Retinitis pigmentosa animal model and construction method therefor and use thereof

Abstract

Provided is a method for constructing a retinitis pigmentosa (RP) animal model. The method comprises: incorporating, into an animal genome, a human RPGR gene fragment comprising a mutation in an RPGR gene. Further provided are an RP animal model constructed by means of the method and a use of the animal model in evaluating in vivo the efficacy and / or safety of a gene editing drug for treating RP.

Description

Retinitis pigmentosa animal model and its construction method and application Technical Field

[0001] The present application relates to the field of biomedicine, and specifically to a method for constructing an animal model of retinitis pigmentosa (RP), the RP animal model constructed by the method, and the use of the animal model in in vivo evaluation of the efficacy and / or safety of gene-editing drugs for treating RP. Background Art

[0002] Retinitis pigmentosa (RP) is a hereditary blinding eye disease characterized by the progressive and selective loss of retinal photoreceptor cells and retinal pigment epithelial cells. It is one of the main causes of irreversible bilateral blindness in children and working-age people. RP is usually caused by gene mutations, and X-linked RP (xlRP) is a more severe type of RP with early onset and rapid progression. 1 , and there is currently no effective treatment. X-linked RP accounts for 10-20% of all RP patients, of which more than 70% are caused by mutations in the RPGR gene. 1 , it is estimated that approximately 210,000 to 420,000 RP patients are caused by RPGR gene mutations.

[0003] The RPGR gene has 10 transcripts, five of which are capable of producing proteins. The two most important transcripts are the basal transcript RPGR Ex1-19 and the retina-specific transcript RPGR ORF15. RPGR Ex1-19 consists of 19 exons with a CDS of 2448 bp, encoding a protein of 816 amino acids and approximately 90 kDa. RPGR ORF15, comprising exons 1-14 and an open reading frame 15 (ORF15), has a CDS of 3459 bp and encodes a protein of 1152 amino acids and approximately 200 kDa. The ORF15 region, consisting of exon 15 and a portion of intron 15, contains a unique AG repeat sequence encoding a 567-amino acid sequence rich in glycine and glutamic acid. Both transcripts encode a domain similar to that of regulatory protein of chromosome condensation 1 (RCC1) between amino acids 54-367 at the N-terminus (exons 3-10); the C-terminus is rich in basic amino acids, also known as the basic functional domain. The ORF15 region of the RPGR gene is a high-incidence site for mutations, with more than 60% of RPGR mutations located in the ORF15 region. 2 .

[0004] In February 2020, Nat Med reported the results of a clinical trial of RPGR gene replacement therapy conducted by Oxford University, but the clinical treatment effect was very limited. 3The reason is that the mutation hotspot of the RPGR gene is located in the last exon ORF15 region. ORF15 region has a special AG repeat sequence that is prone to mutation. At the same time, as the last exon, the mutation of ORF15 region will not cause its mRNA to be degraded through the NMD pathway, but will translate into truncated abnormal protein and cause disease. 4 Moreover, precise control of RPGR protein expression is also crucial. The exogenous gene carried during replacement therapy is not subject to endogenous regulation by the body, and its expression is difficult to control. Overexpression of RPGR is more serious than the phenotype of gene knockout. 5 Furthermore, the RPGR gene has complex post-transcriptional processing, and the exogenous target gene packaged by AAV has no intron sequence, which is prone to splicing errors. 6 . Taking all the above factors into consideration, gene replacement therapy is not the best option for the ORF15 region, which is the mutation hotspot of the RPGR gene, and a better gene therapy method needs to be found. Gene editing is a set of technologies used to modify the genome of an organism. It uses nucleases to generate double-strand breaks at specific locations in the genome, and repairs the break points through the endogenous DNA repair process. During the repair process, the genome can be modified to obtain the ideal genotype. CRISPR / Cas9 is widely used in the fields of cell line modification, establishment of disease animal models and gene therapy due to its advantages such as simple target design, easy operation, low cost and high editing efficiency. Through AAV viral vectors, for mutations in the ORF15 region of the human RPGR gene mutation hotspot, CRISPR / Cas9 gene editing technology targets the intron 14 region of human RPGR through the sequence specificity of sgRNA, exogenously introduces Cas9 protein, and provides a repair template to achieve precise repair of the ORF15 region of the RPGR gene.

[0005] Animal models with gene mutations (naturally occurring or genetically engineered) are important tools for studying target gene function, disease pathogenesis, and the effectiveness of treatments. A good animal model should exhibit disease progression rapidly enough for researchers to assess treatment outcomes within a reasonable timeframe, yet not be too rapid or overwhelming. If the disease progresses too quickly, assessing treatment efficacy becomes difficult, and the disease bears no resemblance to the human condition.

[0006] In recent years, several RPGR animal models have been reported. The first mouse model knocked out exons 4-6 of the RPGR gene. 7The mouse retina develops normally, and degeneration begins around 2 months of age. The opsin in the cones is mislocalized to the inner segments and synapses, and the rhodopsin in the rods is reduced, but the mouse's retinal structure and ERG are still within normal ranges. At 6 months of age, the number of photoreceptor cells in the mouse retina is significantly reduced, and visual function is affected. The second mouse model is a conditional knockout of exon 1 of the RPGR gene. In this model, the retinal ONL thickness is slightly thinner and the ERG amplitude is slightly decreased at 5-6 months of age. At 13 months of age, there is a significant difference in ONL thickness, accompanied by a significant decrease in ERG amplitude. 8 The third animal model is RD9, a naturally occurring mouse model with a 32bp repeat sequence in ORF15 (ORF15 region 687-719). The ONL of the model mouse retina was no different from that of WT at 2 months of age, but the thickness of the IS+OS was significantly thinner. The ONL thickness was slightly thinner at 12 months of age, and at 24 months of age, the ONL was 50% of that of WT. 9 The second and third mouse models do not have RPGR-ORF15 protein in the retina, which can well simulate the retinal degeneration in the late stage of human disease. There are also two other canine models carrying RPGR gene mutations, XLPRA1 and XLPRA2 10 XLPRA1 has a 5bp deletion (c.1028-1032del) in ORF15, resulting in a 230-amino acid deletion at the C-terminus, premature translation termination, and the generation of a truncated RPGR protein. The lesion begins in rods and eventually affects cones, but the progression is slow. XLPRA2 has a 2bp deletion (c.1084-1085del) in ORF15, resulting in a frameshift mutation. After the mutation, 34 new amino acids are added and 161 amino acids are deleted at the C-terminus, leading to premature translation termination. This model has a more severe phenotype than XLPRA1, with onset of disease at 5 weeks of age. The above animal models are widely used in disease research on xlRP caused by RPGR mutations and also provide a key efficacy evaluation system for gene replacement therapy.

[0007] However, based on the mechanism of action of gene editing therapy and the characteristics of sequence targeting specificity, the existing xlRP animal model does not have a site where gene editing drugs can act, and it is impossible to effectively evaluate the efficacy of gene editing drugs. In addition, in drug safety research experiments, in order to fully verify the safety of the drug, it is necessary to select relevant species for toxicological studies. Relevant species refer to animals in which the test substance can produce pharmacological activity. Because gene editing drugs specifically target mutated DNA through the CRISPR / Cas9 system and then repair protein expression to exert therapeutic effects, models with gene editing drug target sites can effectively exert pharmacological activity. At present, no DNA sequence consistent with human RPGR has been found in conventional animal species. Therefore, it is necessary to further search for more suitable animal models. Summary of the Invention

[0008] In response to the above problems, the inventors conducted in-depth research and unexpectedly discovered that by introducing a human RPGR gene fragment including an RPGR gene mutation into the animal genome (especially a fragment including ORF15 with a gene mutation), while introducing drug targeting sites, it is possible to ensure that the model animal has a similar RP disease phenotype as human xlRP. Therefore, this model can be used for in vivo efficacy studies of gene-edited drugs for xlRP patients, and provides an effective safety evaluation system for gene-edited therapeutic drugs for RPGR-xlRP.

[0009] Therefore, in one aspect, the present invention provides a method for constructing an animal model of retinitis pigmentosa (RP), the method comprising: removing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) exons, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18) introns, ORF15, or a combination thereof (e.g., ORF15 and one or more (e.g., 2, 3, 4, or 5) introns and / or exons adjacent thereto) or a portion thereof from the genome of the animal. , such as a combination of intron 13, exon 14 and a portion of intron 14 with ORF15) is replaced by one or more exons, one or more introns, ORF15 or a combination thereof (such as a combination of ORF15 and one or more (such as 2, 3, 4 or 5) adjacent introns and / or exons or parts thereof, such as a combination of intron 13, exon 14, a portion of intron 15 and ORF15) of the corresponding human RPGR gene with one or more RPGR gene mutations, wherein the RPGR gene mutation is an RPGR gene mutation that causes human RP, more preferably the RPGR gene mutation is in ORF15 of the RPGR gene, and even more preferably the RP is X-linked RP (xlRP).

[0010] In certain embodiments, the gene mutation is selected from point mutation, deletion mutation, insertion mutation, and inversion or duplication mutation, preferably a point mutation, which is a missense mutation or nonsense mutation, and more preferably the gene mutation can be repaired by gene editing technology.

[0011] In certain embodiments, the animal is a non-human mammal, preferably a ruminant, a canine, a leporine, a feline, or a rodent, more preferably a mouse, a pig, a monkey, a bear, a sheep, a goat, a horse, a donkey, a rabbit, a cat, a cow, a fox, or a dog, still more preferably a mouse or a rat, still more preferably a C57BL / 6 mouse or a BALB / c mouse, still more preferably a C57BL / 6J and C57BL / 6N mouse, and most preferably a C57BL / 6J mouse.

[0012] In certain embodiments, the exons include exons 1 to 19 of the RPGR gene (e.g., exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, and 18), and the introns include introns 1 to 18 of the RPGR gene (e.g., introns 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, and 18); preferably, the human source has the RPGR gene. The mutated ORF15 replaces the corresponding ORF15 in the genome of the animal; more preferably, the corresponding intron 13-exon 14-ORF15 fragment in the genome of the animal is replaced with a human fragment including intron 13-exon 14-ORF15 having an RPGR gene mutation, wherein the RPGR gene mutation is in ORF15 of the RPGR gene; and / or preferably, the RPGR gene mutation is a nonsense mutation, more preferably the nonsense mutation is c.1905+76G>T.

[0013] In certain embodiments, the animal is a mouse, preferably a C57BL / 6J mouse; and the method comprises replacing the corresponding intron 13-exon 14-ORF15 fragment in the mouse genome with a fragment of human intron 13-exon 14-ORF15 comprising a nonsense mutation in ORF15; more preferably, the nonsense mutation is c.1905+76G>T; and / or most preferably, the fragment of human intron 13-exon 14-ORF15 comprising a nonsense mutation is as shown in SEQ ID NO:1.

[0014] In certain embodiments, the replacement is achieved by the following gene editing technologies: CRISPR / Cas technology; zinc finger nuclease technology (ZFN); or transcription activator-like effector nuclease technology (TALEN); preferably CRISPR / Cas9.

[0015] In certain embodiments, the method comprises: 1) introducing a fragment of one or more exons, one or more introns, ORF15 or a combination thereof comprising the human RPGR gene having one or more RPGR gene mutations into the fertilized egg of the animal through gene editing technology, replacing the one or more exons, one or more introns, ORF15 or a combination thereof corresponding to the RPGR gene in the genome of the animal, and identifying and obtaining F0 generation animals in which the fragment of the human RPGR gene is correctly inserted into the genome; and 2) hybridizing the F0 generation animals with wild-type animals, performing germline propagation, obtaining F1 generation animals, and identifying animals in which the fragment of the human RPGR gene is correctly inserted into the genome, preferably the animals are hemizygous or homozygous, male or female, and more preferably male homozygous.

[0016] In certain embodiments, the animal is a mouse, and / or the identification is by PCR or by Southern blot.

[0017] In certain embodiments, the method further comprises one or more of the following steps:

[0018] 1) Detect fundus changes in model mice by fundus photography abnormalities (FP) and optical coherence tomography (OCT);

[0019] 2) Detect retinal structural changes in model animals by immunofluorescence staining;

[0020] 3) Detect changes in mRNA expression levels of retinal pigment epithelial (RPE), retinal photoreceptor cells, and glial cell markers in model mice by q-RT-PCR; and

[0021] 4) The changes in visual function of model mice were measured by electroretinography (ERG).

[0022] In certain embodiments, the method further comprises: selecting an animal having a disease phenotype consistent with that of a human RP patient as an RP animal model.

[0023] In another aspect, the present invention provides an RP animal model, preferably a mouse model, prepared by the method described above.

[0024] In another aspect, the present invention provides a method for identifying and / or testing a gene editing drug for treating RP, comprising:

[0025] 1) administering the gene editing drug to the RP animal model prepared according to the above method;

[0026] 2) determining whether the RPGR gene mutation is repaired or reversed by the gene editing drug, i.e., whether the correct RPGR mRNA can be expressed; and

[0027] 3) Optionally, testing whether the disease phenotype of RP in the animal model is improved;

[0028] If the RPGR gene mutation is repaired or reversed by the gene editing drug, and / or the disease phenotype of RP in the animal model is improved, it means that the gene editing drug can be effectively used to treat RP.

[0029] In certain embodiments, in the above method, the animal in step 1) is a mouse; the administration in step 1) is subretinal injection; the repair in step 2) is identified by PCR, by Southern blot, or by Sanger sequencing; and / or the detection of the disease phenotype of RP in the animal model in step 3) includes one or more of the following steps: a) detecting fundus changes in the model animal by fundus photography abnormalities (FP) and optical coherence tomography (OCT); b) detecting changes in the retinal structure of the model animal by immunofluorescence staining; c) detecting changes in the mRNA expression levels of retinal pigment epithelial cells (RPE), retinal photoreceptor cells and glial cell markers in the model mouse by q-RT-PCR; and d) measuring changes in the visual function of the model animal by electroretinography (ERG).

[0030] In certain embodiments, in the above method, the gene editing drug comprises a CRISPR / Cas9 gene editing drug, preferably in the form of a recombinant AAV (rAAV) viral vector.

[0031] On the other hand, the present invention also provides the use of the above-mentioned RP animal model for in vivo evaluation of the efficacy and / or safety of gene editing drugs for treating RP, preferably the RP is X-linked RP (xlRP).

[0032] Those skilled in the art can easily discern other aspects and advantages of the present application from the detailed description below. In the detailed description below, only exemplary embodiments of the present application are shown and described. As will be appreciated by those skilled in the art, the content of this application enables those skilled in the art to modify the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application relates. Accordingly, the descriptions in the drawings and specification of this application are merely exemplary and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The above features and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the accompanying drawings, in which:

[0034] FIG1 is a schematic diagram of the construction of a humanized xlRP disease model mouse;

[0035] Figure 2 is a mouse genotyping strategy;

[0036] Figure 3 shows the genotype of the model mice detected by PCR;

[0037] FIG4 shows sequencing identification of gene insertion sites in transgenic mice;

[0038] Figure 5 shows sequencing identification of mutation sites in transgenic mice;

[0039] Figure 6A shows a diagram of the Southern blot analysis strategy;

[0040] Figure 6B shows the genotypes of transgenic mice detected by Southern blot;

[0041] Figure 7 shows the detection of mRNA transcripts in a humanized mouse model;

[0042] Figure 8 shows the relationship between wild-type (WT) mice (RPGR+ / +), female heterozygotes (Female-RPGR + / hMut ), female homozygotes (Female-RPGR hMut / hMut ) and male hemizygotes (Male-RPGR hmut FP and OCT of RPGR mutant humanized mice;

[0043] Figure 9 shows that WT mice (RPGR + / + ), female heterozygotes (Female-RPGR + / hMut ), female homozygotes (Female-RPGR hMut / hMut ) and male hemizygotes (Male-RPGR hmut ) ERG amplitude of humanized RPGR mutant mice. n = 16; 2-way ANOVA; ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05;

[0044] Figure 10 shows the heterozygous female mice (Female-RPGR + / hMut ) and male homozygotes (Male-RPGR hmut ) Changes in ERG amplitude in humanized RPGR mutant mice. n = 16; 2-way ANOVA; ****p < 0.0001, ***p < 0.001;

[0045] Figure 11 shows that 6-month-old WT mice (RPGR + / + ), female heterozygotes (Female-RPGR + / hMut ), female homozygotes (Female-RPGR hMut / hMut ) and male hemizygotes (Male-RPGR hmut ) Structural changes in the retina of humanized RPGR mutant mice by immunostaining. OS: photoreceptor outer segment; IS: photoreceptor inner segment; ONL: retinal outer nuclear layer; INL: retinal inner nuclear layer;

[0046] Figure 12 shows that 6-month-old WT mice (RPGR + / + ), female heterozygotes (Female-RPGR + / hMut ), female homozygotes (Female-RPGRhMut / hMut ) and male hemizygotes (Male-RPGR hmut ) Changes in retinal marker mRNA expression levels in humanized RPGR mutant mice. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05;

[0047] Figure 13 shows PCR and RT-PCR detection of AAV-Cas9-sgRNA RPGR Editing effects in humanized mouse models;

[0048] Figure 14 shows FP and OCT detection of AAV-Cas9-sgRNA RPGR Male-RPGR hMut Fundus effects in mice; and

[0049] Figure 15 shows ERG detection of AAV-Cas9-sgRNA RPGR Male-RPGR hMut Effects on retinal function in mice; n = 16; 2-way ANOVA; ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05. DETAILED DESCRIPTION

[0050] Unless otherwise indicated, the terms used herein have their ordinary technical meanings as understood by those skilled in the art. For definitions and terms in the art, the skilled artisan is particularly referred to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999).

[0051] In this application, the term "retinitis pigmentosa (RP)" generally refers to a hereditary blinding eye disease (Retinitis Pigmentosa, RP) characterized by the progressive and selective loss of retinal photoreceptor cells (cones and rods) and retinal pigment epithelial cells. RP inheritance can include autosomal recessive inheritance (arRP), autosomal dominant inheritance (adRP), and X-linked inheritance (xlRP), among which xlRP develops early and causes the most severe damage. The clinical manifestations of RP may include night blindness, progressive visual field defects, and central vision loss after the macula is affected, which can eventually lead to blindness. The main fundus changes of RP are retinal pigment disorder in the equatorial part, the appearance of osteocyte-like pigmentation, which gradually develops towards the posterior pole and ora serrata, the retinal pigment epithelium (RPE), photoreceptor cells and choroidal capillary layer gradually atrophy, the large blood vessels of the choroid are visible, the retina is bluish-gray, the retinal arteries become thinner, and the optic disc becomes waxy yellow and atrophied. Methods for evaluating retinal function and morphology may include best corrected visual acuity (BCVA), fundus autofluorescence, visual field examination, electroretinography (ERG), fundus color photography, optical coherence tomography (OCT), and fluorescein angiography (FFA).

[0052] In this application, the term "X-linked retinitis pigmentosa (RP)" generally refers to X-linked retinitis pigmentosa, also known as xlRP. Currently, approximately 70% to 75% of xlRP cases are caused by mutations in the RPGR gene, of which more than 75% of RPGR mutations are located in the RPGR ORF15 The clinical signs of xlRP include, but are not limited to, decreased peripheral vision, decreased central (reading) vision, decreased night vision, loss of color perception, decreased visual acuity, decreased photoreceptor cell function, and pigment changes.

[0053] In this application, the term "human retinitis pigmentosa GTPase regulator" is called Retinitis pigmentosa GTPase regulator in English, which is encoded by the RPGR gene and is generally a protein having a series of RCC1-like domains (RLDs). "Gene encoding retinitis pigmentosa GTPase regulator" may also be referred to as "RPGR gene" in this article. "Retinitis pigmentosa GTPase regulator" may include the full-length gene itself or a functional fragment thereof. Retinitis pigmentosa GTPase regulator may be derived from any mammal that naturally expresses the RPGR gene or its homologs, such as primates (e.g., humans) and rodents (e.g., mice and rats). "RPGR gene" may encode transcripts of a variety of spliced ​​forms of different isoforms, and all spliced ​​forms, transcripts and / or functional variants thereof may be included herein. For example, human RPGR isoforms may include isoform A, isoform C, isoform D, isoform E, isoform F, isoform G, isoform I and isoform J. Isoform A and isoform C are full-length human RPGR isoforms. For example, the nucleotide sequence of an exemplary subtype A can be found in NCBI Accession No. NM_000328.3, and the amino acid sequence can be found in NCBI Accession No. NP_000319.1. The nucleotide sequence of an exemplary subtype C can be found in NCBI Accession No. NM_001034853.2, and the amino acid sequence can be found in NCBI Accession No. NP_001030025.1.

[0054] RPGR subtype ex1-19 (from exon 1 to exon 19, corresponding to subtype A above) and RPGR ORF15 (derived from a portion of exon 1 to intron 15, corresponding to subtype C above) are two widely expressed subtypes of RPGR. ORF15 The 16th to 19th exon of RPGR ends before ORF15 The terminal portion of RPGR may be referred to as ORF15, and herein, also referred to as "RPGR ORF15". ORF15 The isoform is required for normal rod and cone function in the retina and is primarily expressed in photoreceptor cells.

[0055] In this application, the term "RPGR ORF15" or "ORF15" generally refers to RPGR ORF15The terminator portion at the end of the isoform may include a portion of the 15th exon and 15th intron of the RPGR gene. RPGR ORF15 contains a long guanine-rich repeat sequence known as a highly conserved guanine nucleotide exchange factor. This sequence has poor stability and complex post-transcriptional processing, making it generally difficult to clone as a cDNA and unstable during recombinant DNA manipulation. RPGR ORF15 is also a hotspot for RPGR gene mutations. The nucleotide sequence of an exemplary wild-type RPGR ORF15 is shown in SEQ ID NO: 101 in WO2022021149A1.

[0056] In this application, the term "gene mutation" refers to a change in a DNA sequence, which may be a single base substitution, insertion or deletion in the gene sequence, or a larger gene deletion, duplication or inversion.

[0057] In this application, the term "point mutation" refers to the replacement of a single base in a gene sequence, which can include missense mutations and nonsense mutations in the present invention. A missense mutation refers to the replacement of one amino acid by another, which may lead to changes in protein structure and function. A nonsense mutation refers to the replacement of one codon by another stop codon, which will lead to the termination of protein synthesis.

[0058] In this application, the terms "deletion mutation" and "insertion mutation" refer to the insertion or deletion of one or more bases in a gene sequence, which may change the amino acid sequence of a protein and lead to changes in protein structure and function.

[0059] In this application, the term "inversion mutation" refers to the inversion of two adjacent regions in a gene sequence, which may lead to a change in gene function.

[0060] In this application, the term "repetitive mutation" refers to the repeated insertion of one or more bases in a gene sequence, which may lead to changes in gene function.

[0061] The term "AAV" is generally an abbreviation for adeno-associated virus and can be used to refer to the virus itself or its derivatives. The AAV may include AAV type 1 (AAV-1 or AAV1), AAV type 2 (AAV-2 or AAV2), AAV type 3 (AAV-3 or AAV3), AAV type 4 (AAV-4 or AAV4), AAV type 5 (AAV-5 or AAV5), AAV type 6 (AAV-6 or AAV6), AAV type 7 (AAV-7 or AAV7), AAV type 8 (AAV-8 or AAV8), AAV type 9 (AAV-9 or AAV9), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV, among others.

[0062] In the present application, the term "RPGR gene mutation" refers to any mutation of the RPGR gene that causes human RP, including point mutations, deletion mutations, insertion mutations, and inversion or duplication mutations. The mutation may be in exons 1-19, such as exons 1-14, or in ORF15. For example, the mutation may be c.581G>A, c.808C>T, c.1243_1244dupAG, c.1571delA, c.1572+1G>A, c.2218G>T (p.E740X), c.2234_2237del (p.R745fs), c.2236_2237delGA (p.E746Rfs*23), c.2268_2269delAG, c.2405_2406delAG (p.E8 02Gfs*32), c.2420_2435del16bp, c.2426_2427delAG, c.2628_2629delGG, c.2236_2237delGA, c.2586_2587delGG, c.2650G>T, or c.2993_2997delAAGGG, where del indicates deletion, dup indicates duplication, G>A indicates point mutation from G to A, and C>T indicates point mutation from C to T. The meanings of the other expressions are similar.

[0063] In this application, the term "gene editing drug" refers to a reagent, kit, system, or combination thereof used in the process of gene editing using gene editing technology. The gene editing technology includes CRISPR / Cas technology; zinc finger nuclease technology (ZFN); or transcription activator-like effector nuclease technology (TALEN); preferably CRISPR / Cas9.

[0064] In the present application, the animal used to construct the animal model can be any animal with the RPGR gene, such as a non-human mammal, preferably a ruminant, canine, leporidae, feline, or rodent, more preferably a mouse, pig, monkey, bear, sheep, goat, horse, donkey, rabbit, cat, cow, fox, or dog, even more preferably a mouse or rat, and even more preferably a C57BL / 6 mouse or a BALB / c mouse. C57BL / 6 mice are one of the most widely used experimental animals. Compared with BALB / c mice, their fundus contains pigment, making them more suitable as an animal model for retinal disease research. There are two main substrains of C57BL / 6 mice: C57BL / 6J and C57BL / 6N. C57BL / 6N has a Crb1 rd8 mutation, which leads to mild retinal degeneration. Therefore, the present invention most preferably uses C57BL / 6J mice as the basis for model construction.

[0065] In one embodiment of the present invention, a method for constructing an animal model of retinitis pigmentosa (RP) is provided, which comprises replacing one or more exons, one or more introns, ORF15 or a combination thereof of a retinitis pigmentosa GTPase regulator gene (RPGR gene) in the genome of the animal with one or more exons, one or more introns, ORF15 or a combination thereof having one or more RPGR gene mutations of the corresponding human RPGR gene, wherein the RPGR gene mutation is an RPGR gene mutation that causes human RP (for example, the mutation listed above with respect to the term "RPGR gene mutation"), more preferably the RPGR gene mutation is in ORF15 of the RPGR gene, and even more preferably the RP is X-linked RP (xlRP).

[0066] In a preferred embodiment of the present invention, the RPGR gene mutation is a point mutation, such as a missense mutation or a nonsense mutation, and preferably the nonsense mutation is c.1905+76G>T.

[0067] In one embodiment of the present invention, the animal is a mouse, preferably a C57BL / 6J mouse; and the method comprises replacing the corresponding intron 13-exon 14-ORF15 fragment in the mouse genome with a fragment of human intron 13-exon 14-ORF15 comprising a nonsense mutation in ORF15; more preferably, the nonsense mutation is c.1905+76G>T; and / or most preferably, the fragment of human intron 13-exon 14-ORF15 comprising a nonsense mutation is as shown in SEQ ID NO: 1.

[0068] The mouse RPGR gene is different from the human RPGR gene. Before confirming the model construction strategy, the inventors fully considered the expression pattern of the mouse RPGR gene and the expression pattern of the human RPGR gene. The mouse RPGR gene has only 18 exons and 9 transcripts. The human RPGR gene has 19 exons and 19 transcripts. In a preferred embodiment, in order to ensure that the model mice can be used for the efficacy and safety testing of gene editing drugs during model construction, the inventors considered replacing the mouse 13 introns, 14 exons and part of the 14 introns with human 13 introns, 14 exons, 15 exons and part of the 15 introns (for example, ORF15 includes nonsense mutations, such as c.1905+76G>T). In addition, considering that the splicing of part of the mouse 13 introns and the human intron 13 region may affect mRNA splicing, resulting in the inability of human RPGR-ORF15 RNA and protein to be expressed normally. Therefore, in the examples, the inventors finally chose a more difficult construction method to replace the entire mouse intron 13 with a human sequence (the inserted sequence is about 5.4kb). In a preferred embodiment, the above-mentioned replacement is achieved by the following gene editing technologies: CRISPR / Cas technology; zinc finger nuclease technology (ZFN); or transcription activator-like effector nuclease technology (TALEN); preferably CRISPR / Cas9. When CRISPR / Cas9 technology is used for the above-mentioned replacement, the sgRNA (gRNA1 and gRNA2) sequences used are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively. The inventors unexpectedly found that the mouse RP model constructed by the above method can have a phenotype similar to human RP (such as xlRP), and the phenotype can be repaired / reversed by gene editing, so that the animal RP model can be used to evaluate the efficacy and / or safety of gene editing drugs for the treatment of RP (such as gene editing drugs for RPGR gene mutations in ORF15) in vivo.

[0069] Therefore, this application provides for the first time a humanized mouse model for in vivo efficacy testing of gene editing therapy for X-linked retinal degeneration (xlRP) caused by RPGR mutations.

[0070] The humanized mouse model obtained by the present invention comprises the human RPGR gene intron 13 to the ORF15 sequence with the patient mutation site (e.g., nonsense mutation, such as c.1905+76G>T), which can be used to detect the in vivo editing efficiency of gene editing drugs in RPGR patients caused by mutations in the RPGR-ORF15 region. In addition, the humanized mouse model has been identified to have a disease phenotype consistent with that of xlRP patients caused by RPGR mutations, and can be used as an in vivo efficacy study model for gene editing drugs. In addition, gene editing therapeutic drugs can effectively exert pharmacological activity in this model, and therefore, it can be used for preclinical drug safety evaluation.

[0071] In a preferred embodiment of the present invention, based on the homology between mouse RPGR and human RPGR genes, the present invention designs sgRNA for the intron 13 region of the mouse RPGR gene, and simultaneously designs a donor vector "KI-c", which contains upstream and downstream homology arms and hRPGR-intron13-exon14-ORF15-mut (1905+76G>T point mutation) regions, and the donor DNA and Cas9 mRNA are co-injected into fertilized eggs to produce targeted knock-in offspring.

[0072] F0 founder animals were identified by PCR and sequence analysis, and then crossed with wild-type mice for germline propagation and F1 animal genotyping. PCR results demonstrated effective insertion of the humanized gene fragment, and sequencing confirmed that the inserted sequence was consistent with the target sequence. Southern blot results further confirmed the successful construction of the humanized model mouse. Furthermore, RT-PCR confirmed that the model mice effectively expressed the humanized RPGR transcript and ensured proper mRNA splicing.

[0073] After confirming the acquisition of the target genotype mice, breeding was carried out, and the disease phenotype of mice of different age groups was identified. For RP patients, fundus photography abnormalities (FP) and progressive degeneration of photoreceptors are the main characteristic phenomena, leading to retinal structural abnormalities and loss of visual function. In order to determine whether the RPGR mutant humanized mouse model has similar pathogenesis and disease phenotypes as RP patients, we detected fundus changes in model mice by FP and OCT, and measured changes in visual function of model mice by ERG. FP results showed that female heterozygotes (Female-RPGR) at 6 months of age had + / hMut ), female homozygotes (Female-RPGR hMut / hMut ) and male hemizygotes (Male-RPGR hmut) Humanized RPGR mutant mice showed a tapetal reflex in the fundus, which worsened with age. In addition, RPGR-ORF15 is localized to the CC site of photoreceptors and is essential for the transport of photoreceptor structural proteins. OCT results showed a phenotype consistent with that previously seen in xlRP patients. Female heterozygotes (Female-RPGR + / hMut ), female homozygotes (Female-RPGR hMut / hMut ) and male hemizygotes (Male-RPGR hmut ) mice had enhanced reflectivity of the retinal RPE-photoreceptor layer. ERG results showed that at 6 and 9 months of age, Female-RPGR + / hMut 、Female-RPGR hMut / hMut 、Male-RPGR hMut The amplitudes of the dark-adapted a-wave and b-wave of the mice were significantly reduced, indicating that the visual function of the RPGR mutant humanized mouse model was impaired. In addition, we further analyzed the phenotype progression of the two genotypes of mice with age. The results showed that Male-RPGR hMut The ERG amplitude of mice decreases more significantly with age.

[0074] Furthermore, frozen sections of samples collected from mice at 6 months of age were analyzed for immunofluorescence staining, demonstrating that the photoreceptor cell markers Rhodopsin and L / M opsin were abnormally localized to the inner segments (IS) of photoreceptor cells in the disease model mice. Furthermore, PNA-labeled photoreceptor inner and outer segments showed abnormal shortening, and expression of the glial cell marker GFAP was enhanced. Furthermore, retina and retinal pigment epithelial cells from each group of mice were isolated, and q-RT-PCR was used to analyze the expression of RPE cell markers RPE65 and ZO1, the retinal marker Rhodopsin, and the Müller cell marker GFAP. The results showed that compared with the control group, the mRNA expression of RPE65, ZO1, and Rhodopsin was significantly decreased in all genotypes of the model mice, while GFAP expression was significantly upregulated.

[0075] To determine the suitability of this model for the in vivo efficacy of gene-editing drugs, three-month-old male heterozygous mice with consistent genotypes and stable phenotypic progression, were selected for gene-editing drug efficacy testing. The experimental results demonstrated that, after administration of gene-editing drugs to the subretinal cavity of the mouse model, the mutant DNA sequence in the model mice was correctly repaired, and the repaired sequence effectively expressed the correct RPGR mRNA. Furthermore, retinal structural and functional repair experiments further demonstrated that six months after subretinal administration of gene-editing drugs in the model mice, fundus phenotypes and ERG damage were significantly restored. Furthermore, the effective DNA repair indicates that gene therapy drugs can effectively exert their pharmacological activity in this mouse model, indicating that this model can be used for safety evaluation of gene therapy for RPGR-xlRP.

[0076] The above results indicate that this humanized mouse disease model has a disease phenotype consistent with that of human RP patients and can be used to verify the in vivo editing efficiency and efficacy of gene-editing drugs. In addition, gene-editing drugs have pharmacological activity in this mouse model and can be used for preclinical safety studies, providing a solid efficacy and safety testing model for the development and marketing of gene-editing drugs.

[0077] The present invention is further described in the following examples which are for illustrative purposes only and are not intended to limit the scope of the present invention.

[0078] Example

[0079] Example 1 Strategy for constructing a humanized xlRP disease mouse model

[0080] The strategy for constructing a humanized xlRP disease mouse model is shown in Figure 1. The mouse RPGR gene (NCBI reference sequence: NM_001177950.1) is located on the mouse X chromosome and comprises 18 exons, with the ATG start codon located in exon 1 and the TAA stop codon located in exon 18. To construct the model mouse, the mouse RPGR gene's introns 13 to 14 were partially replaced with the KI region (introns 13 to 15 of the human RPGR gene). Furthermore, to ensure the disease model phenotype, a mutation in RPGR ORF15 (c.1905+76G>T), which causes premature termination of protein translation, was introduced into intron 15 of the human RPGR gene. The specific targeting sequence (SEQ ID NO: 1) is as follows (from 5' to 3' direction, the first underlined part is the 5' arm; the middle non-underlined part is the KI region, including the human RPGR exon, in which the bold underlined part indicates c.1905+76G>T; the second underlined part is the 3' arm): 5'arm, KI region, exon of human RPGR, c.1905+76G>T, 3'arm

[0081] Based on the above construction strategy, CRISPR / Cas9 gene editing technology was used to design targeting vectors for the mouse RPGR gene, namely gRNA1 and gRNA2. The gRNA sequences and corresponding targets are shown in Table 1. For specific vector construction methods, please refer to the embodiment of WO2022021149A1. The above gRNA, donor DNA and Cas9 mRNA were co-injected into fertilized eggs of C57BL / 6J mice (mice were purchased from Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd.) to produce targeted knock-in offspring to obtain F0 generation mice.

[0082] Table 1 Targeting gRNA binding sites

[0083] Example 2 Genotype identification of F1 model mice

[0084] (1) Genotype identification strategy

[0085] The genotyping strategy is shown in Figure 2. PCR detection of the inserted genome was performed by designing an upstream primer (F1) based on the KI sequence and a downstream primer (R1) downstream of gRNA2. An upstream primer (F2) was designed upstream of gRNA1, and a downstream primer (R2) spanning the KI sequence across F1. To confirm the correctness of the inserted sequence in the model mouse, we designed F3 on the upstream homology arm and R3 on the downstream homology arm. F3 / R3 PCR was performed followed by sequencing to confirm the correctness of the inserted sequence. In addition, an F6 sequencing primer was designed to verify the correct introduction of the humanized mutation site. The primer sequences are shown in Table 2.

[0086] Table 2 Genotype identification primer sequences

[0087] (2) Genotype identification of model mice

[0088] After obtaining F0 generation mice, they were crossed with wild-type (WT) mice. After the F1 generation mice were born, their tails were cut for DNA extraction, and genotypes of the F0 generation mice were identified by PCR using primer pairs F1 / R1 and F2 / R2, respectively. The PCR results are shown in Figure 3. A 4.6 kb positive insertion band was effectively amplified using F1 / R1 for mice 14, 15, 16, and 19, while a 4.8 kb positive insertion band was effectively amplified using F2 / R2. F3 / R3 PCR amplification was followed by sequencing. The sequencing results are shown in Figure 4. Both the upstream and downstream insertion sites were sequenced correctly, indicating successful insertion of the humanized sequence. Furthermore, F6 was used to sequence the F3 / R3 PCR product to confirm the correct insertion of the mutation site. The sequencing results are shown in Figure 5, indicating the correct insertion of the c.1905+76G>T site.

[0089] Example 3 Southern Blot further confirmed the success of the model construction

[0090] (1) Southern blot analysis strategy

[0091] Southern blot analysis of tail DNA samples from four F1 animals (mice 14, 15, 16, and 19) confirmed correct gene insertion. The Southern blot analysis strategy is shown in Figure 6A. Mouse DNA samples were digested with ScaI and AvrII, respectively, and probe size analysis confirmed correct insertion of the model mouse DNA. The Southern blot analysis probe sequences are shown in Table 3.

[0092] Table 3 Southern blot analysis probe sequences

[0093] (2) Southern blot analysis of mouse model genome insertions

[0094] The Southern blot results are shown in Figure 6B. After mouse DNA was digested with ScaI and visualized using the 5' probe hybridization, only a 6.51 kb positive band was observed in the WT mouse, while male mice No. 14, 15, and 16 only showed a 3.89 kb band. Female mouse No. 19 showed bands of 6.51 kb and 3.89 kb. After mouse DNA was digested with AvrII and visualized using the 3' probe hybridization, only a 2.34 kb positive band was observed in the WT mouse, while male mice No. 14, 15, and 16 only showed a 5.57 kb band. Female mouse No. 19 showed bands of 2.34 kb and 5.57 kb. This indicates that male mice No. 14, 15, and 16 are hemizygous for the target gene, while mouse No. 19 is heterozygous for the transgene.

[0095] Example 4 Detection of mRNA expression in model mice

[0096] The humanized RPGR sequence was inserted into the mouse genome during the construction of the model mouse. To further test whether the model mouse constructed above can correctly express the fusion mRNA, we extracted the mouse retina and RPE RNA, and detected the expression of fusion RPGR mRNA by PCR after reverse transcription. The PCR primer sequences are shown in Table 4. The PCR results are shown in Figure 7. No humanized fusion mRNA bands 4 and 5 were detected in WT mice, while the heterozygous RPGR + / hmut and homozygous RPGR hmut / hmut Positive bands 4 (405 bp) and 5 (514 bp) were effectively detected in both mice, indicating that the model mice could effectively express the fusion RPGR mRNA and could be correctly spliced.

[0097] Table 4. Primer sequences for detecting mRNA expression in model mice

[0098] Example 5 Phenotypic Identification of Model Mice

[0099] Patients with xlRP are characterized by abnormal fundus colorimetry (FP) images and progressive photoreceptor degeneration, leading to retinal structural abnormalities and loss of visual function. To determine whether the humanized RPGR mutant mouse model shares similar pathogenesis and disease phenotypes with RP patients, we examined fundus and retinal structural changes using FP and OCT, and assessed visual function using ERG.

[0100] As shown in Figure 8, the FP results showed that 6-month-old female heterozygotes (Female-RPGR + / hMut ) and male hemizygotes (Male-RPGR hmut ) Humanized RPGR mutant mice have a tapetal reflex in the fundus, and the phenotype worsens with age. In addition, RPGR-ORF15 transcripts are mainly located in the CC of photoreceptors and are crucial for the transport of photoreceptor structural proteins. OCT results show that Male-RPGR hmut and Female-RPGR + / hMut The outer nuclear layer of the retina of mice showed no significant abnormalities between 6 and 9 months of age. However, the reflectivity of the RPE (photoreceptor cell layer) was significantly increased, consistent with previous observations in patients with xlRP. The tapetal reflex and increased reflectivity suggest that genetic deficiency of RPGR leads to dysfunction of the photoreceptor cell connecting cilia, potentially resulting in the accumulation of retinoids in the inner segments of photoreceptors.

[0101] Further ERG was used to detect the changes in retinal function in the model mice. The ERG results are shown in Figure 9. At 6 and 9 months of age, Male-RPGRhmut and Female-RPGR + / hMut The amplitudes of the dark-adapted a-wave and dark-adapted b-wave of the mice were significantly reduced, indicating that the visual function of the RPGR mutant humanized mouse model was impaired. In addition, the phenotypes of the two genotypes of mice were further analyzed as they aged. The results are shown in Figure 10. As age increases, the male-RPGR hmut The ERG amplitude of the mice decreased more significantly. Therefore, the humanized RPGR mutant mouse model has similar pathogenesis and disease phenotypes to human RP patients.

[0102] In addition, frozen section staining was used to examine changes in mouse retinal structure. Immunofluorescence staining results, shown in Figure 11, show that the photoreceptor cell markers rhodopsin (antibody: ab5417) and L / M opsin (antibody: AB5405) were abnormally localized to the photoreceptor cell inner segments (IS) in the disease model mice. Furthermore, PNA (antibody: B-1075)-labeled photoreceptor cell inner and outer segments showed abnormal shortening, and expression of the glial cell marker GFAP (antibody: MAB360) was enhanced. Furthermore, retinas and retinal pigment epithelial cells from each group of mice were isolated, and q-RT-PCR was used to examine the expression of RPE cell markers RPE65 and ZO1, the retinal marker rhodopsin, and the Müller cell marker GFAP. The primer sequences for these assays are shown in Table 5. The results are shown in Figure 12. Compared with the control group, the mRNA expression of RPE65, ZO1, and rhodopsin was significantly decreased, while GFAP expression was significantly upregulated in all genotype model mice. The above results further indicate that both the retina and RPE of the RPGR humanized disease mouse model show abnormal phenotypes.

[0103] Table 5. DNA insertion detection primer sequences

[0104] Example 6 Model mice can effectively detect gene editing drugs DNA and RNA expression repair

[0105] Based on the clinical statistics of this disease, the clinical manifestations of male xlRP patients are more typical and severe. hmut To confirm that the above mouse model can be used to test the in vivo efficacy of gene-editing therapeutic drugs, we designed a gene-editing drug based on CRISPR / Cas9 based on the RPGR intron14 (IVS14) region of human RP patients (for experimental methods, see WO2022021149A1) and packaged it into an AAV viral vector. The drug code name is AAV-Cas9-sgRNA RPGR(sgRNA sequence: GATGTGATCTTTGACAGTGAAA (SEQ ID NO: 32); PAM: GAGAAT (SEQ ID NO: 33)), and a single subretinal injection efficacy test was conducted in humanized model mice. The experiment included three dose groups: 3×10 8 / eye(3E8), 2×10 9 / eye(2E9),3×10 9 Two months after administration, mice in each group were killed, and the mouse retinas were isolated for DNA insertion, RNA splicing, and expression testing. The in vivo repair pattern is shown in FIG13 , A.

[0106] The PCR results showed (PCR primer sequences are shown in Table 6) that positive insertion sites could be detected at both the upstream insertion site (P1 / P2) and the downstream insertion site (P3 / P4) in each dose group, and Sanger sequencing results showed that the sequence after insertion was consistent with the reference sequence, without obvious hybrid peaks (Figure 13, B), indicating that humanized mice with RPGR-ORF15 mutation sites were injected with AAV-Cas9-sgRNA in the subretinal space. RPGR After that, the mouse retinal DNA sequence can be effectively repaired. RPGR The injection has the function of DNA repair in the body.

[0107] Table 6. DNA insertion detection primer sequences

[0108] RT-PCR results showed that reverse-transcribed mRNA detected using primers targeting exon 14 (E14) and Opti-ORF15 (primer sequences are shown in Table 7) produced a target band of approximately 250 bp. Sequencing revealed that this target band did not contain IVS14, and the splice site sequence was identical to the reference sequence (Figure 13, C), indicating that the repaired DNA sequence effectively expressed mRNA and was correctly spliced ​​into mature RPGR-ORF15 mRNA. These results demonstrate that this model can effectively monitor the DNA and RNA repair expression of gene-editing drugs.

[0109] Table 7. mRNA splicing detection primer sequences

[0110] Furthermore, effective DNA repair demonstrates that gene therapy drugs can effectively exert their pharmacological activity in this mouse model. Based on the guiding principles for preclinical drug research, safety evaluation plans should include the use of relevant species to fully assess drug safety. Relevant species refer to animals in which the test substance can produce pharmacological activity, indicating that this model can be used for safety evaluation of gene therapy for RPGR-xlRP.

[0111] Example 7 Model mice can effectively detect the effects of gene editing drugs on disease phenotypes

[0112] To test whether the above model mice can be used to evaluate the effects of gene editing drugs on the structure and function of the mouse retina, we injected AAV-Cas9-sgRNA at a dose of 1E9 vg / eye. RPGR FP, OCT and ERG were measured 3 and 6 months after injection. As shown in Figure 14, FP results showed that hMut Compared with the AAV-Cas9-sgRNA group RPGR The tapetal reflex phenotype of the treatment group was significantly improved, indicating that AAV-Cas9-sgRNA RPGR It can effectively improve the visual cycle process of model mice. In addition, OCT results also showed that compared with Male-RPGR hMut Compared with the AAV-Cas9-sgRNA group RPGR The increase in the reflectivity of the RPE-photoreceptor layer in the control group was alleviated to some extent.

[0113] In addition, we also used ERG to further detect the changes in mouse retinal function. The ERG results are shown in Figure 15. Compared with the control group, AAV-Cas9-sgRNA RPGR The ERG dark adaptation a wave of the treated group mice was significantly improved 3 months after injection. As the time after injection increased, AAV-Cas9-sgRNA RPGR The ERG dark adaptation a-wave and b-wave in the treatment group were significantly improved.

[0114] The above results show that after treatment with gene-editing drugs, the fundus abnormalities and retinal function of the model mice were restored to a certain extent, indicating that the model mice can be effectively used for the in vivo evaluation of gene-editing drugs for RPGR-xlRP.

[0115] Those skilled in the art will appreciate that, although the present invention has been specifically described with reference to the above embodiments, the present invention is not limited to these specific embodiments. Based on the methods and technical solutions taught by the present invention, those skilled in the art can make appropriate modifications or improvements without departing from the spirit of the present invention, and the equivalent embodiments obtained therefrom are within the scope of the present invention.

[0116] References

[0117] 1 Talib,M.et al.CLINICAL AND GENETIC CHARACTERISTICS OF MALE PATIENTS WITH RPGR-ASSOCIATED RETINAL DYSTROPHIES:A Long-Term Follow-up Study.Retina 39,1186-1199,doi:10.1097 / IAE.0000000000002125(2019).

[0118] 2 Vervoort,R.et al.Mutational hot spot within a new RPGR exon in X-linked retinitis pigmentosa.Nat Genet 25,462-466,doi:10.1038 / 78182(2000).

[0119] 3 Jasmina Cehajic-Kapetanovic,K.X.,Cristina Martinez-Fernandez de la Camara,Anika Nanda,Alexandra Davies,Laura J.Wood,Anna Paola Salvetti,M.Dominik Fischer,James W.Aylward,Alun R.Barnard,Jasleen K.Jolly,Edmond Luo,Brandon J.Lujan,Tuyen Ong,Aniz Girach,Graeme C.M.Black5,6,Ninel Z.Gregori,Janet L.Davis,Potyra R.Rosa,Andrew J.Lotery 8,9,Byron L.Lam,Paulo E.Stanga and Robert E.MacLaren Initial results from a first-in-human gene therapy trial on X-linked retinitis pigmentosa caused by mutations in RPGR.Nature Medicine(2020).

[0120] 4 Hong,D.H.,Pawlyk,B.S.,Adamian,M.&Li,T.Dominant,gain-of-function mutant produced by truncation of RPGR.Invest Ophthalmol Vis Sci 45,36-41,doi:10.1167 / iovs.03-0787(2004).

[0121] 5 Wright,R.N.,Hong,D.H.&Perkins,B.Misexpression of the constitutive Rpgr(ex1-19)variant leads to severe photoreceptor degeneration.Invest Ophthalmol Vis Sci 52,5189-5201,doi:10.1167 / iovs.11-7470(2011).

[0122] 6 Megaw,R.D.,Soares,D.C.&Wright,A.F.RPGR:Its role in photoreceptor physiology,human disease,and future therapies.Exp Eye Res 138,32-41,doi:10.1016 / j.exer.2015.06.007(2015).

[0123] 7 Hong,D.H.et al.A retinitis pigmentosa GTPase regulator(RPGR)-deficient mouse model for X-linked retinitis pigmentosa(RP3).Proc Natl Acad Sci U S A 97,3649-3654,doi:10.1073 / pnas.060037497(2000).

[0124] 8 Huang,W.C.et al.RPGR-associated retinal degeneration in human X-linked RP and a murine model.Invest Ophthalmol Vis Sci 53,5594-5608,doi:10.1167 / iovs.12-10070(2012).

[0125] 9 Thompson,D.A.et al.Rd9 is a naturally occurring mouse model of a common form of retinitis pigmentosa caused by mutations in RPGR-ORF15.PLoS One 7,e35865,doi:10.1371 / journal.pone.0035865(2012).

[0126] 10 Zhang,Q.et al.Different RPGR exon ORF15 mutations in Canids provide insights into photoreceptor cell degeneration.Hum Mol Genet 11,993-1003,doi:10.1093 / hmg / 11.9.993(2002).

Claims

1. A method for constructing an animal model of retinitis pigmentosa (RP), the method comprising replacing one or more exons, one or more introns, ORF15, or a combination thereof of the retinitis pigmentosa GTPase regulator gene (RPGR gene) in the genome of the animal with the corresponding one or more exons, one or more introns, ORF15, or a combination thereof of the human RPGR gene having one or more RPGR gene mutations, wherein the RPGR gene mutation is an RPGR gene mutation that causes human RP, more preferably the RPGR gene mutation is in ORF15 of the RPGR gene, and even more preferably the RP is X-linked retinitis pigmentosa (xlRP).

2. The method according to claim 1, wherein the gene mutation is selected from point mutation, deletion mutation, insertion mutation, and inversion or duplication mutation, preferably point mutation, the point mutation is a missense mutation or a nonsense mutation, and more preferably the gene mutation can be repaired by gene editing technology.

3. The method according to claim 1 or 2, wherein the animal is a non-human mammal, preferably a ruminant, a canine, a lagomorph, a felid or a rodent, more preferably a mouse, a pig, a monkey, a bear, a sheep, a goat, a horse, a donkey, a rabbit, a cat, a cow, a fox or a dog, even more preferably a mouse or a rat, still more preferably a C57BL / 6 mouse or a BALB / c mouse, still more preferably a C57BL / 6J and a C57BL / 6N mouse, and most preferably a C57BL / 6J mouse.

4. The method according to any one of claims 1 to 3, wherein the exons include exons 1 to 19 of the RPGR gene, and the introns include introns 1 to 18 of the RPGR gene; preferably replacing the corresponding ORF15 in the genome of the animal with a human ORF15 having an RPGR gene mutation; more preferably replacing the corresponding intron 13-exon 14-ORF15 fragment in the genome of the animal with a human fragment including intron 13-exon 14-ORF15 having an RPGR gene mutation, wherein the RPGR gene mutation is in ORF15 of the RPGR gene; and / or preferably the RPGR gene mutation is a nonsense mutation, and more preferably the nonsense mutation is c.1905+76G>T.

5. The method according to any one of claims 1 to 4, wherein the animal is a mouse, preferably a C57BL / 6J mouse; and the method comprises replacing the corresponding intron 13-exon 14-ORF15 fragment in the mouse genome with a human fragment including intron 13-exon 14-ORF15 having a nonsense mutation in ORF15; more preferably the nonsense mutation is c.1905+76G>T; and / or most preferably the human fragment including intron 13-exon 14-ORF15 having a nonsense mutation is as shown in SEQ ID NO:

1.

6. The method according to any one of claims 1 to 5, wherein the replacement is achieved by the following gene editing techniques: CRISPR / Cas technology; zinc finger nuclease technology (ZFN); or transcription activator-like effector nuclease technology (TALEN); preferably CRISPR / Cas9.

7. The method according to any one of claims 1 to 6, wherein the method comprises: 1) By gene editing technology, introducing a fragment comprising one or more exons, one or more introns, ORF15 or a combination thereof of the human RPGR gene having one or more RPGR gene mutations into the fertilized egg of the animal, replacing one or more exons, one or more introns, ORF15 or a combination thereof corresponding to the RPGR gene in the genome of the animal, and identifying and obtaining F0 generation animals with the fragment of the human RPGR gene correctly inserted into the genome; and 2) Crossing the F0 generation animals with wild-type animals for germline transmission to obtain F1 generation animals, and identifying animals with the fragment of the human RPGR gene correctly inserted into the genome, preferably the animals are hemizygotes or homozygotes, male or female, more preferably male homozygotes.

8. The method according to claim 7, wherein the animal is a mouse, and / or the identification is by PCR identification or by Southern blot identification.

9. The method according to claim 8, the method further comprises one or more of the following steps: 1) Detecting fundus changes in model mice by fundus photography anomaly (FP) and optical coherence tomography (OCT); 2) Detecting retinal structural changes in model animals by immunofluorescence staining; 3) Detecting changes in the mRNA expression levels of retinal pigment epithelial cells (RPE), retinal photoreceptor cells and glial cell markers in model mice by q-RT-PCR; and 4) Measuring changes in visual function of model mice by electroretinogram (ERG).

10. The method according to any one of claims 1 to 9, wherein the method further comprises: Selecting an animal consistent with the disease phenotype of human RP patients as an RP animal model.

11. An RP animal model prepared by the method according to any one of claims 1 to 10, preferably a mouse model.

12. A method for identifying and / or testing a gene editing drug for treating RP, comprising: 1) Administering the gene editing drug to an RP animal model prepared by the method according to any one of claims 1 to 10; 2) Determining whether the RPGR gene mutation is repaired or reversed by the gene editing drug, that is, whether correct RPGR mRNA can be expressed; and 3) Optionally, detecting whether the disease phenotype of RP in the animal model is improved; If the RPGR gene mutation is repaired or reversed by the gene editing drug, and / or the disease phenotype of RP in the animal model is improved, it indicates that the gene editing drug can be effectively used for treating RP.

13. The method according to claim 12, wherein: the animal in step 1) is a mouse; the administration in step 1) is subretinal injection; The repair in step 2) is identified by PCR, by Southern blot, or by Sanger sequencing; and / or The detection of the disease phenotype of RP in the animal model in step 3) includes one or more of the following steps: a) Detecting fundus changes in the model animal by fundus photography abnormality (FP) and optical coherence tomography (OCT); b) Detecting retinal structural changes in the model animal by immunofluorescent staining; c) Detecting changes in the mRNA expression levels of retinal pigment epithelial cells (RPE), retinal photoreceptor cells, and glial cell markers in the model mouse by q-RT-PCR; and d) Determining changes in the visual function of the model animal by electroretinogram (ERG).

14. The method according to claim 12 or 13, wherein the gene editing drug comprises a CRISPR / Cas9 gene editing drug, preferably in the form of a recombinant adeno-associated virus (rAAV) vector.

15. Use of the RP animal model according to claim 11 for in vivo evaluation of the efficacy and / or safety of a gene editing drug for treating RP, preferably wherein the RP is X-linked retinitis pigmentosa (xlRP).

Images