Abnormal stem cell selective removal using metabolic characteristics

A stem cell culture medium with ferroptosis inducers selectively removes mutant pluripotent stem cells by targeting ACSL4 and YAP1 expression, maintaining normal stem cell differentiation potential and addressing the inadequacies of previous methods.

WO2025150636A1PCT designated stage expired Publication Date: 2025-07-17SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/009226
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-09
Filing Date
2024-07-01
Publication Date
2025-07-17

AI Technical Summary

Technical Problem

Existing methods for removing mutant pluripotent stem cells during culture are inadequate, as they either lack specificity or have limitations in their mechanisms of action, such as the use of CD30 markers or BH3 mimetics, which do not effectively distinguish between normal and mutant stem cells, and there is a need for a standardized method to maintain the differentiation potential of normal stem cells.

Method used

A medium composition for stem cell culture containing ferroptosis inducers like RSL3, erastin, or sulfasalazine is used to selectively remove mutant stem cells by inducing ferroptosis, targeting increased expression levels of ACSL4 and/or YAP1 in mutant cells while minimizing impact on normal stem cells.

Benefits of technology

The method effectively and selectively eliminates mutant stem cells by inducing ferroptosis, maintaining the differentiation capacity of normal stem cells and ensuring their pluripotency, thus overcoming the limitations of previous methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024009226_17072025_PF_FP_ABST
    Figure KR2024009226_17072025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a technique capable of selectively removing abnormal pluripotent stem cells by using metabolic characteristics thereof during stem cell culturing and, more specifically, to a technique capable of selectively removing only mutant pluripotent stem cells while minimizing effects on normal pluripotent stem cells by inducing ferroptosis. Provided in the present invention is a method for identifying metabolic characteristics caused by genetic mutations in genetically mutated pluripotent stem cells and easily and quickly removing the mutated pluripotent stem cells through treatment with a compound that acts on the metabolic characteristics, and thus the present invention can contribute to overcoming major technical limitations during the clinical use of pluripotent stem cells.
Need to check novelty before this filing date? Find Prior Art

Description

Selective elimination of abnormal stem cells using metabolic characteristics

[0001] The present invention relates to a technology that can selectively remove abnormal stem cells by utilizing metabolic characteristics, and more specifically, to a technology that can selectively remove only mutant pluripotent stem cells while minimizing the impact on normal pluripotent stem cells by inducing ferroptosis.

[0002] Stem cells are cells that have the unique ability (multipotentiality) to produce many different types of cells, and are a general term for cells that can regenerate cells in damaged areas.

[0003] In particular, pluripotent stem cells (PSCs) are cells possessing pluripotency, the ability to differentiate into approximately 260 cell types within the body. They can be mass-produced and undergo various genetic editing, making them ideal for applications in fields such as cell therapy and disease modeling.

[0004] However, various mutations can occur during the subculture process for the utilization of pluripotent stem cells. For example, these mutations include dangerous genetic mutations that can cause cancer, as well as various metabolic, genetic, and epigenetic mutations whose effects are not yet known. In other words, while pluripotent stem cells possess a survival advantage due to mutations introduced during the culture process, this can also lead to the generation and accumulation of mutations that would normally be eliminated (Stem cell reports, Zhang J et al, VOLUME 12, ISSUE 3, P557-571, MARCH 05, 2019).

[0005] Efforts to eliminate mutations that arise during the culture of pluripotent stem cells have continued since the first mutation was reported. However, a standardized method for eliminating mutations that can be used clinically has not yet been established. In 2006, Nature Biotechnology reported that a cell surface marker called CD30 was a biomarker for cells that mutated during the culture process, and proposed that using it could eliminate transformed stem cells (Nat Biotechnol. Daniella H. et al., 2006 Mar;24(3):351-7, PMID 16501577). However, in 2009, PW Andrews' group demonstrated that CD30 expression in stem cells was not solely caused by mutations, and therefore argued that it was unreasonable to use it as a marker for eliminating culture-adapted stem cells (Stem Cells, Neil J Harrison et al., 2009 May;27(5):1057-65, PMID 19415777). In 2018, the inventors of the present invention also demonstrated in Stem Cell Reports, a journal of the International Society for Stem Cell Research, that BH3 mimetics can be used to eliminate culture-adapted stem cells (Stem Cell Reports. Seung-Ju Cho et al, 2018 Nov 13;11(5):1244-1256. PMID: 30293852), but there was a problem that its use was limited due to its mechanism of action, which only works in cells with high BCL2L1 levels.

[0006] Accordingly, the inventors of the present invention have made great efforts to develop a method for selectively removing mutations that occur during the process of subculturing stem cells, and as a result, have for the first time identified the metabolic characteristics of pluripotent stem cells in which major mutations have occurred and the genetic mechanisms that cause such metabolic characteristics. Based on this research, they have developed a method for selectively removing mutants in pluripotent stem cells.

[0007]

[0008] The purpose of the present invention is to provide a novel method capable of selectively removing mutant stem cells resulting from culture adaptation while maintaining the differentiation potential of normal stem cells during the stem cell culture process.

[0009] To achieve the above purpose, the present invention provides a medium composition for stem cell culture containing a ferroptosis inducer.

[0010] In the present invention, the ferroptosis inducer may be at least one selected from the group consisting of RSL3, erastin, imidazole ketone erastin (IKE), sulfasalazine, sorafenib, altretamine, artesunate, ML-162, and ML-210.

[0011] In the present invention, the stem cell may be a pluripotent stem cell or an induced pluripotent stem cell.

[0012] In the present invention, the medium composition may be characterized by maintaining the differentiation capacity of normal stem cells while selectively removing culture-adapted mutant stem cells.

[0013] In the present invention, the culture-adapted mutant stem cells may be characterized in that the expression levels of ACSL4 and / or YAP1 are increased compared to normal stem cells.

[0014] The present invention also provides a method for selectively removing mutant stem cells from stem cells, comprising the step of culturing the stem cells by treating them with a ferroptosis inducing agent.

[0015] In the present invention, the ferroptosis inducer may be at least one selected from the group consisting of RSL3, erastin, imidazole ketone erastin (IKE), sulfasalazine, sorafenib, altretamine, artesunate, ML-162, and ML-210.

[0016] In the present invention, the ferroptosis inducer is RSL3, and RSL3 may be treated at a concentration of 100 nM to 1000 nM for 10 to 48 hours.

[0017] In the present invention, the method may be characterized by maintaining the differentiation capacity of normal stem cells while selectively removing culture-adapted mutant stem cells.

[0018] In the present invention, the culture-adapted mutant stem cells may be characterized in that the expression levels of ACSL4 and / or YAP1 are increased compared to normal stem cells.

[0019] The present invention also provides a reagent composition for removing mutant stem cells, which comprises a ferroptosis inducer as an active ingredient.

[0020] In the present invention, the ferroptosis inducer may be at least one selected from the group consisting of RSL3, erastin, imidazole ketone erastin (IKE), sulfasalazine, sorafenib, altretamine, artesunate, ML-162, and ML-210.

[0021] In the present invention, the reagent composition may be characterized by maintaining the differentiation capacity of normal stem cells while selectively removing culture-adapted mutant stem cells.

[0022] In the present invention, the culture-adapted mutant stem cells may be characterized in that the expression levels of ACSL4 and / or YAP1 are increased compared to normal stem cells.

[0023] The present invention also provides a use of a ferroptosis inducer for eliminating mutant stem cells.

[0024] The present invention also provides the use of a ferroptosis inducer for the preparation of a reagent for removing mutant stem cells.

[0025] The present invention provides a method for easily and quickly removing mutated pluripotent stem cells by identifying metabolic characteristics caused by genetic mutations in genetically mutated pluripotent stem cells and treating them with compounds that act on these metabolic characteristics. Therefore, the present invention can contribute to overcoming the significant technical limitations of the past in the clinical use of pluripotent stem cells.

[0026]

[0027] Figure 1 shows that this process is activated in mutant pluripotent stem cells.

[0028] Figure 1a is a schematic diagram showing normal cells (P1, P2, normal pluripotent stem cells) and genetic mutants (P3, P4, mutant pluripotent stem cells) in a pluripotent stem cell line model and summarizes the characteristics of culture-adapted stem cells.

[0029] Figure 1b shows the results of confirming the change in glucose uptake rate as the subculture of pluripotent stem cells progresses.

[0030] Figure 1c shows the results of confirming changes in mRNA expression of SLC2A1, a glucose transporter, as subculture of pluripotent stem cells progresses.

[0031] Figure 1d shows the tendency for the process to be activated and the resulting total capacity as the subculture of pluripotent stem cells progresses.

[0032] Figure 1e shows the results of comparing TCA activity in normal pluripotent stem cells and mutant pluripotent stem cells.

[0033] Figure 1f shows the results of confirming the change in the amount of ATP produced as the subculture of pluripotent stem cells progresses.

[0034] Figure 1g shows the results of confirming the amount of reactive oxygen species (ROS) produced in mitochondria as the subculture of pluripotent stem cells progresses.

[0035] Figure 2 shows the results of comparing the amount of fat accumulation in normal pluripotent stem cells and mutant pluripotent stem cells.

[0036] Figure 2a shows the results of comparing the survival rates of normal pluripotent stem cells and mutant pluripotent stem cells according to inhibition of the corresponding process.

[0037] Figure 2b shows the results of confirming the effect on survival rate when the process and fatty acid consumption were simultaneously inhibited in mutant pluripotent stem cells.

[0038] Figure 2c shows the results of comparing changes in genes related to long-chain fatty acid accumulation in normal pluripotent stem cells and mutant pluripotent stem cells.

[0039] Figure 2d shows the results of comparing the amount of fat in normal pluripotent stem cells and mutant pluripotent stem cells.

[0040] Figure 2e shows the results comparing the amount of fatty acids in normal pluripotent stem cells and mutant pluripotent stem cells.

[0041] Figure 2f shows a schematic diagram of the process by which glucose is synthesized into fatty acids.

[0042] Figure 3 shows the results confirming the ferroptosis sensitivity of mutant pluripotent stem cells.

[0043] Figure 3a shows the results confirming that when genes that provide survival advantages in normal and mutant pluripotent stem cells are suppressed (YM155 treatment), the resistance of mutant pluripotent stem cells is strongly exhibited.

[0044] Figure 3b shows the results confirming that when mitosis is inhibited (Nocodazole treatment) in normal pluripotent stem cells and mutated pluripotent stem cells, the mutated pluripotent stem cells exhibit strong resistance.

[0045] Figure 3c shows the results of flow cytometry analysis confirming that when ferroptosis is induced in normal pluripotent stem cells and mutated pluripotent stem cells (RSL3 treatment), the mutated pluripotent stem cells exhibit weak resistance.

[0046] Figure 3d is a result of visually confirming that when ferroptosis is induced (RSL3 treatment) in normal pluripotent stem cells and mutated pluripotent stem cells, the resistance of mutated pluripotent stem cells is weak.

[0047] Figure 3e shows the results comparing the changes in the amount of peroxidized lipids when ferroptosis is induced (RSL3 treatment) in normal pluripotent stem cells and mutant pluripotent stem cells.

[0048] Figure 3f shows the results confirming that the responsiveness to ferroptosis induction (RSL3 treatment) is weakened when fatty acids are reduced in mutant pluripotent stem cells.

[0049] Figure 3g shows the results confirming that the responsiveness to ferroptosis induction (RSL3 treatment) is restored when fatty acids are reduced and then restored in mutant pluripotent stem cells.

[0050] Figure 4 shows the results confirming the ferroptosis sensitivity of mutant induced pluripotent stem cells.

[0051] Figure 4a shows the results of comparing the amount of fat in normal induced pluripotent stem cells and mutant induced pluripotent stem cells.

[0052] Figure 4b shows the results of a visual comparison of the reactivity when ferroptosis is induced (RSL3 treatment) in normal induced pluripotent stem cells and mutant induced pluripotent stem cells.

[0053] Figure 4c shows the results of flow cytometry analysis comparing the reactivity of normal induced pluripotent stem cells and mutant induced pluripotent stem cells when ferroptosis is induced (RSL3 treatment).

[0054] Figure 4d shows the results of confirming the responsiveness according to the RSL3 concentration in mutant induced pluripotent stem cells.

[0055] Figure 4e shows the results comparing the lipid peroxidation levels when ferroptosis is induced (RSL3 treatment) in normal induced pluripotent stem cells and mutant induced pluripotent stem cells.

[0056] Figure 4f shows the results of comparing the ferroptosis responsiveness according to fatty acid levels in normal induced pluripotent stem cells and mutant induced pluripotent stem cells.

[0057] Figure 5 shows the results of confirming the regulation of ferroptosis sensitivity of mutant pluripotent stem cells by the YAP-ACSL4 axis.

[0058] Figure 5a shows genes involved in ferroptosis and fatty acid synthesis among the genes increased in mutant pluripotent stem cells.

[0059] Figure 5b shows the results of comparing the mRNA levels of ACSL4 in normal pluripotent stem cells and mutant pluripotent stem cells.

[0060] Figure 5c shows the results comparing the protein levels of ACSL4 in normal pluripotent stem cells and mutant pluripotent stem cells.

[0061] Figure 5d shows the results of comparing the protein levels of YAP1 in normal pluripotent stem cells and mutant pluripotent stem cells.

[0062] Figure 5e shows the results confirming the effect of suppressing YAP1 expression in mutant pluripotent stem cells on ACSL4 mRNA expression.

[0063] Figure 5f shows the results of overexpression of YAP1 in mutant pluripotent stem cells.

[0064] Figure 5g shows the results confirming the effect of YAP1 overexpression on ACSL4 mRNA expression in mutant pluripotent stem cells.

[0065] Figure 5h shows the results confirming the effect of YAP1 overexpression on ACSL4 protein expression in mutant pluripotent stem cells.

[0066] Figure 5i shows the results confirming the effect of YAP1 overexpression on the ferroptosis responsiveness of normal pluripotent stem cells.

[0067] Figure 6 shows the results confirming the effect of ACSL4 on the ferroptosis sensitivity of mutant pluripotent stem cells. In Figure 6, WT refers to normal mutant pluripotent stem cells, and KD refers to mutant pluripotent stem cells with ASCL4 knockout.

[0068] Figure 6a schematically represents the mechanism by which the ACSL family acts within cells.

[0069] Figure 6b shows the results of confirming the ACSL4 sequence in mutant pluripotent stem cells in which ACSL4 was knocked out.

[0070] Figure 6c shows the results of confirming the expression of ACSL4 in mutant pluripotent stem cells in which ACSL4 was knocked out.

[0071] Figure 6d shows the results of confirming the characteristics of stem cells in ACSL4 knockout mutant pluripotent stem cells using AP staining (left) and POU5F1 mRNA expression level (right).

[0072] Figure 6e shows the results of visual confirmation of ferroptosis reactivity according to ACSL4 knockout (clone 1, clone 2) in mutant pluripotent stem cells.

[0073] Figure 6f shows the results of flow cytometry analysis confirming ferroptosis responsiveness according to ACSL4 knockout (clone 1) in mutant pluripotent stem cells.

[0074] Figure 6g shows the results of flow cytometry analysis confirming ferroptosis responsiveness according to ACSL4 knockout (clone 2) in mutant pluripotent stem cells.

[0075] Figure 6h is a schematic diagram showing a system for expressing ACSL4 by tetracycline-inducible (TET-on) reconstitution after ACSL4 knockout in mutant pluripotent stem cells.

[0076] Figure 6i shows the results of examining the ACSL4 protein expression level after treatment with 1 mg / ml of doxycycline for 24 hours for tetracycline-inducible (TET-on) reconstitution following ACSL4 knockout in mutant pluripotent stem cells.

[0077] Figure 6j shows the results of visually confirming ferroptosis sensitivity in the tetracycline-inducible (TET-on) reconstituted mutant pluripotent stem cells.

[0078] Figure 6k shows the results of flow cytometry analysis confirming ferroptosis sensitivity in the tetracycline-inducible (TET-on) reconstituted mutant pluripotent stem cells.

[0079] Figure 7 shows the results of confirming the selective death of mutant pluripotent stem cells due to ferroptosis induction during the stem cell culture process.

[0080] Figure 7a is a schematic diagram showing the process of selectively removing mutant pluripotent stem cells by inducing ferroptosis during the stem cell culture process.

[0081] Figure 7b shows the mRNA expression levels of normal stem cell markers (CHCHD2) and mutant stem cell markers (TPX2, BCL2L1) in normal pluripotent stem cells and mutant pluripotent stem cells.

[0082] Figure 7c shows the mRNA expression level of a normal stem cell marker (CHCHD2) when normal pluripotent stem cells and mutant pluripotent stem cells are mixed in a 1:1 ratio and ferroptosis is induced.

[0083] Figure 7d shows the protein expression level of the mutant stem cell marker BCL-xL (gene name BCL2L1) when normal pluripotent stem cells and mutant pluripotent stem cells are mixed in a 1:1 ratio and ferroptosis is induced.

[0084] Figure 7e is a schematic diagram showing an experimental plan for observing fluorescence changes when apoptosis or ferroptosis is induced by mixing normal pluripotent stem cells tagged with eGFP and mutant pluripotent stem cells without eGFP tag in a 1:1 ratio.

[0085] Figure 7f shows the results of the experiment according to Figure 7e confirmed by flow cytometry analysis.

[0086] Figure 7g shows the results of observing the selective death of mutant cell lines over time using JuLi live imaging after inducing ferroptosis according to Figure 7e.

[0087] Figure 8 shows the results of confirming the integrity of normal pluripotent stem cells under ferroptosis-inducing conditions that induce selective death of mutant pluripotent stem cells.

[0088] Figure 8a shows the growth curve of normal pluripotent stem cells following ferroptosis induction (RSL3 250 nM, 48 hr).

[0089] Figure 8b shows the results of confirming the appearance of normal pluripotent stem cells after ferroptosis induction (RSL3 250 nM, 48 hr).

[0090] Figure 8c shows the results of confirming the stem cell characteristics of normal pluripotent stem cells through AP staining after ferroptosis induction (RSL3 250 nM, 48 hr).

[0091] Figure 8d shows the results of confirming the change in stem cell marker (OCT4) of normal pluripotent stem cells after ferroptosis induction (RSL3 250 nM, 48 hr).

[0092] Figure 8e shows the results of confirming the expression patterns of Endoderm (AFP, SOX17), Mesoderm (Msx1, T), and Ectoderm (PAX6, NESTIN) markers over time in an in vitro spontaneous differentiation experiment of normal pluripotent stem cells after ferroptosis induction (RSL3 250 nM, 48 hr).

[0093] Figure 8f shows the results of confirming the formation of teratoma mass in an in vivo differentiation experiment of normal pluripotent stem cells after ferroptosis induction (RSL3 250 nM, 48 hr).

[0094] Figure 8g shows the results of confirming the 3-germ layer differentiation of teratoma formed in an in vivo differentiation experiment of normal pluripotent stem cells after ferroptosis induction (RSL3 250 nM, 48 hr) using hematoxylin & eosin (H&E) tissue staining (IHC).

[0095]

[0096] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

[0097] In the present invention, it was confirmed that by treating with a ferroptosis-inducing compound at a low concentration for a long period of time, only mutant stem cells can be selectively removed while minimizing the effect on normal stem cells.

[0098] Accordingly, the present invention relates, in one aspect, to a medium composition for stem cell culture comprising a ferroptosis inducer.

[0099] In the present invention, the ferroptosis inducer may be at least one selected from the group consisting of RSL3, erastin, imidazole ketone erastin (IKE), sulfasalazine, sorafenib, altretamine, artesunate, ML-162, and ML-210, but is not limited thereto.

[0100] In the present invention, the stem cell may be a pluripotent stem cell or an induced pluripotent stem cell, but is not limited thereto.

[0101] The above-mentioned general basic medium may be a general basic medium such as a medium used for maintaining or proliferating the pluripotency (undifferentiated state) of stem cells, or a medium used for culturing animal cells, and may be, but is not limited to, Dulbecco's Modified Eagle Media (DMEM), Minimal Essential Medium (MEM), Knockout-DMEM (KO-DMEM), Glasgow Minimal Essential Medium (G-MEM), Basal Medium Eagle (BME), DMEM / Ham's F12, Advanced DMEM / Ham's F12, Iscove's Modified Dulbecco's Media and Minimal Essential Media (MEM), Ham's F-10, Ham's F-12, Medium 199, StemFit02, 04 or RPMI 1640 Media.

[0102] In another embodiment, the conventional basal medium may be, but is not limited to, iPSC-brew MACS, E8, StemFlex, mTeSR1 or PluriSTEM.

[0103] In another embodiment, the above-described conventional basic medium may be any known stem cell culture medium prepared by adding compounds based on DMEM / Ham's F12.

[0104] From another perspective, the present invention relates to a method for selectively removing mutant stem cells from stem cells, comprising the step of culturing the stem cells by treating them with a ferroptosis inducing agent.

[0105] In the present method, the ferroptosis inducer may be at least one selected from the group consisting of RSL3, erastin, imidazole ketone erastin (IKE), sulfasalazine, sorafenib, altretamine, artesunate, ML-162, and ML-210, but is not limited thereto.

[0106] In one embodiment, the ferroptosis inducer is RSL3, and RSL3 may be treated at a concentration of 100 nM to 1000 nM, for example, 250 nM to 500 nM, for 10 to 72 hours, for example, 24 to 48 hours.

[0107] In another aspect, the present invention relates to a reagent composition for removing mutant stem cells, which comprises a ferroptosis inducer as an active ingredient.

[0108] In the present invention, the ferroptosis inducer may be at least one selected from the group consisting of RSL3, erastin, imidazole ketone erastin (IKE), sulfasalazine, sorafenib, altretamine, artesunate, ML-162, and ML-210.

[0109] In the present invention, the reagent composition may be characterized by maintaining the differentiation capacity of normal stem cells while selectively removing culture-adapted mutant stem cells.

[0110] In the present invention, the culture-adapted mutant stem cells may be characterized in that the expression levels of ACSL4 and / or YAP1 are increased compared to normal stem cells.

[0111] For example, the culture-adapted mutant stem cells may be characterized by an increase in the expression level of ACSL4 and / or YAP1 by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more compared to normal stem cells.

[0112] In the present invention, the culture-adapted mutant stem cells may be characterized by having significantly enhanced functions and / or significantly increased fat and fatty acid accumulation compared to normal stem cells.

[0113] For example, the culture-adapted mutant stem cells may be characterized in that at least one of a group consisting of an indicator measuring the corresponding function, an indicator measuring fat accumulation, and an indicator measuring fatty acid accumulation is increased by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more compared to normal stem cells.

[0114] In the present invention, the term "ferroptosis" refers to an oxygen- and iron-dependent form of regulated cell death characterized by the accumulation of membrane lipids and cholesterol peroxides resulting from targeted inhibition of the lipid hydroperoxidase glutathione peroxidase 4 (GPX4).

[0115] In the present invention, the term "cell culture" refers to the process of artificially growing living cells in vitro under controlled conditions. Furthermore, it may involve aseptically removing a portion of a tissue from an individual, enzymatically degrading intercellular connective tissue, and spreading the resulting suspension onto the flat bottom of a culture dish, such as a bottle or petri dish, to allow cells to grow and proliferate.

[0116] In the present invention, the term “culture media” refers to a substance that can support the growth and survival of cells, including stem cells, in vitro.

[0117] In the present invention, the term "stem cell" refers to a cell having differentiation potency and self-renewal ability. Stem cells are divided into pluripotency, multipotency, and unipotency depending on their differentiation ability. The stem cell may be at least one selected from the group consisting of embryonic stem cells (ESC) (inner cells of embryos before implantation), adult stem cells (undifferentiated cells existing in each tissue and organ), and induced pluripotent stem cells (iPSC) (cells in which dedifferentiation is induced by inserting genes and / or proteins into somatic cells, or induced pluripotent stem cells).

[0118] In the present invention, the term "pluripotent stem cell" refers to a cell capable of differentiating into cells of all three embryonic germ layers (i.e., endoderm, ectoderm, and mesoderm). The phrase "pluripotent stem cell" may be read as embryonic stem cell (ESC) and / or induced pluripotent stem cell (iPS cell).

[0119] In the present invention, the term "embryonic stem cell" includes cells obtained from embryonic tissue formed after pregnancy (e.g., blastocyst) before implantation (i.e., pre-implantation blastocyst); blastocyst cells (EBCs) obtained from post-implantation / pre-gastrulation stage blastocyst [see WO2006 / 040763]; and / or germ layer (EG) cells obtained from the reproductive tissue of the fetus at any time during pregnancy, preferably before the 10th week of pregnancy.

[0120] According to some embodiments of the present invention, the pluripotent stem cells of the present invention are embryonic stem cells, such as those of human or primate (e.g., monkey) origin.

[0121] The embryonic stem cells of the present invention can be obtained from a stem cell bank in one embodiment, or obtained using a well-known cell culture method in another embodiment. For example, human embryonic stem cells can be isolated from human blastocysts. Human blastocysts are typically obtained from human in vivo preimplantation embryos or in vitro fertilization (IVF) embryos. Alternatively, single-cell human embryos can be expanded to the blastocyst stage. To isolate human ES cells, the zona pellucida is removed from the blastocyst, and the inner cell mass (ICM) is isolated by immunosurgery. During immunosurgery, trophectoderm cells are lysed and removed from the intact ICM by gentle pipetting. The ICM is then plated in a tissue culture flask containing an appropriate medium that allows for its growth. After 9 to 15 days, the ICM-derived derivatives are dissociated into clumps by mechanical dissociation or enzymatic digestion, and the cells are replated in fresh tissue culture medium. Colonies exhibiting undifferentiated morphology are individually selected using a micropipette, mechanically dissociated into clumps, and replated. The resulting ES cells are then routinely isolated every 4–7 days. For further details on methods for producing human ES cells, see Thomson et al., [US Pat. No. 5,843,780; Science 282: 1145, 1998; Curr. Top. Dev. Biol. 38: 133, 1998; Proc. Natl. Acad. Sci. USA 92: 7844, 1995]; Bongso et al., [Hum Reprod 4: 706, 1989]; and Gardner et al., [Fertil. Steril. 69: 84, 1998].

[0122] It will be appreciated that commercially available stem cells may also be used in this aspect of the present invention. Human ES cells are available from the NIH Human Embryonic Stem Cell Registry (www(dot)escr(dot)nih(dot)gov). Non-limiting examples of commercially available embryonic stem cell lines include BG01, BG02, BG03, BG04, CY12, CY30, CY92, CY10, TE03, TE04, and TE06.

[0123] Blastocyst germ cells (EBCs) can be obtained from blastocysts at least 9 days after fertilization, before gastrulation. Before culturing blastocysts, the zona pellucida is digested (e.g., with Tyrode's acid solution (Sigma Aldrich, St Louis, MO, USA)) to expose the inner cell mass. The blastocysts are cultured as whole embryos for at least 9 days and up to 14 days after in vitro fertilization (i.e., before gastrulation) using standard embryonic stem cell culture methods.

[0124] Another method for producing ES cells was described by Chung et al., Cell Stem Cell, Volume 2, Issue 2, pp. 113-117, February 7, 2008. This method involves removing a single cell from an embryo during in vitro fertilization. The embryo is not destroyed during this process.

[0125] Embryonic germ (EG) cells are prepared from primordial germ cells obtained from fetuses at 8-11 weeks gestation (for fetuses) using laboratory techniques known to those skilled in the art. The genital ridges are dissociated and cut into small pieces, which are then mechanically dissociated into cells. EG cells are then grown in tissue culture flasks in appropriate media. Cells are cultured with daily media changes until a cell morphology consistent with EG cells is observed, typically for 7-30 days or after 1-4 passages. For further details on the preparation of human EG cells, see Shamblott et al., [Proc. Natl. Acad. Sci. USA 95: 13726, 1998] and US Patent No. 6,090,622.

[0126] The term "induced pluripotent stem (iPS) cell" (or embryonic-like stem cell) as used herein refers to a proliferative and pluripotent stem cell obtained by de-differentiation of a somatic cell (e.g., an adult cell).

[0127] According to some embodiments of the present invention, iPS cells are characterized by a proliferative capacity similar to ESCs and thus can be maintained and proliferated in culture almost indefinitely.

[0128] IPS cells can be genetically engineered to acquire embryonic stem cell characteristics. For example, Yamanaka S, Cell Stem Cell. 2007, l(l):39-49; Aoi T, et al., Generation of pluripotent stem cells from adult mouse liver and stomach cells. Science. 2008 Feb 14. (Epub ahead of print); IH Park, Zhao R, West JA, et al., Reprogramming human somatic cells to pluripotency with defined factors. Nature 2008;451: 141-146; K Takahashi, Tanabe K, Ohnuki M, et al., Induction of pluripotent stem cells from adult human fibroblasts by defined factors. As described in Cell 2007;131:861-872, the iPS cells of the present invention can be generated essentially from somatic cells such as fibroblasts, hepatocytes, and gastric epithelial cells by inducing the expression of Oct-4, Sox2, Kfl4, and c-Myc in the somatic cells. Each of the above references is incorporated by reference in its entirety. Additionally or alternatively, the iPS cells of the present invention can be generated essentially from somatic cells by inducing the expression of Oct4, Sox2, Nanog, and Lin28 as described in Yu Junying et al. (Science 318: 1917-1920, 2007) and Nakagawa et al, 2008 (Nat Biotechnol. 26(1): 101-106). Genetic manipulation (reprogramming) of somatic cells can be accomplished using known methods, such as using plasmids or viral vectors, or by derivation without integration with the genome [Yu J, et al., Science. 2009, 324: 797-801]. Other embryonic-like stem cells can be generated by nuclear transfer into an oocyte, fusion with an embryonic stem cell, or nuclear transfer into a zygotic cell, provided the recipient cell is arrested in mitosis.WO 03 / 046141 A2 (Advanced Cell Tech Inc. June 5, 2003) discloses the creation of activated human embryos by parthenogenesis as well as by somatic cell nuclear transfer.

[0129] The iPS cells of the present invention may be derived from embryonic fibroblasts [Takahashi and Yamanaka, 2006 Cell. 2006, 126(4):663-676; Meissner et al, 2007 Nat Biotechnol. 2007, 25(10): 1177-1181], fibroblasts formed from hESCs [Park et al, 2008 Nature. 2008, 451(7175): 141-146], fetal fibroblasts [Yu et al, 2007 Science. 2009, 324(5928) :797-801; Park et al, 2008 (supra)], foreskin fibroblasts [Yu et al, 2007 (supra); Park et al, 2008 (supra)], adult skin and skin tissues [Hanna et al, 2007 Science. 2007, 318(5858): 1920-1923; Lowry et al, 2008 Proc Natl Acad Sci USA, 105(8):2883-2888], b-lymphocytes [Hanna et al 2007 (supra)], and adult liver and stomach cells [Aoi et al, 2008 Science. 2008 Aug l;321(5889):699-702].

[0130] iPS cell lines are also available through cell banks such as WiCell Bank. Non-limiting examples of commercially available iPS cell lines include iPS Foreskin Clone 1 [WiCell Catalogue No. iPS(foreskin)-l-DL-l], iPSIMR90 Clone 1 [WiCell Catalogue No. iPS(IMR90)-l-DL-l], and iPSIMR90 Clone 4 [WiCell Catalogue No. iPS(IMR90)-4-DL-l].

[0131] The above culture may be growth and proliferation.

[0132] The term "growth and proliferation" refers to an increase in the number of cells. The culture may be undifferentiated proliferation. Undifferentiated proliferation refers to the proliferation of stem cells into cells with the same properties as the original cells, i.e., the ability to differentiate and self-renew, without differentiating into specific cells. The term "differentiation" refers to the phenomenon in which cells become specialized in structure or function during their growth through division and proliferation, i.e., the change in form or function of cells, tissues, etc. of a living organism in order to perform their respective tasks. Measuring or determining the degree of differentiation into a specific cell type can be performed by methods well known in the art. Furthermore, the differentiation can be confirmed by examining cell morphology using light microscopy or confocal microscopy, measuring changes in cell surface markers (e.g., staining cells with tissue-specific or cell-marker specific antibodies) and cell morphology (e.g., nuclear / cytoplasmic ratio) using techniques such as flow cytometry or immunocytochemistry, or by measuring changes in gene expression using techniques well known in the art such as polymerase chain reaction (PCR) and gene-expression profiling.

[0133] In the present invention, the term “mutant stem cell” may refer to a cell whose metabolic properties have changed during the process of culturing cells, preferably a stem cell in which genetic and epigenetic mutations have occurred, and may be used interchangeably with the term “culture-adapted stem cell” in the present invention.

[0134] Another aspect provides a method of culturing cells in the above medium composition.

[0135] The above culturing method may include subculturing.

[0136] The term "passage" in the present invention refers to a cell propagation method in which cells are periodically transplanted to a new medium every few days to preserve them and continue their lineage. "Passage" may refer to the growth and proliferation of stem cells from the initial seed culture in a culture vessel to the point where the cells grow vigorously in the same culture vessel (confluence). The method for culturing cells and the method for passaging cells may be performed using conventional culture methods and known methods.

[0137] In another aspect, the present invention relates to the use of a ferroptosis inducer for eliminating mutant stem cells.

[0138] In another aspect, the present invention relates to the use of a ferroptosis inducing agent for the preparation of a reagent for removing mutant stem cells.

[0139] The specific description of the above use may be applied as is to the description of the above composition or the above method, unless they are mutually contradictory, and repeated descriptions thereof are omitted.

[0140]

[0141] Example

[0142]

[0143] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0144]

[0145] Example 1. Experimental method

[0146]

[0147] 1-1. Culturing of stem cells (BJ-iPSC, H9-hESC)

[0148] BJ-iPSC cells (obtained from Bang JS, et al., see Optimization of episomal reprogramming for generation of human induced pluripotent stem cells from fibroblasts. Anim Cells Syst (Seoul) 22, 132-139 (2018)) and H9-hESC (WiCell) cells were cultured in iPSC-brew MACS (Miltenyi biotechnology, #130-104-368, MACS) with 0.1% gentamycin (Gibco, Waltham, MA, USA, #15750-060), respectively. Subcultures were incubated for 1 hour in Gibco Dulbecco's Modified Eagle Medium: Nutrient Mixture F12 (DMEM F12, F12) containing 1 unit of Dispase (Life technologies), washed several times with DMEM F12, and cultured in MACS containing 10 μM of Y27632 (Peprotech#1293823) at a 1:1000 concentration. Afterwards, the medium containing Y27632 was replaced with fresh MACS medium without Y27632 within 24 hours, and the medium was replaced with fresh MACS medium once a day thereafter.

[0149]

[0150] 1-2. Clonogenic assay

[0151] After dispensing equal amounts of cells, the cells were treated with compounds suitable for each experiment for the described time after 1-2 days. After cold MeOH fixation, the total colony area was confirmed by crystal violet (Sigma-Aldrich 548-62-9) staining, and the surviving stem cells after compound treatment were identified.

[0152]

[0153] 1-3. Cell death

[0154] Using a flow cytometer (BD Calibur or Celesta), FITC Annexin-V (BD Bioscience, #556419) and 7-AAD (BD Bioscience, #559925) were diluted according to the manufacturer's protocol, stained on cells for 1 hour, and measured using a flow cytometer BD FACSCalibur™. Cells stained by both compounds were considered dead cells. Data quantification and analysis were performed using Flowjo according to the manufacturer's protocol.

[0155]

[0156] 1-4. Measurement of lipid peroxidation

[0157] Lipid peroxidation was measured by C11 BODIPY staining. For this, each compound was treated for the indicated time, and then C11 BODIPY (581 / 591, ThermoFisher, USA, #D3861) was diluted to the concentration indicated on the data sheet, stained for 1.5 hours, and data were collected using a flow cytometer, Flowjo.

[0158]

[0159] 1-5. Check total fat content

[0160] To determine the total amount of fat, BODIPY or Nile red staining was performed. BODIPY (493 / 503, ThermoFisher, USA, #D3922) or Nile red (Thermofisher, #N1142) were diluted to the recommended concentrations according to the manufacturer's data sheet, stained for 1.5 hours, and data were collected using a flow cytometer, flowjo.

[0161]

[0162] 1-6. Data Processing and Statistics

[0163] Data processing and statistics were performed using GraphPad Prism according to the manufacturer's instructions.

[0164]

[0165] 1-7. Immunoblotting (Western-blotting), IFC

[0166] α-tubulin (#sc-8035), β-actin (#sc-47778), YAP1 (#sc-101199), Vinculin (sc-25336), and ACSL4 (sc-271800) antibodies were purchased from Santa Cruz Biotechnology, and Bcl-xL (ab32370) antibody was purchased from abcam. All dilutions were based on the recommended amounts listed on the manufacturers' data sheets. Immunoreactivity was measured using the WEST-Queen™ (#16026, iNtRON Biotechnology) kit and calculated using Chemi-Doc. For IFC, coverslips (Paul Marlenfeld GmbH #0111520) were coated with matrigel, and cells were cultured as described in 1-1. After fixing with cold MeOH (Sigma-Aldrich #322415-1L) and permeabilizing with 4% paraformaldehyde (Sigma-Aldrich #158127-100mg), fixing with 0.1% Triton-X 100 (Sigma-Aldrich #T8787-250ml) and permeabilizing with 3% BSA (Biosesang, #AC1025-100-00), staining with antibodies at the same magnification as the manufacturer's data, and fluorescence capture was performed using an Olympus BX53. The OCT4 antibody used for IFC was purchased from Cell signaling (#2840S).

[0167]

[0168] 1-8. Live-cell imaging

[0169] Compounds were treated at the times and concentrations described in each experiment, and JuLI TM Data were collected using Stage (NanoEnTek Inc.) and JuLiStat according to the manufacturer's instructions.

[0170]

[0171] 1-9. Electroporation

[0172] It was performed using NEPA21 Electroporator. 1X10 in 100ul of Gibco Opti-MEM (#31980562) 6 The cells were resuspended, treated with siRNA / Vector under optimized conditions for each experiment, and electrically stimulated at 175 V for 2.5 mS to introduce the desired substance into the cells. The cells were then cultured under MACS containing 10 μM of Y27632 (Peprotech#1293823) at a concentration of 1:1000, and replaced with fresh MACS medium without Y27632 within 24 hours. Thereafter, the medium was replaced with fresh MACS medium once a day.

[0173]

[0174] 1-10. Real-Time PCR

[0175] The experiment was conducted in the same way as a conventional RT-PCR. After detaching cells from the plate using Dispase (Life technologies) or accutase (BD bioscience #561527), mRNA was extracted using iNtRON biotechnology easy-BLUE Total RNA extraction kit, cDNA was amplified with Takara 5X PrimeScript RT Master Mix (#RR036A-1), and then Takara TB green Premix Ex Taq (Tli RNaseH plus, #RR420) and primers suitable for each target (see table below) were used. The amount of cDNA was calculated from the number of cycles required to reach a certain level using Applied biosystems, QuantStudio 3, and Program QuantStudio Design&Anysis software v1.5.1.

[0176]

[0177] <h2 style=";text-align:left;direction:ltr">18srRNA F:GTA ACC CGT TGA ACC CCA TTR:CCA TCC AAT CGG TAG TAG CGS LC2A1 (GLUT1)F:AACTCTTCAGCCAGGGTCCACR:CGCAGCCGAGGGGAAGAACAYAPF:GTG AGC CTG TTT GGA TGA TGR:CAC TGG ACA AAG GAA GCT GACTGFF:CCA ATG ACA ACG CCT CCT GR:TGG TGC AGC CAG AAA GCT CSERPINE1F:TTG AAT CCC ATA GCT GCT TGA ATR:ACC GCA ACG TGG TTT TCT CAACSL4F:TCATGTGCTAGAACTGACAGCR:GTACAGTCTCCTTTGCTTCCTTELOVL5F:AATAAACAGCCATTCTCTTGCCR:GCCCTTCCCATACTCCTGTTACFADS1F:CAGACATCAACATGCATCCCTR:AGAAGTATTTGTGCTGGTGGTHMGCRF:GGA CCC CTT TGC TTA GAT GAA AR: CCA CCA AGA CCT ATT GCT CTGTPX2F:GCT CAA CCT GTG CCA CAT TAR:CGA GAA AGG GCA TAT TTC CACHCHD2F:CAG CAG CCT TGC CTC TAT GR:GTT TGC AAG TCG GCA CTG T<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0178] <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0179] <h2 style=";text-align:left;direction:ltr"> 1-11. OCR, ECAR<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0180] OCR (oxygen consumption rate) and ECAR (extracellular acidification rate) were measured using an Agilent Seahorse bioscience XFe96 Analyzer (Agilent technology). Each experimental method and chemical concentration followed the manufacturer's (Agilent technology) instructions using consumables and analysis kits and were not specifically modified. Specifically, stem cells were detached with accutase (BD bioscience #561527) the day before the experiment, and the number of cells was counted using a hematocytometer, and 8X10 4 Inside 1X10 5 Equal numbers of cells were aliquoted into each sample. One day later, experiments were conducted according to the manufacturer's (Agilent Technology) protocol. Cell counts were quantified and data compiled according to the manufacturer's protocol.

[0181]

[0182] 1-12. Gene Set Enrichment Analysis (GSEA)

[0183] This assay was performed using gene expression information (GSE119386) obtained through microarray, and the ranking of RNAs or genes differentially expressed in P4 (Variant) compared to P1 (Normal) was obtained through GEO2R (https: / www.ncbi.nlm.nih.gov / geo / geo2r / ). Then, GSEA analysis was performed on genes related to fatty acid synthesis searched in MSigDB using the R package "fgsea". The criteria for considering a significant change at this time are adjusted p-value <0.05 and Normalized enrichment score (NES) 1.4 or higher.

[0184]

[0185] 1-13. Genetic manipulation using siRNA, CRISPR-Cas9, and PB-Reconstruction

[0186] 20 nM siRNA was used for transient gene expression reduction, and 2,000 ng of gRNA and 3,000 ng of Cas9 per sample were used for gene knockout. Materials were delivered via electroporation as described in 1-9. The sequences are as follows. YAP overexpression was performed using the Flag-YAP8SA vector, kindly provided by Professor Jeong-Sun Mo of Ajou University (originally described in PMID 33207077), and ACSL4 reconstruction was performed using the Piggybac TET-On system Vector purchased from Vectorbuilder.

[0187]

[0188] siYAP1F:CAG AAG AUC AAA GCU ACU UR:AAG UAG CUU UGA UCU UCU GACSL4 gRNAF:GGGCCGAATGGATGATTGCAR:TGCAATCATCCATTCGGCCC

[0189]

[0190] Example 2. Changes in metabolic properties in a pluripotent stem cell model with genetic mutations.

[0191]

[0192] Pluripotent stem cells tend to have a decreasing medium pH with each subsequent passage, even when cultured in the same volume. This characteristic is believed to be due to changes in metabolic properties caused by genetic mutations in pluripotent stem cells during passage. Therefore, the present invention aimed to determine how the metabolic properties of genetically modified pluripotent stem cells change during passage.

[0193]

[0194] 2-1. Activation of the process

[0195] Normal stem cells P1 (passage <50), P2 (passage <100) and mutant stem cells P3 (passage >200), P4 (passage >300) that had undergone mutations as a result of culture adaptation were established (Fig. 1a). In order to confirm the activation of the glycolytic process as a result of changes in metabolic characteristics in the mutant pluripotent stem cells,

[0196] That is, in the present invention, experiments were conducted using normal stem cells that did not exceed passage 100, and experiments were conducted using mutant stem cells that exceeded passage 200.

[0197]

[0198] First, to compare the glucose uptake of normal and mutant pluripotent stem cells, the uptake of 2-NBDG, a glucose analogue, was quantified using a flow cytometer. For this purpose, 2-NBDG (Cayman Chemical, Cat# 186689-07-6) (20 mM) in DMSO was diluted 1:1000 in MACS medium, treated with cells from P1 to P4 for 2 hours, and then the fluorescence intensity was measured. The stronger the fluorescence intensity, the greater the glucose uptake.

[0199] As a result of the experiment, it was confirmed that the glucose uptake rate was increased in the mutant pluripotent stem cells (P3, P4) compared to the normal pluripotent stem cells (P1, P2) (Fig. 1b).

[0200]

[0201] In relation to increased glucose uptake, we sought to determine the expression level of the glucose transporter. The mRNA level of SLC2A1 was measured using the real-time PCR process described in Example 1-10. In this case, BCL2L1 was used as a positive control.

[0202] As a result of the experiment, it was confirmed that the mRNA expression level of SLC2A1 increased in mutant pluripotent stem cells (P3, P4) compared to normal pluripotent stem cells (P1, P2) (Fig. 1c).

[0203]

[0204] 8×10 cells each from P1 to P4 4 - 1×10 5 After overnight culture, the extracellular acidification rate (ECAR) was measured using the method described in Example 1-11. Glucose capacity was calculated as the limiting value of the lowest value (non-glycolytic acidification) after 2-DG treatment at the highest acidification rate.

[0205] As a result, it was confirmed that the activity of the process was generally enhanced in the mutant pluripotent stem cells (Fig. 1d).

[0206]

[0207] Meanwhile, the dependence on the TCA cycle was confirmed by measuring OCR using the method described in Example 1-11.

[0208] As a result, the overall oxygen consumption was found to be reduced in P4 compared to P1, which can be interpreted as a reduced dependence on TCA in P4 (Fig. 1e).

[0209]

[0210] Meanwhile, after treating the MACS medium with ATP-Red at a concentration of 1 μM and staining for 1 hour, the results were quantified using a flow cytometer (see A Multisite-Binding Switchable Fluorescent Probe for Monitoring Mitochondrial ATP Level Fluctuation in Live Cells, Lu wang et al. WILEY Online library, https: / doi.org / 10.1002 / anie.201510003), and it was confirmed that ATP synthesis was more active in the mitochondria of the mutant pluripotent stem cells (Fig. 1f).

[0211] In addition, after treating the MACS medium with Mitosox (Thermofisher scientific, #M36008) at a concentration of 10 μM and staining for 1 hour, quantification using a flow cytometer revealed that mitochondrial ROS production increased in the mutant pluripotent stem cells (Fig. 1g), confirming that there were many changes in glucose metabolism in the mutant pluripotent stem cells.

[0212]

[0213] 2-2. Fat accumulation

[0214] We aimed to confirm fat accumulation through changes in metabolic characteristics in mutant pluripotent stem cells.

[0215]

[0216] To this end, cell death was quantified using flow cytometry after 24-h treatment with various concentrations of 2-DG (Selleckchem, #S4701). 2-DG is a glucose analogue that is uptaken by GLUT but is not actually utilized in the glycolytic process, so it does not lead to ATP synthesis. Instead, it competitively inhibits glucose uptake, significantly reducing the glycolytic process and the resulting ATP synthesis.

[0217] In the case of mutant pluripotent stem cells, ATP synthesis increased significantly through this process, but when this process was inhibited by treating with 2-DG, it was confirmed that cell death did not occur (Fig. 2a). As the subculture progressed, it was confirmed that pluripotent stem cells excessively accumulated fat, and among them, fatty acids (FA) increased and were used as an energy storage body. Specifically, it was found that because the glycolysis process was active in mutant pluripotent stem cells, even when the glycolysis process was inhibited, the survival rate was relatively higher than that of normal pluripotent stem cells.

[0218]

[0219] Mutant pluripotent stem cells were treated with L-Carnitine (Selleckem, S2388, LC) diluted 1:1000, and co-treated with 2-DG at 2.5 and 5.0 mM, respectively. After culturing for 24 h, the degree of cell growth was confirmed through Crystal Violet staining according to the Clonogenic assay experimental method.

[0220] When mutant pluripotent stem cells were treated with 2-DG or L-Carnitine alone, no significant growth inhibition occurred, whereas when 2-DG and L-Carnitine were combined, a significant growth inhibition was observed. This indicates that when glycolysis is inhibited and fatty acid consumption is increased, the survival rate of mutant pluripotent stem cells is also significantly reduced (Fig. 2b). These results suggest that stored fat is used as an energy source, which acts as a buffer against the inhibition of glycolysis and the resulting decrease in ATP synthesis.

[0221]

[0222] Meanwhile, as described in Example 1-12, transcriptome data of normal pluripotent stem cells and mutant pluripotent stem cells were compared through GSEA analysis to determine which genes were significantly changed in the mutant pluripotent stem cells.

[0223] As a result, changes in genes related to the accumulation of long-chain fatty acids were clearly observed (Fig. 2c).

[0224]

[0225] The actual amount of fat accumulated in the mutant pluripotent stem cells was treated with Nile red (Thermofischer scientific, #N1142) at a 1:1000 dilution, stained for 1 hour and 30 minutes, and quantified using flow cytometry. In addition, L-Carnitine (Selleckem, S2388, LC) was treated at a 1:1000 dilution, and after 24 hours, BODIPY 493 / 503 (Thermofisher scientific, #D3922) was treated at a 1:1000 dilution, stained for 1 hour and 30 minutes, and quantified using flow cytometry. In this case, the degree to which staining was reduced by treatment with L-Carnitine indicates that fatty acids were oxidized and lost.

[0226] From these results, it was found that fat accumulation and fatty acid accumulation were increased in the mutant pluripotent stem cells (Fig. 2d, Fig. 2e).

[0227]

[0228] Example 3. Confirmation of ferroptosis sensitivity and its correlation with fatty acids in mutant pluripotent stem cells and induced mutant pluripotent stem cells.

[0229]

[0230] 3-1. Resistance of mutant pluripotent stem cells to apoptosis

[0231]

[0232] Normal pluripotent stem cells and mutant pluripotent stem cells were treated with YM155, a survivin (BIRC5) inhibitor, or Nocodazole, a mitosis inhibitor, at concentrations of 50 nM and 20 nM, respectively, for 23 hours, and then the amount of surviving stem cells was confirmed by crystal violet staining.

[0233] As a result, mutant pluripotent stem cells showed resistance to both causes of cell death, whereas normal pluripotent stem cells were sensitive to both causes of cell death (Fig. 3a).

[0234]

[0235] Meanwhile, normal pluripotent stem cells and mutant pluripotent stem cells were treated with Nocodazole at a concentration of 50 nM for 24 hours, and the degree of cell death was quantified using FACS Calibur.

[0236] As a result, it was confirmed that mutant pluripotent stem cells showed resistance to Nocodazole treatment, whereas normal pluripotent stem cells showed significant cell death due to Nocodazole treatment (Fig. 3b).

[0237]

[0238] 3-2. Sensitivity of mutant pluripotent stem cells to ferroptosis

[0239]

[0240] Normal pluripotent stem cells and mutant pluripotent stem cells were treated with RSL3 (selleckem, Catalog No. S8155), a ferroptosis inducer, at a concentration of 500 nM for 24 hours, and cell viability was quantified using FACS Calibur.

[0241] As a result, it was confirmed that, compared to normal pluripotent stem cells, mutant pluripotent stem cells were more sensitive to RSL3 treatment and ferroptosis was induced (Fig. 3c).

[0242]

[0243] After pretreatment with ferrostatin (Selleckchem, S7243), a ferroptosis inhibitor, at a concentration of 500 nM for 24 hours, the cells were treated with 500 nM RSL3, a ferroptosis inducer, and the extent of cell growth was confirmed using a clonogenic assay.

[0244] As a result, pretreatment with ferrostatin, a ferroptosis inhibitor, in mutant stem cells made them less sensitive to treatment with RSL3, a ferroptosis inducer. From these results, it was found that mutant stem cells were sensitive to ferroptosis (Fig. 3d).

[0245]

[0246] 3-3. Ferroptosis sensitivity and its relationship to fatty acids in mutant pluripotent stem cells

[0247]

[0248] Normal pluripotent stem cells and mutant pluripotent stem cells were treated with RSL3 at a concentration of 500 nM for 4 hours, and the amount of lipid peroxidation was quantified through C11 BODIPY staining.

[0249] As a result, when ferroptosis was induced, accumulation of lipid peroxidation, known as the most important factor in ferroptosis, was clearly observed in the mutant pluripotent stem cells (Fig. 3e).

[0250]

[0251] Normal pluripotent stem cells and mutant pluripotent stem cells were pretreated with L-Carnitine (Selleckem, S2388, LC) at a 1:1000 dilution for 24 hours to induce fatty acid consumption. Then, RSL3 was treated at a concentration of 500 nM for 24 hours, and FITC-Annexin V and 7-AAD staining were performed, confirmed with a FACS Calibur, and cell viability was quantified with Flowjo. The experimental group marked with (+) is the group pretreated with LC at a 1:1000 dilution for 24 hours.

[0252] As a result, it was confirmed that when ferroptosis was induced after inducing fatty acid consumption in mutant pluripotent stem cells, ferroptosis was not effectively induced (Fig. 3f).

[0253]

[0254] Normal pluripotent stem cells and mutant pluripotent stem cells were pretreated with L-Carnitine (Selleckem, S2388, LC) for 24 hours, and then cultured in normal medium for an additional 24 hours (Recover) or treated with L-Carnitine for an additional 24 hours (LC), followed by treatment with 500 nM RSL3 for 24 hours to confirm ferroptosis.

[0255] As a result, it was confirmed that ferroptosis was induced again when fatty acid consumption was induced in mutant pluripotent stem cells and then recovered (Fig. 3g).

[0256]

[0257] 3-4. Ferroptosis sensitivity and its relationship to fatty acids in induced pluripotent stem cells

[0258]

[0259] To determine whether the ferroptosis sensitivity of mutant pluripotent stem cells (H9-hESC) is a characteristic specific to the H9-hESC cell line, additional experiments were conducted using an induced pluripotent stem cell line (BJ-iPSCs).

[0260]

[0261] The amount of total lipids in mutant induced pluripotent stem cells (iPSC-T12) with trisomy on chromosome 12, a key feature of culture adaptation, was compared with that in normal induced pluripotent stem cells (iPSC) through BODIPY 493 / 503 staining.

[0262] As a result, it was confirmed that the total amount of lipids was high in the mutant induced pluripotent stem cells, similar to the mutant pluripotent stem cells (Fig. 4a).

[0263]

[0264] After treatment with 20 nM Z-VAD (pan-Caspase inhibitor, Selleckchem, #S8102, inhibition of apoptosis) or 500 nM Ferrostatin (Fer-1) for 24 hours, and additional treatment with 500 nM RSL3 for 24 hours, ferroptosis sensitivity was confirmed by clonogenic assay.

[0265] As a result, similar to mutant pluripotent stem cells, it was possible to confirm specific ferroptosis sensitivity in mutant induced pluripotent stem cells (Fig. 4b).

[0266]

[0267] Normal induced pluripotent stem cells and mutant induced pluripotent stem cells were treated with RSL3 at a concentration of 500 nM for 24 hours, and cell viability was quantified using FACS Calibur.

[0268] As a result, it was confirmed that compared to normal induced pluripotent stem cells, mutant induced pluripotent stem cells were more sensitive to RSL3 treatment and ferroptosis was induced (Fig. 4c).

[0269]

[0270] Mutant induced pluripotent stem cells were treated with 20 nM Z-VAD (pan-caspase inhibitor, Selleckchem, #S8102, inhibition of apoptosis) or 500 nM Ferrostatin (Fer-1) for 24 hours, and then additionally treated with 250 nM or 500 nM RSL3 for 24 hours. Ferroptosis sensitivity was confirmed by clonogenic assay.

[0271] As a result, ferroptosis sensitivity was confirmed in mutant-induced pluripotent stem cells even by treatment with 250 nM of RSL3 (Fig. 4d).

[0272]

[0273] After treating normal induced pluripotent stem cells and mutant induced pluripotent stem cells with RSL3 at a concentration of 500 nM for 4 hours, the amount of lipid peroxidation was quantified through C11 BODIPY staining.

[0274] As a result, when ferroptosis is induced, accumulation of lipid peroxidation, known as the most important factor in ferroptosis, was clearly observed in mutant induced pluripotent stem cells (Fig. 4e).

[0275]

[0276] Normal induced pluripotent stem cells and mutant induced pluripotent stem cells were pretreated with L-Carnitine (Selleckem, S2388, LC) for 24 hours to induce fatty acid consumption, and then treated with RSL3 at a concentration of 500 nM for 24 hours. FITC-AnnexinV and 7-AAD staining were performed, confirmed with FACS Calibur, and cell viability was quantified with Flowjo.

[0277] As a result, it was confirmed that when ferroptosis was induced after inducing fatty acid consumption in mutant induced pluripotent stem cells, ferroptosis was not effectively induced (Fig. 4f).

[0278]

[0279] Example 4. Regulation of ferroptosis sensitivity of mutant pluripotent stem cells by the YAP-ACSL4 axis.

[0280]

[0281] We aimed to identify genes that influence ferroptosis sensitivity in mutant pluripotent stem cells.

[0282] To this end, among the genes known to be involved in ferroptosis and fat biosynthesis, ASCL4, ASCL1, and ASCL3 were identified as genes whose expression levels were increased in mutant pluripotent stem cells compared to normal pluripotent stem cells (Fig. 5a).

[0283]

[0284] Meanwhile, the mRNA expression levels of ASCL1, ASCL3, and ASCL4 in normal pluripotent stem cells and mutant pluripotent stem cells were confirmed using the same method as in Example 1-10, and in particular, ASL4 showed a high mRNA expression level in mutant pluripotent stem cells (Fig. 5b).

[0285] Accordingly, the protein expression level of ASCL4 in normal and mutant pluripotent stem cells was confirmed by immunoblotting, and the protein expression level of ASL4 was also increased in mutant pluripotent stem cells (Fig. 5c). As TEAD4 is known to increase in mutant pluripotent stem cells, it was used as a positive control for mutant pluripotent stem cells (Experimental & Molecular Medicine volume 55, pages 32-42 (2023)), and B-actin was used as a loading control.

[0286]

[0287] As YAP1 is known to regulate the expression of ACSL4, the level of YAP1 protein expression in mutant pluripotent stem cells was confirmed by immunoblotting.

[0288] As a result, it was confirmed that YAP1 expression increased along with ACSL4 expression in mutant pluripotent stem cells (Fig. 5d). For reference, BCL-xL is known to increase in mutant pluripotent stem cells (Experimental & Molecular Medicine volume 55, pages 32-42 (2023)), so it was used as a positive control for mutant pluripotent stem cells, and Vinculin and a-tubulin were used as loading controls.

[0289] To confirm whether YAP1 regulates the expression of ACSL4 in mutant pluripotent stem cells, siRNA capable of temporarily knocking down YAP1 was treated for 2 days, and then the mRNA expression levels of ACSL4 and CTGF and SERPINE, which are downstream genes of YAP1, were confirmed as described in Example 1-13.

[0290] As a result, it was confirmed that the mRNA expression of ACSL4, CTGF, and SERPIN all decreased following knockdown of YAP1 (Fig. 5e).

[0291]

[0292] Additionally, we aimed to determine the effect of YAP1 overexpression on ACSL4 expression in mutant pluripotent stem cells.

[0293] To this end, as described in Example 1-13, mutant pluripotent stem cells were transformed by electroporation to overexpress YAP1 (Fig. 5f), and the mRNA and protein expression of ACSL4 was confirmed. As a result, it was confirmed that the mRNA and protein expression levels of ACSL4 increased as YAP1 was overexpressed (Figs. 5g, 5h).

[0294] For reference, increased expression of YAP1 downstream genes CCN1, SERPINE1, and BCL2L1 was also confirmed, and Vinculin was used as a loading control.

[0295] Meanwhile, to confirm the effect of YAP1 overexpression on ferroptosis sensitivity in normal pluripotent stem cells, 2 days after introducing a vector for YAP1 overexpression into normal pluripotent stem cells by electroporation, 500 nM of RSL3 was treated for 24 hours, and the cells were stained with 7-AAD and data were collected using FACS and flowjo.

[0296] As a result, when YAP1 was overexpressed in normal pluripotent stem cells, the responsiveness to ferroptosis was significantly increased (Fig. 5i).

[0297]

[0298] Example 5. Effects of ACSL4 Knockout and Reconstitution on the Ferroptosis Sensitivity of Mutant Pluripotent Stem Cells

[0299]

[0300] Through Example 4, ACSL4 was identified as a gene that has a major influence on the ferroptosis sensitivity of mutant pluripotent stem cells.

[0301] Lipid peroxidation is a crucial process in ferroptosis. Polyunsaturated fatty acids (PUFAs) accelerate ferroptosis through a chain reaction that transfers peroxidized PUFAs to adjacent lipids. ACSL4 can promote ferroptosis by adding a CoA group to PUFAs, thereby increasing the amount of PUFA-containing phospholipids in the cell membrane (Figure 6a).

[0302]

[0303] Therefore, we sought to further investigate whether knocking down the ACSL4 gene in mutant pluripotent stem cells would affect the ferroptosis sensitivity of the mutant pluripotent stem cells.

[0304] ACSL4 was knocked out in mutant pluripotent stem cells using CRISPR-Cas9 as described in Example 1-13. As a result, a frameshift mutation was induced (Fig. 6b), confirming that ACSL4 was not expressed (Fig. 6c).

[0305]

[0306] AP staining and POU5F1 mRNA expression levels were confirmed in mutant pluripotent stem cells knocked out of ACSL4 as described in Example 1-10.

[0307] As a result, it was confirmed that there was no difference in pluripotency even when ACSL4 was knocked out in mutant pluripotent stem cells (Fig. 6d).

[0308]

[0309] After treating 1000 nM RSL3 for 3 hours in normal mutant pluripotent stem cells (WT) and mutant pluripotent stem cells with ACSL4 knockout (KD), ferroptosis reactivity was visually confirmed.

[0310] As a result, it was found that ferroptosis sensitivity was reduced in mutant pluripotent stem cells in which ACSL4 was knocked out (Fig. 6e).

[0311]

[0312] After treating 1000 nM RSL3 for 3 hours in normal mutant pluripotent stem cells (WT) and mutant pluripotent stem cells with ACSL4 knockout (KD), lipid peroxidation was confirmed using C11 BODIPY.

[0313] As a result, it was confirmed that lipid peroxidation was reduced in ACSL4 knockout mutant pluripotent stem cells (KD) compared to normal mutant pluripotent stem cells (WT) (Fig. 6f, Fig. 6g).

[0314]

[0315] Meanwhile, a cell line model was established to re-express ACSL4 in mutant pluripotent stem cells in which ACSL4 was knocked out using the TET-ON (tetracycline antibiotics, typically Doxycycline, Dox) system (Fig. 6h). In the cell line model established in this way, Dox was diluted in MACS at 1 mg / ml and treated for a total of 24 hours, and Western blotting was performed to verify that ACSL4 was actually re-expressed in mutant pluripotent stem cells in which ACSL4 was knocked out (Fig. 6i).

[0316] In this way, two independent cell line models established to re-express ACSL4 were treated with 1 mg / ml of Dox for 48 hours, and cells were treated with or without Fer-1 at a concentration of 500 nM, and then RSL3 was treated at a concentration of 3000 nM for 24 hours, and the degree of cell growth was determined using a clonogenic assay.

[0317] As a result, it was confirmed that when ACSL4 was re-expressed in mutant pluripotent stem cells in which ACSL4 was knocked out and ferroptosis was induced, ferroptosis sensitivity could be restored (Fig. 6j, Fig. 6k).

[0318]

[0319] From the above results, it was found that the sensitivity to ferroptosis during the culturing of mutant pluripotent stem cells was closely related to ACSL4.

[0320]

[0321] Example 6. Selective elimination of mutant pluripotent stem cells using ferroptosis sensitivity.

[0322]

[0323] We aimed to confirm that the mutant pluripotent stem cells could be selectively killed by inducing ferroptosis during the stem cell culture process (Fig. 7a).

[0324] Prior to the experiment, normal pluripotent stem cells and mutant pluripotent stem cells were cultured, and the expression levels of TPX2, BCL2L1, and CHCHD2, markers of mutant stem cells (culture adaptation), were confirmed at the mRNA level using the method described in Example 1-10.

[0325] As a result, it was confirmed that the expression levels of TPX2 and BCL2L1 were high and the expression level of CHCHD2 was low in the mutant pluripotent stem cells (Fig. 7b).

[0326]

[0327] Normal pluripotent stem cells and mutant pluripotent stem cells were co-cultured by mixing them in a 1:1 cell ratio and treated with a low concentration (250 nM) of RSL3 for 48 hours, and the mRNA expression level of CHCHD2, a marker of mutant stem cells (culture adaptation), was confirmed.

[0328] As a result, it was confirmed that the mRNA expression level of CHCHD2, a marker of mutant stem cells (culture adaptation), was significantly increased and restored to normal levels compared to the control group not treated with RSL3 (Fig. 7c).

[0329]

[0330] Meanwhile, normal pluripotent stem cells and mutant pluripotent stem cells were co-cultured by mixing them in a 1:1 cell ratio and treated with a low concentration (250 nM) of RSL3 for 48 hours, and the protein expression level of BCL-xL, a marker of mutant stem cells (culture adaptation), was confirmed.

[0331] As a result, it was confirmed that the protein expression level of BCL-xL, a marker of mutant stem cells (culture adaptation), was noticeably reduced and restored to normal levels compared to the control group not treated with RSL3 (Fig. 7d).

[0332]

[0333] Additionally, normal pluripotent stem cells were labeled with eGFP, co-cultured with mutant pluripotent stem cells at a 1:1 ratio, and then apoptosis or ferroptosis was induced, and fluorescence changes were observed. To induce apoptosis, 20 nM YM155 was treated for 48 h, and to induce ferroptosis, 250 nM RSL3 was treated for 48 h (Fig. 7e).

[0334] Subsequently, cell survival was quantified using a flow cytometer, and the results showed that the number of mutant pluripotent stem cells without the eGFP tag decreased when ferroptosis was induced, confirming that ferroptosis induction selectively kills mutant pluripotent stem cells. On the other hand, the mutant pluripotent stem cells were not selectively killed by apoptosis induction.

[0335] In the live cell imaging results confirming the tendency of mutant pluripotent stem cells to die due to treatment with low concentrations of RSL3, although there were differences between individuals, death of mutant pluripotent stem cells began to be observed from about 6 hours (Fig. 7g).

[0336] From these results, it was demonstrated that selective elimination of mutant pluripotent stem cells is possible by treatment with low concentrations of compounds that induce ferroptosis.

[0337]

[0338] Example 7. Confirmation of the integrity of normal pluripotent stem cells following selective removal of mutant pluripotent stem cells using ferroptosis sensitivity.

[0339]

[0340] When culturing stem cells using ferroptosis sensitivity to selectively kill only mutant stem cells, normal stem cells must not lose their ability as stem cells.

[0341] To confirm this, normal pluripotent stem cells were treated with 250 nM RSL3, and the growth curve over time was confirmed through live-cell imaging, and cell morphology was observed after 48 hours.

[0342] As a result, it was observed that growth was somewhat delayed in normal pluripotent stem cells treated with RSL3 (Fig. 8a), but there was no significant change in cell morphology (Fig. 8b).

[0343]

[0344] Meanwhile, normal pluripotent stem cells were treated with 250 nM of RSL3 for 48 hours, and the pluripotency markers of stem cells, such as AP activity and the expression level of OCT4 (Gene name POU5F1), were confirmed using the method described in Example 1-7.

[0345] As a result, the pluripotency marker of stem cells in normal pluripotent stem cells treated with RSL3 did not show a significant difference from before RSL3 treatment, confirming that differentiation ability, which is a major function of stem cells, was maintained (Fig. 8c, Fig. 8d).

[0346]

[0347] Normal pluripotent stem cells were treated with 250 nM RSL3 for 48 hours, followed by a 24-hour recovery time (with normal MACS media) to induce spontaneous differentiation. Spontaneous differentiation is the most common method for examining the differentiation potential of stem cells, in which stem cells are randomly differentiated by providing FBS and growth factors. Afterwards, time-dependent RNA harvest was performed for 15 days, and the ability to differentiate into the 3-germ layer was confirmed through the expression of each marker using the method described in Example 1-10. / AFP and SOX17 are markers of endoderm, MSX1 and T are markers of mesoderm, and PAX6 and NESTIN are markers of ectoderm.

[0348] As a result, it was possible to verify in vitro that the differentiation ability of normal pluripotent stem cells was maintained even when ferroptosis was induced by treating with low concentrations of RSL3 (Fig. 8e).

[0349]

[0350] To verify this effect in vivo, normal stem cells not treated with RSL3 and normal stem cells treated with RSL3 (250 nM, 48 hours) were collected at a density of approximately 3X10 7 After injection into the testis of significantly immunodeficient mice (BALB / C nude, Orient Bio, 3 mice in the experimental group and 2 mice in the control group) with the same cell number, teratoma was developed, harvested, and 3-germ layer differentiation was confirmed by hematoxylin & eosin (H&E) tissue staining (IHC). The pictures were taken at 40X using an Olympus microscope.

[0351] As a result, it was possible to verify in vivo that the differentiation ability of normal pluripotent stem cells was maintained even when ferroptosis was induced by treating with low concentrations of RSL3 (Fig. 8f, 8g).

[0352]

[0353] Through the above results, it was found that when a ferroptosis-inducing compound is treated at an appropriate concentration during the process of culturing stem cells, mutant stem cells can be selectively eliminated, and only normal stem cells with normal differentiation potential can be selectively cultured.

[0354]

[0355] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0356]

[0357] [National Research and Development Project Supporting This Invention]

[0358] [Project ID] 1711179437

[0359] [Assignment Number] 00070316 (RS-2022-00070316)

[0360] [Ministry Name] Ministry of Science and ICT

[0361] [Name of Project Management (Specialist) Institution] (Foundation) Inter-Ministry Regenerative Medicine Technology Development Project Group

[0362] [Research Project Name] Inter-Ministry Regenerative Medicine Technology Development Project

[0363] [Research Project Name] Development of a Safety-Ensuring Technology Capable of Detecting and Removing Culture-Adapted Pluripotent Stem Cells Due to Genomic Mutations

[0364] [Name of the project performing organization] Seoul National University Industry-Academic Cooperation Foundation

[0365] Research Period: April 1, 2022 - December 31, 2026

Claims

1. A medium composition for stem cell culture containing a ferroptosis inducer.

2. A stem cell culture medium composition in claim 1, wherein the ferroptosis inducer is at least one selected from the group consisting of RSL3, erastin, imidazole ketone erastin (IKE), sulfasalazine, sorafenib, altretamine, artesunate, ML-162, and ML-210.

3. A stem cell culture medium composition in claim 1, wherein the stem cells are pluripotent stem cells or induced pluripotent stem cells.

4. A stem cell culture medium composition according to claim 1, characterized in that the medium composition maintains the differentiation potential of normal stem cells while selectively removing culture-adapted mutant stem cells.

5. A stem cell culture medium composition according to claim 4, characterized in that the culture-adapted mutant stem cells have an increased expression level of ACSL4 and / or YAP1 compared to normal stem cells.

6. A method for selectively removing mutant stem cells from stem cells, comprising the step of culturing the stem cells by treating them with a ferroptosis inducer.

7. A method for selectively removing mutant stem cells from stem cells in claim 6, wherein the ferroptosis inducer is at least one selected from the group consisting of RSL3, erastin, imidazole ketone erastin (IKE), sulfasalazine, sorafenib, altretamine, artesunate, ML-162, and ML-210.

8. A method for selectively removing mutant stem cells from stem cells, characterized in that in paragraph 6, the ferroptosis inducer is RSL3, and RSL3 is treated at a concentration of 100 nM to 1000 nM for 10 to 48 hours.

9. A method for selectively removing mutant stem cells from stem cells, characterized in that in paragraph 6, the method maintains the differentiation capacity of normal stem cells while selectively removing culture-adapted mutant stem cells.

10. A method for selectively removing mutant stem cells from stem cells, wherein the culture-adapted mutant stem cells in paragraph 9 have an increased expression level of ACSL4 and / or YAP1 compared to normal stem cells.

11. A composition of a reagent for removing mutant stem cells, comprising a ferroptosis inducer as an effective ingredient.

12. A composition of reagents for eliminating mutant stem cells, wherein the ferroptosis inducer is at least one selected from the group consisting of RSL3, erastin, imidazole ketone erastin (IKE), sulfasalazine, sorafenib, altretamine, artesunate, ML-162, and ML-210.

13. A reagent composition for removing mutant stem cells, characterized in that in claim 11, the reagent composition maintains the differentiation capacity of normal stem cells while selectively removing culture-adapted mutant stem cells.

14. A reagent composition for removing mutant stem cells, characterized in that the culture-adapted mutant stem cells in the 13th paragraph have an increased expression level of ACSL4 and / or YAP1 compared to normal stem cells.

Citation Information

Patent Citations

  • Method for controlling formation of teratoma by selectively inducing apoptosis of human undifferentiated induced pluripotent stem cells

    KR1020140047545A

  • A pepper harvesting machine having a couple of devices for seperating fruit

    KR1020210111388A

  • Massage apparatus

    KR1020240043874A

  • Apparatus for preventing damage to the rear of dump truck

    KR102730182B1