Use of ube2f, cul5, or rnf7 in preventing and / or treating infections

Abstract

Use of Ube2f, Cul5, or Rnf7 in preventing and / or treating infections. Provided is any one of the following uses of a reagent targeting the Ube2f gene, the Cul5 gene, or the Rnf7 gene or an expression product thereof: (i) use in preparing a product for preventing and / or treating infections; (ii) use in preparing a product for enhancing anti-infection ability of immune cells; and (iii) use in preparing a product for preventing and / or reversing immune cell depletion.

Description

Use of Ube2f, Cul5 or Rnf7 in preventing and / or treating infection

[0001] Priority and related applications

[0002] The present invention claims priority to Chinese patent application No. 202410029752.4 filed on January 9, 2024, entitled “Use of Ube2f, Cul5 or Rnf7 in preventing and / or treating infection”, and the entire contents of the above application including the appendix are incorporated herein by reference. Technical Field

[0003] The present invention belongs to the field of immune cell technology, and specifically relates to the use of Ube2f, Cul5 or Rnf7 in preventing and / or treating infection. Background Art

[0004] During pathogen infection, insufficient expansion of immune cells (such as T cells), rapid extinction, inability to form effective immune memory, or exhaustion are key factors in preventing complete pathogen elimination and the formation of long-term immune memory. Current methods for increasing T cell expansion, promoting immune memory formation, and inhibiting exhaustion are very limited and require further research.

[0005] Reference 1 discloses that knockout of Ube2f significantly sensitizes cancer cells to platinum treatment by increasing NOXA protein levels and subsequently promoting apoptosis. Reference 2 discloses that Cul5 deletion reduces the ubiquitination and subsequent degradation of pJak1, leading to increased pJak1 and pSTAT6 levels and lowering the threshold for IL-4 receptor signaling. Reference 3 discloses that Rnf7 affects CARMA2 signaling by regulating the ubiquitination status of MALT1 and the NF-κB regulatory molecule NEMO.

[0006] However, the physiological and pathological functions of Ube2f, Cul5, or Rnf7 in T cells remain unclear, especially their roles in preventing and / or treating infection.

[0007] Citations

[0008] Citation 1: Zhou, Lisha et al. "Induction of NEDD8-conjugating enzyme E2 UBE2F by platinum protects lung cancer cells from apoptosis and confers to platinum-insensitivity." Cell death&disease vol.11,11 975.12Nov.2020,doi:10.1038 / s41419-020-03184-4

[0009] Reference 2: Kumar, Binod et al. “The ubiquitin ligase Cul5 regulates CD4 + T cell fate choice and allergic inflammation." Nature communications vol.13,1 2786.19May.2022,doi:10.1038 / s41467-022-30437-x

[0010] Reference 3: Telesio, Gianluca et al. "The E3 Ubiquitin Ligase RNF7 Negatively Regulates CARD14 / CARMA2sh Signaling." International journal of molecular sciences vol.18,12 2581.1Dec.2017, doi:10.3390 / ijms18122581 Summary of the Invention

[0011] Problems to be solved by the invention

[0012] The current problem is that immune cells (such as T cells) do not expand sufficiently during infection, quickly enter a contraction phase, and are unable to form memory T cells.

[0013] In response to the problems existing in the prior art, the present invention significantly enhances the expansion ability of T cells during infection, increases the formation of memory T cells, and inhibits T cell exhaustion by editing the Ube2f, Cul5 or Rnf7 genes in T cells, thereby improving the anti-infection ability of T cells and significantly reducing the infection of pathogens.

[0014] Solutions for solving problems

[0015] In a first aspect of the present invention, any one of the following uses of an agent targeting the Ube2f gene, the Cul5 gene, or the Rnf7 gene or their expression products is provided:

[0016] (i) use in the preparation of a product for the prevention and / or treatment of infection;

[0017] (ii) use in the preparation of a product for enhancing the anti-infection ability of immune cells;

[0018] (iii) Use in the preparation of a product for preventing and / or reversing immune cell depletion.

[0019] In some embodiments, the infection comprises at least one of a bacterial infection, a viral infection, a fungal infection, a protozoan infection, and a parasitic infection.

[0020] In some embodiments, the prevention and / or treatment of infection includes preventing and / or treating infectious diseases and / or diseases and / or symptoms associated with infection, and / or enhancing the subject's ability to resist infection.

[0021] In some specific embodiments, the infection-related diseases and / or symptoms are one or more selected from the following groups: pathological damage caused by infection; immune cell exhaustion after infection, including reduced proliferation capacity, weakened killing ability, and reduced secretion of cytokines of immune cells; endotoxic shock or death; inflammatory damage to organs; multiple organ failure; acute and / or chronic inflammatory diseases caused by infection.

[0022] In some specific embodiments, enhancing the subject's ability to resist infection comprises enhancing the subject's ability to resist infection by immune cells, and / or preventing and / or reversing immune cell exhaustion in the subject.

[0023] In some embodiments, the immune cells include at least one of T cells, NKT cells, NK cells, innate lymphocytes (ILCs), and chimeric antigen receptor NK cells (CAR-NK cells).

[0024] In some specific embodiments, the T cells include naive T cells, αβ T cells, γδ T cells, CD4 + T cells, CD8 + At least one of T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric antigen receptor T cells (CAR-T cells), T cell receptor T cells (TCR-T cells) and antigen-specific T cells.

[0025] In some specific embodiments, said T cells comprise activated T cells.

[0026] In some specific embodiments, the T cells comprise antigen-specific T cells. Preferably, the antigen-specific T cells are antigen-specific T cells against pathogens that cause infection.

[0027] In some specific embodiments, the T cells comprise CD8 + T cells.

[0028] In some specific embodiments, said T cells comprise exhausted T cells.

[0029] In some embodiments, the immune cell is an immune cell from a subject; and / or, the infection is an infection in a subject.

[0030] In some specific embodiments, the subject is a human or non-human animal.

[0031] In some embodiments, the agent targeting the Ube2f gene, the Cul5 gene, or the Rnf7 gene or their expression products comprises at least one of a nucleic acid, a polypeptide, a ribonucleoprotein complex, and a small molecule inhibitor.

[0032] In some specific embodiments, the nucleic acid comprises at least one of an antisense RNA molecule and an RNA interference molecule.

[0033] In some specific embodiments, the polypeptide comprises at least one of an antibody or an antigen-binding fragment thereof, an artificial zinc finger nuclease, and a TALEN system.

[0034] In some specific embodiments, the ribonucleoprotein complex comprises a CRISPR / cas system.

[0035] In some embodiments, the reagent targeting the Ube2f gene, Cul5 gene or Rnf7 gene or their expression products includes reagents used in any one of gene knockout technology, gene silencing technology, inactivation mutation technology, and PROTAC technology.

[0036] In some embodiments, the product is a pharmaceutical composition, a kit, a reagent, or a test kit.

[0037] In a second aspect, the present invention provides a modified immune cell, wherein the modified immune cell is an immune cell treated with an agent targeting the Ube2f gene, the Cul5 gene, or the Rnf7 gene or an expression product thereof.

[0038] In some embodiments, the immune cells include at least one of T cells, NKT cells, NK cells, innate lymphocytes (ILCs), and chimeric antigen receptor NK cells (CAR-NK cells).

[0039] In some specific embodiments, the T cells include naive T cells, αβ T cells, γδ T cells, CD4 + T cells, CD8 + At least one of T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric antigen receptor T cells (CAR-T cells), T cell receptor T cells (TCR-T cells) and antigen-specific T cells.

[0040] In some specific embodiments, said T cells comprise activated T cells.

[0041] In some specific embodiments, the T cells comprise antigen-specific T cells.

[0042] In some specific embodiments, the T cells comprise CD8 + T cells.

[0043] In some specific embodiments, said T cells comprise exhausted T cells.

[0044] In some embodiments, the antigen-specific T cells are antigen-specific T cells directed against a pathogen that causes an infection.

[0045] In some specific embodiments, the infection comprises at least one of a bacterial infection, a viral infection, a fungal infection, a protozoan infection, and a parasitic infection.

[0046] In some specific embodiments, the infection is an infection in a subject.

[0047] The third aspect of the present invention provides use of the modified immune cells as described in the second aspect of the present invention in the preparation of a product for preventing and / or treating infection.

[0048] In a fourth aspect of the present invention, a composition is provided, comprising at least one selected from the following (a) to (d):

[0049] (a) an agent targeting the Ube2 gene or its expression product;

[0050] (b) an agent targeting the Cul5 gene or its expression product;

[0051] (c) an agent targeting the Rnf7 gene or its expression product; and,

[0052] (d) The modified immune cell according to the second aspect of the present invention.

[0053] In some embodiments, the composition is a pharmaceutical composition, which further comprises a pharmaceutically acceptable carrier.

[0054] Effects of the Invention

[0055] The present invention achieves the effect of enhancing the ability of T cells to resist infection by genetically editing antigen-specific immune cells, such as T cells. By knocking out the Ube2f gene, the Cul5 gene, or the Rnf7 gene, T cells are inhibited from entering the contraction phase, maintained in the expansion phase, the expansion capacity of T cells is enhanced, the persistence of T cells is enhanced, and / or the formation of memory T cells is enhanced, that is, T cells are prevented from entering the exhausted state and the resistance to pathogens (viruses) is enhanced, for example, the viral load is reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1. Knockout of Ube2f, Cul5, and Rnf7 enhances CD8 expression during chronic infection with LCMV clone 13. + Expansion capacity and persistence of T lymphocytes

[0057] Figure 1A is a schematic diagram of the experimental design. + P14 cells were activated and transduced with a GFP-labeled retrovirus expressing a non-targeting sgRNA (sgControl) or the indicated sgRNA labeled Thy1.1. GFP-positive and Thy1.1-positive P14 cells were mixed at a 1:1 ratio and co-transferred into B6 mice infected with LCMV clone 13 one day before adoptive cell transfer. GFP- and Thy1.1-double-positive P14 cells were detected in the blood by flow cytometry. The distribution of P14 cells in the peripheral blood of recipient mice was examined on days 0, 7, 14, 28, and 56 after infection. Figure 1B shows flow cytometric plots of the proportion of Thy1.1 and GFP-positive cells to P14 cells in the peripheral blood of each group of mice at 0, 7, 14, 28, and 56 days after infection, detected by flow cytometry; Figure 1C shows a curve graph of Thy1.1-positive P14 cells in the blood during LCMV clone 13 infection (n=4 mice per group), which is a two-way ANOVA multiple-comparisons test; Figure 1D shows a statistical graph of the viral titer of the serum of the mouse control group (sgControl) and the sgUbe2f group 30 days after LCMV clone 13 infection (n=8-11), which is a two-tailed paired Student's t test.

[0058] Figure 2. Knockout of Ube2f, Cul5, and Rnf7 enhances CD8 expression during acute LCMV-Armstrong infection. + Expansion capacity and persistence of T lymphocytes

[0059] Figure 2A is a schematic diagram of the experimental design. + P14 cells were activated and transduced with a retrovirus expressing non-targeting sgRNA with a GFP marker (sgControl) or an indicator sgRNA with a Thy1.1 marker. GFP-positive and Thy1.1-positive P14 cells were mixed in a 1:1 ratio and co-transferred into B6 mice infected with LCMV-Armstrong one day before cell adoptive transfer. GFP and Thy1.1 double-positive P14 cells in the blood were detected by flow cytometry. The distribution of P14 cells in the peripheral blood of recipient mice was detected on days 7, 14, 28, and 35 after infection. Figure 2B is a representative flow cytometric graph of the proportion of Thy1.1-positive and GFP-positive P14 cells to CD8-positive T cells in the peripheral blood of recipient mice on days 7, 14, 28, and 35 after LCMV-Armstrong infection. Figure 2C shows a graph of the proportion of P14 cells to CD8-positive T cells in the blood during LCMV Armstrong infection (n=4). Figure 2 (D) shows the proportion of control P14 cells (sgControl) and P14 cells with Ube2f, Cul5, and Rnf7 knockout in the spleens of recipient mice on day 36 after LCMV-Armstrong infection. Each group had 4-6 mice. Figure 2 (E) shows the absolute number of control P14 cells (sgControl) and P14 cells with Ube2f, Cul5, and Rnf7 knockout in the spleens of recipient mice on day 36 after LCMV-Armstrong infection. Each group had 4-6 mice. Data in Figure 2 (C), (D), and (E) are mean ± standard error (SEM); Figure 2 (C) is a two-way ANOVA mixed-effects analysis; Figures 2 (D) and (E) are two-tailed unpaired Student's t test.

[0060] Figure 3. Knockout of Ube2f enhances CD8 expression during Listeria monocytogenes-lactalbumin (LM-OVA) infection + Expansion capacity and persistence of T lymphocytes

[0061] Figure 3A shows the percentage of OT-1 cells in the spleen of recipient mice with control (sgControl) or Ube2f knockout (sgUbe2f) on day 45 after LM-OVA infection. +Figure 3B shows the absolute number of OT-1 cells in the spleen of recipient mice 45 days after LM-OVA infection, using the two-tailed unpaired Student's t test, with n=4-5. DETAILED DESCRIPTION

[0062] Various exemplary embodiments, features, and aspects of the present invention will be described in detail below. The word "exemplary" is used herein to mean "serving as an example, embodiment, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior or preferred over other embodiments.

[0063] In addition, numerous specific details are provided in the following detailed description to better illustrate the present invention. Those skilled in the art will appreciate that the present invention can be practiced without certain specific details. In other instances, methods, means, equipment, and steps well known to those skilled in the art are not described in detail in order to highlight the main points of the present invention.

[0064] Unless otherwise stated, the units used in this specification are international standard units, and the numerical values ​​and numerical ranges appearing in the present invention should be understood to include the inevitable systematic errors in industrial production.

[0065] In this specification, the use of "may" includes both the meaning of performing a certain process and the meaning of not performing a certain process.

[0066] In this specification, references to "some specific / preferred embodiments," "other specific / preferred embodiments," "embodiments," etc., mean that the specific elements (e.g., features, structures, properties, and / or characteristics) described in connection with the embodiments are included in at least one embodiment described herein, and may or may not be present in other embodiments. In addition, it should be understood that the elements may be combined in various embodiments in any suitable manner.

[0067] In this specification, the numerical range expressed using "a numerical value A to a numerical value B" means a range including the endpoints A and B.

[0068] In this specification, when the term "and / or" is used to connect two or more options, it should be understood to mean any one of the options or any two or more of the options.

[0069] As used herein, the term "immune cell" refers to any cell that plays a role in an immune response. Immune cells are of hematopoietic origin and include lymphocytes, such as B cells and T cells; natural killer cells; and myeloid cells, such as monocytes, macrophages, dendritic cells, eosinophils, neutrophils, mast cells, basophils, and granulocytes.

[0070] In this specification, the term "lymphocyte" refers to all immature, mature, undifferentiated and differentiated white lymphocyte populations, including tissue-specific and specialized types. By way of non-limiting example, the lymphocytes encompass B cells, T cells, NKT cells and NK cells.

[0071] As used herein, "administer," "give," and "treat" as applied to an animal, human, experimental subject, cell, tissue, organ, or biological fluid, refers to the contact of an exogenous drug, therapeutic agent, diagnostic agent, or composition with an animal, human, subject, cell, tissue, organ, or biological fluid. "Administer," "give," and "treat" can refer to, for example, treatment, pharmacokinetics, diagnosis, research, and experimental procedures. Treatment of cells includes contact of an agent with a cell, and contact of an agent with a fluid, wherein the fluid is in contact with the cell. "Administer," "give," and "treat" also mean the in vitro and ex vivo treatment of, for example, a cell, by a reagent, a diagnostic agent, a binding composition, or by another cell. "Treat" as applied to a human, veterinary, or research subject refers to treatment, prophylaxis, or preventative measures, research, and diagnostic applications.

[0072] As used herein, "treatment" means administering an internal or external therapeutic agent, such as a recombinant immune cell comprising the present invention, to a patient having one or more symptoms of a disease for which the therapeutic agent is known to have a therapeutic effect. Typically, the therapeutic agent is administered in an amount effective to alleviate one or more symptoms of a disease in the patient or population being treated, either by inducing regression of such symptoms or inhibiting the development of such symptoms to any clinically measurable degree. The amount of a therapeutic agent effective to alleviate any specific disease symptom (also referred to as a "therapeutically effective amount") can vary according to a variety of factors, such as the patient's disease state, age, and weight, and the ability of the drug to produce the desired therapeutic effect in the patient. Whether the symptoms of the disease have been alleviated can be evaluated by any clinical test method commonly used by a physician or other health care professional to evaluate the severity or progression of the symptoms.

[0073] In this specification, the term "prevention" refers to preventive treatment of a subject who does not currently have a disease or has not had a disease in the past but is at risk of developing a disease or who has had a disease in the past and does not currently have a disease but is at risk of recurrence of the disease.

[0074] As used herein, an "effective amount" encompasses an amount sufficient to ameliorate or prevent the symptoms or conditions of a medical condition. An effective amount also refers to an amount sufficient to permit or facilitate diagnosis. The effective amount for a particular patient or veterinary subject may vary depending on factors such as the condition to be treated, the patient's overall health, the route and dosage of administration, and the severity of side effects. An effective amount can be the maximum dose or dosage regimen that avoids significant side effects or toxic effects.

[0075] As used herein, a "therapeutically effective amount" is an amount sufficient to provide a therapeutic benefit in the treatment of a condition or sufficient to delay or minimize one or more symptoms associated with the condition. A therapeutically effective amount refers to an amount of a therapeutic agent, alone or in combination with other therapies, that provides a therapeutic benefit in the treatment of a condition. The term "therapeutically effective amount" can include an amount that improves overall therapy; reduces or avoids symptoms, signs, or causes of a condition; and / or enhances the therapeutic efficacy of another therapeutic agent.

[0076] As used herein, a "prophylactically effective amount" is an amount sufficient to prevent a condition or one or more symptoms associated with a condition or to prevent its recurrence. A prophylactically effective amount refers to an amount of a therapeutic agent, alone or in combination with other agents, that provides a prophylactic benefit in preventing a condition. The term "prophylactically effective amount" may include an amount that improves overall prevention or enhances the prophylactic efficacy of another prophylactic agent.

[0077] In this specification, the term "pharmaceutically acceptable" (or "pharmacologically acceptable", "pharmaceutically usable") refers to molecular entities and compositions that do not produce adverse reactions, allergic reactions or other untoward reactions when administered to animals or humans, as appropriate. As used herein, the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial agents, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants, etc. that can be used as media for pharmaceutically acceptable substances.

[0078] In this specification, "UBE2F gene" and "Ube2f gene" can be used interchangeably unless otherwise specified. The Ube2f gene is the Ube2f gene of any target subject.

[0079] In this specification, "CUL5 gene" and "Cul5 gene" can be used interchangeably unless otherwise specified. The "Cul5 gene" is the "Cul5 gene" of any target subject.

[0080] In this specification, "RNF7 gene" and "Rnf7 gene" can be used interchangeably unless otherwise specified. The "Rnf7 gene" is the "Rnf7 gene" of any target subject.

[0081] As used herein, "subject" or "host" refers to a human or non-human animal, including mammals. Examples include primates (e.g., humans and monkeys), cattle, sheep, goats, alpacas, horses, dogs, cats, rabbits, rats, and mice. "Subjects" or "hosts" include both therapeutic and non-therapeutic subjects. "Subjects" or "hosts" also include experimental animal models or animals used to produce biomolecules expressing therapeutic diseases, i.e., "non-therapeutic hosts" or "non-therapeutic subjects."

[0082] <Use for preventing and / or treating infection, enhancing the anti-infection ability of immune cells, and preventing and / or reversing immune cell exhaustion>

[0083] In some aspects of the present invention, any of the following uses of an agent targeting the Ube2f gene, the Cul5 gene, or the Rnf7 gene is provided:

[0084] (i) use in the preparation of a product for the prevention and / or treatment of infection;

[0085] (ii) use in the preparation of a product for enhancing the anti-infection ability of immune cells;

[0086] (iii) Use in the preparation of a product for preventing and / or reversing immune cell depletion.

[0087] (gene, gene expression product)

[0088] In some embodiments, the expression products of the Ube2f gene, Cul5 gene, or Rnf7 gene refer to various forms of molecules of the Ube2f gene, Cul5 gene, or Rnf7 gene at various stages, such as, but not limited to, molecules produced during the amplification, replication, transcription, splicing, processing, translation, and modification of the Ube2f gene, Cul5 gene, or Rnf7 gene, such as cDNA, mRNA, precursor protein, mature protein, and fragments thereof.

[0089] In some embodiments, exemplary information of the Ube2f gene, the Cul5 gene, and the Rnf7 gene can be found in Table 1 below.

[0090] Table 1 Information on Ube2f, Cul5, and Rnf7 genes

[0091] In the present invention, specifically, the human UBE2F gene (Gene ID: 140739, updated on November 23, 2023, https: / / www.ncbi.nlm.nih.gov / gene / 140739) and the mouse Ube2f gene (Gene ID: 67921, updated on November 23, 2023, https: / / www.ncbi.nlm.nih.gov / gene / 67921) encode the UBE2F protein in the cell.

[0092] The human CUL5 gene (Gene ID: 8065, updated on December 3, 2023, https: / / www.ncbi.nlm.nih.gov / gene / 8065) ​​and the mouse Cul5 gene (Gene ID: 75717, updated on November 23, 2023, https: / / www.ncbi.nlm.nih.gov / gene / 75717) encode the CUL5 protein in cells.

[0093] The human RNF7 gene (Gene ID: 9616, updated on November 23, 2023, https: / / www.ncbi.nlm.nih.gov / gene / 9616) and the mouse Rnf7 gene (Gene ID: 19823, updated on November 23, 2023, https: / / www.ncbi.nlm.nih.gov / gene / 19823) encode the RNF7 protein in cells. The above genes are all incorporated into the present invention by reference.

[0094] (Agents targeting genes or their expression products)

[0095] In some embodiments, the agent targeting the Ube2f gene or its expression product, the agent targeting the Cul5 gene or its expression product, or the agent targeting the Rnf7 gene or its expression product can recognize and bind to the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product. In some embodiments, the agent targeting the Ube2f gene or its expression product, the agent targeting the Cul5 gene or its expression product, or the agent targeting the Rnf7 gene or its expression product can regulate the level or activity of the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product. In some specific embodiments, the agent targeting the Ube2f gene or its expression product, the agent targeting the Cul5 gene or its expression product, or the agent targeting the Rnf7 gene or its expression product can reduce the level or activity of the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product. In some specific embodiments, an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, or an agent targeting the Rnf7 gene or its expression product can silence the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product.

[0096] In other embodiments, an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, or an agent targeting the Rnf7 gene or its expression product reduces or eliminates the expression and / or function of the Ube2f gene, Cul5 gene, or Rnf7 gene (e.g., in immune cells, specifically T cells). Exemplarily, the T cells do not contain the Ube2f gene, Cul5 gene, or Rnf7 gene, or the biological function of the expression product of the Ube2f gene, the expression product of the Cul5 gene, or the expression product of the Rnf7 gene in the T cells is inhibited. In some embodiments, the expression or function of the Ube2f gene, Cul5 gene, or Rnf7 gene in immune cells (e.g., T cells) treated with an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, or an agent targeting the Rnf7 gene or its expression product is reduced by at least 10%, 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% compared to immune cells (e.g., T cells) that have not been treated with an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, or an agent targeting the Rnf7 gene or its expression product.

[0097] In the present invention, the agent targeting the Ube2f gene or its expression product, the agent targeting the Cul5 gene or its expression product, or the agent targeting the Rnf7 gene or its expression product can be an agent used in at least one of gene knockout technology, gene silencing technology, inactivation mutation technology, and PROTAC technology, or can be a small molecule inhibitor.

[0098] In some embodiments, the agent targeting the Ube2f gene or its expression product, the agent targeting the Cul5 gene or its expression product, or the agent targeting the Rnf7 gene or its expression product is selected from, but not limited to, at least one of a nucleic acid, a polypeptide, a ribonucleoprotein complex (RNP), or a small molecule inhibitor.

[0099] Nucleic Acids

[0100] In some embodiments, the nucleic acid is selected from DNA, RNA, DNA / RNA.

[0101] In some embodiments, the nucleic acid comprises at least one of an antisense RNA molecule and an RNA interference molecule.

[0102] "Antisense RNA molecule" refers to an RNA molecule that is complementary to an mRNA transcript, regardless of length. An antisense RNA molecule refers to a single-stranded RNA molecule that can be introduced into a cell, tissue, or subject and that causes reduced expression of an endogenous target gene product by a mechanism that is independent of the endogenous gene silencing pathway but relies on the degradation of the target mRNA transcript mediated by RNase H. In some embodiments, the antisense nucleic acid comprises a modified backbone, such as a phosphorothioate, a phosphorodithioate, or other backbones known in the art, or may comprise non-natural internucleoside linkages. In some embodiments, the antisense nucleic acid may comprise a locked nucleic acid (LNA).

[0103] "RNA interference molecules" refer to RNA polynucleotides that mediate the reduced expression of endogenous target gene products by degrading target mRNA through endogenous gene silencing pathways (e.g., Dicer and RNA-induced silencing complex (RISC)). Exemplary RNA interference molecules include microRNAs (also referred to herein as "miRNAs"), short hairpin RNAs (shRNAs), small interfering RNAs (siRNAs), RNA aptamers, and morpholinos.

[0104] In some specific embodiments, the siRNA comprises a sense strand and an antisense strand; wherein the sense strand and the antisense strand are complementary and together form an RNA dimer; and the antisense strand is capable of hybridizing or complementing with a target sequence in the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product. In some specific embodiments, the siRNA can specifically bind to a target sequence in the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product.

[0105] In some specific embodiments, the shRNA is expressed from a vector, for example, by cloning a DNA fragment capable of transcribing the shRNA into a viral expression vector for expression. The shRNA comprises a sense strand segment and an antisense strand segment, as well as a stem-loop structure connecting the sense strand segment and the antisense strand segment. The sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the antisense strand is complementary to or hybridizes with the sequence of the transcription product of the target sequence in the Ube2f gene, the Cul5 gene, or the Rnf7 gene. The shRNA can be converted into siRNA after enzyme cleavage, thereby specifically regulating the level or activity of the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product.

[0106] Those skilled in the art will understand that when targeting the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product, effective siRNA or shRNA can be designed and prepared according to the interfering RNA design principles known in the art.

[0107] peptides

[0108] In some embodiments, the polypeptide is selected from at least one of: an antibody or an antigen-binding fragment thereof, a protein containing one or more zinc finger binding domains and an enzyme domain (zinc finger system, or artificial zinc finger nucleases (Zinc Finger Nucleases, ZFN)), and a protein containing a transcription activator-like effector (TALE) nuclease domain and an enzyme domain (TALEN system).

[0109] Ribonucleoprotein complex (RNP)

[0110] In some embodiments, the RNP is selected from the group consisting of: CRISPR / cas system.

[0111] In some specific embodiments, the CRISPR / cas system comprises a nucleic acid molecule and an enzyme protein, wherein the nucleic acid molecule is a guide RNA (gRNA) molecule, and the enzyme protein is a Cas protein or a Cas ortholog.

[0112] In some optional embodiments, the enzyme protein is selected from Cas9, Cas12a, Cas12b, Cas13a, Cas13b, Cas13c, Cas13e or Cas13f protein or its direct homologs.

[0113] In some embodiments, the CRISPR / cas system includes any of the following:

[0114] (i) a targeting domain sequence in a guide RNA (gRNA) targeting the Ube2f gene complexes with a first Cas endonuclease protein to form a first ribonucleoprotein (RNP) complex;

[0115] (ii) complexing a targeting domain sequence in a guide RNA (gRNA) targeting the Cul5 gene with a second Cas endonuclease protein to form a second ribonucleoprotein (RNP) complex; and

[0116] (iii) The targeting domain sequence in the guide RNA (gRNA) targeting the Rnf7 gene is complexed with the third Cas endonuclease protein to form a third ribonucleoprotein (RNP) complex.

[0117] In some embodiments, in the CRISPR / cas system of the present invention, the nucleic acid binding segment in the guide RNA (gRNA) targeting the Ube2f gene binds to a target DNA sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a DNA sequence encoded by a Ube2f gene derived from a subject (e.g., NCBI Gene ID: 140739 or Gene ID: 67921); the nucleic acid binding segment in the guide RNA (gRNA) targeting the Cul5 gene binds to a target DNA sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a DNA sequence encoded by a Cul5 gene derived from a subject (e.g., NCBI Gene ID: 8065 or Gene ID: 75717); the nucleic acid binding segment in the guide RNA (gRNA) targeting the Rnf7 gene binds to a target DNA sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a DNA sequence encoded by a Rnf7 gene derived from a subject (e.g., NCBI Gene ID: 9616 or Gene ID: 9617); ID: 19823) encoded by a target DNA sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identity.

[0118] In some specific embodiments, in the CRISPR / cas system of the present invention, the targeting domain in the guide RNA (gRNA) targeting the Ube2f gene comprises the sequence TCCCGATGCCTACAACATGG (SEQ ID NO: 3) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO: 3; the targeting domain in the guide RNA (gRNA) targeting the Cul5 gene comprises the sequence AGGCATATATTGTTGAATGG (SEQ ID NO: 4) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO: 4; the targeting domain of the guide RNA (gRNA) targeting the Rnf7 gene comprises the sequence TGCATCGCTTACCCATCACC (SEQ ID NO: 5) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO: 5.

[0119] Small molecule inhibitors

[0120] In some specific embodiments, the agent targeting the Ube2f gene or its expression product, the agent targeting the Cul5 gene or its expression product, or the agent targeting the Rnf7 gene or its expression product comprises a small molecule inhibitor that can reduce or silence the level or activity of the Ube2f gene or its expression product, the Cul5 gene or its expression product, or the Rnf7 gene or its expression product.

[0121] In the present invention, the term "small molecule" refers to a low molecular weight compound, which can be produced synthetically or obtained from natural sources and has a molecular weight of less than 2000 Daltons (Da), less than 1500 Da, less than 1000 Da, less than 900 Da, less than 800 Da, less than 700 Da, less than 600 Da or less than 500 Da.

[0122] In some embodiments, the small molecule inhibitor can be an organic compound, an inorganic compound, or a combination of organic and / or inorganic compounds. In some specific embodiments, the small molecule inhibitor is a chemically prepared active substance or compound. Typically, these compounds are synthesized in a classical manner by chemical reactions between different organic and / or inorganic compounds.

[0123] In some embodiments, the small molecule inhibitor can exert its activity in the form in which it is administered, or the small molecule inhibitor can be a prodrug. Thus, "small molecule inhibitor" encompasses both the active form and the prodrug.

[0124] The term "prodrug" refers to a compound or substance that is converted into a therapeutically active agent under physiological conditions. In some embodiments, a prodrug is a compound or substance that is metabolized into a pharmaceutically active form in a subject after administration (e.g., by enzymatic activity in the subject).

[0125] The term "small molecule inhibitor" also encompasses pharmaceutically acceptable salts thereof. The term "pharmaceutically acceptable salt" refers to any salt form of a small molecule inhibitor that is safe and effective for administration to a subject and that possesses the desired biological, pharmacological, and / or therapeutic activity. Pharmaceutically acceptable salts include salts of acidic or basic groups. Pharmaceutically acceptable acid addition salts may include, but are not limited to, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, sucrose salt, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1,1'-methylene-bis-(2-hydroxy-3-naphthoate)). Suitable base salts may include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc, and diethanolamine salts.

[0126] (Immune cells, immune cell depletion)

[0127] In the present invention, the immune cells include T cells, NKT cells, NK cells, innate lymphocytes (ILCs) or other immune cells with anti-infection ability, as well as chimeric antigen receptor NK cells (CAR-NK cells) or other therapeutic immune cells expressing non-natural antigen receptors, but are not limited thereto.

[0128] In the present invention, the term "T cells" includes naive T cells, αβT cells, γδT cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric antigen receptor T cells (CAR-T cells), T cell receptor T cells (TCR-T cells) and antigen-specific T cells, but are not limited thereto.

[0129] In some specific embodiments, the T cells comprise activated T cells.

[0130] In some specific embodiments, the T cells comprise CD8 + T cells.

[0131] In some specific embodiments, the T cells comprise antigen-specific T cells.

[0132] In some specific embodiments, the antigen-specific T cells are antigen-specific T cells directed against a pathogen that causes an infection.

[0133] In some embodiments, the T cells comprise exhausted T cells.

[0134] In the present invention, immune cell depletion refers to a pathological state in which the number of certain immune cells in the body's immune system is significantly reduced or their functions are impaired, leading to a decline in the body's immune function.

[0135] In the present invention, the term "exhausted T cells" or "T cell exhaustion" refers to dysfunctional T cells, which gradually lose their effector functions during infection.

[0136] In some specific embodiments, preventing and / or reversing T cell exhaustion comprises: inhibiting T cells from entering the contraction phase, maintaining T cells in the expansion phase, enhancing T cell expansion capacity, enhancing T cell persistence, and / or enhancing the formation of memory T cells.

[0137] In the present invention, the "expansion phase" refers to the stage in which T cells initiate an immune response after exposure to an antigen or other stimulus. During this stage, the number of T cells increases rapidly to counteract the antigenic stimulus. This phase is a key step in the T cell immune response.

[0138] In the present invention, "contraction phase" refers to a stage in the immune response of T cells, during which the number of T cells decreases significantly. This stage usually occurs after the expansion phase of T cells and is a key stage of T cell differentiation.

[0139] In this context, "persistence" refers to the lifespan and stability of T cells. T cells with strong persistence can survive for long periods of time and maintain certain immune functions, which helps maintain long-term immune memory. T cells with weak persistence are prone to death, requiring constant replenishment of new T cells to maintain immune system function.

[0140] In some embodiments, the immune cells are from a subject. In some specific embodiments, the subject is a human or non-human animal.

[0141] In some embodiments, the subject has an infection.

[0142] In some specific embodiments, the immune cells comprise antigen-specific immune cells against a pathogen causing the infection in a subject suffering from the infection.

[0143] (Infect)

[0144] In this specification, the term "infection" refers to a pathogen such as a bacterium, virus, fungus, worm or protozoa that invades the cells, tissues and / or organs of a subject. In certain embodiments, the pathogen can grow, reproduce and / or produce toxins in the cells, tissues and / or organs of a subject. In certain embodiments, the subject can react (for example, an allergic reaction or an immune response) to the pathogen. Examples of infection include but are not limited to bacterial infection, viral infection, fungal infection, parasitic infection and protozoan infection.

[0145] In some embodiments, the infection is an acute infection. In other embodiments, the infection is a chronic infection.

[0146] In some embodiments, the infection is a viral infection, and in other embodiments, the infection is a bacterial infection.

[0147] In some embodiments, chronic infection refers to the persistence of a pathogen in the body after an acute infection or latent infection. In some embodiments, chronic infection is a chronic infection in a subject. In some embodiments, the subject is a human or non-human animal.

[0148] In the present invention, preventing and / or treating infection includes preventing and / or treating infectious diseases and / or diseases and / or symptoms associated with infection, and / or enhancing the subject's ability to resist infection.

[0149] In some embodiments, the infection-related diseases and / or symptoms are one or more selected from the following groups: pathological damage caused by infection; immune cell exhaustion after infection, including reduced proliferation capacity, weakened killing capacity, and reduced secretion of cytokines of immune cells; endotoxic shock or death; inflammatory damage to organs; multiple organ failure, for example, the organs are selected from: liver, spleen, brain, kidney, heart, lung, stomach, intestine; acute and / or chronic inflammatory diseases caused by infection (for example, autoimmune diseases such as inflammatory bowel disease, rheumatoid arthritis, systemic lupus erythematosus, chronic nephritis, tuberculosis, chronic gastrointestinal diseases).

[0150] In some embodiments, enhancing the subject's ability to resist infection comprises enhancing the subject's ability to resist infection by immune cells, and / or preventing and / or reversing immune cell exhaustion in the subject.

[0151] (product)

[0152] In the present invention, the product may be a pharmaceutical composition, a pharmaceutical kit, a reagent or a test kit.

[0153] <Modified immune cells and their use in treating infections>

[0154] In some aspects of the present invention, a modified immune cell is provided, which is an immune cell treated with the aforementioned agent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene or their expression products.

[0155] In the present invention, the immune cells include T cells, NKT cells, NK cells, innate lymphocytes (ILCs) or other immune cells with anti-infection ability, as well as chimeric antigen receptor NK cells (CAR-NK cells) or other therapeutic immune cells expressing non-natural antigen receptors, but are not limited thereto.

[0156] In the present invention, the term "T cells" includes naive T cells, αβT cells, γδT cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric antigen receptor T cells (CAR-T cells), T cell receptor T cells (TCR-T cells) and antigen-specific T cells, but are not limited thereto.

[0157] In some embodiments, the T cells comprise activated T cells.

[0158] In some embodiments, the T cells comprise CD8 + T cells.

[0159] In some embodiments, the T cells comprise antigen-specific T cells.

[0160] In some embodiments, the antigen-specific T cells are antigen-specific T cells directed against a pathogen causing an infection, wherein the infection is as described above.

[0161] In some embodiments, the T cells comprise exhausted T cells.

[0162] In some embodiments, the immune cells are from a subject. In some specific embodiments, the subject is a human or non-human animal.

[0163] In some embodiments, the subject has an infection. In some embodiments, the immune cells comprise antigen-specific immune cells against a pathogen causing the infection in a subject having an infection.

[0164] In some aspects of the present invention, provided is the use of modified T cells in preparing a product for preventing and / or treating infection, wherein the modified T cells are T cells treated with the reagent targeting the Ube2f gene, Cul5 gene or Rnf7 gene or their expression products as described above.

[0165] In some specific embodiments, an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, or an agent targeting the Rnf7 gene or its expression product reduces or eliminates the expression and / or function of the Ube2f gene, Cul5 gene, or Rnf7 gene in the modified T cells. Exemplarily, the modified T cells do not contain the Ube2f gene, Cul5 gene, or Rnf7 gene, or the biological function of the expression product of the Ube2f gene, the expression product of the Cul5 gene, or the expression product of the Rnf7 gene in the T cells is suppressed. In some embodiments, the expression or function of the Ube2f gene, Cul5 gene, or Rnf7 gene in modified T cells treated with an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, or an agent targeting the Rnf7 gene or its expression product is reduced by at least 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% compared to T cells that are not treated with an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, or an agent targeting the Rnf7 gene or its expression product (unmodified T cells).

[0166] (Handling method)

[0167] In the present invention, the method for treating immune cells with an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, or an agent targeting the Rnf7 gene or its expression product is not particularly limited. For example, the agent targeting the Ube2f gene or its expression product, the agent targeting the Cul5 gene or its expression product, and / or the agent targeting the Rnf7 gene or its expression product can be introduced into the immune cells. In some exemplary embodiments, treating immune cells with an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, or an agent targeting the Rnf7 gene or its expression product can be by introducing nucleotides carrying one or more components capable of expressing an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, or an agent targeting the Rnf7 gene or its expression product into the immune cells using techniques known to those skilled in the art.

[0168] In some embodiments, the vector used is a viral vector, a virus-like vector or a non-viral vector. In some embodiments, the recombinant vector comprising a polynucleotide encoding one or more components of a reagent targeting Ube2f gene or its expression product, a reagent targeting Cul5 gene or its expression product, or a reagent targeting Rnf7 gene or its expression product (e.g., components for reducing or eliminating the expression and / or function of Ube2f gene, Cul5 gene and Rnf7 gene in immune cells, such as sgRNA, Cas protein, etc.) is a viral vector. Suitable viral vectors include but are not limited to viral vectors based on the following: vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus and mammary tumor virus), etc. Suitable non-viral vectors are selected from transposons, lipid nanoparticles, liposomes, exosomes, attenuated bacteria or virus-like particles.

[0169] In some embodiments, the polynucleotide sequence encoding the reagent targeting Ube2f gene or its expression product, the reagent targeting Cul5 gene or its expression product, or the reagent targeting Rnf7 gene or its expression product is operably connected to a control element, such as a transcriptional control element, such as a promoter. Transcriptional control elements can be functional in eukaryotic cells (e.g., mammalian cells) or prokaryotic cells (e.g., bacteria or archaeal cells). In some embodiments, the polynucleotide sequence encoding the reagent targeting Ube2f gene or its expression product, the reagent targeting Cul5 gene or its expression product, or the reagent targeting Rnf7 gene or its expression product is operably connected to multiple control elements, which allow the polynucleotide to be expressed in both prokaryotic and eukaryotic cells. Depending on the cell type and gene regulation system used, any one of many suitable transcription and translation control elements (including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc.) can be used in expression vectors.

[0170] In some embodiments, non-limiting examples of suitable eukaryotic promoters (promoters that function in eukaryotic cells) include those from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTR) from retroviruses, and mouse metallothionein 1. The selection of suitable vectors and promoters is entirely within the capabilities of those of ordinary skill in the art. The expression vector may also include a ribosome binding site and a transcription terminator for translation initiation. The expression vector may also include appropriate sequences for amplifying expression. The expression vector may also include a nucleotide sequence encoding a protein tag (e.g., 6×His tag, hemagglutinin tag, green fluorescent protein, etc.) fused to the site-directed modified polypeptide to produce a chimeric polypeptide.

[0171] (Methods for obtaining and culturing immune cells).

[0172] In the present invention, there is no particular limitation on the method for obtaining immune cells. For example, peripheral blood mononuclear cells can be isolated from the peripheral blood of a subject, and immune cells of a specific phenotype can be isolated by, for example, magnetic bead sorting or flow cytometry sorting.

[0173] In some embodiments, in the present disclosure, there are no particular limitations on the method for culturing immune cells. In some embodiments, immune cells can be implanted into a subject for amplification, and recombinant immune cells after in vivo amplification can be obtained. Modified immune cells obtained after amplification from a first-generation subject can be used for autologous treatment of the subject or for allogeneic treatment of other subjects. In some embodiments, the immune cells are autologous immune cells or allogeneic immune cells for the subject. In some embodiments, the immune cells can also be amplified in vitro.

[0174] <Composition>

[0175] In other aspects, the present disclosure provides a composition. In some embodiments, a "composition" is a preparation comprising (a) a reagent targeting the Ube2f gene or its expression product as described above; (b) a reagent targeting the Cul5 gene or its expression product; (c) a reagent targeting the Rnf7 gene or its expression product; and (d) at least one of the modified immune cells described above, which can be administered or delivered to a subject or cell. The composition can (i) prevent and / or treat infection; (ii) enhance immune cell anti-infection ability; (iii) prevent and / or reverse immune cell exhaustion.

[0176] A "therapeutic composition" or "pharmaceutical composition" (used interchangeably herein) is a composition comprising at least one of (a) an agent targeting the Ube2f gene or its expression product as described above; (b) an agent targeting the Cul5 gene or its expression product; (c) an agent targeting the Rnf7 gene or its expression product; and (d) a modified immune cell as described above, which can be administered to a subject to treat an infection. In some optional embodiments, the composition for treating a disease further comprises a pharmaceutically acceptable carrier.

[0177] <Method>

[0178] In some embodiments, the present disclosure provides a method for treating an infection in a subject in need thereof, comprising administering to the subject an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, and / or an agent targeting the Rnf7 gene or its expression product, or administering to the subject a modified immune cell as described above, or administering to the subject a composition or pharmaceutical composition as described above.

[0179] In some embodiments, the present disclosure provides a method for enhancing the anti-infection ability of immune cells, comprising the step of treating immune cells with an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, and / or an agent targeting the Rnf7 gene or its expression product as described above.

[0180] In some embodiments, the present disclosure provides a method for preventing and / or reversing immune cell exhaustion, comprising the step of treating immune cells with an agent targeting the Ube2f gene or its expression product, an agent targeting the Cul5 gene or its expression product, and / or an agent targeting the Rnf7 gene or its expression product as described above.

[0181] Example

[0182] The embodiments of the present invention will be described in detail below with reference to the examples, but it will be understood by those skilled in the art that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the invention. Where specific conditions are not specified in the examples, the methods were performed according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be obtained commercially.

[0183] Example 1. Preparation of recombinant T cells with knockout of Ube2f, Cul5, and Rnf7

[0184] 1. Construction of gene knockout vector

[0185] In this example, retrovirus-based sgRNA expression vectors, namely pMSCV-sgUbe2f-Thy1.1, pMSCV-sgCul5-Thy1.1, pMSCV-sgRnf7-Thy1.1, pMSCV-sgControl-Thy1.1, and pMSCV-sgControl-GFP, were constructed.

[0186] Among them, the vector pMSCV-sgControl-Thy1.1 (SEQ ID NO: 1), in which positions 1686-1705 are a random sequence SEQ ID NO: 2 that does not target any gene, is used as a control without knocking out any gene and is called sgNon-targeting or sgControl;

[0187] Vector pMSCV-sgUbe2f-Thy1.1, which is obtained by replacing positions 1686-1705 of SEQ ID NO:1 with SEQ ID NO:3 while keeping the rest of the sequence unchanged. SEQ ID NO:3 is the target sequence recognition region of sgUbe2f for knocking out Ube2f;

[0188] Vector pMSCV-sgCul5-Thy1.1, which is obtained by replacing positions 1686-1705 of SEQ ID NO: 1 with SEQ ID NO: 4, while keeping the rest of the sequence unchanged. SEQ ID NO: 4 is the target sequence recognition region of sgCul5 for knocking out Cul5;

[0189] Vector pMSCV-sgRnf7-Thy1.1, wherein the sequence of this vector is obtained by replacing positions 1686-1705 of SEQ ID NO:1 with SEQ ID NO:5, while keeping the other sequences unchanged. SEQ ID NO:5 is the target sequence recognition region of sgRnf7 for knocking out Rnf7, and is used for knocking out Rnf7;

[0190] The vector pMSCV-sgControl-GFP is obtained by replacing the Th1.1 expression sequence at positions 2079-2615 of SEQ ID NO: 1 with the EGFP expression sequence (SEQ ID NO: 6).

[0191] All vectors were obtained by complete gene synthesis.

[0192] The sgRNAs used above are shown in Table 2 below:

[0193] Table 2 Target sequence recognition region of sgRNA

[0194] 2. Isolation and Activation of Initial P14 Cells

[0195] Cas9 was isolated by magnetic bead sorting + The initial CD8 + T cells were resuspended in 2 ml of RPMI1640 medium (containing 5% fetal bovine serum and interleukin-2) and activated in vitro by the addition of the peptide gp33-41 (Qiangyao Biotechnology, Cat#04010023714; a peptide consisting of 9 amino acid residues, which is the optimal sequence in the lymphocytic choriomeningitis virus GP1 antigenic determinant, sequence KAVYNFATC; SEQ ID NO: 7). The cells were cultured in a 5% carbon dioxide incubator at 37°C and infected with the virus after 24 hours of culture.

[0196] 3. Isolation and Activation of Initial OT1 Cells

[0197] Cas9 was isolated by magnetic bead sorting + Initial CD8 + T cells were resuspended in 2 ml of RPMI1640 medium (containing 5% fetal bovine serum and interleukin-2) and activated in vitro by the addition of the polypeptide OVA257-264 (strongly biosynthesized; a polypeptide consisting of 8 amino acid residues, which is a class 1 (Kb) restricted peptide epitope of ovalbumin (OVA), with the sequence SIINFEKL; SEQ ID NO: 8). The cells were cultured in a 5% carbon dioxide incubator at 37°C and infected with the virus after 24 hours of culture.

[0198] 4. Construction of P14 cells with Ube2f gene knockout

[0199] 1) Retrovirus preparation

[0200] 1×10 6After Phoenix-Eco cells (ATCC#CRL-3214) were cultured for 24 hours, 20 μg of the sgRNA expression vector pMSCV-sgUbe2f-Thy1.1 prepared in 1 above and 60 mg of the packaging plasmid pCL-Eco (purchased from Addgene#12371) were co-transfected using Chemifect eukaryotic cell transfection reagent (Beijing Fengrui Biotechnology). The supernatant containing the packaged virus was harvested 48 hours after transfection, and the viral supernatant was filtered with a 0.45 μm filter membrane to remove dead cell impurities to obtain the retroviral supernatant, i.e., the retrovirus with Ube2f knocked out.

[0201] 2) Retroviral infection

[0202] 1×10 6 CD8 + T cells were added with 1 ml of the retroviral supernatant obtained in step 1) and mixed, followed by horizontal centrifugation at 2000 × g for 2 hours at room temperature. The cells were then incubated in a CO2 incubator for 4 hours, replaced with 2 ml of fresh RPMI1640 medium (containing 5% fetal bovine serum and 2 ng / ml interleukin-2) and continued to be cultured (this time was recorded as the post-infection time). Thy1.1-positive cells (Thy1.1-biotin, BioLegend #202510) were sorted by flow cytometry to obtain Ube2f-knockout P14 cells (denoted as Thy1.1-sgUbe2f-P14).

[0203] 5. Construction of Cul5-knockout P14 cells

[0204] The only difference from "4. Construction of P14 cells with Ube2f knockout" is that the "sgRNA expression vector pMSCV-sgUbe2f-Thy1.1" is replaced with the "sgRNA expression vector pMSCV-Cul5-Thy1.1", and the other steps remain unchanged to obtain P14 cells with Cul5 knockout (expressed as Thy1.1-sgCul5-P14).

[0205] 6. Construction of Rnf7 knockout P14 cells

[0206] The only difference from "4. Construction of P14 cells with Ube2f gene knockout" is that the "sgRNA expression vector pMSCV-sgUbe2f-Thy1.1" is replaced with the "sgRNA expression vector pMSCV-sgRnf7-Thy1.1", and the other steps remain unchanged to obtain P14 cells with Rnf7 knockout (expressed as Thy1.1-sgRnf7-P14).

[0207] 7. Construction of sgControl-P14 cells without gene knockout

[0208] The only difference from "4. Construction of P14 cells with Ube2f gene knockout" is that the "sgRNA expression vector pMSCV-sgUbe2f-Thy1.1" is replaced with the "sgRNA expression vector pMSCV-sgControl-Thy1.1". The other steps remain unchanged, and P14 cells with no gene knockout (expressed as Thy1.1-sgControl-P14) are obtained.

[0209] The only difference from "4. Construction of P14 cells with Ube2f gene knockout" is that the "sgRNA expression vector pMSCV-sgUbe2f-Thy1.1" is replaced with the "sgRNA expression vector pMSCV-sgControl-GFP". The other steps remain unchanged, and P14 cells with no gene knockout (expressed as GFP-sgControl-P14) are obtained.

[0210] 8. Construction of OT1 cells with Ube2f gene knockout

[0211] The difference from "4. Construction of P14 cells with Ube2f knockout" is that "P14 cells" are replaced with "OT1 cells", and the other steps remain unchanged to obtain OT1 cells with Ube2f knockout (expressed as Thy1.1-sgUbe2f-OT1).

[0212] 9. Construction of sgControl-OT1 cells without gene knockout

[0213] The only difference from "8. Construction of Ube2f-knockout OT1 cells" is that the "sgRNA expression vector pMSCV-sgUbe2f-Thy1.1" is replaced with the "sgRNA expression vector pMSCV-sgControl-Thy1.1". The other steps remain unchanged, and OT1 cells with no gene knockout (expressed as Thy1.1-sgControl-OT1) are obtained.

[0214] Example 2. Virus infection and titration

[0215] Lymphocytic choriomeningitis virus (LCMV) strains Armstrong and LCMV clone 13 each induced acute and chronic infection. LCMV was expressed in BHK21[C13] cells. The cells were propagated and titrated by plaque assay on VERO cells. LCMV clone 13 (2 × 10 6 Mice were intravenously infected with LCMV Armstrong (2×10 6Mice were infected by intraperitoneal injection of 100 PFU (1000 PFU). LCMV-infected mice were maintained according to the institutional biosafety regulations of Tsinghua University. LCMV viral loads in serum, organ, and tissue samples were quantified by qPCR.

[0216] Example 3: Infection with Listeria expressing the ovalbumin 257-264 peptide segment

[0217] Listeria monocytogenes expressing the 257-264 peptide fragment of ovalbumin, hereinafter referred to as LM-OVA. LM-OVA was propagated in brain heart infusion medium supplemented with erythromycin. 5 Mice were intravenously infected with 100 PFU of LM-OVA. Mice infected with LM-OVA were maintained according to the institutional biosafety regulations of Tsinghua University. LM-OVA bacterial loads in serum, organ, and tissue samples were quantified by qPCR.

[0218] Example 4: Knockout of Cul5, Rnf7, and Ube2f enhances CD8 + T cell expansion capacity and persistence

[0219] The cell reinfusion process is shown in Figure 1A: + CD8 cells were isolated from spleen and lymph nodes of P14 transgenic mice + T cells were activated with peptide gp33-41 for 24 hours to obtain activated CD8 + T cells (the method is the same as that of Example 1, step 2); then, the retrovirus obtained by transfection with pMSCV-sgControl-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgCul5-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgRnf7-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgUbe2f-Thy1.1, and the retrovirus obtained by transfection with pMSCV-sgControl-GFP were used to infect activated CD8 + The obtained recombinant cells were named Thy1.1-sgControl-P14, Thy1.1-sgCul5-P14, Thy1.1-sgRnf7-P14, Thy1.1-sgUbe2f-P14 and GFP-sgControl-P14 cells (the method was the same as 4-7 of Example 1). The above cells obtained after infection for 24 hours were respectively infused into C57bl / B6 mice (hereinafter referred to as B6 mice) through the tail vein. The specific infusion method is as follows:

[0220] 6-8 week old B6 mice weighing 20-25 g were divided into 4 groups, namely, sgControl group (4 mice), sgCul5 group (4 mice), sgRnf7 group (4 mice) and sgUbe2f group (4 mice).

[0221] Mice were infected with LCMV clone 13 (the method was the same as in Example 2). On the second day of infection, the mice were divided into the following groups and re-transfused with P14 cells.

[0222] sgControl (control) group: 10 5 The prepared Thy1.1-sgControl-P14 cells and GFP-sgControl-P14 cells were prepared into a cell suspension with PBS, mixed at a ratio of 1:1, and then reinfused into each mouse in the sgControl group through the tail vein;

[0223] sgCul5 group: 10 5 The prepared Thy1.1-sgCul5-P14 cells and GFP-sgControl-P14 cells were prepared into a cell suspension with PBS, mixed at a ratio of 1:1, and then reinfused into each mouse in the sgCul5 group through the tail vein;

[0224] sgRnf7 group: 10 5 The prepared Thy1.1-sgRnf7-P14 cells and GFP-sgControl-P14 cells were prepared into a cell suspension with PBS, mixed at a ratio of 1:1, and then reinfused into each mouse in the sgRnf7 group through the tail vein;

[0225] sgUbe2f group: 10 5 The prepared Thy1.1-sgUbe2f-P14 cells and GFP-sgControl-P14 cells were prepared into a cell suspension with PBS, mixed in a 1:1 ratio, and then reinfused into each mouse in the sgUbe2f group through the tail vein.

[0226] On the 7th, 14th, 28th and 56th day after LCMV clone 13 infection, Thy1.1 antibody (the knockout vector carries a Thy1.1 screening tag) and GFP fluorescence flow cytometry were used to analyze the percentage of non-knockout gene Thy1.1-sgControl-P14 cells, Cul5 knockout Thy1.1-sgCul5-P14 cells, Rnf7 knockout Thy1.1-sgRnf7-P14 cells and Ube2f knockout Thy1.1-sgUbe2f-P14 cells in the peripheral blood of each mouse. + The proportion of T cells, i.e., the proliferation and persistence of infused P14 cells were monitored in peripheral blood.

[0227] The results are shown in Figure 1B and Figure 1C. During chronic infection with LCMV clone 13, Thy1.1 in the control group decreased significantly on day 7 after infection. + Compared with the control P14 cells, Cul5 deficiency, Rnf7 deficiency and Ube2f deficiency enhanced the proliferation of P14 cells in the blood; subsequently, on the 14th and 28th days after infection, the P14 cells in the sgControl (control) group gradually decreased and entered the contraction period, while Cul5 deficiency, Rnf7 deficiency and Ube2f deficiency weakened the reduction of P14 cells in the contraction period; 56 days after infection, the P14 cells with Cul5 deficiency, Rnf7 deficiency and Ube2f deficiency increased significantly compared with the P14 cells in the control group, indicating that Cul5 deficiency, Rnf7 deficiency and Ube2f deficiency enhanced the formation of memory P14 cells. At the same time, as shown in Figure 1B, in the control group, the ratio of GFP-sgControl-P14 cells to Thy1.1-sgControl-P14 cells in the same mouse was close to 1:1 on the 7th, 14th, 28th, and 56th days after chronic infection with LCMV clone 13; in the sgCul5, sgRnf7, and sgUbe2f groups, although the change trend of the ratio of GFP-sgControl-P14 cells was similar to that of GFP-sgControl-P14 in the control group, the ratio of GFP-sgControl-P14 cells to Thy1.1 ... The proportion of cells showed a similar trend: GFP-sgControl-P14 cells began to enter a contraction phase and gradually decreased after 14 days post-infection. However, the proportion of P14 cells lacking Cul5, Rnf7, and Ube2f in the same mouse was significantly higher than that of the control sgControl-P14 cells on day 7. From day 14 to day 56, the contraction rate of P14 cells lacking Cul5, Rnf7, and Ube2f was significantly slower than that of the control sgControl-P14 cells in the same mouse. By day 56, the proportion of P14 cells lacking Cul5, Rnf7, and Ube2f was 5-6 times that of the control sgControl-P14 cells in the same host. This result further indicates that the deficiency of Cul5, Rnf7, and Ube2f enhances the expansion and persistence of CD8+ T cells during chronic infection with LCMV clone 13 virus.

[0228] The results were shown in Figure 1D . On the 30th day after LCMV clone 13 infection, the viral load in the spleen of mice in the sgUbe2f group was significantly reduced compared with that in the control group.

[0229] These data indicate that knockout of Cul5, Rnf7, and Ube2f during chronic LCMV clone 13 infection significantly promotes CD8 + T lymphocytes form memory cells.

[0230] Example 5: In acute infection induced by LCMV-Armstrong, knockout of Cul5, Rnf7, and Ube2f significantly promoted CD8 + T lymphocytes form memory cells

[0231] The cell reinfusion process is shown in Figure 2A: + CD8 cells were isolated from spleen and lymph nodes of P14 transgenic mice + T cells were activated with peptide gp33-41 for 24 hours to obtain activated CD8 + T cells (the method is the same as that of Example 1, step 2); then, the retrovirus obtained by transfection with pMSCV-sgControl-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgCul5-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgRnf7-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgUbe2f-Thy1.1, and the retrovirus obtained by transfection with pMSCV-sgControl-GFP were used to infect activated CD8 + The obtained recombinant cells were named Thy1.1-sgControl-P14, Thy1.1-sgCul5-P14, Thy1.1-sgRnf7-P14, Thy1.1-sgUbe2f-P14 and GFP-sgControl-P14 cells (the method was the same as 4-7 of Example 1). The above cells obtained after infection for 24 hours were respectively infused into the tail vein of B6 mice. The specific infusion method is as follows:

[0232] 6-8 week old B6 mice weighing 20-25 g were divided into 4 groups, namely, sgControl group (5 mice), sgCul5 group (4 mice), sgRnf7 group (4 mice) and sgUbe2f group (4 mice).

[0233] sgControl (control) group: 10 5 The prepared Thy1.1-sgControl-P14 cells and GFP-sgControl-P14 cells were prepared into a cell suspension with PBS, mixed at a ratio of 1:1, and then reinfused into each mouse in the sgControl group through the tail vein;

[0234] sgCul5 group: 10 5 The prepared Thy1.1-sgCul5-P14 cells and GFP-sgControl-P14 cells were prepared into a cell suspension with PBS, mixed at a ratio of 1:1, and then reinfused into each mouse in the sgCul5 group through the tail vein;

[0235] sgRnf7 group: 105 The prepared Thy1.1-sgRnf7-P14 cells and GFP-sgControl-P14 cells were prepared into a cell suspension with PBS, mixed at a ratio of 1:1, and then reinfused into each mouse in the sgRnf7 group through the tail vein;

[0236] sgUbe2f group: 10 5 The prepared Thy1.1-sgUbe2f-P14 cells and GFP-sgControl-P14 cells were prepared into a cell suspension with PBS, mixed in a 1:1 ratio, and then reinfused into each mouse in the sgUbe2f group through the tail vein.

[0237] On the 7th, 14th, 28th and 35th day after LCMV-Armstrong infection, Thy1.1 antibody (the knockout vector carries a Thy1.1 screening tag) and GFP fluorescence flow cytometry were used to analyze the percentage of non-knockout gene Thy1.1-sgControl-P14 cells, Cul5 knockout Thy1.1-sgCul5-P14 cells, Rnf7 knockout Thy1.1-sgRnf7-P14 cells and Ube2f knockout Thy1.1-sgUbe2f-P14 cells in the peripheral blood of each mouse. + The proportion of T cells, i.e., proliferation, contraction, and persistence of infused P14 cells were monitored in the blood and spleen.

[0238] The results are shown in Figure 2B and Figure 2C. During acute infection with LCMV-Armstrong, on day 7 after infection, Thy1.1 in the control group +Compared with the control P14 cells, Cul5 deficiency, Rnf7 deficiency and Ube2f deficiency enhanced the proliferation of P14 cells in the blood; subsequently, on the 14th and 28th days after infection, the P14 cells in the sgControl (control) group gradually decreased and entered the contraction period, and Cul5 deficiency, Rnf7 deficiency and Ube2f deficiency weakened the reduction of P14 cells in the contraction period; 35 days after infection, the P14 cells with Cul5 deficiency, Rnf7 deficiency and Ube2f deficiency increased significantly compared with the P14 cells in the control group, indicating that they enhanced the formation of memory P14 cells. At the same time, as shown in Figure 2B, the change trend of the proportion of GFP-sgControl-P14 cells in the sgCul5, sgRnf7, and sgUbe2f groups was similar to that of the GFP-sgControl-P14 cells in the control group. That is, from day 14 to day 35 after infection, GFP-sgControl-P14 cells began to enter the contraction phase and gradually decreased. In the same mouse, the proportion of P14 cells with Cul5 deficiency, Rnf7 deficiency, and Ube2f deficiency was significantly higher than that of the control sgControl-P14 cells on day 7. From day 14 to day 35, the contraction rate of P14 cells with Cul5 deficiency, Rnf7 deficiency, and Ube2f deficiency was significantly lower than that of the control sgControl-P14 cells in the same mouse. By day 35, the proportion of P14 cells with Cul5 deficiency, Rnf7 deficiency, and Ube2f deficiency was 10-20 times that of the control sgControl-P14 cells in the same host. This result further illustrates that Cul5 deficiency, Rnf7 deficiency, and Ube2f deficiency enhance the expansion and persistence of CD8+ T cells during acute LCMV-Armstrong infection.

[0239] The results are shown in Figure 2D and Figure 2E. 35 days after LCMV-Armstrong infection, Thy1.1 in the spleen of mice was significantly increased compared with that in the control group. + Compared with the control P14 cells, the proportion and number of P14 cells with Cul5 deficiency, Rnf7 deficiency and Ube2f deficiency were significantly increased. These data indicate that knockout of Cul5, Rnf7 and Ube2f during acute infection with LCMV-Armstrong virus significantly promotes CD8 + T lymphocytes form memory cells.

[0240] Example 6: In LM-OVA-induced acute infection, knockout of Ube2f significantly promoted CD8 + T lymphocytes form memory cells

[0241] From Cas9 + Isolation of CD8 T cells from spleen and lymph nodes of OT1 transgenic mice+ T cells were activated with peptide OVA257-264 for 24 hours to obtain activated CD8 + T cells (the same method as in Example 1, step 3); then the retrovirus obtained by transfection with pMSCV-sgControl-Thy1.1 and the retrovirus obtained by transfection with pMSCV-sgUbe2f-Thy1.1 were used to infect activated CD8 + The recombinant cells were named Thy1.1-sgControl-OT1 and Thy1.1-sgUbe2f-OT1 (the method was the same as 8-9 in Example 1). The cells obtained after 24 hours of infection were infused into the tail vein of B6 mice. The specific infusion method was as follows:

[0242] 6-8 week old B6 mice weighing 20-25 g were divided into 4 groups, ie, a control (sgControl) group (5 mice) and a sgUbe2f group (4 mice).

[0243] Control (sgControl) group: 10 5 The prepared Thy1.1-sgControl-OT1 cells were prepared into a cell suspension with PBS and reinfused into each mouse in the sgControl group via the tail vein;

[0244] sgUbe2f group: 10 5 The prepared Thy1.1-sgUbe2f-OT1 cells were prepared into a cell suspension with PBS and reinfused into each mouse in the sgUbe2f group through the tail vein.

[0245] On the 45th day after LM-OVA infection, the percentage of Thy1.1-sgControl-OT1 cells and Ube2f-knockout Thy1.1-sgUbe2f-OT1 cells in the spleen of each mouse was analyzed by flow cytometry. + The results are shown in Figure 3A and Figure 3B. Compared with the control OT-1 cells, the proportion of Ube2f-deficient OT-1 cells in the spleen was CD8 + The proportion and number of T cells increased significantly. This result proves that knockout of Ube2f significantly promoted the proliferation of CD8 T cells in acute infection induced by LM-OVA. + T lymphocytes form memory cells.

[0246] Nucleotide sequence of vector pMSCV-sgControl-Thy1.1 (SEQ ID NO: 1):

[0247] Among them, the single underline part is sgControl; the double underline part is Thy1.1.

[0248] Nucleotide sequence encoding EGFP (SEQ ID NO: 6)

Claims

1. Use of a reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene, or its expression product, for any of the following: (i) Use in the preparation of a product for preventing and / or treating infection; (ii) Use in the preparation of a product for enhancing the anti-infection ability of immune cells; (iii) Use in the preparation of a product for preventing and / or reversing immune cell exhaustion.

2. Use according to claim 1, wherein, The infection includes at least one of bacterial infection, viral infection, fungal infection, protozoan infection, and parasitic infection.

3. Use according to claim 1 or 2, wherein, The prevention and / or treatment of infection includes preventing and / or treating infectious diseases and / or diseases and / or symptoms related to infection, and / or enhancing the anti-infection ability of a subject; Optionally, the disease and / or symptom related to infection is one or more selected from the group consisting of: pathological damage caused by infection; immune cell exhaustion after infection, including reduced proliferation ability, weakened killing ability, and reduced cytokine secretion of immune cells; endotoxin shock or death; inflammatory damage to organs; multiple organ failure; acute and / or chronic inflammatory diseases caused by infection; Optionally, enhancing the anti-infection ability of a subject includes enhancing the anti-infection ability of immune cells in the subject, and / or preventing and / or reversing immune cell exhaustion in the subject.

4. Use according to any one of claims 1 to 3, wherein, The immune cells include at least one of T cells, NKT cells, NK cells, innate lymphoid cells (ILC), and chimeric antigen receptor NK cells (CAR-NK cells); Optionally, the T cells include naïve T cells, αβ T cells, γδ T cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric antigen receptor T cells (CAR-T cells), T cell receptor T cells (TCR-T cells), and antigen-specific T cells, at least one of which; Optionally, the T cells include activated T cells; Optionally, the T cells include antigen-specific T cells, preferably, the antigen-specific T cells are antigen-specific T cells against the pathogen causing the infection; Optionally, the T cells comprise CD8 + T cells; Optionally, the T cells include exhausted T cells.

5. Use according to any one of claims 1 to 4, wherein The immune cells are immune cells from a subject; and / or, the infection is an infection in the subject; Optionally, the subject is a human or non-human animal.

6. Use according to any one of claims 1 to 5, wherein, The reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene, or its expression product, includes at least one of nucleic acids, polypeptides, ribonucleoprotein complexes, and small molecule inhibitors; Optionally, the nucleic acids include at least one of antisense RNA molecules and RNA interference molecules; Optionally, the polypeptides include at least one of antibodies or their antigen-binding fragments, artificial zinc finger nucleases, and TALEN systems; Optionally, the ribonucleoprotein complex includes the CRISPR / cas system.

7. Use according to any one of claims 1 to 6, wherein The reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene, or its expression product, includes a reagent used in any one of gene knockout technology, gene silencing technology, inactivating mutation technology, and PROTAC technology.

8. The use according to any one of claims 1 to 7, characterized in that, The product is a pharmaceutical composition, kit, reagent, or test kit.

9. A modified immune cell, wherein, The modified immune cells are immune cells treated with a reagent targeting the Ube2f gene, Cul5 gene, or Rnf7 gene, or its expression product; Optionally, the immune cells include at least one of T cells, NKT cells, NK cells, innate lymphoid cells (ILC), and chimeric antigen receptor NK cells (CAR-NK cells); Optionally, the T cells include at least one of naive T cells, αβ T cells, γδ T cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric antigen receptor T cells (CAR-T cells), T cell receptor T cells (TCR-T cells), and antigen-specific T cells; Optionally, the T cells comprise activated T cells; Optionally, the T cells comprise antigen-specific T cells; Optionally, the T cells comprise CD8 + T cells; Optionally, the T cells comprise exhausted T cells.

10. The modified immune cell according to claim 9, wherein, The antigen-specific T cells are antigen-specific T cells against the pathogen causing the infection; Optionally, the infection includes at least one of bacterial infection, viral infection, fungal infection, protozoal infection, and parasitic infection; Optionally, the infection is an infection in a subject.

11. Use of the modified immune cell according to claim 9 or 10 in the preparation of a product for preventing and / or treating an infection.

12. A composition comprising at least one selected from the following (a) to (d): (a) A reagent targeting the Ube2 gene or its expression product; (b) A reagent targeting the Cul5 gene or its expression product; (c) A reagent targeting the Rnf7 gene or its expression product; and (d) The modified immune cell according to claim 9 or 10; Optionally, the composition is a pharmaceutical composition, and the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

Images