Immunogenicity assessment platform for biotherapeutic proteins

Abstract

Compositions and methods for immunogenicity assessment of a biotherapeutic protein which can be used for identifying an HLA-DRB1 allele that presents a peptide of a biotherapeutic protein, understanding development of anti-drug antibodies, and identifying subjects susceptible to developing anti-drug antibodies to biotherapeutic proteins.

Description

1MMUN0GENICITY ASSESSMENT PLATFORM FOR BIOTHERAPEUTIC PROTEINSCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit and priority to United States Provisional Patent Application No. 63 / 616,900 filed on January 2, 2024, which is incorporated by reference in its entirety.INCORPORATION OF A SEQUENCE LISTING

[0002] A computer readable form of a Sequence Listing containing the file named "B30273PCT.xml", created on December 24, 2024. which is 253,295 bytes in size as measured in MICROSOFT WINDOWS® EXPLORER), is provided herein and is herein incorporated by reference. This Sequence Listing consists of SEQ ID NOs: l- 271.BACKGROUND OF THE DISCLOSURE

[0003] The present disclosure relates generally to medicine. More particularly, the present disclosure relates to compositions and methods for identifying an HLA-DRB1 (Major Histocompatibility Complex. Class II, DR Beta I) allele that presents portions of a biotherapeutic protein and allows for anti-drug antibody prediction.

[0004] Biotherapeutics constitute a large and growing segment of pharmaceutical therapeutics. Understanding and predicting immunogenicity of biotherapeutic proteins is a major concern as biotherapeutic proteins can induce the body to produce anti-drug antibodies (AD As). ADAs have broad and diverse effects such as negating the clinical benefit of the biotherapeutic protein, reducing efficacy of the biotherapeutic protein, causing allergic reactions, and have the potential to bind endogenous proteins. These effects can be serious and, in some cases, lethal. Monitoring the potential immune response of biotherapeutic proteins is an important regulatory requirement during drug development.

[0005] In silico and experimental methods can be used to predict biotherapeutic protein immunogenicity assessment. For example, in silico methods use algorithms to predict Major Histocompatibility Complex, Class II (MHC-II) binding and T-cell epitopes and can incorporate protein structural information to predict effects of amino acid substitutions on stability. Experimental methods use peripheral blood mononuclear cells from naive, healthy human donors to detect T-cell proliferation and cytokine secretion following introduction of a biotherapeutic protein. For example. Major Histocompatibility Complex (MHC)-associated peptide proteomics (MAPPs) is an analytical assay for analyzing biotherapeutic proteins for immunogenicity and potential outcome for patients. MAPPs seeks to identify the presence of a specific biotherapeutic protein on a donor’s MHC-II proteins. MAPPs involves the isolation of monocytes from fresh peripheral blood collections of human donors. However, the MAPPs assay is limited by the time needed to process the blood sample to obtain dendritic cells, the time needed to complete the entire assay, the random nature of DRB1 alleles arising from the population of blood donors, under sampling of DRB1 alleles specific to a specific patient population, and difficulty to link display of a peptide of the biotherapeutic protein of interest to any particular DRB1 allele.

[0006] Human leukocyte antigen class II (HLA-II) receptors on antigen presenting cells display fragments of self and foreign proteins for T cell surveillance. HLA-II receptors are highly polymorphic. Each HLA-DRB1 allele has distinct binding properties. Current methods to elucidate the sequences of peptides presented on HLA- II receptors uses monocyte-derived dendritic cells from random donors, which, similar to MAPPs, is known to provide limited allelic diversify. Additionally, most donors have multiple HLA-DRB1 alleles which obfuscate which allele is presenting the peptide and limits anti-drug antibodies (ADA) prediction.

[0007] The B cell is one of the two major types of lymphocytes in the adaptive immune system. The B cell is also one of the professional antigen presenting cells that express HLA-II receptors and interact with T cells during the cascade of events that occur during an adaptive immune response. The antigen receptor on B cells, usually called the B cell receptor (BCR) is a cell-surface immunoglobulin. The BCR includes a membrane-bound immunoglobulin molecule and a signal transductionmoiety. B cells use the surface bound immunoglobulin with limited binding specificity to internalize proteins for HLA-II presentation. The use of immortalized B cell lines for immunogenicity assessment is hampered by both the lack of a generalized method for the protein of interest to be internalized and HLA-DRB1 allele coverage. There exists a need for a more accurate, more effective method, and materials thereof, for assessing immunogenicity of a biotherapeutic protein in vitro. Such method and materials should address one of more of the problems identified herein. The present disclosure provides such a method and materials including cell lines deficient in expression of endogenous human leukocy te antigen-DRBl (HLA-DRB1) alleles and including a recombinant B cell receptor and a recombinant human leukocyte antigen-DRBl (HLA-DRB1) allele that is capable of internalizing a range of biotherapeutic proteins.

[0008] Embodiments of the panel of cell lines provided herein, with defined HLA-II alleles and capable of internalizing a wide range biotherapeutic proteins via a universal BCR, will benefit drug development. The system provided herein greatly simplifies and adds increased resolution to current state.

[0009] Encountering immune responses during the course of expensive clinical trials provides a compelling priority to improve effectiveness and safety profiles of biotherapeutics during drug development. Accordingly, there exists a need for developing more effective methods to predict and reduce protein immunogenicity during product development.

[0010] To address this need, the present disclosure provides transformed B cells that are deficient in endogenous HLA-DRB1 alleles and express a recombinant BCR on the membrane surface and a specific, known recombinant HLA-DRB1 allele and combinations of these transformed B cells each of which specifically express a specific, known recombinant HL A DRB1 allele to identify peptide(s) of a biotherapeutic protein presented by HLA-DRB1 allele(s). The transformed B cells allow for ADA prediction and to identify susceptibility of a subject to develop ADA to a biotherapeutic protein and, conversely, to identify subjects who are not likely to develop ADA to a biotherapeutic protein. Transformed B cells of the present disclosure express an exogenous BCR that is designed to take up biotherapeutic proteins and,through enzymatic processing of the biotherapeutic protein, form a HLA-DRB 1 allele- peptide complex with a specific, known recombinant HLA-DRB 1 allele(s) also expressed by the transformed B cell.BRIEF DESCRIPTION OF THE DISCLOSURE

[0011] The present disclosure is generally related to compositions and methods for identifying peptides of a biotherapeutic protein presented by HLA-DRB 1 allele(s). More particularly, the present disclosure provides transformed B cells deficient in expression of endogenous HLA-DRB 1 alleles and each expressing a recombinant B cell receptor on the B cell membrane surface and expressing a specific, known HLA-DRB 1 allele, combinations of these transformed B cells, and methods to identify peptides of a biotherapeutic protein presented by HLA-DRB 1 allele(s). The methods can further identify anti-drug antibody response to a biotherapeutic protein. The methods also allow for measuring susceptibility of a subject to develop anti-drug antibody response to a biotherapeutic protein.

[0012] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous HLA-DRB 1 alleles, comprising a nucleic acid encoding a recombinant B cell receptor that is expressed on the B cell membrane surface and a nucleic acid encoding a recombinant human leukocyte antigen-DRBl (HLA-DRB 1) allele. The recombinant human leukocyte antigen-DRBl (HLA-DRB 1) allele is selected from the group consisting of a HLA-DRBl*0L01, a HLA- DRB1 *03:01 , a HLA-DRB 1 *04: 1 , a HLA-DRB 1 *04:04, a HLA-DRB 1 *04:05, a HLA-DRB 1*07: 01, a HLA-DRBl*08:01, aHLA-DRBl*08:03, a HLA-DRB 1*09: 01, a HLA-DRBl*l l :01, a HLA-DRB1*12:O1, a HLA-DRBl*13:01, a HLA- DRB 1 * 13 : 02, a HLA-DRB 1 * 15 : 01 , and a HLA-DRB 1 * 15 : 02.

[0013] In one aspect, the present disclosure is directed to a method for identifying a peptide of a biotherapeutic protein presented by a human leukocyte antigen-DRBl (HLA-DRB 1) allele, the method comprising: contacting a biotherapeutic protein with a first transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB 1) alleles, wherein thetransformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on the B cell membrane surface and a nucleic acid encoding a recombinant human leukocyte antigen-DRBl (HLA-DRB1) allele; culturing the transformed B cell for a time sufficient for the recombinant B cell receptor to bind the biotherapeutic protein and form a HLA-DRB1 -peptide complex comprising peptides of the biotherapeutic protein and the recombinant HLA-DRB1; and analyzing the HLA- DRB1 -peptide complex to identify the peptide.

[0014] In one aspect, the method further comprises contacting the biotherapeutic protein with a second transformed B cell deficient in expression of endogenous HLA-DRB1 alleles, wherein the second transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on the second B cell membrane surface and a nucleic acid encoding a recombinant human leukocy te antigen-DRBl (HLA-DRB1) allele that is different from the recombinant HLA-DRB1 allele expressed by the first transformed B cell.

[0015] In one aspect, the present disclosure is directed to a method for identifying a peptide of a biotherapeutic protein presented by a human leukocyte antigen-DRBl (HLA-DRB1) allele, the method comprising: contacting a biotherapeutic protein with a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on the B cell membrane surface and a nucleic acid encoding a recombinant human leukocyte antigen-DRBl (HLA-DRB1) allele selected from the group consisting of a HLA-DRBl*01:01, a HLA-DRBl*03:01, a HLA-DRBl*04:01, aHLA-DRBl*04:04, a HLA-DRB1 *04:05, a HLA-DRBl*07:01, a HLA-DRB1*O8:O1, a HLA- DRB1*O8:O3, a HLA-DRBl*09:01, a HLA-DRBl*l l :01, a HLA-DRB1*12:O1, a HLA-DRBl* 13:01, a HLA-DRB1*13:O2, a HLA-DRBl*15:01, and a HLA- DRB 1*15: 02; culturing the transformed B cell for a time sufficient for the recombinant B cell receptor to bind the biotherapeutic protein and form a HLA-DRB1 -peptide complex comprising peptides of the biotherapeutic protein and the recombinant HLA- DRB1; and analyzing the HLA-DRB1 -peptide complex to identify the peptide.

[0016] In another aspect, the present disclosure is directed to a method for identifying a subject as susceptible to developing an anti-drug antibody response to a biotherapeutic protein, the method comprising: contacting a biotherapeutic protein with a transformed B cell deficient in expression of endogenous human leukocyte antigen- DRB1 (HLA-DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on the B cell membrane surface and a nucleic acid encoding a recombinant human leukocyte antigen-DRBl (HLA-DRB1) allele selected from the group consisting of a HLA-DRB1 *01 :01, a HLA-DRBl*03:01, a HLA-DRBl*04:01, aHLA-DRBl*04:04, aHLA-DRBl*04:05, a HLA-DRBl*07:01, a HLA-DRBl*08:01, a HLA-DRB1*O8:O3, a HLA- DRBl*09:01, a HLA-DRBl* l l :01, a HLA-DRBl*12:01, a HLA-DRBl*13:01, a HLA-DRB1* 13:02, a HLA-DRB1* 15:01, and a HLA-DRB 1*15:02; culturing the transformed B cell for a time sufficient for the recombinant B cell receptor to bind the biotherapeutic protein and form a HLA-DRB 1 -peptide complex comprising peptides of the biotherapeutic protein and the recombinant HLA-DRB 1; analyzing the HLA- DRB 1 -peptide complex to identify the peptide; and identifying the subject as susceptible to develop an anti-drug antibody response to the biotherapeutic protein if the HLA-DRB 1 allele presenting the peptide of the biotherapeutic protein in the HLA- DRB 1 -peptide complex is the same HLA-DRB 1 allele as the HLA DRB1 allele genotype of the subject.BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The disclosure will be better understood, and features, aspects and advantages other than those set forth above will become apparent when consideration is given to the following detailed description thereof. Such detailed description makes reference to the following drawings, wherein:

[0018] FIGS. 1A-1C are schematics illustrating the reasoning for identifying sequences processed by antigen presenting cells for T cell surveillance and the MHC-Associated Peptide Proteomics (MAPPs) identification of sequences processed by antigen presenting cells for T cell surveillance. FIG. 1A depicts antigen presentation via TCR of a naive CD4 T cell and HLA-II of a dendritic cell. FIG. IBdepicts the MHC-associated peptide proteomics (MAPPs) process for identifying sequences processed by antibody presenting cells for T cell surveillance. FIG. 1C depicts exemplary data obtained for an HLA-II derived peptide identification by MAPPs.

[0019] FIG. 2 is a schematic illustrating an exemplary embodiment of a method for identify ing an HLA-DRB1 allele according to the present disclosure.

[0020] FIG. 3 is Western blot on several knock-out cell lines with DRB1 antibody (Thermo PA5-28156). Clones starting with 1 indicate cell lines that were transfected with DRB1* 10:01 gRNAl and cell lines with 3 are gRNA3. Most of the cells that were transfected with gRNAl show complete absence of DRB1 (exception is 1C2). Clone 1E6 was selected for further investigation.

[0021] FIG. 4 is a schematic depicting stable expression of a recombinant BCR on 1E6 cell surface.

[0022] FIG. 5 depicts results of overexpressed BCR on the cell surface of 1E6 clones.

[0023] FIGS. 6 A and 6B depict heatmaps of adalimumab peptides derived from adalimumab variable heavy (FIG. 6A) and variable light (FIG. 6B) domains from each of the 15 B cell lines. Each row represents results from each B cell line. The heatmap density legend is displayed to the right. Residue numbering is indicated below each graph. VH = variable heavy; VL = variable light; MAPPs = MHC-associated peptide proteomics.

[0024] FIG. 7A depicts MAPPs display heatmaps representing IgGl (top), IgG2 (middle), and IgG4 (bottom) human heavy chain isotypes. The various constant region domains are depicted above the heatmaps for orientation.

[0025] FIG. 7B depicts MAPPs display heatmaps representing kappa (top) and lambda (bottom) human light chain isotypes. Each HLA-DRB 1 allele is represented as a row in the heatmap. The x-axis denotes the position within the constant regionsequence (EU numbering). Heatmap densities are normalized to the region of highest peptide display for each isotype, respectively.

[0026] FIGS. 8A-8D depict the sensitivity and reproducibility of the monoallelic B cell MAPPs platform. FIG. 8A depicts heatmaps summarizing peptides identified from the VH. Four cell lines were dosed with 1, 10, or 100 pg / ml anti-PCSK9 bococizumab. Each row represents an individual condition (HLA-DRB1 and dose level). The x-axis denotes the position within the linear sequence. Darker shaded regions within the heatmap correspond to greater peptide coverage. FIG. 8B depicts fifteen (15) Bococizumab H3 cluster peptides (residues 87-105) that were identified from the dosing concentration denoted below the chart (1, 10, or 100 pg / ml). Bococizumab H3 cluster peptide sequences (residues 87-105) identified from DRB 1*07:01 are listed on the right. Three columns represent 1, 10, and 100 pg / ml dose levels. Boxes shaded in grey depict peptides that were identified from the dosing concentration. For example, the first peptide (RSEDTAVYYCARERPLY; SEQ ID NO:271) was identified from the 100 pg / ml, but not 10 or 1 pg / ml dose levels. FIG. 8C depicts heatmaps showing golimumab VH peptides identified from four different cell lines at passage 7, 13 and 30. Each row represents an individual condition (HLA-DRB1 and passage number). The x-axis denotes the position within the linear sequence. The density scale is capped at 20 peptides. FIG. 8D is a graph depicting the sum of golimumab variable region peptides (VH + VL) identified from each sample. Golimumab was dosed on cell lines at various times across 30 passages. The peptide count is denoted on the Y -axis, the passage number is denoted on the x-axis, and colored lines indicate different HLA-DRB1 alleles.

[0027] FIG. 9 are heatmaps depicting that the universal BCR monoallelic HLA-DRB1 B cell platform recapitulates results obtained with monocyte derived dendritic cells. MDDCs and B cell lines were dosed with anti-IL21R antibody ATR- 107. Peptides identified from the variable regions were summarized for each sample and displayed as heatmaps. Each row of a heatmap represents an independent donor or monoallelic HLA-DRB1 cell line. The heatmaps on the left show peptides aligned to the VH using linear sequence numbering. The heatmaps on the right show peptides aligned to the VL using linear sequence numbering. The top plots correspond toMDDCs immunoprecipitated with a pan-HLA class II antibody (clone Tu39). The middle plots correspond to MDDCs and the bottom plots correspond to monoallelic B cell lines immunoprecipitated with an HLA-DR specific antibody (clone L243). The scale is capped at 20 peptides for each heatmap.

[0028] FIG. 10 are heatmaps demonstrating that the universal monoallelic B cell platform identified multiple areas of immunogenicity risk for adalimumab. Heatmaps of HLA-DRB1 peptides derived from adalimumab variable heavy (top panel) and variable light (bottom panel) domains from each of the 15 monoallelic B cell lines. Each row represents results from one HLA-DRB 1 allele cell line. The heatmap density legend is displayed to the right. The top end of the heat map was fixed at 20 peptides. Linear residue numbering is indicated below each graph. VH = variable heavy; VL = variable light. General locations of clusters are annotated at top of each heatmap.

[0029] FIGS. HA and 1 1B depict the synchronicity of cysteine modification patterns between HLA-DRB1 alleles. Modification state of cysteine- containing VH CDR3 peptides identified from adalimumab (FIG. 11 A) and ATR-107 (FIG. 11B). Each unique peptide is represented by a dot. Cysteine modifications (Y- axis) and HLA-DRB 1 allele of the cell lines (X-axis) are denoted on each graph.

[0030] FIG. 12 is aheatmap demonstrating that the universal monoallelic B cell platform can determine the HLA-DRB 1 binding of exogenous peptides using a human chimeric antibody. Each row represents results from one HLA-DRB 1 allele cell line. The heatmap density legend is displayed to the right. The top end of the heat map was fixed at 30 peptides. The sequence of the GIP peptide is denoted below the graph.DETAILED DESCRIPTION

[0031] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure belongs. Although any methods and materials similar to or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred methods and materials are described below.

[0032] While the present disclosure is susceptible to various modifications and alternative forms, exemplary embodiments thereof are shown by way of example in the drawings and are herein described in detail. It should be understood, however, that the description of exemplar}' embodiments is not intended to limit the disclosure to the particular forms disclosed, but on the contrary, the intention is to cover all modifications, equivalents and alternatives falling within the scope of the disclosure as defined by the embodiments above and the claims below. Reference should therefore be made to the embodiments above and claims below for interpreting the scope of the present disclosure. Moreover, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one element is present, unless the context clearly requires that there be one and only one element. The indefinite article "a" or "an" thus usually includes "at least one." The term "about" means up to ±10%.

[0033] As used herein, “nucleic acid”, “polynucleotide”, “nucleic acid molecule” and the like may be used interchangeably and refer to a series of nucleotide bases (also called “nucleotides”) in DNA and RNA. The nucleic acid may contain deoxyribonucleotides, ribonucleotides, and / or their analogs. The term encompasses sequences that include any of the known base analogues of DNA and RNA including4-acetylcytosine. 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl) uracil, 5 -fluorouracil, 5-bromouracil,5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1 -methyladenine, 1- methylpseudouracil, 1-methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5 -methylcytosine, N6- methyl adenine, 7-methylguanine, 5-methylaminomethyluracil, 5- methoxyaminomethy 1-2 -thiouracil, beta-D-mannosylqueosine, 5'- methoxy carbonylmethyluracil. 5 -methoxy uracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine. pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4- thiouracil, 5 -methyluracil, -uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, pseudouracil, queosine. 2-thiocytosine. and 2,6-diaminopurine.The term “nucleic acid” includes, for example, single-stranded and double-stranded molecules. A nucleicacid can be, for example, a gene or gene fragment, exons, introns, a DNA molecule (e.g., cDNA), an RNA molecule (e.g., mRNA), recombinant nucleic acids, plasmids, and other vectors, primers and probes.

[0034] A nucleic acid molecule, such as DNA, is said to be ‘‘capable of expressing’7a polypeptide if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are “operably linked” to nucleotide sequences which encode the polypeptide. An operable linkage is a linkage in which the regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene expression. As used herein, "operably linked" means that the elements of the expression cassette are configured so as to perform their usual function. Thus, control sequences (z.e., promoters) and / or regulatory' regions operably linked to a coding sequence are capable of effecting expression of the coding sequence. The control sequences and / or regulatory regions need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated, yet transcribed, sequences can be present between a promoter and a coding sequence, and the promoter sequence still can be considered "operably linked" to the coding sequence. The precise nature of the control sequences and / or regulatory regions needed for gene expression may vary from organism to organism, as is well known in the analogous art. See, e.g., Sambrook et al. MOLECULAR CLONING: LAB. MANUAL (3rd ed„ Cold Spring Harbor Lab. Press, Cold Spring Harbor, N.Y., 2001) and Ausubel et al. Current Protocols in Molecular Biology’ (New York: Greene Publishing Association / Wiley Interscience), 1993.

[0035] The term "recombinant," is used according to its ordinary meaning to mean a molecule that has been created or modified through deliberate human intervention such as by genetic engineering. For example, a recombinant nucleic acid molecule is one having a nucleotide sequence that has been modified to include an artificial nucleotide sequence or to include some other nucleotide sequence that is not present within its native (non-recombinant) form. Further, a recombinant nucleic acid molecule has a structure that is not identical to that of any naturally occurring nucleic acid molecule or to that of any fragment of a naturally occurring genomic nucleic acidmolecule spanning more than one gene. A recombinant nucleic acid molecule also includes, without limitation, a nucleic acid molecule having a sequence of a naturally occurring genomic or extrachromosomal nucleic acid molecule, but which is not flanked by the coding sequences that flank the sequence in its natural position; a nucleic acid molecule incorporated into a construct, expression cassette or vector, or into a host cell's genome such that the resulting polynucleotide is not identical to any naturally occurring vector or genomic DNA; a separate nucleic acid molecule such as a cDNA, a genomic fragment, a fragment produced by amplification methods such as polymerase chain reaction (PCR) and a restriction fragment; and a recombinant nucleic acid molecule having a nucleotide sequence that is part of a hybrid gene (i.e., a gene encoding a fusion protein). As such, a recombinant nucleic acid molecule can be modified (chemically or enzymatically) or unmodified DNA or RNA, whether fully or partially single-stranded or double-stranded or even triple-stranded.

[0036] Methods for synthesizing nucleic acid molecules are well known in the art, such as cloning and digestion of the appropriate sequences, as well as direct chemical synthesis (e.g. , ink-jet deposition and electrochemical synthesis). Methods of cloning nucleic acid molecules are described, for example, in Sambrook et al. MOLECULAR CLONING: LAB. MANUAL (3rd ed„ Cold Spring Harbor Lab. Press, Cold Spring Harbor, N.Y., 2001), Ausubel et al. Current Protocols in Molecular Biology (New York: Greene Publishing Association / Wiley Interscience), 1993, and Copeland et al. (2001) Nat. Rev. Genet. 2:769-779; PCR Cloning Protocols, 2nd ed. (Chen & Janes eds., Humana Press 2002). Methods of direct chemical synthesis of nucleic acid molecules include the phosphotriester methods of Reese (1978) Tetrahedron 34:3143-3179 and Narang et al. (1979) Methods Enzymol. 68:90-98; the phosphodiester method of Brown et al. (1979) Methods Enzymol. 68:109-151; the diethylphosphoramidate method of Beaucage el al. (1981) Tetrahedron Lett. 22: 1859- 1862: and the solid support methods of Fodor etal. (1991) Science 251:767-773; Pease et al. (1994) Proc. Natl. Acad. Sci. USA 91 :5022-5026; and Singh-Gasson et al. (1999) Nature Biotechnol. 17:974-978; as well as US Patent No. 4,485,066. See also, Peattie (1979) Proc. Natl. Acad. Sci. USA 76: 1760-1764; as well as EP Patent No. 1 721 908; Infl Patent Application Publication Nos. WO 2004 / 022770 and WO 2005 / 082923; USPatent Application Publication No. 2009 / 0062521; and US Patent Nos. 6,521,427;6,818,395 and 7,521.178.

[0037] For nucleotide sequences, "variant" refers to a substantially similar nucleotide sequence to a nucleotide sequence of a recombinant nucleic acid molecule as described herein. For nucleotide sequences, a variant comprises a nucleotide sequence having deletions (i.e., truncations) at the 5' and / or 3' end, deletions and / or additions of one or more nucleotides at one or more internal sites compared to the nucleotide sequence of the recombinant nucleic acid molecules as described herein; and / or substitution of one or more nucleotides at one or more sites compared to the nucleotide sequence of the recombinant nucleic acid molecules described herein. One of skill in the art understands that variants are constructed in a manner to maintain the open reading frame.

[0038] Conservative variants include those nucleotide sequences that, because of the degeneracy of the genetic code, result in a functionally active modified protein as described herein. Naturally occurring allelic variants can be identified by using well-known molecular biology techniques such as, for example, polymerase chain reaction (PCR) and hybridization techniques. Variant nucleotide sequences also can include synthetically derived sequences, such as those generated, for example, by site-directed mutagenesis but which still provide a functionally active modified protein. Generally, variants of a nucleotide sequence of the recombinant nucleic acid molecules as described herein will have at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleotide sequence of the recombinant nucleic acid molecules as determined by sequence alignment programs and parameters as described elsewhere herein.

[0039] Variants of the recombinant nucleic acid molecules described herein also can be evaluated by comparing the percent sequence identity between the polypeptide encoded by a variant and the polypeptide encoded by a reference nucleic acid molecule. Thus, for example, an isolated nucleic acid molecule can be one that encodes a polypeptide with a given percent sequence identity to the polypeptide of interest. Percent sequence identity between any two polypeptides can be calculatedusing sequence alignment programs and parameters described elsewhere herein. Where any given pair of polynucleotides of the present disclosure is evaluated by comparison of the percent sequence identify shared by the two polypeptides they encode, the percent sequence identify between the two encoded polypeptides can be at least about 70%, 75%, 80%, 85%. 90%, 91%, 92%, 93%, 94%, 95%, 96%. 97%, 98%, 99% or more sequence identify.

[0040] Determining percent sequence identify between any two sequences can be accomplished using a mathematical algorithm. Non-limiting examples of such mathematical algorithms include, but are not limited to, the algorithm of Myers & Miller (1988) CABIOS 4: 11-17; the local alignment algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482-489; the global alignment algorithm of Needleman & Wunsch (1970) J. Mol. Biol. 48:443-453; the search-for-local alignment method of Pearson & Lipman (1988) Proc. Natl. Acacl. Sci. USA 85:2444-2448; the algorithm of Karlin & Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in Karlin & Altschul (1993) roc. Natl. Acad. Sci. USA 90:5873-5877.

[0041] Compositions of the present disclosure also include nucleic acid constructs, such as expression cassettes or vectors, having promoters operably linked with nucleic acid molecules that encode recombinant B cell receptors and recombinant HLA-DRB1 alleles for use in the methods and for transforming cells as described herein.

[0042] As used herein, "nucleic acid construct" refers to an oligonucleotide or polynucleotide composed of deoxyribonucleotides, ribonucleotides or combinations thereof having incorporated therein the nucleotide sequences described herein.

[0043] As used herein, a "coding sequence" or "coding sequences" refers to a sequence that encodes a particular polypeptide, and is a nucleotide sequence that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at a 5' (amino) terminus and a translation stop codon at a 3' (carboxy) terminus. A codingsequence can include viral nucleic acid sequences, cDNA from prokaryotic or eukaryotic mRNA. genomic DNA sequences from prokaryotic or eukaryotic DNA, and even synthetic DNA sequences and synthetic RNA sequences. A transcription termination sequence will usually be located 3' to the coding sequence.

[0044] As used herein, a "promoter" refers to a nucleotide region comprising a nucleic acid (i.e., DNA) regulatory sequence, wherein the regulatory sequence is derived from a gene or synthetically created that is capable of binding RNA polymerase and initiating transcription of a downstream (3'-direction) coding sequence. Alternatively, promoters can be selected based upon a desired outcome. Such promoters include "constitutive promoters" (where expression of a polynucleotide sequence operably linked to the promoter is unregulated and therefore continuous), "inducible promoters" (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), and "repressible promoters" (where expression of a polynucleotide sequence operably linked to the promoter is repressed by an analyte, cofactor, regulatory protein, etc.).

[0045] To assist in introducing the nucleotide sequences of interest into the appropriate host cells, the expression cassette can be incorporated or ligated into a vector. As used herein, "vector" refers to a replicon, such as a plasmid, phage or cosmid, to which another nucleic acid segment may be attached so as to bring about the replication of the attached segment. A vector is capable of transferring nucleic acid molecules to the host cells. Bacterial vectors typically can be of plasmid or phage origin.

[0046] Typically, the terms "vector construct," "expression vector," "gene expression vector," "gene delivery vector," "gene transfer vector," and "expression cassette" all refer to an assembly that is capable of directing the expression of a nucleic acid sequence or gene of interest having at least a control sequence operably linked to a coding sequence. Thus, the terms include cloning and expression vehicles. Vectors ty pically contain one or a small number of restriction endonuclease recognition sites where a nucleic acid molecule of interest can be inserted in a determinable fashion without loss of essential biological function of the vector, as well as a selectable marker that can be used for identifying and selecting cells transformed with the vector.

[0047] As used herein, "reporter gene", "reporter protein", and "reporter", are all used according to their ordinary meaning as understood by one of ordinary skill in the art to refer to a gene that encodes a protein that is attached to a regulatory sequence of another gene of interest to induce visually identifiable characteristics in a cell expressing the reporter. Suitable reporters include fluorescent and luminescent proteins including, for example, luc (luciferase enzyme) lacZ (|3-galactosidase). GFP (green fluorescent protein), RFP (red fluorescent protein), and other known reporters.

[0048] As used herein, "selection gene" is used according to its ordinary meaning as understood by one of ordinary skill in the art to refer to a gene that encodes a protein that is attached to a regulatory sequence of another gene of interest to confer resistance to a selection agent in a cell expressing the selection gene. Particularly suitable selection genes include antibiotic-resistance genes. As understood by one of ordinary skill in the art, selection genes are used to select for transformed cells after transfection following contact with the selection agent. When cultured in selective medium including, for example, an antibiotic, cells that were not transfected or were transiently transfected will die, and those that express the antibiotic resistance gene at sufficient levels will survive. Antibiotics for use as selection agents include antibiotics such as puromycin, hygromycin. zeocin, blasticidin, neomycin, and other known antibiotics.

[0049] The term "transformed cell" is used according to its ordinary meaning to refer to a cell having a foreign (or exogenous) nucleic acid and expressing the recombinant protein(s) encoded by the foreign nucleic acid. Preferably, the transformed cell is stably transformed rather than transiently transformed. As understood by one of ordinary7skill in the art, in stable transformation, the foreign DNA taken up by the host cell is fully and permanently integrated into the host genome and the genetic modifications are present in further generations and in transient transformation, the foreign DNA temporarily introduced into a host cell and the DNA is not integrated into the host genome. The term "cell line" is used according to its ordinary meaning to refer to a cell culture developed from a single cell and therefore consisting of cells with a uniform genetic makeup. Particularly suitable transformed cells of the present disclosure are stably transformed cells.

[0050] As used herein, "deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles" refers to cells in which naturally occurring HL A-DRB 1 allele expression by the B cell is reduced, substantially reduced, or eliminated (knocked-out) such that the B cell does not express the endogenous HLA- DRB1. Similarly, "deficient in expression of endogenous B cell receptor (BCR)" refers to cells in which naturally occurring BCR expression by the B cell is reduced, substantially reduced, or eliminated (knocked-out) such that the B cell does not express the endogenous BCR. Expression of endogenous HLA-DRB1 and / or endogenous BCR can be monitored using well-known methods to detect and / or measure expression. Methods for detecting expression include Southern blot, Northern blot, in situ hybridization, amplification (e.g.. polymerase chain reaction), immunoassays (e.g.. Western blot, immunoprecipitation, flow cytometry, microarray analysis, dot blots, slot blot, S-l nuclease protection assay, RNase protection assay. Most desirably, endogenous HLA-DRB1 allele expression is completely eliminated such that endogenous HLA-DRB1 expression is undetectable. As described herein, endogenous HLA-DRB1 allele expression and / or endogenous BCR expression is eliminated using methods known in the art including CRISPR / Cas9, zinc finger nucleases, homing endonucleases, transcription activator-like effector nucleases, and the like. A particularly suitable method for eliminating endogenous HLA-DRB1 allele expression and / or endogenous BCR is accomplished by genetically editing the genomic sequence encoding the endogenous HLA-DRB1 allele and / or by genetically editing the genomic sequence encoding the endogenous BCR to create a mutation (e.g., deletion, insertion) that results in a premature stop codon such that the endogenous HL A-DRB 1 allele and / or endogenous BCR is not expressed.

[0051] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell. In some embodiments, the recombinant B cell receptor includes a chimeric antihuman IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain. Suitable BCR are described herein. In someembodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0052] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell includes a nucleic acid encoding a recombinant B cell receptor (BCR) that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant EILA-DRB 1 allele. In some embodiments, each transformed B cell is monoallelic for HLA-DRB 1 , expressing a single, recombinant EILA-DRB 1 allele. In other embodiments, the transformed B cell expresses more than one recombinant HLA-DRB 1 allele. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable antihuman IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding therecombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0053] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB 1*01:01 allele. In a particularly suitable embodiment, the nucleic acid encodes a HLA-DRB 1*01 :01 allele of SEQ ID NO: 1. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse antihuman IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR in addition to expressing the nucleic acid encoding the recombinant B cell receptor (BCR). In some embodiments, the transformed B cell is deficient in expression of endogenous BCR.

[0054] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB 1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB 1*03:01 allele. In a particularly suitable embodiment, the nucleic acid encodes a HLA-DRB 1*03: 01 allele of SEQ ID NO:2. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain,as described herein. A particularly suitable anti-human IgG domain is a mouse antihuman IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0055] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB 1*04:01 allele. In a particularly suitable embodiment, the HLA-DRB 1*04: 01 allele includes SEQ ID NO:3. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0056] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB 1*04:04 allele. In a particularly suitable embodiment, the HLA-DRB 1*04: 04 allele includes SEQ ID NO:4. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17. SEQ ID NO: 18, SEQ ID NO: 19. and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0057] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB 1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB 1*04: 05 allele. In a particularly suitable embodiment, the HLA-DRB 1 *04:05 allele includes SEQ ID NO:5. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encodedby a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0058] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB 1*07:01 allele. In a particularly suitable embodiment, the HLA-DRB 1 *07:01 allele includes SEQ ID NO:6. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17. SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0059] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB 1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB 1*08:01 allele. In a particularly suitable embodiment, the HLA-DRB 1*08: 01 allele includes SEQ ID NO:7. Suitable BCR are described herein. In some embodiments, the recombinant BCRincludes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17. SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0060] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB 1*08:03 allele. In a particularly suitable embodiment, the HLA-DRB 1 *08: 03 allele includes SEQ ID NO: 8. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isot pe, a human IgG2 isotype, and human IgG4 iso t pe, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0061] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRBl*09:01 allele. In a particularly suitable embodiment, the HLA-DRBl*09:01 allele includes SEQ ID NO:9. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0062] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB1* 11:01 allele. In a particularly suitable embodiment, the HLA-DRB1 *11:01 allele includes SEQ ID NO: 10. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cellreceptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO: 20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0063] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB1*12:O1 allele. In a particularly suitable embodiment, the HLA-DRB1*12:O1 allele includes SEQ ID NO: 11. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0064] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB1 *13:01 allele. In aparticularly suitable embodiment, the HLA-DRB1*13:O1 allele includes SEQ ID NO: 12. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0065] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB 1*13:02 allele. In a particularly suitable embodiment, the HLA-DRB1*13:O2 allele includes SEQ ID NO: 13. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isoty pe, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16. SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, thetransformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0066] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRBl*15:01 allele. In a particularly suitable embodiment, the HLA-DRBl*15:01 allele includes SEQ ID NO: 14. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0067] In one aspect, the present disclosure is directed to a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA- DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB 1*15:02 allele. In a particularly suitable embodiment, the HLA-DRB1*15:O2 allele includes SEQ ID NO: 15. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgGantibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0068] In one aspect the present disclosure is directed to a panel of transformed B cells deficient in expression of endogenous human leukocyte antigen- DRB1 (HLA-DRB1) alleles, wherein each of the transformed B cells comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant HLA-DRB 1 allele, wherein the recombinant HLA-DRB 1 allele is selected from the group consisting of a recombinant HLA-DRBl*01 :01 allele, a recombinant HLA-DRBl*03:01 allele, a recombinant HLA-DRB 1*04:01 allele, a recombinant HLA-DRBl*04:04 allele, a recombinant HLA-DRBl*04:05 allele, a recombinant HLA-DRB1 *07:01 allele, a recombinant HLA-DRB1 *08:01 allele, a recombinant HLA-DRB1 *08:03 allele, a recombinant HLA-DRB1 *09:01 allele, a recombinant HLA-DRB 1*11 :01 allele, a recombinant HLA-DRB 1*12:01 allele, a recombinant HLA-DRB1 *13:01 allele, a recombinant HLA-DRB1* 13:02 allele, a recombinant HLA-DRBl*15:01 allele, and a recombinant HLA-DRB1* 15:02 allele. Particularly suitable nucleic acids encode a recombinant HLA-DRB1 allele selected from the group consisting of SEQ ID NO: 1-15. In some embodiments, each of the transformed B cells includes a nucleic acid encoding a single recombinant HLA-DRB1 allele. In some embodiments, each of the transformed B cells includes nucleic acids encoding more than one recombinant HLA-DRB allele. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgGdomain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0069] Suitable cells for preparing transformed cells include human cells. A particularly suitable human cell includes a human B cell. A particularly suitable cell line for use as the B cell is a RAJI cell line (commercially available). The RAJI cell line is a human cell line of hematopoietic origin and was derived from a patient with Burkitt's lymphoma (BL).

[0070] Transformed cells are cells that have been transformed or transfected with recombinant expression constructs made using recombinant DNA techniques and comprising nucleic acids encoding the B cell receptor and nucleic acids encoding the HLA-DRB1 alleles, as described herein.

[0071] Preferably, the transformed B cells and the transformed cell line of the present disclosure are stably transfected.

[0072] In one aspect, the present disclosure is directed to a method for identifying a peptide of a biotherapeutic protein presented by a human leukocyte antigen-DRBl (HLA-DRB1) allele. The method includes: contacting a biotherapeutic protein with a first transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on a membrane surface of the transformed B cell, and a nucleic acid encoding a recombinant human leukocyte antigen-DRBl (HLA-DRB1) allele; culturing the transformed B cellfor a time sufficient for the recombinant B cell receptor to bind the biotherapeutic protein and form a HLA-DRB 1 -peptide complex comprising peptides of the biotherapeutic protein and the recombinant HLA-DRB 1 allele; and analyzing the HLA- DRB 1 -peptide complex to identify the peptide of the biotherapeutic protein. As used herein, "HLA-DRB 1 allele " refers to any one of the 15 HLA-DRB 1 alleles described herein. In particular, a HLA-DRBl*01:01 allele, a HLA-DRB 1*03: 01 allele, a HLA- DRBl*04:01 allele, a HLA-DRBl*04:04 allele, a HLA-DRB 1*04: 05 allele, a HLA- DRBl*07:01 allele, a HLA-DRB 1*08:01 allele, a HLA-DRB1 *08:03 allele, a HLA- DRBl*09:01 allele, a HLA-DRB1*! 1 :01 allele, a HLA-DRB1* 12:01 allele, a HLA- DRBl*13:01 allele, a HLA-DRB 1*13:02 allele, a HLA-DRBl*15:01 allele, and a HLA-DRB 1* 15:02 allele. As described herein, in some embodiments, the transformed B cell of the method is monoallelic for the HLA-DRB1 allele. For example, the transformed B cell of the method expresses only one of the recombinant HLA-DRB 1 alleles selected from a HLA-DRB 1*01 :01 allele, a HLA-DRB 1*03: 01 allele, a HLA- DRBl*04:01 allele, a HLA-DRBl*04:04 allele, a HLA-DRB 1*04: 05 allele, a HLA- DRBl*07:01 allele, a HLA-DRB 1*08:01 allele, a HLA-DRB1 *08:03 allele, a HLA- DRBl*09:01 allele, a HLA-DRB1*! 1 :01 allele, a HLA-DRB1* 12:01 allele, a HLA- DRBl*13:01 allele, a HLA-DRB1* 13:02 allele, a HLA-DRBl*15:01 allele, and a HLA-DRB1* 15:02 allele. In other embodiments, the transformed B cell of the method expresses more than one of the recombinant HLA-DRB 1 alleles selected from a HLA- DRBl*01 :01 allele, a HLA-DRB 1*03:01 allele, a HLA-DRB 1*04: 01 allele, a HLA- DRBl*04:04 allele, a HLA-DRBl*04:05 allele, a HLA-DRB1 *07:01 allele, a HLA- DRBl*08:01 allele, a HLA-DRB 1*08: 03 allele, a HLA-DRB 1*09: 01 allele, a HLA- DRBl*l l :01 allele, a HLA-DRB 1* 12: 01 allele, a HLA-DRBl*13:01 allele, a HLA- DRB1*13:O2 allele, a HLA-DRBl*15:01 allele, a HLA-DRB 1*15:02 allele, and combinations thereof. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse antihuman IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16. SEQ ID NO: 17, SEQ ID NO: 18,SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0073] The method can further include culturing the transformed B cell for a time sufficient for the transformed B cell to present peptides of the biotherapeutic protein via a HLA-DRB1 -peptide complex. The method can further include isolating the transformed B cell following the step of culturing. The method can further include lysing the transformed B cell to release the HLA-DRB1 -peptide complex. The method can further include eluting the peptide from the HLA-DRB1 -peptide complex. It will be understood that the peptide of the HLA-DRB1 -peptide complex are peptides of the biotherapeutic protein after the biotherapeutic protein is bound (via the BCR) by the transformed B cell, internalized by the transformed B cell, and enzymatically processed by the transformed B cell to form peptides of the biotherapeutic protein, which then form HLA-DRB1 -peptide complexes.

[0074] The method can further include analyzing the HLA-DRB1 -peptide complex to identify peptides for anti-drug antibody epitopes.

[0075] The method further includes contacting the biotherapeutic protein with a second transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on the B cell membrane surface and a nucleic acid encoding a second recombinant human leukocyte antigen-DRBl (HLA-DRB1) allele; culturing the second transformed B cell for a time sufficient for the recombinant B cell receptor to bind the biotherapeutic protein and form a HLA-DRB1 -peptide complex comprising peptides of the biotherapeutic protein and the second recombinant HLA-DRB1 allele; and analyzing the HLA-DRB1 -peptide complex to identify the peptide.

[0076] The method further includes contacting the biotherapeutic protein with a third transformed B cell, a fourth transformed B cell, a fifth transformed B cell, a sixth transformed B cell, a seventh transformed B cell, an eighth transformed B cell, a ninth transformed B cell, a tenth transformed B cell, an eleventh transformed B cell, a twelfth transformed B cell, a thirteenth transformed B cell, a fourteenth transformed B cell, a fifteenth transformed B cell, and combinations thereof. It should be understood that each of the transformed B cells (i.e., the first to the fifteenth) are deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB 1) alleles and each includes a nucleic acid encoding a recombinant B cell receptor that is expressed on the B cell membrane surface and a nucleic acid encoding a recombinant human leukocyte antigen-DRBl (HLA-DRB 1) allele. In some embodiments, the nucleic acid encoding the recombinant human leukocyte antigen-DRBl (HLA-DRB 1) allele contained within each transformed B cell encodes a different HLA-DRB 1 allele such that fifteen different transformed B cells each having a different HLA-DRB1 allele can be contacted with a biotherapeutic protein. In such methods, all fifteen HLA-DRB 1 alleles can be independently tested for presenting peptides of the biotherapeutic protein. In particular, 15 transformed B cells that are each monoallelic for HLA-DRB1 allele can be contacted with a biotherapeutic protein and used to identify peptides of the biotherapeutic protein that form a HLA-DRB1 -peptide complex with one or more of the 15 HLA-DRB1 alleles. As provided herein, the 15 HLA-DRB1 alleles include a HLA-DRBl*01 :01 allele, a HLA-DRBl*03:01 allele, a HLA-DRBl*04:01 allele, a HL A-DRB 1*04:04 allele, a HLA-DRBl*04:05 allele, a HLA-DRB1 *07:01 allele, a HLA-DRB 1*08: 01 allele, a HLA-DRBl*08:03 allele, a HLA-DRBl*09:01 allele, a HLA-DRBl* l l :01 allele, a HLA-DRB1* 12:O1 allele, a HLA-DRBl*13:01 allele, aHLA-DRB1* 13:02 allele, a HLA-DRBl*15:01 allele, and a HLA-DRBl *15:02 allele.As provided herein, transformed B cells of the present disclosure express a single recombinant HLA-DRB1 allele (monoallelic) selected from a HLA-DRB1 *01 :01 allele, a HLA-DRBl*03:01 allele, a HLA-DRBl*04:01 allele, a HLA-DRBl*04:04 allele, a HLA-DRB 1*04:05 allele, a HLA-DRBl*07:01 allele, a HLA-DRB 1*08:01 allele, a HLA-DRBl*08:03 allele, a HLA-DRB 1*09: 01 allele, a HLA-DRBl*l l :01 allele, a HLA-DRB1*12:O1 allele, a HLA-DRBl*13:01 allele, a HLA-DRB1* 13:02 allele, a HLA-DRB1* 15:01 allele, and a HL A-DRB1 *15:02 allele. In otherembodiments, the transformed B cell expresses more than one recombinant HLA- DRB1 alleles. In other embodiments, the transformed B cell expresses more than one recombinant HLA-DRB1 alleles selected from a HLA-DRBl*01 :01 allele, a HLA- DRBl*03:01 allele, a HLA-DRBl*04:01 allele, a HLA-DRBl*04:04 allele, a HLA-DRBl*04:05 allele, a HLA-DRB 1*07:01 allele, a HLA-DRB1 *08:01 allele, a HLA-DRBl*08:03 allele, a HLA-DRB 1*09: 01 allele, a HLA-DRB1*! 1:01 allele, a HLA-DRBl*12:01 allele, a HLA-DRB 1* 13:01 allele, a HLA-DRB1* 13:02 allele, a HLA-DRBl*15:01 allele, a HLA-DRB1* 15:02 allele, and combinations thereof. As described herein, the transformed B cells also express a recombinant B cell receptor. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR

[0077] The method is particularly suitable for analyzing biotherapeutic proteins. Suitable biotherapeutic proteins include antibodies such as monoclonal antibodies and polyclonal antibodies such as IgG antibodies, including the IgGl, IgG2, and IgG4 subclasses of IgG antibodies. Suitable biotherapeutic proteins also include biologies such as hormones (e.g., parathyroid hormone, growth hormone, insulin, glucagon, gonadotropins, and the like), haematopoietic growth factors (such as erythropoietin, colony stimulating factors, and the like), blood factors (such as Factor VIII, Factor IX, and the like), thrombolytic agents (such as tissue plasminogenactivator), interferons, interleukins, vaccines, tumor necrosis factor, and other therapeutic enzymes.

[0078] The method includes culturing the transformed B cell for a time sufficient for the recombinant B cell receptor to bind the biotherapeutic protein and form a HLA-DRB1 -peptide complex comprising peptides of the biotherapeutic protein and the recombinant HLA-DRB1. Without being bound by theory, when the recombinant B cell receptor binds the biotherapeutic protein, the transformed B cell internalizes the recombinant B cell receptor / biotherapeutic protein complex. Internalization of the recombinant B cell receptor bound to the biotherapeutic protein results in a cell signaling cascade that leads to activation of the B cell and processing of the biotherapeutic protein into peptides that are loaded on HLA class II DR molecules to form a HLA-DRB1 -peptide complex. The HLA-DRB1 -peptide complex is then displayed at the B cell membrane surface. It will be understood that the HLA-DRB1- peptide complex can be captured and analyzed before reaching the membrane surface of the transformed B cell. It will be understood that the nucleic acid encoding a recombinant B cell receptor (also referred to herein as "BCR" and "chimeric BCR") that is expressed on the B cell membrane surface and specifically binds the biotherapeutic protein is an expression construct. The chimeric BCR uses the natural signaling system present in B cells after binding and internalizing the biotherapeutic protein. In a particularly suitable exemplar}' embodiment, the nucleic acid encoding a recombinant B cell receptor (BCR) that is expressed on the B cell membrane surface includes a human IgD constant region for the heavy chain of the BCR and a human IgK constant region for the light chain of the BCR. Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17. SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence ofSEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0079] Transformed B cells expressing the same HLA-DRB1 are cultured together in a single well of a multi-well culture plate, and thus, isolating the transformed B cells following the time sufficient for the transformed B cell to process the biotherapeutic protein into the peptides and form the HLA-DRB1 -peptide complex is not required. Where isolating the transformed B cell is desired, any suitable methods can be used for isolating the transformed B cell following the time sufficient for the transformed B cell to process the biotherapeutic protein into the peptides and form the HLA-DRB1 -peptide complex. Suitable methods include fluorescence activated cell sorting (FACS), immunomagnetic cell sorting, microfluidic cell sorting, antibody- and complement-mediated cell separation, polystyrene immunoaffmity devices, buoyancy- activated cell sorting (BACS), and the like.

[0080] Any suitable methods can be used for lysing the transformed B cell to release the HLA-DRB1 -peptide complex. For example, cells can be lysed with lysis buffers, by cycles of freeze-thaw, homogenization, sonication, and the like. Suitably, the transformed B cells can be lysed without first isolating the transformed B cell.

[0081] Any suitable methods can be used for capturing the HLA-DRB1 - peptide complex. A particularly suitable method is by immunocapture such as antibodypulldown, for example.

[0082] Peptides from the HLA-DRB1 -peptide complexes are purified by column chromatography and identified by mass spectrometry. As understood by one skilled in the art, analysis by mass spectrometry enables sequence identification of the peptide of the biotherapeutic protein via database search by comparing the measured mass spectra of the peptide to calculated mass spectra generated from peptide sequencesobtained from a protein database. The identified peptides can then be mapped to the sequence of the biotherapeutic protein.

[0083] In another aspect, the present disclosure is directed to a method for identifying a subject as susceptible to develop an anti-drug antibody response to a biotherapeutic protein. The method includes: contacting a biotherapeutic protein with a transformed B cell deficient in expression of endogenous human leukocyte antigen- DRB1 (HLA-DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor that is expressed on the B cell membrane surface and a nucleic acid encoding a recombinant human leukocyte antigen-DRBl (HLA-DRB1) allele selected from the group consisting of a HLA-DRBl*01 :01, a HLA-DRB 1*03: 01, a HLA-DRB 1*04:01, a HLA-DRBl*04:04, aHLA-DRBl*04:05, a HLA-DRBl*07:01, a HLA-DRBl*08:01, a HLA-DRB1*O8:O3, a HLA- DRBl*09:01, a HLA-DRBl*l l :01, a HLA-DRB1*12:O1, a HLA-DRBl*13:01, a HLA-DRB 1* 13:02, a HLA-DRB 1*15:01, and a HLA-DRB 1* 15:02; culturing the transformed B cell for a time sufficient for the recombinant B cell receptor to bind the biotherapeutic protein and form a HLA-DRB 1 -peptide complex comprising peptides of the biotherapeutic protein and the recombinant HLA-DRB 1; analyzing the HLA- DRB 1 -peptide complex to identify the peptide; and identifying the subject as susceptible to develop an anti-drug antibody response to the biotherapeutic protein if the HLA-DRB1 allele presenting the peptide in the HLA-DRB 1 -peptide complex is the same as the HLA-DRB 1 genotype of the subject. In some embodiments, the method further includes identifying the subject's HLA-DRB 1 allele genotype.

[0084] "Anti-drug antibody response" is used herein according to its ordinary meaning as understood by one of ordinary skill in the art to mean a subject's development of an immune response against a biotherapeutic protein. The subject's immune response leads to the production of anti-drug antibodies that can reduce the efficacy of a biotherapeutic protein, inactivate the therapeutic effect of the biotherapeutic protein, and neutralize both the biotherapeutic protein and its endogenous counterpart protein.

[0085] Suitable BCR are described herein. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse antihuman IgG antibody that specifically binds to at least one of a human IgG I isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein. In some embodiments, the transformed B cell continues expressing endogenous BCR while expressing the nucleic acid encoding the recombinant BCR. In some embodiments, the transformed B cell is deficient in expression of endogenous BCR while expressing the nucleic acid encoding the recombinant BCR.

[0086] Any methods for identifying a subject's HLA-DRB1 allele genotype are suitable such as sequence-based typing. Additionally, certain populations of humans are known to have a particular HLA-DRB1 allele genotype.

[0087] The results of the method can further indicate that the subject is or is not a candidate for a particular biotherapeutic protein. If, for example, the HLA- DRB1 allele presenting the peptide in the HLA-DRB1 -peptide complex is the same as the HLA-DRB1 genotype of the subject, the subject is susceptible to developing antidrug antibodies against the biotherapeutic protein. In this case, the subject may initially be responsive to the biotherapeutic protein, but then lose responsiveness to the biotherapeutic protein over time. Conversely, if the HLA-DRB1 allele presenting the peptide in the HLA-DRB1 -peptide complex is the not the same as the HLA-DRB1 genotype of the subject, the subject is not expected to develop anti-drug antibodies against the biotherapeutic protein. In this case, the subject is expected to be responsive to the biotherapeutic protein.

[0088] In one aspect, the present disclosure is directed to a nucleic acid encoding a recombinant B cell receptor. In some embodiments, the recombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant regionas a heavy' chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO:20, as described herein.

[0089] In one aspect, the present disclosure is directed to a nucleic acid encoding a recombinant human leukocyte antigen-DRBl (HLA-DRB1) allele. The recombinant human leukocyte antigen-DRBl (HLA-DRB1) allele is selected from a recombinant HLA-DRB 1*01:01, a recombinant HLA-DRB 1*03:01, a recombinant HLA-DRBl*04:01, a recombinant HLA-DRB 1*04: 04, a recombinant HLA- DRBl*04:05, a recombinant HLA-DRB 1*07:01, a recombinant HLA-DRB 1*08: 01, a recombinant HLA-DRB 1*08:03, a recombinant HLA-DRB 1*09:01, a recombinant HLA-DRBl*l l :01, a recombinant HLA-DRB 1*12:01, a recombinant HLA- DRBl*13:01, a recombinant HLA-DRB1* 13:02, a recombinant HLA-DRBl*15:01, a recombinant HLA-DRB 1*15:02, and combinations thereof. A suitable recombinant HLA-DRB1 *01 :01 includes SEQ ID NO: 1. A suitable recombinant HLA-DRB 1*03:01 includes SEQ ID NO:2. A suitable recombinant HLA-DRB1 *04:01 includes SEQ ID NO: 3. A suitable recombinant HLA-DRB 1*04:04 includes SEQ ID NO:4. A suitable recombinant HLA-DRB 1*04: 05 includes SEQ ID NO:5. A suitable recombinant HLA- DRBl*07:01 includes SEQ ID NO:6. A suitable recombinant HLA-DRB 1*08:01 includes SEQ ID NO:7. A suitable recombinant HLA-DRB 1*08: 03 includes SEQ ID NO: 8. A suitable recombinant HLA-DRB1 *09:01 includes SEQ ID NO:9. A suitable recombinant HLA-DRBl*l l :01 includes SEQ ID NOTO. A suitable recombinant HLA-DRB1* 12:01 includes SEQ ID NO: 11. A suitable recombinant HLA- DRBl*13:01 includes SEQ ID NO: 12. A suitable recombinant HLA-DRB 1* 13:02 includes SEQ ID NO: 13. A suitable recombinant HLA-DRB1 * 15:01 includes SEQ ID NO: 14. A suitable recombinant HLA-DRB1* 15:02 includes SEQ ID NO: 15.

[0090] In one aspect, the present disclosure is directed to a vector having a nucleic acid encoding a recombinant B cell receptor. In some embodiments, therecombinant BCR includes a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain, as described herein. A particularly suitable anti-human IgG domain is a mouse antihuman IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype, as described herein. Particularly suitable B cell receptors include at least one of SEQ ID NO: 16. SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and combinations thereof, as described herein. A particularly suitable BCR is encoded by a nucleic acid sequence of SEQ ID NO: 20, as described herein.

[0091] In one aspect, the present disclosure is directed to a vector having a nucleic acid encoding a recombinant human leukocyte antigen-DRBl (HLA-DRB1) allele. The recombinant human leukocyte antigen-DRBl (HLA-DRB1) allele is selected from a recombinant HLA-DRBl*01:01, a recombinant HLA-DRB1*O3:O1, a recombinant HLA-DRB 1*04:01, a recombinant HLA-DRBl*04:04, a recombinant HLA-DRBl*04:05, a recombinant HLA-DRB 1*07: 01, a recombinant HLA- DRBl*08:01, a recombinant HLA-DRB1 *08:03, a recombinant HLA-DRBl*09:01, a recombinant HLA-DRB1 *11:01, a recombinant HLA-DRB1* 12:01, a recombinant HLA-DRB1* 13:01, a recombinant HLA-DRB 1*13:02, a recombinant HLA- DRBl*15:01, a recombinant HLA-DRB 1*15:02, and combinations thereof. A suitable recombinant HLA-DRB 1*01:01 includes SEQ ID NO: 1. A suitable recombinant HLA- DRBl*03:01 includes SEQ ID NO:2. A suitable recombinant HLA-DRB 1*04:01 includes SEQ ID NO:3. A suitable recombinant HLA-DRB 1*04: 04 includes SEQ ID NO:4. A suitable recombinant HLA-DRB 1*04: 05 includes SEQ ID NO:5. A suitable recombinant HLA-DRB 1*07: 01 includes SEQ ID NO: 6. A suitable recombinant HLA- DRB1 *08:01 includes SEQ ID NO:7. A suitable recombinant HLA-DRB 1*08: 03 includes SEQ ID NO:8. A suitable recombinant HLA-DRB 1*09: 01 includes SEQ ID NO:9. A suitable recombinant HLA-DRB 1*11:01 includes SEQ ID NOTO. A suitable recombinant HLA-DRB 1* 12: 01 includes SEQ ID NO: 11. A suitable recombinant HLA-DRBl *13:01 includes SEQ ID NO: 12. A suitable recombinant HLA- DRB1*13:O2 includes SEQ ID NO: 13. A suitable recombinant HLA-DRBl*15:01 includes SEQ ID NO: 14. A suitable recombinant HLA-DRB 1*15:02 includes SEQ ID NO: 15.

[0092] Suitable vectors include viral vectors, plasmids, cosmids, lambda phages, and artificial chromosomes. Suitable vectors include cloning vectors and expression vectors.

[0093] Nucleic acids and vectors of the present disclosure can include other elements such as origins of replication, promoters, enhancers, cloning sites, genetic markers, selection genes (such as antibiotic resistance genes), antibody epitopes, reporter genes, targeting sequences, protein purification tags, and the like.EXAMPLESEXAMPLE 1Cell Line Preparation

[0094] A human DRB 1 double knock out Raji cell line was created by using guide RNAs targeting DRB 1-03 and DRB 1-10 alleles. DRB1 crRNAs were purchased from Horizon targeting DRB1.03 (cat. # CM-011688-04-0005 with the target sequence CGTGACAAGCCCTCTCACAG (SEQ ID NO:21)) and the DRB1.10 allele (cat. # crRNA-471552 PERDT-000001 with the target sequenceATGGTGTGTCTGAGGCTCCC (SEQ ID NO:22)).

[0095] A single knock out of DRBl*03:01 was created in Raji cells. Sanger sequencing confirmed a 7bp deletion resulting in a frame shift and a short stop in the protein sequence. Sanger sequencing also confirmed that DRBl*10:01 was intact so an additional round of CRISPR was performed on the DRB 1*03:01 clone with gRNAs targeting DRB 1*10:01.

[0096] The DRB 1.03 or DRB 1.10 crRNA was combined with tracrRNA (Horizon, cat. U-002005-050) and Cas9 EGFP Nuclease mRNA (Horizon CAS 11860) and transfected into Raji cells by nucleofection with the AMAXA® lib instrument (Lonza) using NUCLEOFECTOR® V solution and program M-013. Nucleofected cells were recovered with 500 pl of complete medium containing 10% FBS and dispensed into a 12 well plate containing 1ml of pre-warmed media and incubated at 37 °C, 5% CO2 until the cells were 80-90% confluent. Cells were sorted by FACs for single cellsin a 96 well plate and incubated at 37 °C; 5% CO2. Cells were screened by the T7EI assay for gene editing and several cell clones were identified for evaluation by western blot (FIG. 3).Exogenous anti-human IgG B cell receptor construction

[0097] To build a panel of HLA-DR expressing B cell lines capable of internalizing molecules of interest that contain a human IgG Fc, a base cell line that expresses an exogenous B cell receptor (BCR) was created. The 1E6 cell line that had endogenous HLA-DRB alleles inactivated was used for transfection of the exogenous anti-hlgG BCR. Once created, this cell line was used for all subsequent HLA-DRB transfections.

[0098] Initially, a mouse antibody capable of binding human IgGl, IgG2, and IgG4 isotypes was identified.Table 1. Mouse anti -human binding.

[0099] The murine variable genes were then cloned into an expression vector to generate a chimeric exogenous BCR containing a human IgD constant region for the heavy chain of the BCR and a human IgK constant region for the light chain of the BCR. The expression construct also included a gene encoding blast cidin resistance to facilitate stable cell line generation after transfection. The chimeric BCR utilized the natural signaling system present in B cells after antigen binding.Transfection and stable cell line development.

[0100] As illustrated in FIG. 4, 1E6 HLA-DR knockout cell line was transfected with hlgG BCR 1GHD bicistronic expression plasmid that containsblastacidin S deamindase to enable selection of stably transfect cells. The AMAXA® NUCLEOFECTOR® system (Lonza) was used to transfect cells with plasmid following manufacturer instructions. Transfected cells were seeded into 96 well plate. Blasticidin (5 micrograms / ml) was added to cells after 24 hours to select for stable plasmid integration. Cells were cultured for 3-4 weeks and growth was visually monitored. Those wells with growth were expanded into 24-well plate with 1 ml of selective media.

[0101] Expression and function of exogenous chimeric anti-human IgG BCR was confirmed using flow cytometry. A biotinylated human IgG4 (4 microgram / ml) with streptavidin-phycoerythrin (Invitrogen cat# S866) (1 microgram / ml) was used to stain 1x10 E6 cells. Clone 1E6-17G10 was further expanded for cell bank generation and used for monoallelic HLA-DR transfections. As depicted in FIG. 5 data indicated that clone 1E6-17 A2 and 1E6-17G10 overexpressed chimeric BCR on the cell surface.Cell line transfectionsTransfection of HLA-DRB 1

[0102] On day 1, 2xlOA6 17gl0 IgD engineered RAJI B cells were transfected with 2 pg of HLA-DRB 1 DNA of choice using the Super Piggy Bac Vector (SBI. Cat#PB210PA-l). 15 HLA-DR alleles were selected for transfection: HLA- DRBI*0I:0I, 03:01, 04:01, 04:04, 04:05, 07:01, 08:01, 08:03, 09:01, 11:01, 12:01, 13:01, 13:02, 15:01, and 15:02, creating 15 HLA-DRB1 expressing cell lines. The transfections were done using the AMAXA® instrument, and the AMAXA® Cell Line NUCLEOFECTOR® Kit V (Lonza, cat#VCA-1003) protocol was followed. After transfection, the cells were incubated in warm media (RPMI 1640 with 2 mM L- glutamine (Gibco, cat#l 1875-093)); 5% FBS (Gibco, cat#10082-147), lx Antibiotic / Antimycotic (Gibco, cat# 15240-062), 5 pg / mL Blasticidin (Gibco, cat# Al 1139-03) for 3 days. On day 4, cells were resuspended in fresh selection media (RPMI 1640 with 2 mM L-glutamine (Gibco, cat# 1 1875-093)); 5% FBS (Gibco, cat#10082-147), lx Antibiotic / Antimycotic (Gibco, cat# 15240-062), 5 pg / mLBlasticidin (Gibco. cat#Al 1139-03), and 0.5 pg / mL Puromycin (Gibco, cat#A11138- 03). Cells were then expanded to become confluent in a T75 cell culture flask.RAJI B Cell MFI Checks

[0103] lx 106cells were stained with primary cell markers : anti-HLA-DRB 1 clone L234 and biotin-tagged human IgG (Lilly, BE05552-055) for 20 minutes in FACs buffer (0.5% BSA in PBS). The cells were washed with FACs buffer then stained with secondary' antibodies: SAPE (Life Tech, Cat#S866) and Rat anti-mouse IgG2a-FITC (BD-Pharm, Cat#553390). The samples were then analyzed by flow cytometry using the BD FACs Melody. The median fluorescent intensity was determined using the FlowJo Software.MAPPs Assay Performance and Results

[0104] 4 Test Abs (3 HC isotypes (IgGl-IgG2-IgG4) and 2 LC isotypes(kappa and lambda) were used.

[0105] Engineered RAJI B Cell Culture. Engineered RAJI B cells were maintained in complete RPMI media (RPMI 1640 with 2 mM L-glutamine (Gibco, cat# 11875-093)); 5% FBS (Gibco, cat#10082-147), lx Antibiotic / Antimycotic (Gibco, cat# 15240-062), 5 pg / mL Blasticidin (Gibco, cat#Al 1139-03), and 0.5 pg / mL Puromycin (Gibco, cat#Al 1138-03).

[0106] For test article dosing, viability and cell count was determined with Trypan blue staining (Thermo Fisher Scientific, Countess cell counter). Cells from each selected HLA-DRB1 cell line were resuspended at a density of 5xl05cells / mL in 30 mLs and plated 5 mLs per well in a 6 well cell culture plate. Cells were dosed with test article (Examples mAbs 1 -2-3-4) at 100 pg / mL and placed in an incubator at 37 °C and 5% CO2 for 24 hours. The cells were lysed the next day with RIPA lysis and extraction buffer (Thermo Fisher Scientific, cat # 89900, 25 mM Tris»HCl pH 7.6. 150 mM NaCL 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) containing 1: 1000 of 10 unit / pL DNase (Roche, cat# 04716728001) and 1 tablet of EDTA free protease inhibitors(Roche, Cat# 11836170001) per 10 mL of lysis buffer. The lysates were frozen at -80Immunoprecipitation

[0107] An Agilent Assay MAP robot was used to isolate HLA-DR molecules in the lysate. One hundred micrograms of biotinylated anti-HLA-DR antibody clone L243 was immobilized on streptavidin cartridges (Agilent, SA-W, 5 pL). The cartridge was washed with 50 pL of PBS three times. B cell lysates were thawed, passed over a 0.22 pm filter, and 1 mL of each sample was loaded onto a 96 well polypropylene plate. The lysate was aspirated into the syringes and the antibody loaded cartridge was attached to the syringe tip. The lysate was passed over the affinity cartridge at 5 pL / minutes at room temperature. The cartridge was washed 2 x 50 pL with 100 mM ammonium acetate at 25 pL / minute and once with 50 pL water at 25 pL / minute. The cartridge was eluted with 50 pL of 5% acetic acid with 0. 1% TFA at 2 pL / minute into a 96 well polypropylene PCR plate. The eluted peptides were passed over a 10k MWCO spin filter treated with 1 mg / mL BSA (Sigma, 05470) and 100 ng / mL angiotensin I peptide and washed with 5% acetic acid. The filtered material was loaded in a 96 well polypropylene PCR plate for mass spec analysis.LC / MS analysis of HLA-II Eluted Peptides

[0108] The samples were analyzed with a Thermo LUMOS mass spectrometer using a Thermo easy 1200 nLC-HPLC system. The separation w as carried out with a 75 pm x 15 cm cl 8 column (Thermo ES900) coupled to an EASY-Spray source with an electrospray potential of 1.9 kV. The solvents were A: 0.1% formic acid in water (Thermo Fisher Scientific. Optima LC / MS Grade) and B: 80% acetonitrile with 0.1% formic acid (Thermo Fisher Scientific, Optima LC / MS Grade). The gradient was 65 minutes using a flow rate of 300 nL / minute, starting with a 60 minute 2%- 55%B ramp followed by a 1 minute 55%-98%B ramp and a 4 minute hold at 98%B). The LUMOS was run with a full scan at 240,000 resolution in the orbitrap followed by a 3 second data dependent MS / MS cycle comprised of ion trap rapid scans where +2 ions were fragmented by HCD(CE of 15,22,28) and +3 and +4 ions were fragmentedby HCD(CE of 15,22,28) and EThcD (Calibrated Charge-Dependent ETD parameters and supplemental HCD activation (50%)).Data Processing and Analysis

[0109] The data was analyzed with the Lilly proteomics pipeline (Higgs et al., 2008). The data conditioning steps consisted of extraction from the vendor format, fitting parent ions for data dependent scans to theoretical isotope patterns and correcting the monoisotopic mass and charge of the parent ion, determining the fit of the parent ion isotope to the theoretical isotope pattern and filtering out ms / ms scans if the parent ions did not match the isotope pattern with a score of 0.6 or greater. From the filtered scans, an MGF file was created along with a table of spectral features for each spectrum.

[0110] Spectral identifications were performed with X! Tandem version 2017 and OMSSA version 2.1.7 search engines. A database was used consisting of the antibody test compound heavy and light chains and 2134 common human and bovine proteins identified from HLA-II bound peptides seen from Raji cells, DCs, and bovine proteins in the cell media. The search engine parameters included a no enzyme search with a maximum missed cleavage site setting of 30, 10 ppm tolerance for parent ions, and 0.5 Da tolerance for the fragment ions. Potential amino acid modifications included: Cysteine mods of disulfide; mercaptoethanolation; mono, di, and tri oxidation; and cysteinylation; deamidation of glutamine and asparagine; methionine oxidation; tryptophan oxidation, deoxidation, oxidation to kynurenin. HCD spectra were searched for b- and y-ions and EThcD were searched for c-, z-, b-, and y-ions.

[0111] False positive identifications were controlled by running the searches against a reversed version of the protein database and estimating false discovery rates. An iterative random forest classifier was trained using search results and spectral features to increase identification sensitivity in a manner similar to the percolator algorithm (Kall et al., 2007). The search results from X! Tandem and OMSSA were pooled and peptides with q-values < 0.20 were assigned to the smallest group of proteins that account for all identified peptides.Table 2. Results Test Article MAPPs PeptidesEXAMPLE 2HLA-DRB1 B Cell Analysis of Adalimumab

[0112] Adalimumab was dosed at a concentration of 100 micrograms / ml with each of 15 HLA-DRB1 B cell lines. Cells were harvested after 18 hours and lysed. HLA-DRB1 -Adalimumab peptide complexes were immunoprecipitated and analyzed with mass spectrometry after liquid chromatography as described in previous examples. Adalimumab peptides were identified from each cell line, aligned to the parent Adalimumab sequence and displayed as a heatmap for relative peptide abundance visualization (FIG. 6A and 6B). One can readily observe that certain portions of adalimumab variable regions were associated with particular HLA-DRB1 allele(s) and that not all HLA-DRB1 alleles bind peptides from the same regions of adalimumab.

[0113] A total of 233 unique peptides ranging in length from 10 to 23 residues derived from adalimumab variable heavy and variable light regions were identified from the 15 HLA-DRB1 B cell lines (Table 3).Table 3. Unique Adalimumab variable region HLA-DRB1 peptides from 15 DRB1 expressing B cell lines.

[0114] While the adalimumab peptides were variable in length, each contained a 9 residue sequence which formed the peptide binding core that interacted with HLA-DRB1 and the T cell receptor. The adalimumab-derived peptides were analyzed to determine if any non -germline residues were predicted to be contained in the HLA-DRB1 binding cores for each allele using NetMHCIIpan (NetMHCIIpan 4.0 - DTU Health Tech - Bioinformatic Services; Reynisson, B. et al. J. Proteome Res. April 30. 2020, 19(6): 2304-2315). Table 4 associates the binding cores with nongermline residue(s) with the HLA-DRB1 allele from which it was identified. The core sequence, particular region of the variable domain, core start and ending residue numbers are also denoted.Table 4. NetMHCIIpan predicted HLA-DRB1 binding cores that contain non-germline residues from Adalimumab variable domains.Abbreviations: core = the 9 residue HLA-DRB1 peptide binding core; core.domain = the antibody variable region domain containing the binding core sequence; HC = heavy chain; LC = light chain; FW2 = framework 2; FW3 = framework 3; CDR2 = 2nd complementarity determining region; CDR3 = 3rd complementarity determining region; core start position = the location in the parent sequence for the Pl position of the 9 residue core; core end position = the location in the parent sequence for the P9 position of the 9 residue core.

[0115] HLA-DRB1 peptide binding core(s) that contains a non-germline residue(s) is considered at risk for (or susceptible to) eliciting an anti-drug antibody response. Table 5 summarizes the population risk for adalimumab immunogenicity.Table 5. Adalimumab variable region heavy and light domain HLA-DRB1 allele population risk summary.Abbreviations: core.domain = the antibody variable region domain containing the binding core sequence; HC = heavy chain; LC = light chain; FW2 = framework 2; FW3 = framework 3; CDR2 = 2ndcomplementarity determining region; CDR3 = 3rdcomplementarity determining region; US Adj Pop risk = population frequency of the DRB1 allele in the United States population after adjustment based on 2020 census using equations 1 and 2; JPN Pop risk = population frequency of the DRB1 allele in Japan population using equation 2; cumulative pop risk = the summed population frequency for each HLA-DRB 1 allele that contained one or more core peptide binding domains that contained one or more non-germline residues.

[0116] The core binding domain(s) containing non-germline residues(s) are listed for each HLA-DRB 1 allele from which it was identified. The population risk for each allele in the United States and Japan is calculated using the HLA-DRB1 allele frequency for various ethnic groups from The Allele Frequency Net Database - Allele, haplotype and genotype frequencies in Worldwide Populations (allelefrequencies.net) (Gonzale-Galarza, F.F. et al. Nucleic Acid Res. 2020, 48:D783-8). The United States population considered for this example contain European (EUR), African American (AFA), Hispanic (HIS) and Chinese (CHN) ethnic groups. The Japanese population was not broken into various ethnic groups. An adjusted United States allele frequency was calculated using data from the 2020 US census (U.S. Census Bureau QuickFacts: United States) for each HLA-DRB 1 allele in the B cell panel using:Equation 1 :

[0117] Most, but not all, individuals contain two different HLA-DRB1 alleles. The allele frequency was then converted to population frequency which represents the fraction of population containing the particular HLA-DRB1 allele using:Equation 2:Population frequency = 1 — (1 — allele frequncy)2

[0118] The resulting population frequencies for each HLA-DRB1 allele for which one (or more) binding cores containing non-germline residue(s) are summed to generate a cumulative immunogenicity risk for both the United States and Japan populations. Table EEE indicates that 86% of the United States population and 100% of the Japan population would be at risk for adalimumab immunogenicity. It can also be appreciated that certain alleles may have higher immunogenicity’ risk by displaying multiple binding cores from multiple regions of adalimumab. However, no immunogenicity risk would be expected for individuals containing only HLA- DRBl*03:01, HLA-DRBl*l l:01, HLA-DRBl*15:01, and HLDRB*15:02 alleles as no binding cores containing non-germline residue(s) were identified from these cell lines.

[0119] Table 6 shows the number of HLA binding cores observed from each HLA-DRB1 alleles. HLA-DRB 1*01 :01 presents 2 different binding cores; HLA- DRB1 *04:01 presents 2 different binding cores. HLA-DRB 1*04: 04 presents 2 different binding cores. HLA-DRB 1*04: 05 presents 1 binding core. HLA-DRBl*07:01 presents 3 different binding cores. HLA-DRB1*O8:O1 presents 3 different binding cores. HLA- DRB1*O8:O3 presents 2 different binding cores. HLA-DRB 1*09: 01 presents 5 different binding cores. HLA-DRB1*12:O1 presents 1 binding core. HLA-DRBl*13:01 presents 2 different binding cores. HLA-DRB1 *13:02 presents 2 different binding cores.Table 6. NetMHCIIpan predicted HLA-DRB 1 binding cores that contain non-germline residues from Adalimumab variable domains by HLA-DRB 1 allele.Abbreviations: US freq = population frequency of the DRB1 allele in the United States population after adjustment of based on 2020 census using equations 1 and 2; JPN freq = population frequency of the DRB1 allele in Japan population using equation 2: core = amino acid sequence of the 9 residue HLA-DRB1 peptide binding core; core start = the location in the parent sequence for the Pl position of the 9 residue core; core_end = the location in the parent sequence for the P9 position of the 9 residue core; core domain = the antibody variable region domain containing the binding core sequence; HC = heavy chain; LC = light chain; FW2 = framework 2; FW3 = framework 3; CDR2 = 2nd complementarity determining region; CDR3 = 3rd complementarity determining region.

[0120] Table 7 shows the number of HLA-DRB1 alleles that present binding core with non-germline sequence from the various antibody variable region domains. The HLA binding core(s) from HC.CDR2-HC.FW3 domain was observed from 4 alleles. The HLA binding core(s) from HC.CDR3 domain was observed from 5 alleles. The HLA binding core(s) from HC.FW2-HC.CDR2 domain was observed from 2 alleles. The HLA binding core(s) from HC.FW3 domain was observed from 1 allele. The HLA binding core(s) from HC.FW3-HC.CDR3 domain was observed from 8 alleles. The HLA binding core(s) from LC.FW3-LC.CDR3 domain was observed from 2 alleles.Table 7. Grouping of NetMHCIIpan predicted HLA-DRB1 binding cores that contain non-germline residues from Adalimumab variable domains.Abbreviations: core_domain = the antibody variable region domain containing the binding core sequence; HC = heavy chain; LC = light chain; FW2 = framework 2; FW3 = framework 3; CDR2 = 2nd complementarity determining region; CDR3 = 3rd complementarity7determining region; US freq = population frequency of the DRB1 allele in the United States population after adjustment of based on 2020 census using equations 1 and 2; JPN freq = population frequency of the DRB1 allele in Japanpopulation using equation 2; core = amino acid sequence of the 9 residue HLA-DRB1 peptide binding core; core start = the location in the parent sequence for the P 1 position of the 9 residue core; core_end = the location in the parent sequence for the P9 position of the 9 residue core.EXAMPLE 4Characterization of Universal BCR monoallelic HLA-DRB1 Technology Platform Endogenous HLA-DRB1 Allele Knockout

[0121] Each ofthe 15 monoallelic cell lines were dosed with apanel of anti- PCSK9 antibodies that represented different Ig HC and LC isotypes. Alirocumab is IgGl / kappa, bococizumab is IgG2 / kappa, evolocumab is IgG2 / lambda, and frovocimab is IgG4-S228P, F234A, L235A / kappa isotypes, respectively. Peptides identified by MAPPs derived from the constant regions of the antibodies are aligned and displayed with heat maps (FIGS. 7A and 7B). Most, but not all, alleles displayed peptides from at least one area of the constant regions and many alleles displayed peptides from multiple regions. Constant region peptides were observed from 12 of 15 alleles for IgGl. lgG2, and IgG4. Constant region peptides were observed for 13 of 15 alleles for IgK and 10 of 15 alleles for IgL. Interestingly, a few alleles did not present any peptides from many of the isotypes examined. For instance, HLA-DRB1* 15:01 did not present any peptides from IgGl, IgG2, IgG4, and IgK isotypes. It was confirmed that the HLA- DRB1 *15:01 cell line was functional as 1000's of peptides from endogenous proteins, media components and variable region peptides from multiple therapeutic antibodies were identified during cell line characterization. Taken together, these results demonstrate that the universal BCR was capable of binding and internalizing several different antibody isotypes commonly used for therapeutic applications.

[0122] The unique HLA-DRB1 peptides derived from endogenous and serum components obtained from the multiple antibody isotypes were also analyzed. In aggregate, 33,584 unique peptides were identified from the dataset. The total number of unique peptides for each cell line are shown. Peptide numbers ranged from a maximum of 5765 for HLA-DRBl*09:01 to a minimum of 1412 peptides fromDRB1*13:O1. Leveraging the monoallelic nature of the monoallelic B cell platform, MHCMotifDecon 1.0 (Kaabinejadian et al., Frontiers in Immunology 26 January 2022. Sec. Antigen Presenting Cell Biology, DOI: 10.3389 / fimmu.2022.835454 / ) was used to unequivocally assign peptide restriction for binding core predictions. The predicted HLA-DRB1 binding cores from the monoallelic B cell platform were observed to match those obtained from larger muti-allelic MDDC immunopeptidome data sets. The monoallelic system also enabled subtle binding differences between alleles within HLA supertypes to be unambiguously defined. For instance, HLA-DRBl*04:01 accepted F and Y residues at Pl and negatively charged resides at P4 and P6. However, HLA- DRBl*04:04 did not accept F and Y residues at Pl or negatively charged resides at P4. Finally. HLA-DBl*04:05 accepted F and Y residues at Pl but prefered negatively charged residues at P9.

[0123] The effect of antigen titration on the ability to identify exogenous antigen-derived HLA-DRB1 peptides was then determined. Bococizumab is an antibody that results in high incidence of ADA that impacted efficacy. Bococizumab was dosed at concentrations ranging from 1 to 100 pg / ml on 4 different HLA-DRB1 cell lines that were previously determined to present variable region peptides from this molecule. Three distinct clusters with varying numbers of peptides contained in each cluster were observed from the variable heavy (VH) region (FIG. 8A). Remarkably, the HLA-DRB1 display of all the clusters remained largely unchanged over concentrations that differed by 2 orders of magnitude. A closer examination of the H3 cluster (residues 87-105) from HLA-DRBl*07:01 cell line revealed that almost all of the 15 peptide sequences identified at the 100 pg / ml dose level were also observed at the 1 pg / ml dose level (FIG. 8B). Reproducibility of the results over the course of time was also determined. Five distinct clusters from golimumab VH were observed from 4 different HLA-DRB1 cell lines and the presence and density of display were unchanged over the course of > 20 passages during continuous cell culture (FIG. 8C). The total number of golimumab peptides observed from both the VH and VL regions observed from 7 different HLA-DRB1 cell lines were plotted as a function of passage number (FIG. 8D). In totality, these results demonstrated the robust reproducibility and sensitivity of our svstem.

[0124] MAPPs results obtained from the universal BCR monoallelic HLA- DRB1 platform were compared with results from traditional monocyte-derived dendritic cells (MDDCs). ATR-107 is a fully human anti-IL21 receptor antibody that generated a high degree of ADA with adverse events associated with hypersensitivity reactions during clinical investigation (Hua et al. 2014). ATR-107 has also been used as a positive control in preclinical immunogenicity assessment assays (Cohen 2021, Xue 2015). MDDCs from 10 normal healthy donors and the 15 HLA-DRB1 cell lines were dosed with ATR-107. Either a pan HLA class II antibody (Tu39) capable of binding a wide subset of HLA-DR1 / 3 / 5, -DQ, and -DP molecules or HLA-DR antibody (L234) was used for immunoprecipitation prior to MS analysis. Heatmaps of the results from both VH and VL regions of ATR-107 are shown (FIG. 9 left and right panels, respectively). The HLA-DRB1 cell lines recapitulated all the HLA class II clusters observed from MDDCs. The prominent VH CDR3 cluster (residues 90-105) observed from a majority of the MDDC donors was restricted to HLA-DRB 1*01:01. 07:01, 09:01, 11 :01 and 15:02 alleles. The VL CDR2 cluster (residues 37-59) was restricted to HLA-DRBl*13:01 and 13:02 alleles. Finally, the VL CDR3 cluster (residues 79-99) was restricted to HLA-DRBl*01:01, 04:01, 07:01, 08:01, 08:03, 09:01, 11 :01, and 15:02 alleles. These results also indicated that all the ATR-107 clusters observed from MDDCs were likely restricted to HLA-DRB 1 molecules as no meaningful differentiation was observed between results obtained with pan- or DR-specific antibodies. These results demonstrated that the universal BCR monoallelic HLA-DRB 1 platform is comparable to results obtained with MDDCs.

[0125] Adalimumab is one of the most prescribed biologies in the world and has been associated with various degrees of immunogenicity'. To determine if the HLA- DRB1 monoallelic system could indicate which proportion of both U.S. and Japanese populations may be at risk for developing ADA, adalimumab was dosed at a concentration of 100 pg / ml with each of the 15 HLA-DRB 1 monoallelic B cell lines. Adalimumab-derived MAPPs peptides were identified, aligned to the parent sequence, and displayed as a heatmap for relative peptide abundance visualization (FIG. 10). A total of 221 unique adalimumab VH and VL derived peptides ranging in length from 10 to 23 residues with a median length of 15 were identified from 14 of the 15monoallelic HLA-DRB1 B cell lines. No adalimumab variable region peptides were observed from HLA-DRB1*O3:O1 cell line. One can readily observe that certain portions of adalimumab variable regions were associated with particular HLA-DRB1 allele(s) with different density of display and that not all HLA-DRB1 alleles present peptides from the same regions of adalimumab. A low of 6 variable region peptides were observed from HLA-DRB 1*12:01 and a high of 100 variable region peptides were observed from HLA-DRB 1*01:01. Peptides from the VH domain were either the only presented peptides or were the variable domain with the higher number of presented peptides from every' allele except DRBl*15:01 which only presented peptides from the VL domain.

[0126] HLA-DRB 1 presentation of peptides that contain one or more nongermline residues are considered at risk for eliciting a T cell response that aid the generation of anti-drug antibody responses. Two overlapping clusters from CDR2 and two overlapping clusters from CDR3 of the VH region were identified that contained one or more non-germline residues (FIG. 10, top panel). One cluster from CDR1, one cluster from CDR2 and two overlapping clusters from CDR3 of the VL region (FIG. 10 bottom panel) were identified that contained one or more non-germline residues. Peptide clusters from other regions of adalimumab variable regions were also observed but did not contain any non-germline residues to indicate risk and were not annotated. In aggregate, 8 regions of concern were identified from 14 of the 15 monoallelic cell lines.

[0127] The ability of a particular sequence to activate CD4 T cells depends on many factors including the peptide binding register and whether non-germline residue(s) are exposed for TCR interaction. While not every region presented for T cell surveillance would be expected to result in activation, notably most of the adalimumab regions that were identified from the panel of monoallelic HLA-DRB 1 cell lines have been associated as CD4 T cell epitopes (Meunier 2020). Table 8 lists those clusters that have been shown to elicit a T cell response from either healthy drug naive donors or patients who developed ADA to adalimumab. Moreover, the population risk for potential ADA can be calculated based on allele frequencies for both U.S. and Japan populations. The H3-1 cluster (VH resides 87-106) has the widest range of prevalencewith nearly 70% of U.S. and 95% of Japanese populations at risk for developing anti- adalimumab antibodies mediated by this single region of the molecule. It is also notable that the magnitude of difference in exposure for the H2-2 cluster (residues 53-71) between U.S. and Japan populations at 38% and 66%, respectively. This data highlights how the same segment of a biotherapeutic molecule can have differential immunogenicity impact between populations with diverse HLA-DRB 1 allele utilization.Table 8. Adalimumab T cell epitope HLA-DRB 1 population risk.Abbreviations: H2-1 = variable heavy region CDR2 cluster 1; H2-2 = variable heavy region CDR2 cluster 2; H3-1 = variable heavy region CDR3 cluster 1; H3-2 = variable heavy region CDR3 cluster 2; L2-1 = variable light region CDR2 cluster 1; US Pop Risk = population frequency of the DRB1 allele in the United States population after adjustment based on 2020 census using equations 1 and 2; Japan Pop Risk = population frequency of the DRB1 allele in Japan population using equation 2; cumulative pop risk = the summed population frequency for each HLA-DRB1 alleles.Modified Cysteine Residues Are Present in HLA-DRB1 Binding Registers

[0128] The MAPPs protocol does not implement a reduction / alkylation step prior to LC-MS so that natural modifications in any cysteine-containing HLA-DRB1 peptides can be determined. Analysis of cysteine-containing peptides from the antibody isotype immunopeptidomic dataset indicated 30% of identified peptides contained a modified cysteine residue. Universal intra-domain disulfide bonds are contained in both VH and VL domains. A common HL A-DRB1 cluster that spans VH framework 3 (FR3) into the CDR3 containing an invariant cysteine residue was observed from many antibodies across several alleles. Several H3 CDR cysteine-containing peptides were observed that contained various modifications. Even more surprising was an apparent synchronicity of the modification pattern between certain alleles for identical peptide sequences.

[0129] Representative cysteine-containing peptides from both adalimumab and ATR-1 7 are shown in FIG. 11 . The adalimumab FR3-H3 cluster (residues 88-109) observed from HLA-DRBl*01 :01 allele contained 25 unique cysteine-containing peptide sequences. None of the peptides associated with this allele contained modified cysteines (FIG. 11 A). In stark contrast, 13 out of 14 unique adalimumab cysteine- containing peptides obtained from HL A-DRB 1*13:01 contained a cysteine tri-oxidized to cysteic acid or di-oxidized to sulfinic acid. A similar allele-specific modification pattern was also observed with the ATR-107 FR3-H3 cluster (FIG. 1 IB). Again, modified cysteine residues were absent from the 15 unique cluster peptides (residues 88-106) identified from the HLA-DRBl*07:01 allele. Again in stark contrast, all 8 of the unique ATR-107 FR3-H3 peptides (residues 88-105) obtained from HLA-DRB1*11 :O1 allele only contained tri-oxidized modified cysteine residues. Other cysteine modifications (mono-oxidation, di-oxidation, and cysteinylation) were also observed from other alleles from this same region of both adalimumab and ATR-107 molecules. Mass spectrometry data supported the modified cysteine identifications.

[0130] NetMHCIIpan-4.3 (Nilsson Science Advances 2023) was used to predict the binding core from adalimumab (AEDTAVYYCAKVSYL; SEQ ID NO:266) and ATR-107 (AADTAVYYCARGGGIS; SEQ ID NO:267) FW3-H3 peptides. Table 9 summarizes predicted HLA-binding registers for representative cysteine-containing VH CDR3 peptides that were modified in one allele but not another. The antibody and the HLA-DRB1 alleles are denoted on the left side of table. Cluster depth represents the number of unique peptide sequences contained in the cluster from each allele. Peptide sequences of a representative peptide from each antibody are listed and the predicted HLA-binding core (underlined) for each HLA- DRB1 allele was determined using NetMHCIIpan 4.3 (NetMHCIIpan 4.3 - DTU Health Tech - Bioinformatic Services). The reliability of the binding core (core_rel), expressed as the fraction of networks in the ensemble selecting the optimal core, is reported. The cysteine (“Cys"’) modification state (SH or tri-oxidation), predicted core position (P3 or P4) and T cell receptor or HLA-DRB1 exposure status (TCR or HLA-DR) as a result of the predicted binding core of the cysteine residues are denoted.Table 9. predicted HLA-binding registers for representative cysteine-containing VH CDR3 peptides.

[0131] These peptides were chosen as representative sequences that were identified from alleles that contained either unmodified or modified cysteines. The predicted 9-mer binding register from both peptides for each allele is underlined and was of high confidence. Binding core residues Pl, P4, P6, and P9 are buried and critical for binding contacts with HLA-DRB1 and residues P2, P3, P5, P7, and P8 are solvent exposed and could interact with T cell receptors (TCR) (Stem Nature 1994). The unmodified cysteine from the adalimumab peptide is predicted to reside at P3 and be solvent exposed for TCR interaction when bound by HLA-DRBl*0101; whereas the modified cysteine is predicted to reside at P4 and be buried as part of interaction with HLA-DRBl*13:01. The unmodified cysteine residue for the ATR-107 peptide is also predicted to reside at P3 and be TCR-facing when bound by HLA-DRB1*O7:O1. The ATR-107 modified cysteine residue is predicted to reside at P4 and interact with the HLA-DRB1* 11 :01 allele. It is surprising that a buried cysteine residue would carry a modification, as it would be expected that its location within the binding pocket would be somewhat protective.EXAMPLE 5Characterization of Peptide MAPPs with monoallelic HLA-DRB1 B cells

[0132] The exogenous anti-human BCR binds the Fc portion of human IgG I . IgG2, and IgG4 isotypes. A “bridge” antibody was used with the monoallelic HLA-DRB1 cell line panel for MAPPs analysis of exogenous peptides. A human chimeric version of an anti-human GIP monoclonal antibody (heavy chain SEQ ID Ex7.1 (SEQ ID NO:268) and light chain SEQ ID Ex7.2 (SEQ ID NO:269) was constructed to be used as a bridge antibody to determine the HLA-DRB1 presentation of human GIP 1-42 peptide (SEQ ID Ex7.3; SEQ ID NO:270). See, Table 10. The variable region of this chimeric antibody is capable of binding human GIP 1-42 peptide and the human IgGI Fc portion of the chimeric antibody is capable of being recognized by the exogenous anti -human BCR present in the monoallelic HLA-DRB1 cell lines.Table 10. Bridge antibody and GIP 1-42 peptide sequences

[0133] For peptide dosing, viability and cell count was determined with Trypan blue staining (Thermo Fisher Scientific, Countess cell counter). Cells from each selected HLA-DRB1 cell line were resuspended at a density of 4-5xl05cells / mL in 30 mLs and plated 5 mLs per well in a 6 well cell culture plate. Cells were dosed with the human GIP 1-42 peptide at 670 nM and the anti-GIP human chimeric antibody at 67 nM and placed in an incubator at 37 °C and 5% CO2 for 24 hours. The cells were lysed the next day with RIPA lysis and extraction buffer (Thermo Fisher Scientific, cat # 89900, 25 mM Tris«HCl pH 7.6. 150 mM NaCl. 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) containing 1 : 1000 of 10 unit / pL DNase (Roche, cat# 04716728001) and 1 tablet of EDTA free protease inhibitors (Roche, Cat# 11836170001) per 10 mL of lysis buffer. The lysates were frozen at -80 °C. The lysate was then processed as indicated in previous examples. The results (FIG. 12) indicate that different regions and intensity of the human GIP 1-42 peptide were displayed from the HLA-DRB 1*01:01. 03:01, 04:01. 04:04, 07:01, 09:01 alleles.

[0134] Current methods to elucidate the sequences of biotherapeutics presented on HLA-II receptors is limited. Monocyte-derived dendritic cells from an assortment of PBMCs from random donors does not guarantee sampling of a particular allele of interest, especially if an allele is not common in the population from which the PBMC is collected (e.g. Asian allele from midwestem US collection site). Additionally, most donors have multiple HLA-II alleles which obfuscate which allele is presenting the peptide.

[0135] The present disclosure provides the ability to use an immortalized cell line with defined HLA-II alleles capable of internalizing a wide range biotherapeutic proteins would be of interest both to drug development companies and contract research organizations providing drug characterization services. The methods of the present disclosure enable the identification of patients susceptible to or at risk of developing immunogenicity and patients not susceptible to or at risk of developing immunogenicity to a biotherapeutic protein.

[0136] The monoallelic HLA-DRB1 system of the present disclosure is capable of determining the immunogenic potential of any human IgG. The exogenous universal recombinant BCR allows the monoallelic HLA-DRB1 system of the present disclosure to interrogate a wide range of biotherapeutic protein modalities in a professional antigen presenting cell. Utilization of these cells preserves the natural expression of the ancillary HLA-DM and HLA-DO proteins required for accurate peptide loading which reflects in vivo conditions. The platform is highly scalable, and the throughput is amendable to analysis of multiple molecules on a weekly basis. The monoallelic B cell system of the present disclosure recapitulates results obtained with traditional monocyte derived dendritic cells.

[0137] Application of the monoallelic HLA-DRB1 system of the present disclosure is applied early in biotherapeutic discovery7with molecules having diverse sequences. Ideally one or more molecules has no or limited HLA-DRB1 presentation of sequence(s) of concern. If a molecule with concerning HLA-DRB1 presentation is selected, then the immunogenic potential of those peptides from the biotherapeutic can be characterized for T cell proliferation potential in an allele-specific manner if desired. Confirmation of immunogenicity potential can then inform subsequent engineering efforts to remove or limit HLA-DRB1 presentation prior to clinical development.

[0138] The monoallelic HLA-DRB1 system of the present disclosure is also useful for assessing HLA-DRB 1 ligands for any proteinaceous component for which a human chimeric bridge antibody can be generated as demonstrated in the Examples of the present disclosure. This platform also provides a system to evaluate the impact of HLA-DO on immunopeptide repertoires from the various HLA-DRB 1 alleles includedin this data set. Finally, while a current limitation, further modifications of this platform will allow investigation of HLA-DRB1 paralogs HLA-DRB3 / 4 / 5. as well as prominent HLA-DQ and HLA-DP alleles to gain a fuller HLA class II understanding for any exogenous protein of interest.

Claims

CLAIMSWhat is claimed is:

1. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant human leukocyte antigen-DRBl (HLA-DRB1) allele.

2. The transformed B cell of claim 1, wherein the nucleic acid encoding the HLA-DRB1 allele encodes recombinant HLA-DRBl*01 :01 allele, recombinant HLA-DRB 1*03: 01 allele, recombinant HLA-DRB 1*04: 01 allele, recombinant HLA- DRBl*04:04 allele, recombinant HL A-DRB 1*04:05 allele, recombinant HLA-DRBl*07:01 allele, recombinant HLA-DRB1 *08:01 allele, recombinant HLA-DRB1*O8:O3 allele, recombinant HLA-DRB 1*09:01 allele, recombinant HLA-DRB1 *11 :01 allele, recombinant HLA-DRB1* 12:01 allele, recombinant HLA-DRB1 *13:01 allele, recombinant HLA-DRB1 *13:02 allele, recombinant HLA-DRBl*15:01 allele, recombinant HL A-DRB1* 15:02 allele, and combinations thereof.

3. The transformed B cell of claim 1, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a human IgD (hlgD) constant region and the light chain comprises a human IgK (hlgK) constant region.

4. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB 1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRBl*01 :01 allele.

5. The transformed B cell of claim 4, wherein the recombinant HLA- DRB1 *01 :01 allele comprises SEQ ID NO: 1.

6. The transformed B cell of claim 4, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

7. The transformed B cell of claim 4, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

8. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRBl*03:01 allele.

9. The transformed B cell of claim 8, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

10. The transformed B cell of claim 8, wherein the recombinant HLA- DRBI*03:0I allele includes SEQ ID NO:2.

11. The transformed B cell of claim 8, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

12. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles compnsing a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRBl*04:01 allele.

13. The transformed B cell of claim 12, wherein the recombinant HLA- DRBl*04:01 allele includes SEQ ID NO:3.

14. The transformed B cell of claim 12, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

15. The transformed B cell of claim 12, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

15. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HL A-DRB 1*04:04 allele.

16. The transformed B cell of claim 15, wherein the recombinant HLA- DRB1 *04:04 allele includes SEQ ID NO:4.

17. The transformed B cell of claim 15, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

18. The transformed B cell of claim 15, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

19. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HL A-DRB 1*04:05 allele.

20. The transformed B cell of claim 19, wherein the recombinant HLA- DRBl*04:05 allele includes SEQ ID NO:5.

21. The transformed B cell of claim 19, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

22. The transformed B cell of claim 19, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

23. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRBl*07:01 allele.

24. The transformed B cell of claim 23, wherein the recombinant HLA- DRB1*O7:O1 allele includes SEQ ID NO:6.

25. The transformed B cell of claim 23, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

26. The transformed B cell of claim 23, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

27. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRBl*08:01 allele.

28. The transformed B cell of claim 27, wherein the recombinant HLA- DRBl*08:01 allele includes SEQ ID NO:7.

29. The transformed B cell of claim 27, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

30. The transformed B cell of claim 27, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

31. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRBl*08:03 allele.

32. The transformed B cell of claim 31, wherein the recombinant HLA- DRB1 *08:03 allele includes SEQ ID NO: 8.

33. The transformed B cell of claim 31, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

34. The transformed B cell of claim 31, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

35. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRBl*09:01 allele.

36. The transformed B cell of claim 35, wherein the recombinant HLA- DRBl*09:01 allele includes SEQ ID NO:9.

37. The transformed B cell of claim 35, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

38. The transformed B cell of claim 35, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

39. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRB1*11 :O1 allele.

40. The transformed B cell of claim 39, wherein the recombinant HLA- DRB1 *11 :01 allele includes SEQ ID NO: 10.

41. The transformed B cell of claim 39, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

42. The transformed B cell of claim 39, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

43. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRB1* 12:01 allele.

44. The transformed B cell of claim 43, wherein the recombinant HLA- DRB1 *12:01 allele includes SEQ ID NO: 11.

45. The transformed B cell of claim 43, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

46. The transformed B cell of claim 43, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

47. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRB1*13:O1 allele.

48. The transformed B cell of claim 47, wherein the recombinant HLA- DRB1*13:O1 allele includes SEQ ID NO: 12.

49. The transformed B cell of claim 47, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

50. The transformed B cell of claim 47, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

51. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRB1* 13:02 allele.

52. The transformed B cell of claim 51, wherein the recombinant HLA- DRB1*13:O2 allele includes SEQ ID NO: 13.

53. The transformed B cell of claim 51, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

54. The transformed B cell of claim 51, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

55. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRB1*15:O1 allele.

56. The transformed B cell of claim 55, wherein the recombinant HLA- DRB1*15:O1 allele includes SEQ ID NO: 14.

57. The transformed B cell of claim 55, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

58. The transformed B cell of claim 55, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

59. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-DRB1* 15:02 allele.

60. The transformed B cell of claim 59, wherein the recombinant HLA- DRB1*15:O2 allele includes SEQ ID NO: 15.-SO-61. The transformed B cell of claim 59, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

62. The transformed B cell of claim 59, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

63. A panel of transformed B cells comprising: a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl *01:01 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (EILA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRB 1*03:01 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl *04:01 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl *04:04 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformedB cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl*04:05 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRB 1 *07:01 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl *08:01 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl *08:03 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl*09:01 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl *11:01 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl* 12:01 allele;a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl* 13:01 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB 1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl* 13:02 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB 1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl* 15:01 allele; a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB 1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding a recombinant HLA-human leukocyte antigen (HLA)-DRBl * 15:02 allele; and combinations thereof, wherein the panel comprises a plurality of the transformed B cells.

64. A method for identifying a peptide of a biotherapeutic protein presented by an HLA-DRB1 allele, the method comprising: contacting a biotherapeutic protein with a first transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB 1) alleles, the transformed B cell comprising: a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, anda nucleic acid encoding a recombinant human leukocyte antigen-DRB 1 (HLA-DRB 1) allele; incubating the biotherapeutic protein with the transformed B cell for a time sufficient for the recombinant B cell receptor to bind the biotherapeutic protein, whereby the biotherapeutic protein is reduced by the transformed B cell to peptides, and form a HLA-DRB1 -peptide complex comprising peptides of the biotherapeutic protein and the recombinant HLA-DRB 1 ; and analyzing the HLA-peptide complex to identify the peptide.

65. The method of claim 64, further comprising analyzing the HLA-DRB 1- peptide complex to identify the peptides for anti-drug antibody epitopes.

66. The method of claim 64, further comprising, contacting the biotherapeutic protein with a second transformed B cell deficient in expression of endogenous human leukocyte antigen-DRB 1 (HLA-DRB 1) alleles, the transformed B cell comprising: a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a recombinant nucleic acid encoding a recombinant human leukocyte antigen- DRB! (HLA-DRB 1) allele that is different from the HLA-DRB 1 allele of the first transformed B cell; and analyzing the HLA-DRB 1 -peptide complex to identify the peptide.

67. The method of claim 64, wherein the biotherapeutic protein is selected from the group consisting of an antibody, a peptide, and combinations thereof.

68. The method of claim 67, wherein the antibody is a full-length antibody, an antibody fragment, a variable heavy chain, a variable light chain, a Fab. a F(ab')2. a single-chain variable fragment (scFv).

69. The method of claim 67, wherein the antibody is an IgG antibody.

70. The method of claim 69, wherein the IgG antibody is selected from the group consisting of an IgGl, an IgG2, an IgG3, an IgG4, and combinations thereof.

71. The method of claim 64, further comprising isolating the transformed B cell.

72. The method of claim 64, further comprising immunocapturing the HLA- peptide complex.

73. The method of claim 64, further comprising eluting the peptide from the HLA-peptide complex.

74. The method of claim 64, further comprising analyzing the peptide by liquid chromatography-mass spectrometry.

75. The method of claim 64, wherein the recombinant B cell receptor comprises a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype.

76. The method of claim 64, wherein the recombinant B cell receptor comprises a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain.

77. The method of claim 64, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

78. The method of claim 64, wherein the recombinant human leukocyte antigen -DRB1 (HLA-DRB1) allele is selected from the group consisting of recombinant HL A-DRB1 *01:01, recombinant HLA-DRB 1*03:01, recombinant HLA- DRBl*04:01, recombinant HLA-DRB 1*04: 02, recombinant HLA-DRBl*04:04, recombinant HLA-DRBl*04:05, recombinant HLA-DRB 1*04:08, HLA- DRBl*05:01, recombinant HLA-DRB 1*07:

01. recombinant HLA-DRB 1*08:01, recombinant HLA-DRB1 *09:01, recombinant HLA-DRB l*13:01, recombinant HLA- DRB1 *13:02, recombinant HLA-DRB1* 15:01, recombinant HLA-DRB1* 15:02, and combinations thereof.

79. A method for identifying a subject as susceptible to developing an antidrug antibody response to a biotherapeutic protein, the method comprising: contacting a biotherapeutic protein with a transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles, wherein the transformed B cell comprises a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface, and a nucleic acid encoding one of a recombinant human leukocyte antigen- DRB1 (HLA-DRB1) allele selected from the group consisting of recombinant HLA- DRBl*01:01, recombinant HLA-DRB 1*03:

01. recombinant HLA-DRB 1*04:

01. recombinant HLA-DRB 1*04: 04, recombinant HLA-DRB 1*04:05, recombinant HLA- DRB1*O7:O1, recombinant HLA-DRBl*08:01, recombinant HLA-DRB1*O8:O3, recombinant HLA-DRB1 *09:01, recombinant HLA-DRBl*ll :01, recombinant HLA- DRB 1*12:01, recombinant HLA-DRB 1*13:

01. recombinant HLA-DRB 1*13:

02. recombinant HLA-DRB 1 * 15 : 01, and recombinant HLA-DRB 1 * 15 : 02; culturing the transformed B cell for a time sufficient for the recombinant B cell receptor to bind the biotherapeutic protein and form a HLA-DRB 1 -peptide complex comprising peptides of the biotherapeutic protein and the recombinant HLA-DRB 1; analyzing the HLA-DRB 1 -peptide complex to identify the peptide; identifying the subject's HLA-DRB1 allele genotype; and identifying the subject as susceptible to develop an anti-drug antibody response to the biotherapeutic protein if the HLA-DRB 1 allele presenting the peptide in the HLA-DRB 1 -peptide complex are the same HLA-DRB 1 allele as the HLA DRB1 allele genotype identified in the subject.

80. The method of claim 79, further comprising analyzing the HLA-DRB 1- peptide complex to identify the peptides for anti-drug antibody epitopes.

81. The method of claim 79, further comprising, contacting the biotherapeutic protein with a second transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB 1) alleles, the transformed B cell comprising: a nucleic acid encoding a recombinant B cell receptor, wherein therecombinant B cell receptor is expressed on the transformed B cell membrane surface, and a recombinant nucleic acid encoding a recombinant human leukocyte antigen- DRB1 (HLA-DRB1) allele that is different from the HLA-DRB1 allele of the first transformed B cell; and analyzing the HLA-DRB1 -peptide complex to identify the peptide.

82. The method of claim 79, wherein the biotherapeutic protein is selected from the group consisting of an antibody, a peptide, and combinations thereof.

83. The method of claim 82, wherein the antibody is a full-length antibody, an antibody fragment, a variable heavy chain, a variable light chain, a Fab, a F(ab')2, a single-chain variable fragment (scFv).

84. The method of claim 82, wherein the antibody is an IgG antibody.

85. The method of claim 84, wherein the IgG antibody is selected from the group consisting of an IgGl, an IgG2, an IgG3, an IgG4, and combinations thereof.

86. The method of claim 79, further comprising isolating the transformed B cell.

87. The method of claim 79, further comprising immunocapturing the HLA- peptide complex.

88. The method of claim 79, further comprising eluting the peptide from the HLA-peptide complex.

89. The method of claim 79, further comprising analyzing the peptide by liquid chromatography-mass spectrometry.

90. The method of claim 79, wherein the recombinant B cell receptor comprises a mouse anti-human IgG antibody that specifically binds to at least one of a human IgGl isotype, a human IgG2 isotype, and human IgG4 isotype.

91. The method of claim 79, wherein the recombinant B cell receptor comprises a chimeric anti-human IgG domain comprising a human IgD constant region as a heavy chain and a human IgK constant region as a light chain.

92. The method of claim 79, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

93. A nucleic acid encoding a recombinant B cell receptor comprising a heavy chain and a light chain, wherein the heavy chain comprises a human IgD constant region and the light chain comprises a human IgK constant region.

94. The nucleic acid of claim 93, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; and combinations thereof.

95. The nucleic acid of claim 93, wherein the nucleic acid sequence is SEQ ID NO:20.

96. A nucleic acid encoding a recombinant human leukocyte antigen (HLA)-DRB1 allele.

97. The nucleic acid of claim 96, wherein the recombinant human leukocyte antigen (HLA)-DRB 1 allele is selected from the group consisting of recombinant HLA- DRBl*01:01, recombinant HLA-DRB 1*03:

01. recombinant HLA-DRB 1*04:01, recombinant HLA-DRB 1*04: 04, recombinant HLA-DRB 1*04:05, recombinant HLA- DRBI*07:01, recombinant HLA-DRBl*08:01, recombinant HLA-DRBl*08:03, recombinant HLA-DRB1 *09:01, recombinant HLA-DRBl*l l :01, recombinant HLA- DRB 1*12:01, recombinant HL A-DRB1 *13:01, recombinant HLA-DRB 1*13:02, recombinant HLA-DRB1 *15:01, recombinant HLA-DRB 1*15:

02. and combinations thereof.

98. The nucleic acid of claim 96, wherein the nucleic acid encodes at least one of SEQ ID NO: 1; SEQ ID NO:2; SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:7; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO: 10; SEQ IDNO: 11; SEQ ID NO: 12; SEQ ID NO: 13; SEQ ID NO:14; SEQ ID NO: 15; and combinations thereof.

99. A chimeric antibody comprising a heavy chain, a light chain, and a human IgGl Fc portion.

100. The chimeric antibody of claim 99, wherein the heavy chain is SEQ ID NO:268 and the light chain is SEQ ID NO:269.

101. A transformed B cell deficient in expression of endogenous human leukocyte antigen-DRBl (HLA-DRB1) alleles comprising a nucleic acid encoding a recombinant B cell receptor, wherein the recombinant B cell receptor is expressed on the transformed B cell membrane surface.

102. The transformed B cell of claim 101, wherein the recombinant B cell receptor comprises a heavy chain and a light chain, wherein the heavy chain comprises a hlgD constant region and the light chain comprises a hlgK constant region.

103. The transformed B cell of claim 101, wherein the nucleic acid encoding the recombinant B cell receptor encodes at least one of SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19: and combinations thereof.

Images