Adenine deaminase, base editor fusion protein and base editor system containing same, and use thereof
By transforming adenine deaminase, a new adenine base editor was obtained, which solved the problem of large and high INDEL events in the existing technology, and achieved a more efficient and safer gene editing effect, which was suitable for precision medicine and animal disease model production.
Patent Information
- Application Number
- PCT/CN2025/071821
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-10
- Filing Date
- 2025-01-10
- Publication Date
- 2025-07-17
AI Technical Summary
The existing adenine base editor has a large editing window and a high probability of INDEL events, making it difficult to meet the needs of precision medicine and diversified indications.
A novel adenine deaminase is provided, whose amino acid sequence has lower consistency with the existing sequence, and an adenine base editor with a narrower editing window and higher editing efficiency is obtained, combining Cas9 nuclease and SgRNA for targeted editing.
The editing window of the adenine base editor is narrowed, the editing efficiency is maintained, and the probability of INDEL events is significantly reduced, which improves the diversity of safety and indications.
Smart Images

Figure PCTCN2025071821-FTAPPB-I100001 
Figure PCTCN2025071821-FTAPPB-I100002 
Figure PCTCN2025071821-FTAPPB-I100003
Abstract
Description
Adenine deaminase, base editor fusion protein containing the same, base editor system and application thereof Technical Field
[0001] The present invention belongs to the field of gene editing, and specifically relates to an adenine deaminase, an adenine base editor fusion protein containing the same, a base editor system, and applications thereof. Background Art
[0002] Targeted editing of nucleic acid sequences, such as targeted cleavage or editing of genomic DNA, is a promising approach for studying gene function and may also provide new treatments for human genetic diseases.
[0003] Currently, approximately 60% of known human genetic diseases are caused by single-base mutations. Of the 32,000 known pathogenic single-base mutations, the largest proportion, approximately 48%, is G / C to A / T mutations. Currently available adenine base editors that convert A / T to G / C in genomic DNA all contain the TadA protein as their core component.
[0004] By fusing TadA (adenine deaminase) from Escherichia coli with Cas9, with the assistance of directed evolution and protein engineering transformation technology, multiple rounds of evolution were finally obtained to obtain adenine base editors (adenine base editors) ABE series that can act on DNA (for example, ABE7.10 (Gaudelli NM, et al. Programmable base editing of A·T to G·C in genomic DNA without DNA cleavage. Nature, 2017), ABE8.20 (Gaudelli NM, et al. Directed evolution of adenine base editors with increased activity and therapeutic application. Nat Biotechnol, 2020, CN 114072496 A), ABE8e (Richter MF, et al. Phage assisted evolution of an adenine base editor with improved cas domain compatibility and activity. Nat Biotechnol, 2020), and other mutants generated by introducing one or two amino acid mutations on the basis of ABE8e (CN 115772512 A). The amino acid sequences of these TadA mutants are highly identical, with the largest difference compared to wild-type TadA containing only 14 amino acid positions.
[0005] This field still needs to explore a larger protein space to obtain base editors with higher editing efficiency and specificity, as well as different editing window preferences, and enrich the types of base editors to better meet the application of more indication scenarios. Summary of the Invention Technical issues
[0006] The technical problem to be solved by the present invention is to provide a new type of adenine deaminase that is accurate and efficient and has a small editing window, an adenine base editor containing the same, and its application. The adenine base editor of the present invention can narrow the main editing window, maintain a high editing efficiency, and has a low probability of indel events, thus having high safety.
[0007] Technical Solution
[0008] In one aspect, the present invention provides an adenine deaminase comprising one or more of the following sequences:
[0009] (a) the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3;
[0010] (b) an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3, and which retains the deamination activity of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3;
[0011] (c) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3, and which retains the deamination activity of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3; or
[0012] (d) an amino acid sequence encoded by a nucleotide sequence that hybridizes to a polynucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 under stringent conditions, and the amino acid sequence retains the deamination activity of the amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3, wherein the stringent conditions are moderately stringent conditions, medium-high stringent conditions, high stringent conditions or very high stringent conditions.
[0013] In the present invention, the expression "retains deamination activity," for example, "retains the deamination activity of the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3," can refer to completely retaining the deamination activity of an adenine deaminase with the original sequence, or partially retaining the deamination activity of an adenosine deaminase with the original sequence, for example, retaining 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the deamination activity. In other embodiments, the adenine deaminase with the modified sequence may also have a higher deamination activity than the adenosine deaminase with the original sequence.
[0014] As used herein, "moderately stringent conditions," "moderate-high stringency conditions," "high stringency conditions," or "very high stringency conditions" describe conditions for nucleic acid hybridization and washing. Guidance for conducting hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6, which is incorporated herein by reference.
[0015] In some embodiments, the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1 is shown in SEQ ID NO: 4, the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2 is shown in SEQ ID NO: 5, and the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 3 is shown in SEQ ID NO: 6.
[0016] In some embodiments, the adenine deaminase can comprise an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3. In some embodiments, the adenine deaminase can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more mutations compared to the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3. In some embodiments, the adenine deaminase may comprise at least 5, at least 10, at least 15, at least 20, at least 30, at least 40, or at least 50 identical consecutive amino acid residues compared to the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. The above amino acid sequence may have the same or similar function or biological activity as the adenine deaminase.
[0017] The adenine deaminase provided by the present invention can act on any polynucleotide, including DNA, RNA and DNA-RNA hybrids. In some embodiments, the adenine deaminase can deaminate the target adenine (A) of a polynucleotide comprising DNA. In some embodiments, the adenosine deaminase can deaminate the target adenine (A) of a polynucleotide comprising RNA.
[0018] In another aspect, the present invention provides an adenine base editor fusion protein comprising a nuclease and at least one adenine deaminase of the present invention.
[0019] In some embodiments, the adenine base editor fusion protein may further comprise a nuclear localization signal sequence. The nuclear localization signal sequence may be one conventionally used in the art, for example, a nuclear localization signal sequence as shown in SEQ ID NO: 7.
[0020] In some embodiments, the nuclear localization signal sequence can be located at the N-terminus, C-terminus, or both ends of the base editor, or between the adenine deaminase and the nuclease. In some embodiments, the nuclear localization signal sequence can be directly fused to the base editor or fused to the base editor via a linker.
[0021] In some embodiments, the nuclease may be a Cas protein and its variants, as well as proteins such as TnpB.
[0022] In some embodiments, the Cas protein may be a Cas9 protein, a Cas12a protein, for example, spCas9 from Saccharomyces cerevisiae, SaCas9 from Staphylococcus aureus, LbCas12a from Lachnospiraceae bacteria, or enAsCas12a from Acidamicoccus bacteria; the Cas protein variant may be VQRspCas9, VRERspCas9, spRY, spNG, SaCas9KKH or SaCas9NG.
[0023] In some embodiments, the Cas9 protein, i.e., the Cas9 nuclease, has a partially inactivated DNA cleavage domain, i.e., Cas9 is a nickase, referred to as a "nCas9" protein. Nuclease-inactivated Cas9 proteins are interchangeably referred to as "dCas9" proteins. Methods for generating Cas9 proteins (or fragments thereof) with inactive DNA cleavage domains are known (see, e.g., Jinek et al., Science. 337:816821 (2012); Qi et al., "Repurposing CRISPR as an RNA Guided Platform for Sequence Specific Control of Genes"). Expression" (2013) Cell. 28; 152(5): 117383, the entire contents of which are incorporated herein by reference). For example, it is known that the DNA cleavage domain of Cas9 includes two subdomains, the HNH nuclease subdomain and the RuvC1 subdomain. The HNH subdomain cuts the strand complementary to the gRNA, while the RuvC1 subdomain cuts the non-complementary strand. Mutations within these subdomains can silence the nuclease activity of Cas9. For example, mutations D10A and H840A completely inactivate the nuclease activity of Streptococcus pyogenes Cas9 (Jinek et al., Science. 337: 816821 (2012); Qi et al., Cell. 28; 152(5): 1173-83 (2013)).
[0024] In some embodiments, the nucleotide sequence encoding the adenine base editor fusion protein may sequentially comprise a promoter-adenine deaminase-nuclease-polyadenylation signal (polyA), as long as it can provide an A>G editing efficiency similar to or not lower than that of ABE8.20; wherein, the promoter and the polyA may be those conventionally used in the art.
[0025] In some embodiments, the promoter may be CMV, or other types of broad-spectrum promoters and tissue-specific promoters, such as CAG, PGK, EF1ɑ; muscle-specific promoter Ctsk; liver-specific promoter Lp1, etc.
[0026] In some embodiments, the polyA may be bovine growth hormone polyadenylation signal BGH polyA, or a polyadenylation signal from another biological source.
[0027] In another aspect, the present invention provides a polynucleotide encoding the aforementioned adenine deaminase or the aforementioned adenine abase editor fusion protein.
[0028] In another aspect, the present invention provides a vector comprising the aforementioned polynucleotide.
[0029] In some embodiments, the vector is a mammalian expression vector. In some embodiments, the expression vector can be one or more selected from adeno-associated virus, retroviral vector, adenoviral vector, lentiviral vector, Sendai virus vector and herpes virus vector.
[0030] In another aspect, the present invention provides a cell comprising one or more selected from the group consisting of the aforementioned adenine deaminase, the aforementioned adenine abase editor fusion protein, the aforementioned polynucleotide, and the aforementioned vector.
[0031] In some embodiments, the cell is a prokaryotic cell, a eukaryotic cell, for example, a bacterial cell, a plant cell, an insect cell, a human cell, or a mammalian cell.
[0032] In another aspect, the present invention provides an adenine base editing system, comprising:
[0033] the aforementioned adenine deaminase; a nuclease; and an sgRNA, or
[0034] The aforementioned adenine base editor fusion protein; and sgRNA.
[0035] The description about nuclease is the same as above.
[0036] SgRNA is used to accurately identify target gene sequences. Based on existing technologies, those skilled in the art can design reasonable and effective sgRNAs by analyzing target gene information and selecting target regions. The design of sgRNA is not the novelty of the present invention and is therefore not described in detail to avoid obscuring the subject matter of the present invention.
[0037] In some embodiments, the sgRNA sequence is selected from the following sequences:
[0038] On the other hand, the present invention provides a pharmaceutical composition comprising one or more selected from the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell and the aforementioned adenine base editor system, and a pharmaceutically acceptable carrier.
[0039] In some embodiments, the pharmaceutically acceptable carrier can be a delivery carrier, such as a lipid, a cationic lipid, or other polymers with drug delivery function.
[0040] On the other hand, the present invention provides a kit comprising one or more selected from the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell, and the aforementioned adenine base editor system.
[0041] In another aspect, the present invention provides a delivery system comprising one or more selected from the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell, and the aforementioned adenine base editor system; and a delivery medium.
[0042] In some embodiments, the delivery medium can be nanoparticles, liposomes, exosomes, microvesicles, or cell-penetrating peptides.
[0043] In another aspect, the present invention provides a base editing method comprising the following steps:
[0044] The aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein or the aforementioned adenine base editing system is expressed in the target cells, and under the guidance of SgRNA, the target cells undergo gene editing.
[0045] In some embodiments, the target cells may refer to cells cultured in vitro or in vivo, examples of which include but are not limited to HEK293T cells, embryonic stem cells, T cells, and the like.
[0046] In another aspect, the present invention provides the use of the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell and the aforementioned adenine base editor system, the aforementioned pharmaceutical composition, the aforementioned kit or the aforementioned delivery system in the preparation of base editing drugs or tools.
[0047] On the other hand, the present invention provides the use of the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell and the aforementioned adenine base editor system, the aforementioned pharmaceutical composition, the aforementioned kit or the aforementioned delivery system in the preparation of gene therapy drugs.
[0048] In another aspect, the present invention provides the use of the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell and the aforementioned adenine base editor system, the aforementioned pharmaceutical composition, the aforementioned kit or the aforementioned delivery system in constructing animal models and crop breeding. Beneficial effects
[0049] The amino acid sequence of the adenine deaminase of the present invention has a low sequence identity with the amino acid sequence of the existing adenine deaminase, which greatly expands the sequence diversity space of adenine deaminase and enriches the adenine base editor toolbox. The adenine base editor of the present invention can effectively narrow the editing window while maintaining high editing activity; and maintain a very low INDEL ratio, which improves safety and can promote its application in precision medicine, animal disease model preparation, crop genetic breeding, etc., and has great application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0050] Figure 1 is the plasmid map of ABE8.20-m.
[0051] Figure 2 is a plasmid map of pFYF1548.
[0052] Figure 3 is a comparison of the A>G base editing results achieved by various base editors at the endogenous target site 2 in HEK293T cells.
[0053] Figure 4 is a comparison of the A>G base editing results achieved by various base editors at the endogenous target site 4 in HEK293T cells.
[0054] Figure 5 is a comparison of the A>G base editing results achieved by various base editors at the endogenous target site 8 in HEK293T cells.
[0055] Figure 6 shows the results of ABE10.3 base editor achieving A>G base editing at the endogenous target site 2 in HEK293T cells. DETAILED DESCRIPTION
[0056] The present invention is further illustrated by way of examples below, but the present invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.
[0057] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0058] ABE8.20-m plasmid was purchased from Addgene (Plasmid #136300), and its plasmid map is shown in Figure 1.
[0059] The pFYF1548 plasmid was purchased from Addgene (Plasmid #47508), and its plasmid map is shown in Figure 2.
[0060] The pUC-GW-Amp plasmid was purchased from Anshengda.
[0061] The linearized primers used in the examples are shown in Table 1.
[0062] Table 1 ABE8.20-m linearized primers
[0063] The sgRNA sequences used in the examples are shown in Table 2.
[0064] Table 2 SgRNA sequences
[0065] The target identification primers used in the examples are shown in Table 3.
[0066] Table 3. Primers for fragment amplification corresponding to sgRNA
[0067] Example 1
[0068] The TadA sequence in ABE8.20-m (hereinafter abbreviated as ABE8) was replaced with the new TadA sequence designed by the present invention (SEQ ID NO: 4 and SEQ ID NO: 5 sequences, synthesized by Anshengda Company) to obtain new base editors, which were respectively recorded as ABE10.1 and ABE10.2.
[0069] This embodiment is designed to compare the editing characteristics of ABE8 with those of ABE10.1 and ABE10.2.
[0070] 1.1 ABE10.1 and ABE10.2 plasmid design and construction
[0071] 1) Preparation of insert fragments for homologous recombination
[0072] The pUC-GW-Amp plasmid containing the predesigned fragment (SEQ ID NO: 4 or SEQ ID NO: 5) was synthesized by Ascenta. The predesigned fragments (SEQ ID NO: 4 and SEQ ID NO: 5) were PCR amplified from the universal gene synthesis vector pUC-GW-Amp using the Novozymes Phanta Max Super-Fidelity DNA Polymerase Kit. Homology arms were also added for subsequent homologous recombination with the vector. The sequences of the homology arms were: forward 5'-3'atacgactcactatagggagagccgccacc (SEQ ID NO: 19), and reverse 5'-3'tgccgctagaaccaccagaagaaccaccaga (SEQ ID NO: 20).
[0073] The obtained PCR fragment was subjected to DNA electrophoresis, and the target fragment of about 500 bp was cut out. Then, the target fragment was recovered and purified by gel recovery using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 to obtain the insert fragment for homologous recombination.
[0074] 2) Preparation of linearized base editing vector
[0075] The ABE8.20-m vector (Figure 1) was linearized by inverse PCR to expose the ends of the homology arms. DNA electrophoresis was then performed, and the target fragment was excised and purified by gel recovery to obtain the vector fragment for homologous recombination.
[0076] 3) Integration
[0077] The insert and vector fragments were homologously recombined using NEBbuilder HiFi DNA Assembly Master Mix, with a molar ratio of 1:10. The integration product was then transformed into competent cells using the fully gold chemically competent cells trans-5α. The next day, 5-10 monoclonal strains were selected for Sanger sequencing. Finally, clones that fully matched the designed sequence were selected for amplification, and base editor plasmid DNA (i.e., ABE10.1 and ABE10.2 plasmids) was extracted for subsequent experiments.
[0078] 1.2 Construction of sgRNA expression vector (sgRNA plasmid)
[0079] Plasmid pFYF1548 was selected as the sgRNA expression backbone, and the original sgRNA was replaced with the target sgRNA. Downstream primer: GGTGTTTCGTCCTTTCCACAAG (SEQ ID NO: 21). Upstream primer: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC (SEQ ID NO: 22) added to the 3' end of the sgRNA sequence corresponding to Site2-sense. The primers were 5' phosphorylated using T4 PNK enzyme. Circular PCR was performed using the phosphorylated primers. To increase the number of positive clones, the PCR product was treated with Dpn I enzyme, and the template plasmid was fragmented. After purification using a PCR clean-up kit, ligation was performed using T4 ligase. The ligation product was transformed into trans5 competent Escherichia coli cells, plated, single colonies were selected, shaken, and plasmid DNA was extracted and confirmed by Sanger sequencing. SgRNA plasmid DNA that had been sequenced and aligned correctly was used for subsequent experiments.
[0080] 1.3 Cell transfection
[0081] ABE8.20-m, ABE10.1, and ABE10.2 plasmids were used as base editor plasmids, respectively, and the above-mentioned sgRNA plasmids were used for cell transfection.
[0082] Day 1: HEK293T cells in good condition were seeded into 12-well plates, with 7x10 cells per well. 4 cells, ensuring that the cell confluence is 40% on the next day of the experiment
[0083] Day 2: Use lipo2000 reagent for transfection. For cells in one well, the amount of transfection reagent is
[0084] Tube A: optiMEM 50μl+lipofectamine2000 5μl
[0085] Tube B: Opti-MEM 50 μl + 1 μg DNA (0.5 μg base editor plasmid + 0.5 μg sgRNA plasmid)
[0086] Gently mix tubes A and B, let them stand for 15 minutes, then evenly distribute the cells on a 12-well plate and incubate for 6 hours. Observe the cell status during the medium change. Collect the cells on the 5th day of normal passage, 72 hours after transfection.
[0087] 1.4 Genome extraction, target fragment amplification and library preparation
[0088] 72 hours after cell transfection, genomic DNA was extracted using the Qiagen tissue & blood DNA extraction kit.
[0089] Amplicon libraries were then constructed using two PCR methods. The first PCR was used to extract the target edited DNA fragment. Using the Novozymes Phanta Max Super-Fidelity DNA Polymerase Kit protocol, primers corresponding to the editing sgRNA (Table 3) were used, and 13 cycles of PCR amplification were performed using extracted cellular DNA as a template to obtain sequences near the editing site. The second PCR was performed to add the Qingke fastNGS adapter sequences to both ends. The 5' end of the forward primer contained adapter read 1: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 23), and the 5' end of the reverse primer contained adapter read 2: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 24).
[0090] Using the product from the first reaction as a template, 13 cycles of PCR amplification were performed. Finally, the resulting PCR product was subjected to DNA electrophoresis and gel recovery. The final product was sent to Qingke for high-throughput sequencing, with a target sequencing depth of approximately 5000x.
[0091] 1.5 Next-generation sequencing data analysis and statistics
[0092] Clean reads were obtained by removing adapter sequences using the trimmomatic program. Paired-end reads were then aligned to the hg38 genome using bowtie2. The alignment file was converted to the same format using samtools. The sequencing depth and mutation information for each base position in the targeted interval were calculated using the bam-readcount program, and the mutation frequency and INDEL ratio were calculated.
[0093] 1.6 Results Analysis
[0094] As shown in Figure 3, ABE8 has the highest editing activity at site 2 at A5, and three base sites have an A to G editing ratio greater than 15%: A3, A5, and A7. ABE10.1 has the highest editing activity at A5, with a higher editing ratio than ABE8. It also has two base sites with an A to G editing ratio greater than 15%: A3 and A5. ABE10.2 also has the highest editing activity at A5, with a higher editing ratio than ABE8, and only one base site with an A to G editing ratio greater than 15%: A5.
[0095] In addition, ABE10.1 and ABE10.2 maintained a lower proportion of INDEL events (Table 4).
[0096] The results showed that ABE10.1 and ABE10.2 had narrower editing windows, higher or similar editing activities, and similarly lower levels of INDEL occurrence compared to ABE8.20-m.
[0097] Table 4 Ratio of editor INDELs at site 2
[0098] Example 2
[0099] This example was designed to compare the editing characteristics of ABE8, ABE10.1, and ABE10.2 at site 4.
[0100] 2.1 Plasmid design and construction
[0101] In this example, except for synthesizing the sense and antisense strands of the sgRNA (Table 2, site4-sense), the construction method of the sgRNA plasmid targeting site4 was as described in Example 1. The construction method of the base editing vector in this example was as described in Example 1.
[0102] 2.2 Cell transfection
[0103] The cell transfection method in this example is the same as that in Example 1.
[0104] 2.3 Target fragment amplification and library preparation
[0105] The target fragment amplification and library preparation methods in this example are the same as those described in Example 1.
[0106] 2.4 Next-generation sequencing data analysis and statistics
[0107] The data analysis and statistical methods in this embodiment are the same as those described in Example 1.
[0108] 2.5 Results Analysis
[0109] As shown in Figure 4, the maximum editing activity of ABE8 at site 4 is at A4. ABE10.1 also has the maximum editing activity at A4, with a higher editing ratio than ABE8. ABE10.2 also has the maximum editing activity at A4, with a higher editing ratio than ABE8. The editing ratios of ABE8, ABE10.1, and ABE10.2 at site A9 are all low.
[0110] Example 3
[0111] This example was designed to compare the editing characteristics of ABE8 with those of ABE10.1 and ABE10.2 at site 8.
[0112] 2.1 Plasmid design and construction
[0113] The construction method of the sgRNA plasmid targeting site 8 in this example is as described in Example 1. In this example, except for the synthesis of the sense and antisense strands of the sgRNA (Table 2, site 8-sense), the base editing vector was constructed as described in Example 1.
[0114] 2.2 Cell transfection
[0115] The cell transfection method in this example is the same as that in Example 1.
[0116] 2.3 Target fragment amplification and library preparation
[0117] The target fragment amplification and library preparation methods in this example are the same as those described in Example 1.
[0118] 2.4 Next-generation sequencing data analysis and statistics
[0119] The data analysis and statistical methods in this embodiment are the same as those described in Example 1.
[0120] 2.5 Results Analysis
[0121] As shown in Figure 5, the maximum editing activity of ABE8 at site 8 is at A7. ABE10.1 also has the maximum editing activity at A7, with a higher editing ratio than ABE8. ABE10.2 also has the maximum editing activity at A7, with a higher editing ratio than ABE8. The editing ratios of ABE8, ABE10.1, and ABE10.2 at sites A11 and A17 are all low.
[0122] Example 4
[0123] A new base editor, designated ABE10.3, was obtained by replacing the TadA sequence in ABE10.1 with SEQ ID NO: 6. This example was designed to compare the editing properties of ABE8 and ABE10.3.
[0124] 2.1 Plasmid design and construction
[0125] The construction method of the sgRNA plasmid targeting site 2 in this example is as described in Example 1. The construction method of the base editing vector in this example is as described in Example 1, wherein the TadA sequence used is SEQ ID NO: 6.
[0126] 2.2 Cell transfection
[0127] The cell transfection method in this example is the same as that in Example 1, and the amount of cells used is 2×10 5 cells.
[0128] 2.3 Target fragment amplification and library preparation
[0129] The target fragment amplification and library preparation methods in this example are the same as those described in Example 1.
[0130] 2.4 Next-generation sequencing data analysis and statistics
[0131] The data analysis and statistical methods in this embodiment are the same as those described in Example 1.
[0132] 2.5 Results Analysis
[0133] As shown in Figure 6, the site with the highest editing activity in ABE10.3 is located at A5, with a higher editing ratio than ABE8. The second-highest editing activity site is located at A3, with a higher editing ratio than ABE8. These results indicate that ABE10.3 has higher or similar editing activity than ABE8.20-m, but the distribution of editing activity within the editing window differs.
[0134] Sequence information
[0135] SEQ ID NO: 1
[0136] SEQ ID NO: 2
[0137] SEQ ID NO:3
[0138] SEQ ID NO:4
[0139] SEQ ID NO:5
[0140] SEQ ID NO:6
[0141] SEQ ID NO:7
Claims
1. An adenine deaminase comprising one or more of the following sequences: (a) an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3; (b) an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3, and retaining the deamination activity of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3; (c) an amino acid sequence with addition, substitution, deletion or insertion of one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3, and retaining the deamination activity of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3; or, (d) an amino acid sequence encoded by a nucleotide sequence that hybridizes under stringent conditions with a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3, and the amino acid sequence retains the deamination activity of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3, wherein the stringent conditions are medium stringency conditions, medium-high stringency conditions, high stringency conditions or very high stringency conditions.
2. The adenine deaminase according to claim 1, wherein, The polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1 is as shown in SEQ ID NO: 4, the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2 is as shown in SEQ ID NO: 5, and the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 3 is as shown in SEQ ID NO:
6.
3. An adenine base editor fusion protein comprising a nuclease and at least one adenine deaminase as claimed in claim 1 or 2.
4. The adenine base editor fusion protein according to claim 3, further comprising a nuclear localization signal sequence, preferably, the nuclear localization signal sequence is the nuclear localization signal sequence as shown in SEQ ID NO:
7.
5. The adenine base editor fusion protein according to claim 3 or 4, wherein, The nuclease is selected from Cas proteins and their variants, and TnpB proteins.
6. The adenine base editor fusion protein according to claim 3 or 4, wherein, The nucleotide sequence encoding the adenine base editor fusion protein sequentially comprises a promoter - adenine deaminase - nuclease - polyadenylation signal.
7. A polynucleotide encoding the adenine deaminase as claimed in claim 1 or 2 or encoding the adenine base editor fusion protein as claimed in any one of claims 3 to 6.
8. A vector comprising the polynucleotide as claimed in claim 7.
9. A cell, comprising one or more selected from the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 3 to 6, the polynucleotide as described in claim 7, and the vector as described in claim 8.
10. An adenine base editing system, comprising: the adenine deaminase as described in claim 1 or 2; a nuclease; and an SgRNA, or the adenine base editor fusion protein as described in any one of claims 3 - 6; and an SgRNA.
11. A pharmaceutical composition, comprising one or more selected from the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 4 to 6, the polynucleotide as described in claim 7, the vector as described in claim 8, the cell as described in claim 9, and the adenine base editor system as described in claim 10, and a pharmaceutically acceptable carrier.
12. A kit, comprising one or more selected from the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 4 to 6, the polynucleotide as described in claim 7, the vector as described in claim 8, the cell as described in claim 9, and the adenine base editor system as described in claim 10.
13. A delivery system, comprising one or more selected from the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 4 to 6, the polynucleotide as described in claim 7, the vector as described in claim 8, the cell as described in claim 9, and the adenine base editor system as described in claim 10; and a delivery medium.
14. A base editing method, comprising the following steps: expressing in a target cell the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 3 to 6, or the adenine base editing system as described in claim 10, and under the guidance of an SgRNA, causing gene editing in the target cell.
15. Use of the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 4 to 6, the polynucleotide as described in claim 7, the vector as described in claim 8, the cell as described in claim 9, the adenine base editor system as described in claim 10, the pharmaceutical composition as described in claim 11, the kit as described in claim 12, and the delivery system as described in claim 13 in the preparation of base editing drugs or tools, the preparation of gene therapy drugs, the construction of animal models, or crop breeding.
Citation Information
Patent Citations
Adenosine deaminase base editors and methods of using same to modify a nucleobase in a target sequence
CN114072496A
Adenine deaminase, adenine base editor containing adenine deaminase and application of adenine base editor
CN115772512A
Optimized crispr-CAS nucleases and base editors and methods of use thereof
WO2021081264A1
Adenosine deaminase variants and uses thereof
WO2022204574A1