H), 7.47 (d, 7 = 8.4 Hz, 1H), 7.38 (d, 7 = 5.0 Hz, 1H), 7.09 - 7.04 (m, 1H), 7.00 (d, 7 = 1.4 Hz, 2H), 6.76 (d, 7 = 8.0 Hz, 1H), 3.97 (s, 3H).2-chloro-6-hydrazineyl-3-( trifluoromethyl)pyridine ( 94 )

[0459] To a solution of 86 (2.5 g, 11.6 mmol) in EtOH (38 mL), K2CO3 (2.4 g, 17.4 mmol) and 35% by weight hydrazine (8 mL) was added under inert atmosphere at room temperature for 16 h. To reaction, water (50 mL) was added, and the product was extracted with DCM. The combined organic layers were washed with brine, and dried over Na2SO4, filtered, and concentrated under reduced pressure to afford a yellow residue. The residue waspurified by silica flash chromatography (0% to 40% EtOAc in Hexanes) to provide 94 (1.14 g, 5.4 mmol, 47% yield).]-(( 6-chloro-5-( trifluoromethyl )pyridin-2-yl lam in o )-3-methyl- 1 H-pyrrole-2,5-dione ( 33 )

[0460] To a solution of 94 (50 mg, 0.24 mmol) in CHCh (2.4 mL), maleic anhydride (34.4 mg, 0.35 mmol) was added under inert atmosphere at 61°C for 16 h, then cooled to room temperature, water (20 mL) was added, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 75% EtOAc in Hexanes) to provide 33 (44.2 mg, 0.14 mmol, 64% yield) as a white solid.1H NMR (500 MHz, CDCh) 8 7.80 (d, J = 8.5 Hz, 1H), 7.38 (s, 1H), 6.89 (s, 2H), 6.57 (d, 7 = 8.5 Hz, 1H).N'-(5-methoxy-2-(thiophen-2-yl)qidnazolin-4-yl}acrylohydrazide (34)

[0461] To a solution of 62 (25 mg, 0.092 mmol) in CHCh (1.8 mL), acryloyl chloride (9.1 mg, 0.10 mmol) was added under inert atmosphere at 61 °C for 22 h. The reaction mixture was then cooled to room temperature, water (20 mL) was added, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 100% EtOAc in hexanes) to provide 34 (21.8 mg, 0.067 mmol, 73% yield) as a white solid.!H NMR (500 MHz, CDCh) 8 10.40 (s, 1H), 9.51 (s, 1H), 7.98 (d, 7 = 3.7 Hz, 1H), 7.58 (1, 7 = 8.1 Hz, 1H), 7.42 (dd, 7 = 16.3, 6.6 Hz, 2H), 7.12 (t, 7 = 4.0 Hz, 1H), 6.76 (d, 7 = 8.0 Hz, 1H), 6.50 (d, 7 = 16.9 Hz, 1H), 6.36 (dd, 7 = 17.0, 10.2 Hz, 1H), 5.83 (d, 7 = 10.3 Hz, 1H), 4.04 (s, 3H).N'-(6-chloro-5-( trifluoromethyl )pyridin-2-yl )acrylohydrazide (35)

[0462] To a solution of 94 (50 mg, 0.24 mmol) in CHC13 (2 mL), acryloyl chloride (21 mg, 0.24 mmol) was added under inert atmosphere at 61 °C for 23 h, then cooled to room temperature, water (20 mL) was added, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 75% EtOAc in Hexanes) to provide 35 (56.7 mg, 0.21 mmol, 88% yield) as a white solid.1H NMR (500 MHz, Dioxane) 8 9.04 (s, 2H), 6.94 (d, 7 = 8.7 Hz,1H), 5.72 (d, 7 = 8.8 Hz, 1H), 5.43 (dd, J = 17.1, 10.2 Hz, 1H), 5.24 (d, J = 17.1 Hz, 1H), 4.74 (d, J = 10.2 Hz, 1H).4-ethyl -5 -hydroxy furan-2( 5H)-one (106)

[0463] Solid morpholine hydrochloride (3.4 g, 28 mmol) was added into a solution of 105 (4.60 g, 31.1 mmol) in dioxane (20 mL) followed by addition of water (3 mL) at 20°C. After all the solid dissolved, 104 (1.93 g, 26.7 mmol) in dioxane (5 mL) was added at 20°C, and the mixture was stirred at 20°C for 3 h and then stirred at 100°C for another 12 h. The reaction mixture was concentrated under reduced pressure. The residue was diluted with water (2 mL) and extracted with EtOAc, the combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under vacuum to afford 106 as a yellow solid which was used in follow up without further purification.3-ethylfuran-2, 5-dione (95)

[0464] To a solution of 106 (200 mg, 1.56 mmol) in DCM (2 mL), DMP (695 mg, 1.64 mmol) was added at 0 °C and the mixture was stirred at 20°C for 2 h. The reaction was filtered and the filtrate was concentrated under vacuum to afford 95 as a yellow oil which was used in follow up without further purification. l-(( 6-chloro-5-( Irifluoromelhyl )pyridin-2-yl)amino )-3-ethyl-l H-pyr role-2, 5-dione ( 36 )

[0465] A solution of 95 (50 mg, 0.40 mmol) and 94 (84 mg, 0.40 mmol) in toluene (1 mL) was stirred at 110°C for 1 h under inert atmosphere. The reaction mixture was filtered. The residue was purified by prep-HPLC (TFA condition, column: Phenomenex Luna C 18 75*30mm*3 μm; mobile phase: [water (TFA) - ACN]; ACN%:35%-65%, 8 min) to afford 36 (4.9 mg, 0.011 mmol, 2.8% yield) as a white solid. LCMS (ESI) [M + H]+ = 320.1 / 322.1.1H NMR (400 MHz CD3OD) 5 pμm 7.90 (d, J=8.77 Hz, 1 H) 6.73 - 6.79 (m, 1 H) 6.60 (t, J=1.97 Hz, 1 H) 2.37 - 2.69 (m, 2 H) 1.27 (t, J=7.34 Hz, 3 H). diethyl 2-isopropylmaleate (102)

[0466] To a solution of 100 (500 mg, 3.47 mmol) in THF (5 mL), 60% sodium hydride dispersed in mineral oil (166 mg, 4. 16 mmol) was at 0°C. The mixture was stirred at 0°C for 0.5 h under inert atmosphere. Then ethyl 2-(diethoxyphosphoryl)acetate (933 mg, 4.16 mmol) was added, the mixture was stirred at 20 °C for 2 h under inert atmosphere. The reactionmixture was poured into saturated NH4CI (10 mL) solution and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under vacuum to afford 102 (700 mg) as a yellow oil which was used without further purification.3-isopropylfuran-2,5-dione (96)

[0467] To a solution of 102 (350 mg, 1.63 mmol) in THF (3 mL) and H2O (0.6 mL), LiOH H2O (171 mg, 4.08 mmol) was added. The mixture was stirred at 20°C for 1 h. The reaction mixture was diluted with water (2 mL) and extracted with EtOAc. The aqueous layer was adjusted to pH= 5-6 by addition of HC1 (1 mol / mL) and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under vacuum to afford a yellow oil containing 2-isopropylmaleic acid (180 mg). This solution of yellow oil (180 mg, 1.14 mmol) in AC2O (232.4 mg, 2.28 mmol) was stirred at 120°C for 12 h. The reaction mixture was concentrated under vacuum to afford 96 (120 mg) as a yellow oil without further purification. l-((6-chloro-5-(trifluoromethyl)pyridin-2-yl)amino)-3-isopropyl-lH-pyrrole-2,5-dione (37)

[0468] A solution of 96 (20 mg, 0.095 mmol) and 94 (13.25 mg, 0.095 mmol) in toluene (1 mL) was stirred at 110 °C for 1 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (HO condition, column: Phenomenex Luna 80*30mm*3 μm; mobile phase: [water (HC1) - ACN]; ACN%: 40%-70%, 8 min) to afford 37 (12.9 mg, 0.035 mmol, 36.7% yield) as a white solid. LCMS (ESI) [M + H]+ = 334.0 / 336.0.1H NMR (400 MHz CD3OD) 5 pμm 7.90 (d, J=8.63 Hz, 1 H) 6.75 (d, J=8.63 Hz, 1 H) 6.57 (d, J=1.63 Hz, 1 H) 2.89 (dtd, J=13.71 , 6.87, 6.87, 1.44 Hz, 1 H) 1.28 (d, J=6.75 Hz, 6 H). diethyl 2 -cyclopropylmaleate (103)

[0469] To a solution of ethyl 2-(diethoxyphosphoryl)acetate (789 mg, 3.52 mmol) in THF (10 mL) was added 60% sodium hydride dispersed in mineral oil (281 mg, 7.03 mmol) at 0°C. The mixture was stirred at 0°C for 0.5 h, then 101 (500 mg, 3.52 mmol) was added, the mixture was stirred at 50°C for 2 h. The reaction mixture was poured into saturated NH4CI (10 mL) and extracted with EtOAc. The combined organic layers were dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue waspurified by silica flash chromatography (0% to 1% EtOAc in petroleum ether) to afford 103 (130 mg, 613 mmol, 17% yield) as a yellow oil.3-cyclopropylfuran-2,5-dione (97)

[0470] To a solution of 103 (130 mg, 0.612 mmol) in THF (1 mL) and water (1 mL) and MeOH (0.1 mL), LiOH EhO (103 mg, 2.45 mmol) wad added. The mixture was stirred at 20°C for 2 h. The reaction mixture was acidified with 1 M HC1 to pH=5, then the mixture was concentrated under reduced pressure to remove solvent to afford a yellow gum (130 mg). This yellow gum was stirred in AC2O (2 mL) at 120°C for 12 h. The reaction mixture was concentrated under reduced pressure to afford 97 (80 mg) as a yellow solid. l-(( 6-chloro-5-( trifluoromethyl )pyridin-2-yl )amino )-3-cyclopropyl-lH-pyrrole-2,5-dione (38)

[0471] To a solution of 97 (80 mg, 0.58 mmol) and 94 (122 mg, 0.58 μmol) in toluene (2 mL), TEA (175 mg, 1.74 mmol) was added. The mixture was stirred at 110°C for 1 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by Prep- HPLC (TFA condition; column: Phenomenex luna C18 100*40mm*3 μm; mobile phase: [H2O (0.1% TFA) - ACN]; gradient: CAN: 30%-60%, 8.0 min) to afford 38 (7.17 mg, 0.015 mmol, 2.6% yield) as a white solid. LCMS (ESI) [M + H]+ = 332.0 / 334.0.1H NMR (400 MHz CD3OD): δ pμm 7.90 (d, J = 8.6 Hz, 1H), 6.74 (d, J = 8.5 Hz, 1H), 6.36 (s, 1H), 1.99 - 1.90 (m, 1H), 1.23 (br dd, J = 2.3, 8.2 Hz, 2H), 1.13 - 1.08 (m, 2H). diethyl 2-methoxymaleate (108)

[0472] To a solution of 107 (1 g, 5.88 mmol) and MeOH (188 mg, 5.88 mmol) in DCM (10 mL), DABCO (66 mg, 0.59 mmol) was added at 20°C and the mixture was stirred at 20 °C for 10 min. The reaction was concentrated under vacuum. The residue was purified by silica flash chromatography (0% to 16% EtOAc in petroleum) to afford 108 (950 mg, 4.70 mmol, 80% yield) as a colorless oil.3-methoxyfuran-2, 5-dione (98)

[0473] To a solution of 108 (300 mg, 1.48 mmol) in THF (2 mL), MeOH (0.5 mL) and water (2 mL), LiOH H2O (623 mg, 14.8 mmol) was added. The mixture was stirred at 20°C for 12 h. The reaction mixture was acidified with 1 M HC1 to pH=5, then the mixture was lyophilized to afford a white solid (600 mg). AC2O (3.26 g, 31.9 mmol) was added to this white solid and stirred at 120°C for 12 h. The reaction mixture was concentrated underreduced pressure to remove solvent to afford 98 (150 mg) as a black solid which was used directly without further purification. l-(( 6-chloro-5-( trifluoromethyl )pyridin-2-yl jamino )-3 -methoxy- 1 H-pyrrole-2, 5-dione ( 39)

[0474] To a solution of 98 (150 mg, 0.71 mmol) and 94 (91 mg, 0.71 mmol) in toluene (2 mL), TEA (215 mg, 2.13 mmol) was added. The mixture was stirred at 110 °C for 1 h. The reaction mixture was filtered. The residue was purified by Prep-HPLC (column: Phenomenex luna C18 100*40mm*3 μm; mobile phase: [H2O (0.1% TFA) - ACN]; gradient: ACN: 25%-55%, 8.0 min) to afford 39 (6.32 mg, 0.014, 2% yield) as a colourless gum.LCMS (ESI) [M + H]+ = 322.0 / 324.1.1H NMR (400 MHz CD3OD): δ pμm 7.90 (d, J=8.63 Hz, 1 H) 6.70 - 6.83 (m, 1 H) 5.82 (s, 1 H) 4.02 (s, 3 H).1-(( 6-chloro-5-( trifluoromethyl )pyridin-2-yl )amino )-3-( trifluoromethyl )-l H-pyrrole-2, 5-dione (40)

[0475] To a solution of 94 (100 mg, 0.47 mmol) in toluene (1.5 mL), 99 (78 mg, 0.47 mmol) was added at 20 °C and the mixture was stirred at 110°C for 1 h. The reaction was concentrated under vacuum. The residue was purified by Prep-HPLC (TFA condition) (column: Phenomenex Luna C 18 100*30mm*5 μm; mobile phase: [H2O (0.1% TFA) - ACN]; gradient: ACN: 30%-60%, 8.0 min) to afford 40 (22 mg, 0.044 mmol, 9% yield) as a pale yellow solid which was lyophilized immediately after Prep-HPLC. LCMS (ESI) [M + H]+ = 360.0 / 362.0.]H NMR (400 MHz DMSO): δ pμm 10.28 (br s, 1 H) 7.97 - 8.11 (m, 2 H) 7.00 (d, J=8.63 Hz, 1 H).2-chloro-N'-( 6-chloro-5-( trifluoromethyl )pyridin-2-yl )-N -methylacetohydrazide ( 41 )

[0476] To a solution of 94 (2 g, 9.26 mmol) in 2-methylbutan-2-ol (20 mL), t-BuXPhos Pd G3 (735 mg, 0.93 mmol), K3PO4 (5.90 g, 27.8 mmol), and tert-butyl 1 -methylhydrazine- 1- carboxylate (1.62 g, 11.1 mmol) were added. The mixture was stirred at 90°C for 12 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The reaction mixture was diluted with water (20 mL) and extracted with EtOAc. The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by silica flash chromatography (5% EtOAc in petroleum ether) to afford tert-butyl 2-(6-chloro-5- (trifluoromethyl)pyridin-2-yl)-l -methylhydrazine- 1 -carboxylate as a yellow oil (2.1 g, 6.45mmol, 70% yield). TFA (768 mg, 6.73 mmol) was added to this yellow oil (100 mg, 0.31 mmol) and the mixture was stirred at 20°C for 2 h. The reaction mixture was concentrated under reduced pressure to remove solvent to afford a yellow solid (60 mg).

[0477] To a solution of the yellow solid (30 mg) in DCM (1 mL), TEA (40 mg, 0.40 mmol) and 2-chloroacetyl chloride (18 mg, 0.16 mmol) were added. The mixture was stirred at 0°C for 1 h. The reaction mixture was filtered. The residue was purified by Prep-HPLC (column: Phenomenex Luna C18 75*30mm*3 μm; mobile phase: [H2O (0.04% HC1)-ACN]; gradient: ACN: 25%-55%, 8.0 min) to afford 41 (5.01 mg, 14.8 mmol, 11% yield) as a white solid. LCMS (ESI) [M + H]+ = 302.1 / 304.0.1H NMR (400 MHz CD3OD): δ pμm 7.98 (d, 7=8.50 Hz, 1 H) 6.73 (d, 7=8.50 Hz, 1 H) 4.41 (d, 7=14.13 Hz, 1 H) 4.18 (d, 7=14.13 Hz, 1 H) 3.19 (s, 3 H).13C NMR (100 MHz, DMSO-d6): 169.1, 168.9, 159.7, 147.3, 139.8, 139.5, 127.6, 124.9, 122.2, 119.5, 115.1, 114.8, 114.5, 106.0, 105.9, 42.7, 35.2. Exact mass calcd. for C9H9CI2F3N3O [M+H]: 302.0075; found: 302.0082. l-((6-chloro-5-(trifluoromethyl)pyridin-2-yl)amino)-5-hydroxy-l,5-dihydro-2H-pyrrol-2-one (42)

[0478] To a solution of 33 (500 mg, 1.71 mmol) in MeOH (5 mL), NaBH4 (32.4 mg, 0.86 mmol) was added. The mixture was stirred at 0°C for 0.5 h. The reaction mixture was quenched by water (1 mL) and filtered. The residue was purified by Prep-HPLC (TFA condition, column: Phenomenex luna Cl 8 100*40mm*3 μm; mobile phase: [H2O (0.1% TFA)-ACN]; gradient: ACN: 15%-45%, 8.0 min) to afford 42 (41 mg, 0.086 mmol, 5% yield) as a yellow solid. LCMS (ESI) [M + H]+ = 294.1 / 296.1.!H NMR (400 MHz DMSO): δ pμm 9.87 - 9.51 (m, 1H), 7.94 (d, J = 8.8 Hz, 1H), 7.21 (dd, J = 1.6, 6.4 Hz, 1H), 6.95 - 6.52 (m, 2H), 6.31 (dd, J = 0.7, 6.4 Hz, 1H), 5.50 (s, 1H). l-(( 6-chloro-5-( trifluoromethyl )pyridin-2-yl)ammo)-l,5-dihydro-2H-pyrrol-2-one (43 )

[0479] A solution of 94 (100 mg, 0.47 mmol) and Citraconic anhydride (62 mg, 0.47 mol) in HC1 (1 M, 28 mL) was stirred at 20°C for 0.5 h. The mixture was adjust to pH= 8-9 by added NH3 H2O and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (HC1 condition, column: Phenomenex luna Cl 8 80*30mm*3 μm; mobile phase: [H2O (0.04% HC1)-ACN]; gradient: ACN: 20%-50%, 8.0 min) to afford 43 (26.4 mg, 0.081 mmol, 6% yield) as a yellow solid. LCMS (ESI) [M + H]+= 278.2 / 280.2.1H NMR (400 MHz CD3OD): δ pμm 7.88 (d, J = 8.6 Hz, 1H), 7.41 (d, J = 6.5 Hz, 1H), 6.63 (d, J = 8.6 Hz, 1H), 6.28 (d, J = 6.5 Hz, 1H), 4.34 (t, J = 1.8 Hz, 2H). Exact mass calcd. for C10H8CIF3N3O [M+H]: 278.0308; found, 278.0320 l-(( 6-chloro-5-( trifluoromethyl)pyridin-2-yl)ammo)-5-methoxy-l,5-dihydro-2H-pyrrol-2-one (44)

[0480] To a solution of 42 (70 mg, 0.24 mmol) in MeOH (2 mL), PTS A (41 mg, 0.24 mmol) and iodomethane (68 mg, 0.48 mmol) were added. The mixture was stirred at 60°C for 12 h. The reaction mixture was filtered. The residue was purified by Prep-HPLC (TFA condition, column: Phenomenex luna Cl 8 100*40mm*3 μm; mobile phase: [H2O (0.1% TFA)-ACN]; gradient: ACN: 40%-70%, 8.0 min) to afford 44 (7.23 mg, 16.8 μmol, 7% yield) as a white solid. LCMS (ESI) [M + H]+ = 308.0 / 310.0. H NMR (400 MHz CD3OD): δ pμm 7.95 (d, J = 8.8 Hz, 1H), 7.79 (d, J = 9.6 Hz, 1H), 7.37 (dd, J = 9.6, 15.8 Hz, 1H), 7.24 (d, J = 8.8 Hz, 1H), 6.21 (d, J = 15.8 Hz, 1H), 3.78 (s, 3H).N-(6-chloro-5-(trifhioromethyl)pyridin-2-yl)-N-(3A-dinwthyl-2,5-dioxo-2,5-dihydro-lH- pyrrol- l-yl)acetarmde (45)

[0481] To a solution of 3 (25 mg, 0.078 mmol) in THF (1.2 mL), NaH 60% dispersed in mineral oil (3.1 mg, 0.078 mmol) was added under inert atmosphere at 0°C for 0.5 h. To the reaction, acetyl chloride (9.2 mg, 0.117 mmol) was added then allowed to rise to room temperature over 1 h, then held there for an additional 12 h. To the reaction, water (20 mL) was added, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over NazSCU, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 75% EtOAc in Hexanes) to provide 45 (21.8 mg, 0.060 mmol, 77% yield) as a white solid.1H NMR (500 MHz, CDCI3) 5 8.29 (s, 1H), 8.00 (d, 7 = 8.5 Hz, 1H), 2.30 (s, 3H), 2.12 (d, 7 = 2.0 Hz, 6H).N-(6-chloro-5-(triflu0romethyl}pyridin-2-yl}-N-(3-methyl-2,5-dioxo-2,5-dihydro-lH-pyrrol-l- yDacetamide (46)

[0482] To a solution of 8 (200 mg, 0.65 mmol) in DCM (3 mL), AC2O (100 mg, 0.98 mmol) and TEA (198 mg, 1.96 mmol) were added at 0°C. The mixture was stirred at 20°C for 1 h. The reaction mixture was filtered. The residue was purified by Prep-HPLC (column: Phenomenex luna C18 100*40mm*3 μm; mobile phase: [H2O (0.1% TFA) - ACN]; gradient: ACN: 35 %- 65%, 8.0 min) to afford 46 (9 mg, 19 mmol, 3% yield) as a yellow gum. LCMS(ESI) [M + H]+ = 348.1 / 350.0.1H NMR (400 MHz CD3OD): δ pμm 8.20 - 8.35 (m, 2 H) 6.81 (q, J=1.75 Hz, 1 H) 2.30 (s, 3 H) 2.20 (d, J=1.75 Hz, 3 H).8-chlom-2-hydrazjneylauinoline ( 110)

[0483] To a solution of 109 (0.100g, 0.505 mmol) in DMF (5 mL) was added hydrazine solution (0.09 mL, 2.525 mmol). The reaction mixture was heated at 110°C for 36 h, after which the reaction mixture was cooled, diluted with ethyl acetate (20 mL) and washed with ice water and brine. The organic layer was dried over anhydrous Na2SO4and concentrated under reduced pressure. The crude mixture was purified by silica flash chromatography (0% to 100% EtOAc in Hexanes) on silica to give 110 (17 mg, 0.087 mmol, 17.4% yield) as an orangish-yellow solid. l-((8-chloroquinolin-2-yl)amino)-3A-dimethyl-lH-pyrrole-2,5-dione (47)

[0484] To a solution of 110 (17 mg, 0.087 mmol, leq) in chloroform (lOmL) was added 3, 4-dimethylfuran-2, 5-dione (11 mg, 0.087 mmol). The reaction mixture was heated at 61 °C for 16 h, after which the reaction mixture was concentrated under reduced pressure to give 47 as a brown oil. The crude mixture was purified with silica flash chromatography (0% to 100% EtOAc in Hexanes).]H NMR (500 MHz, CDCI3) 8 7.95 (d, J = 8.9 Hz, 1H), 7.66 (dd, 7 = 7.5, 1.6 Hz, 1H), 7.59 - 7.54 (m, 1H), 7.23 (t, 7 = 7.7 Hz, 1H), 6.88 (d, 7 = 10.5 Hz, 2H), 2.10 (d, 7 = 1.8 Hz, 6H).8-chloro-2-hydraz.meylquinoline ( 110)

[0485] To a solution of 109 (2 g, 10.1 mmol) in EtOH (20 mL), NH2NH2H2O (3.16 g, 50.5 mmol) was added. The mixture was stirred at 80°C for 12 h under inert atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica flash chromatography (50% EtOAc in petroleum ether) to afford 110 (1.8 g, 9.30 mmol, 92% yield) as a red solid. l-((8-chloroquinolin-2-yl)amino)-3-melhyl-lH-pyrrole-2,5-dione (48)

[0486] To a solution of 110 (200 mg, 1.03 mmol) in toluene (5 mL), Citraconic anhydride (232 mg, 2.07 mmol) was added. The mixture was stirred at 110°C for 1 h. The reaction mixture was filtered. The residue was purified by Prep-HPLC (column: Phenomenex luna C18 100*40mm*3 μm; mobile phase: [H2O (0.1% TFA) - ACN]; gradient:ACN: 25%-55%, 8.0 min) to afford 48 (137 mg, 0.404 mmol, 39% yield) as a yellow solid. LCMS (ESI) [M + H]+ = 288.0 / 290.0.1H NMR (400 MHz CD3OD): δ pμm 8.06 (d, J=8.88 Hz, 1 H) 7.63 (dd, J=7.82, 2.44 Hz, 2 H) 7.22 (t, J=7.82 Hz, 1 H) 7.01 (d, J=8.88 Hz, 1 H) 6.65 (q, J=1.75 Hz, 1 H) 2.16 (d, J=1.75 Hz, 3 H).13C NMR (100 MHz, DMSO-J6): 171.2, 170.2, 145.3, 142.9, 139.1, 130.2, 129.7, 127.5, 127.5, 127.2, 126.0, 123.8, 111.3, 11.5. Exact mass calcd. for C14H11CIN3O2 [M+H]: 288.0540; found: 288.0537. l-(( 3,5-bis( trifluoromethyl jphenyl jamino )-3,4-dimethyl- 1 H-pyrrole-2,5-dione ( 49 )

[0487] To a solution of 111 (500 mg, 1.78 mmol) in CHCL (10 ml), 3,4-dimethylfuran- 2, 5-dione (337 mg, 2.67 mmol) was added under inert atmosphere at 61°C for 20 h, then cooled to room temperature, water (20 mL) was added, and the product was extracted with EtOAc. The combined organic layers were washed with brine and dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica flash chromatography (0 to 80% EtOAc in Hexanes) to provide 49 (70.2 mg, 0.20 mmol, 7.5% yield) as an orange solid.:H NMR (500 MHz, CDCh) 5 7.43 (s, 1H), 7.11 (s, 2H), 6.20 (s, 1H), 2.09 (s, 6H).1 -((3, 5-bis(trifluoromethyl)phenyl)ammo)-3-methyl-lH-pyrrole-2, 5-dione (50)

[0488] To a solution of 111 (500 mg, 2.05 mmol) in toluene (5 mL) was added Citraconic anhydride (230 mg, 2.05 mmol). The mixture was stirred at 110°C for 1 h. The reaction mixture was filtered. The residue was purified by Prep-HPLC (column: Phenomenex luna C18 100*40mm*5 μm; mobile phase: [H2O (0.1% TFA)-ACN]; gradient: ACN: 36%-65%, 8.0 min) to afford 50 (232 mg, 0.497 mmol, 24.3% yield) as a white solid. LCMS (ESI) [M + H]+ = 336.9.1H NMR (400 MHz DMSO): δ pμm 9.00 (s, 1 H) 7.41 (s, 1 H) 7.37 (s, 2 H) 6.78 (d, 7=1.88 Hz, 1 H) 2.07 (d, 7=1.75 Hz, 3 H).nC NMR (100 MHz, DMSO-76): 170.1, 169.1, 149.7, 145.4, 132.2, 131.9, 131.5, 131.2, 127.8, 126.8, 125.1, 122.4, 119.7, 112.6, 112.4, 11.8. Exact mass calcd. for C13H7F6N2O2 [M-H]: 337.0412; found: 337.0439.Cellular Assay ProtocolsCell lines and Reagents

[0489] Jurkat E6-1 (TIB-152) and U-2 OS (HTB-96) cell lines were purchased from ATCC. Jurkat IL2 promoter reporter cell line was purchased from BPS Bioscience (60481).All cell lines were incubated at 37°C with 5% CO2 under humidified conditions and were maintained in glutamine-containing RPMI-1640 supplemented with 10% fetal bovine serum (FBS), 1% penicillin / streptomycin, and 10 mM HEPES.Small molecule synthesis and validation

[0490] The small molecules purchased for this study included Leptomycin B (Cayman Chemical, 10004976), Selinexor (Selleck Chemicals, S7252), KPT-185 (Selleck Chemicals, S7125), KPT-276 (Selleck Chemicals, S7251), KPT-335 (Selleck Chemicals, S7707), and KPT-8602 (Selleck Chemicals, S8397). All other small molecules mentioned were synthesized by either Wuxi AppTec or our chemists, and the purity and identity of all small molecules were confirmed using1H NMR and LC-MS. Details of the synthesis and characterization of these molecules can be found in the Chemical Characterization Data in the Supplementary Information.IL2 Luciferase Assay

[0491] Jurkat IL2 promoter reporter cell line was seeded in 384-well plates (Corning, 3765) at a density of 25,000 cells in 50 μL growth media per well. Cells were activated with a cocktail of PMA (50 nM, Cayman Chemical) and lonomycin (1 μM, Cayman Chemical). 100 nl of each compound in the 384-well drug plate as described above were transferred to the 384-assay plate by multi-blot replicator (VP386, V&P Scientific, San Diego, CA). The assay plate was then incubated for 6h at 37°C. 5 μL of Bright-Glo Luciferase Assay System (Promega, E2620) was added to each well of incubated assay plate to express firefly luciferase driven by IL2 promoter activities and the contents mixed on an orbital shaker at 25°C for 15 minutes. The Biotek Synergy Neo2 microplate reader with the Gen5 3.03.14 software was used to record the amount of luminescence in each well.Cell viability assay

[0492] Jurkat cells (either wild-type or XPO1C528S-expressing cells) were seeded in 384-well plates (Corning, 3765) at a density of 25,000 cells in 50 μL growth media per well and treated with 384-well drug plate by multi-blot replicator (VP386, V&P Scientific, San Diego, CA). After 24h of incubation, 5 μL of CellTiter-Glo (Promega, G7572) was added to each well of incubated assay plate and contents mixed on an orbital shaker at 25°C for 15minutes. The amount of luminescence in each well was measured by the Biotek Synergy Neo2 microplate reader with the Gen5 3.03.14 software.Immunofluorescence and Analysis of Nuclear Export Inhibition

[0493] U-2 OS cells were seeded in a black, clear-bottom 96-well plate (Perkin Elmer,50-209-9831) at a density of 3,000 cells in 50 μL of media and allowed to attach overnight. Cells were following treated with corresponding inhibitor molecules and incubated for 6 hours at 37°C. Cells were fixed with 4% paraformaldehyde, blocked with 10% normal donkey serum (Jackson Immunoresearch Laboratories, 017-000-121), permeabilized with 0.2% Triton-X in PBS, and stained with anti-RanBPl (abeam, ab97659) at a 1:500 dilution overnight. The next day, cells were stained with secondary antibody (Invitrogen, A-31573) at 1:500 dilution and DAPI (Sigma- Aldrich, D8417) at 1:20000 dilution. The plate was imaged by the Operetta High Content Imaging and Analysis System (Perkin Elmer) with 7 fields captured per well at 20X magnification. Images were analyzed using the Harmony software on the Columbus data server (Perkin Elmer). Briefly, live cells were identified, and their nuclei were established using DAPI staining. The cytoplasmic region was defined around these nuclei based on non-overlapping staining for RanBPl. The nuclear-to-cytoplasmic ratio of total signal intensity for RanBPl staining was calculated with using these criteria, and the untreated wells were normalized to 0% and 10 nM Leptomycin B set to 100%.In-gel Fluorescence

[0494] Jurkat cells were plated at a density of 500,000 cells in 1 mL of culture and treated with respective drugs for Ih at 37°C. 1 μM Selinexor-alkyne-functionalized small molecules (Selinexor-Alkyne) was added for another 1 hour at 37°C. After incubation, the culture media was aspirated, cells were washed twice with PBS and resuspended in PBS containing Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific, 78440). Cells were lysed with the Fisher Scientific Sonic Dismembrator Model 60 using 15 x 1 second pulses at power level 3 and 4°C. Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, 23225) was used to measure protein concentrations and Biotek Synergy Neo2 microplate reader was used to record the fluorescent develoμment. The protein concentration was normalized for SDS-PAGE, and the following was added to protein lysate to initiate click chemistry: (1) 1.5 μL of 20% SDS, (2) 0.5 μL of 5 mM Cy3.5-azide (Kerafast,FLP358), (3) 0.5 μL of 50 mM TCEP, (4) 1.25 μL of 1 mM TBTA, and (5) 0.5 μL of 50 mM CuSO4. After incubation at 25°C for 1 hour, a mixture of loading buffer containing reducing agent (Invitrogen, B009) and sample loading dye (Invitrogen, B007) was added to each sample. Samples were resolved on 4%- 12% gradient gels (Invitrogen, NW04122BOX) and fluorescence was captured on the LI-COR Odyssey Fc Imaging System.RT-qPCR

[0495] Jurkat cells were plated at a density of 500,000 cells in 1 mL of culture and activated with PMA / Iono as previously described, following treatment of respective drugs for 6 hours at 37°C. QIAGEN RNEasy Kit (QIAGEN, 74106) used to collect RNA according to manufacturer’s protocol. High-Capacity RNA-to-cDNA Kit (Applied Biosystems, 4387406) was used to produce cDNA. The exon-spanning Taqman primers added in this study included GAPDH (Hs02786624_gl, Mm99999915_gl) and IL2 (Hs00174114_ml, Mm00434256_ml). The QuantStudio 7 Flex System and the QuantStudio Software vl.3 was used to detect relative transcript levels, and IL2 expression was normalized relative to GAPDH control.Results

[0496] We first sought to evaluate whether structural analogs of prototypical SIT A (SP100030) would retain the parent’s SITA profile or possibly switch to a SINE profile. To evaluate SINE / SITA behavior in high throughput, we relied initially on two established luminescence-based assays performed in 384-well plate format: first, a Jurkat-based IL2-Luc reporter assay to assess the potency with which analogs suppress the XPO1 -dependent upregulation of 1L2, and second a CellTiter-Glo viability assay in Jurkat cells. Comparable potency in these two assays defines SINE behavior and was observed for the SINEs Selinexor and S109 (Fig. 15, 16A, B); conversely, diminished potency for cell killing relative to suppression of IL2 upregulation is characteristic of SITAs and was observed for the previously-reported SITAs SP100030 and SPC-839 (Fig. 15, 16C, D). Past work has established that covalent target engagement for these probes closely tracks the potency observed in the IL2-Luciferase assay.

[0497] Interestingly, five newly-synthesized SP100030 (1) analogs also behaved as SITAs, with significantly greater potency for suppression of IL2 expression than induction ofcell death (Table 1). Notably, potency among this set of analogs varied by more than 10-fold, indicating that both high- and low-potency analogs can equally demonstrate a SITA profile. Modifications that reduced the electrophilicity of the chloropyrimidine ring, either by replacement of the pyrimidine with pyridine (9) or trifluoromethyl with methyl (10), showed diminished potency while retaining the SITA profile. Modifications to the aniline ring were generally closer in potency to SP100030 (11-13). Conversely, four previously-reported analogs of the prototypical SINE Selinexor (14-17) retained a SINE profile, with comparably high potency for suppression of IL2 expression and cell death (Table 2). These analogs all share Selinexor’ s electrophile and bistrifluoromethylaryl substituent but contain diverse acyl substituents.

[0498] To further confirm the SINE / SITA profiles of representative analogs, we measured the nuclear retention of RANBP1 as a well-established marker of impaired nuclear export. Selinexor analog 17 (KPT-8602) demonstrated far greater effects on nuclear exportthan SP100030 analog 11, further supporting the SINE / SITA profiles of these molecules (Fig. 17A, B). Additionally, numerous experiments were performed to confirm that these phenotypes were XPO1 dependent. We confirmed that representative molecules from each set (11 and 17) indeed covalently engaged XPO1 in cells using an alkyne-tagged Selinexor analog (18), and this potency for cellular target engagement mirrored potency for suppression of TL2 upregulation (Fig. 17C). Critically, the effects of 11 and 17 on TL2 expression was also strongly suppressed in Jurkat cells expressing the C528S resistance allele established to block C528-targeting small molecules’ cellular phenotypes, confirming that IL2 suppression stems from covalent targeting of XPO1 (Fig. 17D). The cytotoxicity of KPT-8206 (17) was also strongly suppressed in XPO1 C528S-expressing cells; in contrast, the reduction in cytotoxicity was modest for 11, suggesting that targets beyond XPO1 account for much of its effects on viability (Fig. 17E). Together, these studies establish that this set of SP100030 and Selinexor analogs uniformly retain the SINE or SITA profile of their parent molecule; additionally, use of the XPO1 C528S resistance allele verifies that these cellular phenotypes are dependent on XPO 1.

[0499] We next synthesized and evaluated analogs of SPC-839 and CW0134, established SITAs that share a citraconimide electrophile distinct from SP100300 or Selinexor. Eight analogs of SPC-839 (7) that retained the citraconimide electrophile all retained a SITA profile comparable in magnitude to SPC-839 despite making diverse changes to the SPC-839 template (Table 3). These changes included removing or replacing the 5- OMe substituent (19, 23, 24), varying the 2-thienyl substituent (20-26), introducing nitrogen at positions 6 and 8 (21,22), and introducing substituents at positions 7 and 8 (25, 26). The reductions in potencies from removing or replacing the 5-OMe substituent suggests that this substituent at this position is important for target engagement with XPO1. Likewise, modifications to CW0134 (8) at sites other than the citraconimide led to a set of 5 analogs (Table 4). These CW0134 derivatives all behaved as SITAs despite significant modifications, including Wmethylation (27), removal of substituents (28, 29), and substitution of the chloro atom with alkyl and haloalkyl groups (30, 31). Notably, these SPC839 and CW0134 analogs cover a lOOOx range in potency but uniformly retain a SITA profile, with IL2-Luc potency typically 10 to 30-fold higher than cytotoxic effects (Table 4). Additionally, we confirmed that representative analog 22 showed minimal effects on nuclear export, as observed for other SITAs (Figs. 18A, B). Its potency for cellular targetengagement also mirrored its ability to suppress upregulation of IL2 activity (Fig. 18C). The effects of 22 on IL2 expression and cell viability were also suppressed in cells expressing the XPO1 C528S resistance allele, confirming that these phenotypes are also driven by covalent targeting of XPOl at C528 (Figs. 18D,E).

[0500] We also evaluated a set of analogs that modified the electrophilic citraconimide moiety of CW0134 and SPC839. Interestingly, for both SPC-839 and CW0134, switching to the less hindered maleimide electrophile (32, 33) lowered potency 30 to 500-fold but had little effect on the SITA profile as indicated by a comparable IL2 / cell viability ratio (Table 5). Potentially the broad thiol reactivity of the maleimide electrophile hinders engagement with Cys528 of XPO1 . Replacing the citraconimide methyl substituent of CW0134 with ethyl (36), isopropyl (37), or cyclopropyl (38) had little impact on either potency or IL2 / cell viability ratio (Table 6). However, analogs containing the more electron donating methoxy substituent (39) or the more withdrawing trifluoromethyl substituent (40) were inactive (Table 6).

[0501] In contrast, other modifications to the citraconimide electrophile shifted the profile of resulting analogs from SIT As to SINEs. For example, replacement of the citraconimide of both CW0134 and SPC-839 with the widely-used acrylamide moiety substantially lowered the potency, but also led to a SINE profile, with nearly equivalent potencies for IL2 suppression and cell viability (34, 35) (Table 5). However, it remains possible that the SINE activities of these acrylamide derivatives may be attributable to off- target effects. Likewise, a chloroacetamide analog (41) of CW0134 showed both diminished potency and a SINE profile, and multiple a,p-unsaturated lactam analogs also functioned as SINEs (Table 7). For example, hemiaminal 42 was comparably potent to CW0134 in IL2 suppression but showed a SINE activity profile. Subsequent reduction led to lactam 43, which also showed a SINE profile as well as substantially diminished potency. Surprisingly, methoxyaminal 44 showed a strong SITA profile, with an IL2 / Cell viability ratio superior to CW0134 (Table 7). Together these results highlight that modification of the electrophilic moiety of citraconimide SITAs can in several cases switch analogs to a SINE profile, and that even subtle changes in electrophile structure can strongly impact the SITA / SINE profile.Table 5. Evaluation of CW0134 and SPC-839 Table 7. CW0134 analogs with modified electrophiles analogs with modified electrophiles "i

[0502] Previous work established that S I 09, which differs from the SITA CW0134 only by addition of a methyl group to form a dimethylmaleimide electrophile, functioned as both a SINE and as a rapid degrader of XPO1. We confirmed that SINE S 109 rapidly degraded XPO1 in cells, while its des-methyl analog CW0134 had no effect on XPO1 levels (Fig. 19A). To assess the generality of this observation, we synthesized and evaluated threeadditional matched pairs in which each scaffold was appended with either a citraconimide or a dimethylmaleimide electrophile (Table 8).

[0503] Initial evaluation of these matched pairs in our high-throughput assays revealed that each citraconimide-containing molecule (46, 48, 50) demonstrated a SITA profile, reinforcing observations above that this electrophile is generally associated with the SITA profile (Table 8). In contrast, each dimethylmaleimide analog (45, 47, 49) demonstrated a SINE profile, in analogy to S109 (Table 8). We next evaluated the ability of these three novel matched pairs to induce XPO1 degradation via western blot. Remarkably, each of the three dimethylmaleimide analogs induced rapid degradation of XPO1 comparable to S109; in contrast, none of the three matched citraconimide analogs induced degradation of XPO 1 (Fig. 19A). As previously established for S109, the degradation of 45, 47 and 49 was suppressed by pretreatment with pevonedistat, an inhibitor of NAE1, indicating that cullin ring ligase complexes likely mediate XPO1 ubiquitination (Fig. 19B). Pevonedistat treatment also substantially diminished the cytotoxicity of 45, indicating the ability to degrade XPO1 substantially contributes to the cytotoxicity of 45 (Fig. 19C). Additionally, while some past reports have suggested that Selinexor can induce XPO1 degradation, particularly after treatment times longer than 24 h, neither Selinexor nor four additional Selinexor analogs induced rapid degradation of XPO1 (Fig. 19D). These data support the dimethylmaleimide electrophile as uniquely associated with XPO1 degradation among the SINEs within this study and highlight degradation as another cellular phenotype highly sensitive to the nature of the electrophile used to target XPO1 Cys528.Chemistry

[0504] The synthesis of SP100030 analogs proceeded via amide coupling as described in Scheme 1. SPC-839 and SPC-839 derivatives that contained modified electrophiles were synthesized using slight modifications to an established route (Scheme 2). Additional SPC- 839 analogs that made modifications to the quinazoline ring were also synthesized using variants of this route, including the use of palladium-catalyzed Suzuki coupling to install the cyclopropyl moieties of 24 and 25 (Scheme 3). Analogs of 8 (CW0134) were generally synthesized by addition of hydrazine to a suitable chloropyridine followed by imide formation using citraconic anhydride (Scheme 4) or other electrophiles (Scheme 5). Chloropyridine 89 was synthesized from pyridine 90 via pyridine A'-oxide intermediate 91 (Scheme 4). To synthesize reduced variants of imide electrophiles, maleimide 33 was subjected to half-reduction with sodium borohydride to provide hemiaminal 42, which was converted to methoxyaminal 44. A distinct approach using 2, 5 -dimethoxy -2, 5 -dihydrofuran enabled synthesis of a, P, -unsaturated lactam 43. In several cases substituted anhydride reagents (e.g., 96-99) were not commercially available and were synthesized using straightforward Wittig, aldol condensation, or alkyne hydration approaches (Scheme 5). Finally, synthesis of matched pairs of citraconimide and dimethylmaleimide electrophilecontaining analogs was achieved via acetylation of SI 09 and CW0134 or via hydrazineaddition and subsequent installation of the electrophile from the appropriate anhydride (Scheme 6).

[0505] All newly-synthesized molecules are >95% purity by HPLC analysis.Molecules purchased from vendors were used without further purification.Scheme 1. Synthesis of SP100030 analogsa'Reagents and conditions: a) Na2CO3, DMF, 25 °C, 1-18 h.Scheme 2. Synthesis of SPC-839 and related analogsaaReagents and conditions: a) 2-Thiophenecarbonyl chloride, 25 °C, 24 h; b) 4 M aq. NaOH, MeOH, 100 °C, 27 h; c) POCI3, 100 °C, 1 h; d) 35 % aq. hydrazine, THF, 25 °C, 2 h; e) citraconic anhydride, CHCI3, reflux, 18 h; f) maleic anhydride, CHCI3, reflux, 18 h; g) acryloyl chloride, CHCI3, reflux, 22 h.Scheme 3. Synthesis of SPC-839 quinazoline derivativesa“Reagents and conditions: a) TFAA, 80 °C, 12 h; b) POCI3, 110 °C, 12 h; c) 35 % aq. hydrazine, EtOH, 20 °C, < 1 h; d) citraconic anhydride, PhMe, reflux, 1 h; e) cyclopropyl boronic acid, K3PO4, Pd(dppf)C12, CH2CI2, dioxane, 80 °C, 12 h; f) Lawesson’s reagent, PhMe, 100 °C, 12 h.Scheme 4. Synthesis of CW0134 derivativesaaReagents and conditions: a) 35 % aq. hydrazine, K2CO3, EtOH, 20 °C, 16 h; b) citraconic anhydride, CHCI3, reflux, 18 h; c) N-methyl hydrazine, DIPEA, NMP, 80 °C, 1 h; d) H2O2, TFA, 70 °C, 1 h; e) POCI3, 90 °C, 12 h; f) Boc2O, NEt3, THF, 20 °C, 12 h; g) cyclopropyl boronic acid, K3PO4, Pd(OAc)2, PPh3, PhMe, H2O, 100 °C, 12 h; h) ZnBr2, CH2C12, 20 °C, 2 h.Scheme 5. Synthesis of additional CW0134 derivativesaaReagents and conditions: a) 35 % aq. hydrazine, K2CO3, EtOH, 20 °C, 16 h; b) maleic anhydride, CHCI3, reflux, 16 h; c) NaBH4, MeOH, 0 °C, 0.5 h; d) TsOH, Mel, MeOH, 60 °C, 12 h; e) 1 M aq. HC1, 20 °C, 0.5 h; f) 1 -methyl- 1 -Boc-hydrazine, K3PO4, t-BuXPhos Pd G3, 2-methylbutan-2-ol, 90 °C, 4 h; g) ZnBr2, CH2CI2, 20 °C, 2 h; h) chloroacetyl chloride, NEb, CH2CI2, 20 °C, 2 h; i) acryloyl chloride, CHCI3, reflux, 24 h; j) anhydride, PhMe, reflux, 1 h; k) ethyl diethylphosphonoacetate, NaH, THF, 0-50 °C, 2 h, 1) LiOH«H2O, THF, H2O, 20 °C, 2h; m) acetic anhydride, 120 °C, 12 h; n) morpholine hydrochloride, dioxane, H2O, 100 °C, 12 h; o) Dess-Martin periodinane, CH2CI2, 20 °C, 2 h; p) DABCO, MeOH, CH2CI2, 20 °C, 10 min.Scheme 6. Synthesis of matched pairs of citraconimides and dimethylmaleimidesaaReagents and conditions: a) AczO, NEta, CH2CI2, 20 °C, 1 h; b) hydrazine, EtOH, 80 °C, 12 h; c) citraconic anhydride (for 47 and 49) or dimethylmaleic anhydride (for 48 and 50), PhMe, reflux, 1 h.

[0506] In summary, we have synthesized and evaluated the cellular activity of analogs of five independent series of XPO1 -targeting SINES and SITAs. Modifications to the substituent distal to the electrophile of SINEs or SITAs frequently led to 100X shifts in potency. However, in no case did changes to substituents distal to the electrophile shift an analog from a SINE profile to a SITA profile or vice versa. In contrast, we demonstrate multiple examples where modifications to the citraconimide electrophile common to many SITAs, including replacement with the commonly-used acrylamide or chloroacetamide functionalities, shifted analogs to a SINE profile. Additionally, in four cases, addition of amethyl group to citraconimide-containing SITAs led to analogs that functioned as SINEs and also rapidly degraded XPO1 . Our study provides a unique case study for how variations to the electrophile of Cys528-targeting XPO1 modulators can lead to divergent pharmacological activities.

[0507] How do these subtly distinct electrophilic moieties targeting the same XPO 1 cysteine give rise to molecules with such distinct cellular effects? One possibility is that changes in the steric environment proximal to Cys528 induce distinct conformations of XPO1 that have different abilities to engage in the protein-protein interactions needed to perform XPOl’s diverse cellular roles. XPO1 is a HEAT repeat protein, and proteins in this class are known to have substantial conformational flexibility and in some cases to resemble intrinsically disordered regions. Alternatively, electrophiles may idiosyncratically orient the remainder of the molecule along unique vectors that as above impair different subsets of XPOl’s protein-protein interactions. Structural biology studies that characterize the binding site of SITAs and resulting conformation of XPO1 may enable comparison to existing structures of SINEs to help evaluate these possibilities.

[0508] The ability of certain XPO1 Cys528 ligands containing dimethylmaleimide electrophiles to induce rapid degradation of XPO 1 is a particularly striking aspect of this work. One possibility is that these molecules serve as ‘molecular glues’ that bridge interactions between XPO1 and an as-yet-unidentified cullin ring ligase complex to mediate the proteasomal degradation of XPO1. However, the removal of a methyl group to form a citraconimide electrophile in four cases abrogated the degradation of XPO 1, and it may be unlikely that a single methyl group is sufficient to promote such ‘glue’ behavior. An alternative possibility is that these dimethylmaleimide-containing compounds may function as ‘destabilizers’ that alter the conformation of XPO1 in ways that expose degrons that can be surveilled by cullin ring ligases. Such an effect is aligned with the possibility above that changes to XPO1 confirmation may be sensitive to electrophile structure and contribute to the divergent cellular effects seen for XPO1 ligands.

[0509] Together, these observations comprise a unique case in which the specific electrophilic moiety chosen determines the cellular impact of small molecules targeting XPO1 at one specific cysteine. The SAR analysis presented here also provides important clues to enable further understanding of the mechanistic basis for the divergent SINE, SIT A, and SINE-degrader profiles of existing XPO1 ligands.Example 3

[0510] This Example provides data on SITA and SINE compounds using a Jurkat-based IL2 luciferase reporter assay to assess the potency with which the compounds suppress XPO1 -dependent upregulation of IL2 (384 well IC50 Luciferase IL2 Suppression Jurkat (nM)), a CellTiter-Glo (CTG) viability assay of Jurkat cells to assess the cytotoxicity of the compounds (384 well IC50 Cell Viability Jurkat (nM)), and the CTG / IL2 differential response ratio. Compounds having comparable potency (nM) for both these assays defines SINE behavior as was previously observed for the SINE Selinexor. Conversely, diminished potency for cell killing relative to suppression of IL2 upregulation is characteristic of SITAs.TABLE 9Example 4

[0511] The synthetic route is based on the following procedure:General procedure for preparation of Compound 2

[0512] To a solution of Compound 1 (5 g, 27.54 mmol, 3.52 mL) in THF(20mL) was added LiTMP (1 M, 55.08 mL) at 0°C under N2, the mixture was stirred at 0°C for 0.5 hr, then I2 (6.99 g, 27.54 mmol) in THF(30mL) was added. The mixture was stirred at 25°C for 1.5 hrs. LCMS showed 23% of Compound 1 was remained and 50% of desired compound was detected. The reaction mixture was concentrated under reduced pressure to remove solvent. The residue was purified by flash silica gel chromatography (ISCO®; 120 g SepaFlash® Silica Flash Column, Eluent of 0~0% Ethyl acetate / Petroleum ether gradient @ 120 mL / min) (SiC)?, Ethyl acetate: Petroleum ether=0:l, Rf(Pl)=0.44) to afford Compound 2 (2.1 g, 6.63 mmol, 24.06% yield, 97% purity) as a yellow oil. MS-ESI (m / z) calcd for C6H2C1F3IN [M+H]+: 308.1 / 310.1 Found 307.8 / 309.8.General procedure for preparation of Compound 3

[0513] To a solution of Compound 2 (350 mg, 1.14 mmol) and Compound 2A (269.91 mg, 1.48 mmol, 332.04 uL) in ...

Claims

Having described the invention, we claim:

1. A compound of formula (I): (I) or a pharmaceutically acceptable salt, tautomer, or solvatethereof, wherein:X2, X3, and X4are each independently C(R10) or N;R1is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R2is absent, oxo, -OH, or alkoxy;R3is H, alkyl, or haloalkyl;R4is absent, alkyl, haloalkyl, or alkynyl if X1is C(H) and R5is absent;R5is absent, alkyl, alkynyl, halogen, or haloalkyl;R6is absent, alkynyl, halogen, -N(R11)2, alkyl, haloalkyl, -alkynylene- alkylene-alkoxy, cycloalkyl optionally substituted with one or more R12, heterocyclyl optionally substituted with one or more R12, aryl optionally substituted with one or more R12, or heteroaryl optionally substituted with one or more R12;R7is absent, halogen, haloalkyl, -N(R11)2 cycloalkyl optionally substituted with one or more R12, heterocyclyl optionally substituted with one or more R12, aryl optionally substituted with one or more R12, heteroaryl optionally substituted with one or more R12;R8is absent, haloalkyl or cycloalkyl optionally substituted with one or more R12;R9is absent or halogen, cycloalkyl optionally substituted with one or more R12; each R10is absent, H, halogen, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more R12; each R11is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R11together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl is each optionally substituted with one or more R12; each R12is halogen, alkyl, or alkoxy; andR13is absent, halogen, alkyl, haloalkyl, or alkynyl.

2. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 1, wherein R1is C1-C6, alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R2is oxo, preferably R1is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R2is oxo.

3. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 1, wherein R1is absent and R2is absent or C1-C6, alkoxy, preferably, R1is absent and R2is absent or methoxy.

4. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 1 to 3, wherein R3is H or C1-C6alkyl, preferably, R3is H or methyl.

5. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 1 to 4, wherein R4is absent, C1-C6alkyl, C1-C6haloalkyl, or C1-C6alkynyl if X1is C(H) and R5is absent, preferably, R4is absent, ethynyl, or -CF3.

6. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 1 to 4, wherein: R5is absent, C1-C6alkyl, C1-C6alkynyl, halogen, or C1-C6haloalkyl, preferably, R5is absent, ethynyl, F, or -CF3.

7. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 1 to 6, wherein R6is absent, C1-C6alkynyl, halogen, -N(R11)2, C1-C6alkyl, C1-C6haloalkyl, -alkynylene-alkylene-alkoxy, 3- to 7-membered ring cycloalkyl optionally substituted with one or more R12, 4- to 8-membered, mono- or bi-heterocyclyl optionally substituted with one or more R12, 6- to 10-membered aryl optionally substituted with one or more R12, or 5- to 8-membered heteroaryl optionally substituted with one or more R12, preferably, R6is -N(H)C1-C6alkyl, -alkynylene-alkylene-alkoxy, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, or piperidinyl each of which is optionally substituted with one or more R12, more preferably, R6is Cl or F, or -N(H)CH3, cyclopropyl, cyclobutyl, cyclopentyl,each of which is optionally substituted with one ormore R12.

8. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 1 to 4, wherein R7is a halogen or C1-C3 haloalkyl, -N(H)alkyl, -N(C1-C6alkyl)-3- to 6- membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), thiophenyl, pyrrolidinyl, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, phenyl, or piperidinyl each of which is optionally substituted with one or more R12, preferably, R7is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, - phenyl, or, each of which isoptionally substituted with one or more R12.

9. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 1 to 4, wherein R8is absent, C1-C6haloalkyl or C3-C8cycloalkyl optionally substituted with one or more R12.

10. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 9, wherein R9is absent or halogen, or C3-C8cycloalkyl optionally substituted with one or more R12.

11. A compound of formula (II) :(II) or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:X1is C(H) or N;R1is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R2is absent, oxo, -OH, or alkoxy;R3is H, alkyl, or haloalkyl;R4is absent, alkyl, haloalkyl, or alkynyl if X1is C(H) and R5is absent;R5is absent, alkyl, alkynyl, halogen, or haloalkyl;R6is absent, alkynyl, halogen, -N(Rn)r, alkyl, haloalkyl, -alkynylene-alkylene-alkoxy, cycloalkyl optionally substituted with one or more R12, heterocyclyl optionally substituted with one or more R12, aryl optionally substituted with one or more R12, or heteroaryl optionally substituted with one or more R12;each R11is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R11together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl is each optionally substituted with one or more R12; and each R12is halogen, alkyl, or alkoxy.

12. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 11, wherein R1is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R2is oxo, preferably R1is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R2is oxo.

13. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 11 , wherein R1is absent and R2is absent or C1-C6alkoxy, preferably, R1is absent and R2is absent or methoxy.

14. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 11 to 13, wherein R3is H or C1-C6alkyl, preferably, R3is H or methyl.

15. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 11 to 14, wherein R4is absent, C1-C6alkyl, C1-C6haloalkyl, or C1-C6alkynyl if X1is C(H) and R5is absent, preferably, R5is absent, ethynyl, or -CF3.

16. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 11 to 14, wherein: R5is absent, C1-C6alkyl, C1-C6alkynyl, halogen, or C1-C6haloalkyl, preferably, R5is absent, ethynyl, F, or -CF3.

17. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 11 to 16, wherein R6is absent, C1-C6alkynyl, halogen, -N(R11)2, C1-C6alkyl, C1-C6haloalkyl, -alkynylene-alkylene-alkoxy, 3- to 7-membered ring cycloalkyl optionally substituted with one or more R12, 4- to 8-membered, mono- or bi-heterocyclyl optionally substituted with one or more R12, 6- to 10-membered aryl optionally substituted with one ormore R12, or 5- to 8-membered heteroaryl optionally substituted with one or more R12, preferably, R6is -N(H)C1-C6alkyl, -alkynylene-alkylene-alkoxy, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, or piperidinyl each of which is optionally substituted with one or more R12, more preferably, R6is Cl or F, or -N(H)CH3, cyclopropyl, cyclobutyl, cyclopentyl,each of which is optionally substituted with one or more R12.A compound of formula (III):(lll) or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:R1is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R2is absent, oxo, -OH, or alkoxy;R3is H, alkyl, or haloalkyl;R7is absent, halogen, haloalkyl, N(R11)2, cycloalkyl optionally substituted with one or more R12, heterocyclyl optionally substituted with one or more R12, aryl optionally substituted with one or more R12, heteroaryl optionally substituted with one or more R12; each R11is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R11together with the N atom to which they are attached can form a 4- to 8-membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl is each optionally substituted with one or more R12; each R12is halogen, alkyl, or alkoxy; andR13is absent, halogen, alkyl, haloalkyl, or alkynyl.

19. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 18, wherein R1is C1-C6alkyl, C1-C6haloalkyl, C3-C7cycloalkyl optionally substituted with one or more halogen and R2is oxo, preferably R1is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R2is oxo.

20. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 18, wherein R1is absent and R2is absent or C1-C6alkoxy, preferably, R1is absent and R2is absent or methoxy.

21. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 18 to 20, wherein R3is H or C1-C6alkyl, preferably, R3is H or methyl.

22. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claim 18 to 21, wherein R7is a halogen or C1-C3 haloalkyl, -N(H)alkyl, -N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), thiophenyl, pyrrolidinyl, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, phenyl, or piperidinyl each of which is optionally substituted with one or more R12, preferably R7is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, phenyl oreach of which isoptionally substituted with one or more R12.

23. A compound of formula (IV): tautomer, or solvate thereof, wherein:X2, X3, and X4are each independently C(R10) or N;R1is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R2is absent, oxo, -OH, or alkoxy;R3is H, alkyl, or haloalkyl;R8is absent, haloalkyl or cycloalkyl optionally substituted with one or more R12;R9is absent or halogen, cycloalkyl optionally substituted with one or more R12; each R10is absent, H, halogen, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more R12; each R11is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R11together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl is each optionally substituted with one or more R12; and each R12is halogen, alkyl, or alkoxy.

24. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 23, wherein R1is C1-C6alkyl, C1-C6haloalkyl, C3-C7cycloalkyl optionally substituted with one or more halogen and R2is oxo, preferably R1is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R2is oxo.

25. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 23, wherein R1is absent and R2is absent or C1-C6alkoxy, preferably, R1is absent and R2is absent or methoxy.

26. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 23 to 25, wherein R3is H or C1-C6alkyl, preferably, R3is H or methyl.

27. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 23 to 26, wherein R8is absent, C1-C6haloalkyl or C3-C8cycloalkyl optionally substituted with one or more R12.

28. The compound of any of claims 23 to 27, wherein R9is absent or halogen, C3- C8cycloalkyl optionally substituted with one or more R12.

29. A compound of formula (V):(V) or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:A1isa dashed line (e.g., or — ) is an optional bond;X5, X6, X8, X9and X10are each independently C(H) or N;X7is C, C(H), N;X11, X12, X13, and X14are each independently C, C(H), N, or N(H);R14is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R1Sis absent, oxo, -OH, or alkoxy;R16is H, alkyl, or haloalkyl;R17is absent, alkyl, haloalkyl, or halogen;R18is absent, haloalkyl, or alkynyl;R19is absent, alkyl, alkynyl, halogen, or haloalkyl;R20is absent, alkynyl, halogen, alkyl, haloalkyl, -N(R27)2, -alkynylene- alkylene-alkoxy, cycloalkyl optionally substituted with one or more R28, heterocyclyl optionally substituted with one or more R28, aryl optionally substituted with one or more R28, or heteroaryl optionally substituted with one or more R28;R21is absent, alkoxy, halogen, haloalkyl, N(R27)2. cycloalkyl optionally substituted with one or more R28, heterocyclyl optionally substituted with one or more R28, aryl optionally substituted with one or more R28, heteroaryl optionally substituted with one or more R28;R22is absent, H, halogen, haloalkyl, or cycloalkyl optionally substituted with one or more R28;R23is absent, H, halogen, alkoxy, -alkylene-alkyl, or alkynyl;R24is absent or cycloalkyl optionally substituted with one or more R28;R25is absent, H, or halogen;R26is absent, haloalkyl, cycloalkyl optionally substituted with one or more R28, or heteroaryl optionally substituted with one or more R28; each R27is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R27together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl is each optionally substituted with one or more R28; andR28is halogen, alkyl, or alkoxy.

30. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 29, wherein R14is C1-C6alkyl, C1-C6haloalkyl, C3-C7cycloalkyl optionally substituted with one or more halogen and R15is oxo, preferably, R14is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R15is oxo.

31. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 29, wherein R14is absent and R15is absent, -OH, or C1-C6alkoxy, preferably, R14is absent and R15is absent, -OH, or methoxy.

32. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 29 to 31, wherein R16is H or C1-C6alkyl, preferably, R16is H or methyl.

33. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 29 to 32, wherein R17is absent, C1-C6alkyl, C1-C6haloalkyl, or halogen.

34. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 29 to 33, wherein, R18is absent, C1-C6haloalkyl, or C1-C6alkynyl.

35. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 29 to 34, wherein R19is absent, C1-C6alkyl, C1-C6alkynyl, halogen, or C1-C6haloalkyl.

36. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 29 to 35, wherein R20is absent, C1-C6alkynyl, halogen, C1-C6alkyl, C1-C6haloalkyl, -N(R27)2, -alkynylene-alkylene-alkoxy, 3- to 7-membered ring cycloalkyl optionally substituted with one or more R28, 4- to 8-membered, mono- or bi-heterocyclyl optionally substituted with one or more R28, 6- to 10-membered aryl optionally substituted with one or more R28, or 5- to 8-membered heteroaryl optionally substituted with one or more R28, preferably, R20is -N(H)CI-C6 alkyl, -alkynylene-alkylene-alkoxy, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, or piperidinyl each of which is optionally substituted with one or more R28, more preferably, R20is Cl or F, or -N(H)CHr, cyclopropyl, cyclobutyl, cyclopentyl,-alkynylene-alkylene-alkoxy,, oreach of which is optionally substituted with one or more R28.

37. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 29 to 32, wherein R21is a halogen or alkoxy, C1-C3 haloalkyl, -N(H)alkyl, - N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), thiophenyl, pyrrolidinyl, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, phenyl, or piperidinyl each of which is optionally substituted with one or more R28, preferably, R21is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, phenyl, , oreach of which is optionally substituted with one or more R28.

38. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 29 to 32, wherein R22is absent, H, halogen, C1-C6haloalkyl, C1-C6cycloalkyl optionally substituted with one or more R28.

39. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 38, wherein R23is absent, H, halogen, C1-C6alkoxy, -C1-C6alkylene-C1-C6alkyl, or C1-C6alkynyl.

40. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 38 or 39, wherein R24is absent or C1-C6 cycloalkyl optionally substituted with one or more R28.

41. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 38 to 40, wherein R25is absent, H, or halogen.

42. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 38 to 41, wherein R26is haloalkyl, C1-C6cycloalkyl optionally substituted with one or more R28, or C1-C6heteroaryl optionally substituted with one or more R28.

43. A compound of formula (VI):(VI) or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:X5and X6are each independently C(H) or N;X7is C, C(H), N;R14is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R15is absent, oxo, -OH, or alkoxy;R16is H, alkyl, or haloalkyl;R17is absent, alkyl, haloalkyl, or halogen;R18is absent, haloalkyl, or alkynyl;R19is absent, alkyl, alkynyl, halogen, or haloalkyl;R20is absent, alkynyl, halogen, alkyl, haloalkyl, -N(R27)2, -alkynylene- alkylene-alkoxy, cycloalkyl optionally substituted with one or more R28, heterocyclyl optionally substituted with one or more R28, aryl optionally substituted with one or more R28, or heteroaryl optionally substituted with one or more R28; each R27is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R27together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl is each optionally substituted with one or more R28; andR28is halogen, alkyl, or alkoxy.

44. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 43, wherein R14is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R15is oxo, preferably, R14is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R15is oxo.

45. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 43, wherein R14is absent and R15is absent, -OH, or C1-C6alkoxy, preferably, R14is absent and R15is absent, -OH, or methoxy.

46. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 43 to 45, wherein R16is H or C1-C6alkyl, preferably, R16is H or methyl.

47. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 43 to 46, wherein R17is absent, C1-C6alkyl, C1-C6haloalkyl, or halogen.

48. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 43 to 46, wherein, R18is absent, C1-C6haloalkyl, or C1-C6alkynyl.

49. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 43 to 46, wherein R19is absent, C1-C6alkyl, C1-C6alkynyl, halogen, or C1-C6haloalkyl.

50. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 43 to 46, wherein R20is absent, C1-C6alkynyl, halogen, C1-C6alkyl, C1-C6haloalkyl, -N(R27)2, -alkynylene-alkylene-alkoxy, 3- to 7-membered ring cycloalkyl optionally substituted with one or more R28, 4- to 8-membered, mono- or bi-heterocyclyl optionally substituted with one or more R28, 6- to 10-membered aryl optionally substituted with one or more R28, or 5- to 8-membered heteroaryl optionally substituted with one or more R28, preferably, R20is -N(H)C1-C6alkyl, -alkynylene-alkylene-alkoxy, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, or piperidinyl each of which is optionally substituted with one or more R28, more preferably, R20is Cl or F, or -N(H)CH3, cyclopropyl, cyclobutyl, cyclopentyl,-alkynylene-alkylene-alkoxyoreach of which is optionally substituted with one ormore R28.

51. A compound of formula (VII) :(VII) or a pharmaceutically acceptable salt, tautomer, or solvate thereof, wherein:X8, X9and X10are each independently C(H) or N;R14is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R15is absent, oxo, -OH, or alkoxy;R16is H, alkyl, or haloalkyl;R21is absent, alkoxy, halogen, haloalkyl, N(R27)2, cycloalkyl optionally substituted with one or more R28, heterocyclyl optionally substituted with one or more R28, aryl optionally substituted with one or more R28, heteroaryl optionally substituted with one or more R28; each R27is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R27together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl is each optionally substituted with one or more R28; andR28is halogen, alkyl, or alkoxy.

52. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 51, wherein R14is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R15is oxo, preferably, R14is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R15is oxo.

53. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 51, wherein R14is absent and R15is absent, -OH, or C1-C6alkoxy, preferably, R14is absent and R15is absent, -OH, or methoxy.

54. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 51 to 53, wherein R16is H or C1-C6alkyl, preferably, R16is H or methyl.

55. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 51 to 54, wherein R21is a halogen or alkoxy, C1-C3 haloalkyl, -N(H)alkyl, - N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N( C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), thiophenyl, pyrrolidinyl, azetidinyl, spirocyclic azetidinyl, pyrrolidinonyl, imidazolyl, oxazolyl, isooxazolyl, cyclopropyl, cyclobutyl, cyclopentyl, pyrazolyl, phenyl, or piperidinyl each of which is optionally substituted with one or more R28, preferably, R21is a Cl, F, or -CF3, or -N(H) C1-C6alkyl, -N(C1-C6alkyl)-3- to 6-membered cycloalkyl, -N(C1-C6alkyl)-(C1-C6alkylene-3- to 6 membered cycloalkyl), cyclopropyl, cyclobutyl, cyclopentyl, phenyl,, each of which is optionally substituted with one or more R28.

56. A compound of formula (VIII):(VIII) or a pharmaceutically acceptable salt, tautomer, or solvate thereof,wherein: a dashed line (e.g., — or — ) is an optional bond;X5is C(H) or N;X11, X12, X13, and X14are each independently C, C(H), N, or N(H);R14is absent, alkyl, haloalkyl, or cycloalkyl optionally substituted with one or more halogen;R15is absent, oxo, -OH, or alkoxy;R16is H, alkyl, or haloalkyl;R22is absent, H, halogen, haloalkyl, or cycloalkyl optionally substituted with one or more R28;R23is absent, H, halogen, alkoxy, -alkylene-alkyl, or alkynyl;R24is absent or cycloalkyl optionally substituted with one or more R28;R25is absent, H, or halogen;R26is haloalkyl, cycloalkyl optionally substituted with one or more R28, or heteroaryl optionally substituted with one or more R28; each R27is independently H, alkyl, -alkylene-cycloalkyl, or cycloalkyl, or alternatively, two R27together with the N atom to which they are attached can form a 4- to 8- membered heterocyclyl or 6- to 10- membered heterobicyclyl, optionally containing an additional heteroatom selected from O, S, or N, and wherein the heterocyclyl or heterobicyclyl is each optionally substituted with one or more R28; andR28is halogen, alkyl, or alkoxy.

57. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 56, wherein R14is C1-C6alkyl, C1-C6haloalkyl, C3-C7 cycloalkyl optionally substituted with one or more halogen and R15is oxo, preferably, R14is methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, and R15is oxo.

58. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claim 56, wherein R14is absent and R15is absent, -OH, or C1-C6alkoxy, preferably, R14is absent and R15is absent, -OH, or methoxy.

59. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 56 to 58, wherein R16is H or C1-C6alkyl, preferably, R16is H or methyl.

60. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 56 to 59, wherein R22is absent, H, halogen, C1-C6haloalkyl, C1-C6cycloalkyl optionally substituted with one or more R28.

61. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of claims 56 to 59, wherein R23is absent, H, halogen, C1-C6alkoxy, -C1-C6alkylene-C1-C6alkyl, or C1-C6alkynyl.

62. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 56 or 61, wherein R24is absent or C1-C6cycloalkyl optionally substituted with one or more R28.

63. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 56 to 62, wherein R25is absent, H, or halogen.

64. The compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 56 to 63, wherein R26is haloalkyl, C1-C6cycloalkyl optionally substituted with one or more R28, or C1-C6heteroaryl optionally substituted with one or more R28.pharmaceutically acceptable salt, tautomer, or solvate thereof.

66. A compound selected from:pharmaceutically acceptable salt, tautomer, or solvate thereof for use as a selective inhibitor of transcription activation (SITA).

67. A pharmaceutical composition comprising a compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 1 to 66.

68. The composition of claim 67 for use in treating a T cell mediated disorder a disorder associated with dysregulated T-cell activation in a subject in need thereof.

69. The composition of claim 67, wherein the compound, pharmaceutically acceptable salt, tautomer, or solvate thereof is an exportin- 1 (XPO1) modulator that is a SITA.

70. The composition of claim 69, wherein the SITA targets XPO1 at Cys528 and disrupts XPOl ’s chromatin localization with minimal impact on XPO1 -mediated nuclear export, centrosome and centromere functions, and cell death.

71. The composition of claim 69 or 70, wherein the SITA suppresses IL2 production and transcriptional activity of AP-1 and NFAT.

72. The composition of claim 68, wherein the T cell mediated disorder or the disorder associated with dysregulated T-cell activation is an autoimmune disorder and the SITA can be administered to the subject at an amount effective to treat the autoimmune disorder73. The composition of any of claims 67 to 71 for use in treating at least one of achlorhydra autoimmune active chronic hepatitis, acute disseminated encephalomyelitis, acute hemorrhagic leukoencephalitis, Addison’s disease, agammaglobulinemia, alopecia areata, Alzheimer’s disease, amyotrophic lateral sclerosis, ankylosing spondylitis, anti- gbm / tbm nephritis, antiphospholipid syndrome, antisynthetase syndrome, aplastic anemia, arthritis, atopic allergy, atopic dermatitis, autoimmune cardiomyopathy, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome, autoimmune peripheral neuropathy, autoimmune polyendocrine syndrome, autoimmune progesterone dermatitis, autoimmune thrombocytopenia purpura, autoimmune uveitis, balo disease / balo concentric sclerosis, bechets syndrome, Berger's disease, Bickerstaff’s encephalitis, blau syndrome, bullous pemphigoid, castleman's disease, chagas disease, chronic fatigue immune dysfunction syndrome, chronic inflammatory demyelinating polyneuropathy, chronic lyme disease, chronic obstructive pulmonary disease, churg-strauss syndrome, cicatricial pemphigoid, coeliac disease, cogan syndrome, cold agglutinin disease, cranial arteritis, crest syndrome, Crohns disease, Cushing's syndrome, Dego's disease, Dercum's disease, dermatitis herpetiformis, dermatomyositis, diabetes mellitus type 1, Dressier's syndrome, discoid lupus erythematosus, eczema, endometriosis, enthesitis-related arthritis, eosinophilic fasciitis, epidermolysis bullosa acquisita, essential mixed cryoglobulinemia, evan's syndrome, fibrodysplasia ossificans progressive, fibromyalgia, fibromyositis, fibrosing aveolitis,gastritis, gastrointestinal pemphigoid, giant cell arteritis, glomerulonephritis, Goodpasture's syndrome, graft-versus-host disease (GVHD), Graves' disease, Guillain-barre syndrome (gbs), Hashimoto’s encephalitis, Hashimoto’s thyroiditis, henoch-schonlein purpura, hidradenitis suppurativa, Hughes syndrome, inflammatory bowel disease (IBD), idiopathic inflammatory demyelinating diseases, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura, iga nephropathy, inflammatory demyelinating polyneuopathy, interstitial cystitis, irritable bowel syndrome (ibs), Kawasaki's disease, lichen planus, Lou Gehrig’s disease, lupoid hepatitis, lupus erythematosus, meniere's disease, microscopic polyangiitis, mixed connective tissue disease, morphea, multiple myeloma, multiple sclerosis, myasthenia gravis, myositis, narcolepsy, neuromyelitis optica, neuromyotonia, occular cicatricial pemphigoid, opsoclonus myoclonus syndrome, ord thyroiditis, Parkinson’s disease, pars planitis, pemphigus, pemphigus vulgaris, pernicious anaemia, polymyalgia rheumatic, polymyositis, primary biliary cirrhosis, primary sclerosing cholangitis, progressive inflammatory neuropathy, psoriasis, psoriatic arthritis, raynaud phenomenon, relapsing polychondritis, Reiter’s syndrome, rheumatoid arthritis, rheumatoid fever, sarcoidosis, schizophrenia, Schmidt syndrome, Schnitzler syndrome, scleritis, scleroderma, Sjogren's syndrome, spondyloarthropathy, sticky blood syndrome, still’s disease, stiff person syndrome, sydenham chorea, sweet syndrome, takayasu’s arteritis, temporal arteritis, transplant rejection, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease, undifferentiated spondyloarthropathy, vasculitis, vitiligo, Wegener's granulomatosis, Wilson’s syndrome, Wiskott-Aldrich syndrome, hypersensitivity reactions of the skin, atherosclerosis, ischemia-reperfusion injury, myocardial infarction, or restenosis.

74. A composition for use in treating graft-versus-host disease or transplant rejection in a subject in need thereof, the composition comprising at least one exportin- 1 ( XPO1) modulator that is a selective inhibitor of transcription activation (SITA), wherein the SITA targets XPO1 at Cys528 and disrupts XPO1’s chromatin localization with minimal impact on XPO1 -mediated nuclear export, centrosome and centromere functions, and cell death.

75. The composition of claim 74, wherein the SITA suppresses IL2 production and transcriptional activity of AP- 1 and NFAT.

76. The composition of claims 74 or 75, wherein the SITA comprises a compound, pharmaceutically acceptable salt, tautomer, or solvate thereof of any of claims 1 to 66.

Citation Information

Patent Citations

  • Compounds as nuclear transport modulators and uses thereof

    US20210087177A1

  • Substituted 1,5-dihydropyrrol-2-one derivatives active as NMDA receptor antagonists for treatment of states of pain

    US6642267B2

  • 1,5-dihydropyrrol-2-one derivatives as inhibitors of p53-MDM2 / MDM4 protein-protein interaction

    WO2015004610A1