Mesh chip

The capture surface with metapolonies and unique barcode regions addresses the high cost and scalability issues in spatial transcriptomics and proteomics, enabling efficient spatial mapping and decoding from sequencing data.

WO2025153496A1PCT designated stage expired Publication Date: 2025-07-24BENSON ERIK +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/050806
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-15
Filing Date
2025-01-14
Publication Date
2025-07-24

AI Technical Summary

Technical Problem

Current methods for spatial transcriptomics and spatial proteomics are labor-intensive and expensive, making large-scale use nearly impossible due to the high cost of capture surface production and sequencing.

Method used

A method for creating a capture surface with metapolonies, each comprising capture probes with two unique barcode regions, generated from orthogonal polony types, allowing for efficient spatial mapping of target molecules by encoding neighbor polony barcode information and enabling dense, cost-effective production.

Benefits of technology

The method enables high-resolution, scalable, and cost-effective spatial mapping of target molecules by decoding spatial distribution from sequencing information alone, overcoming the limitations of prior art.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000090_0001
    Figure IMGF000090_0001
  • Figure IMGF000091_0001
    Figure IMGF000091_0001
  • Figure IMGF000091_0002
    Figure IMGF000091_0002
Patent Text Reader

Abstract

The present invention relates to a method for creating a capture surface for at least one target molecule, such as an mRNA molecule, in a sample, wherein each target molecule comprises a target nucleic acid region. The invention also relates to a capture surface for said at least one target molecule that is suitable for determining spatial location of the at least one target molecule in the sample, a kit comprising said capture surface as well as a method for creating a spatial map of said at least one target molecule present in the sample using said capture surface.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] MESH CHIP

[0002] Technical Field

[0003] The present invention relates to a method for creating a capture surface for at least one target molecule, such as an mRNA molecule, in a sample, wherein each target molecule comprises a target nucleic acid region. The invention also relates to a capture surface for said at least one target molecule that is suitable for determining spatial location of the at least one target molecule in the sample, a kit comprising said capture surface as well as a method for creating a spatial map of said at least one target molecule present in the sample using said capture surface.

[0004] Background

[0005] Proteomics includes the study of the proteome, i.e. the proteins expressed in an organism, while transcriptomics study the transcriptome of an organism, i.e. the RNA transcripts in an organism. These techniques are used for studying gene expression and protein profile of an organism. Spatial transcriptomics aims to determine the number of transcripts of a gene at distinct spatial locations in a sample, such as a tissue, and similarly, spatial proteomics aims to localize and quantify proteins within subcellular structures (samples).

[0006] Although a number of techniques exist for performing spatial transcriptomics and spatial proteomics, these techniques suffer from a number of draw-backs, making them labor intensive and expensive. Several methods exist where a capturing surface or chip is used for capturing a target molecule, such as RNA or proteins on the surface, followed by sequencing and identification of the captured target molecule. However, the methods of making said capture surfaces are typically very expensive, or the read out methods labor intensive, making large scale use of them nearly impossible. Accordingly, enhanced methods for proving such capture surfaces and for performing spatial transcriptomics and spatial proteomics are needed. Summary

[0007] An object of the present disclosure is to provide novel methods and means for determining spatial location of one or more target molecules in a sample. The object is obtained by a capture surface that specifically binds said one or more target molecules via a target nucleic acid region present in said one or more target molecules.

[0008] In some aspects are provided a method for creating a capture surface for at least one target molecule in a sample, each target molecule comprising a target nucleic acid region, wherein said method comprises generating at least one metapolony comprising at least one capture probe linked to a surface; wherein each capture probe of a metapolony comprises a first and a second unique barcode region that are unique for said metapolony and a region capable of binding the target nucleic acid region of said at least one target molecule; wherein each meta polony is generated from a polony of a first polony type and a polony of a second polony type grown on said surface; and wherein the second unique barcode region and the region capable of binding the target nucleic acid region are obtained in each capture probe by (i) extending a cleaved nucleic acid strand of a modified polony of the first polony type using a neighboring cleaved nucleic acid strand of a modified polony of the second polony type as template for said extension, wherein the cleaved nucleic acid strand extended in step (i) comprises said first unique barcode region that is unique for said modified polony of the first polony type and said neighboring cleaved nucleic acid strand comprises a reverse complement of said second unique barcode region that is unique for said modified polony of the second polony type.

[0009] In some embodiments, the method prior to step (i) comprises (ii) obtaining said modified polonies of said first and said second polony types from the polonies of said first and said second polony types grown on the surface.

[0010] In some embodiments, the method subsequent to step (i) comprises (iii) a selective substantial removal of each cleaved nucleic acid strand of said modified polonies of the second polony type. In some embodiments, said method comprises in step (iii) a cleavage of each extended cleaved nucleic acid strand of said modified polonies of the first polony type obtained in step (i), wherein said region capable of binding the target nucleic acid region is obtained at the distal end, such as at the 3'- end, of each capture probe.

[0011] In some embodiments, the method prior to step (i) and / or step (ii) comprises (iv) generating each polony of said first and said second polony types by bridge amplification on said surface, wherein said modified polonies of said first and said second polony types are obtainable from said polonies generated in step (iv).

[0012] In some aspects are provided a capture surface for at least one target molecule in a sample, each target molecule comprising a target nucleic acid region, said capture surface comprising a surface and a plurality of metapolonies, each metapolony comprising a plurality of capture probes linked to said surface, wherein each capture probe of a metapolony comprises a first and a second unique barcode region that are unique for said meta polony and a region capable of binding the target nucleic acid region of said at least one target molecule.

[0013] In some embodiments, the combination of the first and the second unique barcode regions encoded by a capture probe indicates information about the spatial position of said capture probe on said surface.

[0014] In some embodiments, said plurality of metapolonies are generated from a plurality of polonies of two orthogonal polony types grown on said surface.

[0015] In some embodiments, the capture surface is manufactured using the method as defined above.

[0016] In some aspects are provided a method for creating a spatial map of a plurality of target molecules in a sample, each target molecule comprising a target nucleic acid region, said method comprising

[0017] (a) capturing a plurality of target molecules using a capture surface as defined above,

[0018] (b) extending each capture probe of said capture surface that binds a target molecule of said plurality of target molecules based on a nucleic acid sequence region of the captured target molecule; (c) producing a sequenceable library of a plurality of extended capture probes obtained in step (b);

[0019] (d) sequencing said sequenceable library obtained in step (c);

[0020] (e) defining the spatial position of said plurality of extended capture probes on the capture surface based on the information indicated by the combinations of the first and the second unique barcode regions encoded by each of said plurality of extended capture probes;

[0021] (f) creating a spatial map of said plurality of target molecules in said sample based on the spatial position of said plurality of extended capture probes and the nucleic acid sequence regions of the captured plurality of target molecules.

[0022] In some embodiments, said spatial position in step (d) is a relative spatial position obtained for each extended capture probe relative to other extended capture probes of said plurality of extended capture probes.

[0023] In some embodiments, said spatial map defines the spatial position of said plurality of target molecules. In some embodiments, said spatial position of said plurality of target molecules is a relative spatial position obtained for each target molecule relative to other target molecules of said plurality of target molecules. In some embodiments, said spatial position of said plurality of target molecules is an absolute spatial position obtained for each target molecule in said sample.

[0024] In some aspects are provided a kit comprising a capture surface as defined above and instructions for use thereof.

[0025] Brief description of the drawings

[0026] Figure 1 shows a schematic of double stranded template nucleic acid strands of a first set of template nucleic acid strands (A; alpha seed) and of a second set set of template nucleic acid strands (B; beta seed) suitable as seeds for generating two types of polonies on the surface as demonstrated in the appended Examples. Each strand is composed of several domains including a random unique molecular identifer (UMI) region, and terminated at either end with domains complementary to primers imoblized on the surface for the bridge PCR reaction. (UMI: unique barcode region; A, B, C and D regions correspond to nucleic acid sequences of A, B, C and D primers linked to the surface; LT bridge: low temperature bridge region; Amp primer: forward primer binding region suitable for amplification for sequencing; Capture: a region capable of binding to a target nucleic acid region; rc: reverse complement of the respective regions)

[0027] Figure 2 shows agarose gel electrophoresis of seed strands obtained in a PCR reaction, as described in Example 2. Alpha and Beta strands before and after purification were loaded on a 2 % agarose gel and run together with gene ruler 100 BP ladder (Thermo Fisher Scientific, Waltham, Massachusetts, USA) for 40 minutes at 120 V. The gel was then stained with Thermo fisher SYBR gold dye (Thermo Fisher Scientific, Waltham, Massachusetts, USA).

[0028] Figure 3 shows a schematic of a process for generating a capture surface according to the present disclosure and as described in Examples 3-5, starting with seeding of a surface with a dense lawn of four primer types forming two oligonucleotide pairs (A-B and C-D, respectively) that are capable of amplifying template nucleic acid strands of the first and the second set of template nucleic acid strands (Alpha and Beta seed strands), respectively. This is followed by seeding of the template nucleic acid strands and bridge PCR to locally amplify the seed strands to form polonies of two polony types, wherein each polony encodes a uniqe barcode region (UMI). Finally, the polonies are postprocessed to copy sequence information from one polony type to another.

[0029] Figure 4 shows a detailed schematic of surface seeding (A), bridge amplification (bridge PCR; B) and post-processing (C and D) for generating a single capture probe according to the description in Examples 3-5, wherein the sequence regions are depicted in detail. Figure 4A presents annealing of a single stranded Alpha seed strand and a single stranded Beta seed strand to a surface-linked A and C primer, respectively, the extension of A and C primers using the seed strands as templates for said extension as well as the nucleic acid strands obtained by said extension after removal of the template nucleic acid strands from the surface. Figure 4B demonstrates bridge annealing and extension during bridge amplification of the seeded strands using the nucleic acid strands obtained according to Figure 4A and the respective surface-linked primer pair of A (B) and C (D), wherein two polonies of two polony types are generated. Figure 4C shows selective substantial removal and cleavage of nucleic acid strands obtained by the bridge amplification using an EcoRI restriction enzyme, wherein modified polonies of the polony types are obtained. Nucleic acid strands obtained by the extension of B and C primers are selectively substantially removed and nucleic acid strands obtained by the extension of A and D primers are cleaved. The cleaved nucleic acid strand of the modified polony of the first polony type that derives from the nucleic acid strand obtained by the extension of the A primer comprises a first unique barcode region (UMI) and a low temperature bridge region (LT bridge). The cleaved nucleic acid strand of the modified polony of the second polony type that derives from the nucleic acid strand obtained by the extension of the D primer comprises a reverse complement of a second unique barcode region (rcUMI), a reverse complement of the low temperature bridge region (rcLT bridge) and a reverse complement of a region capable of binding to a target nucleic acid region (rcCapture). Figure 4D shows further steps of a post-processing demonstrated in the Examples. Firstly, the cleaved nucleic acid strands of the modified polonies of the two polony types hybridize at the low temperature bridge region and the reverse complement thereof (LT bridge and rcLT bridge) and the cleaved nucleic acid strand of the modified polony of the first polony type is elongated based on the nucleic acid sequence of the cleaved nucleic acid strand of the modified polony of the second polony type. Sequence regions upstream from the rcLT bridge region (i.e. regions that are located more proximally) in the cleaved nucleic acid strand of the modified polony of the second polony type are copied into the cleaved nucleic acid strand of the modified polony of the first polony type. The second UMI (UMI) and the region capable of binding to the target nucleic acid region (Capture) are obtained in a capture probe of a metapolony by the extension (i.e. the above described hybridization and elongation). Figure 4D further shows that the cleaved nucleic acid strand of the modified polony of the second polony type is selectively substantially removed from the surface and the extended cleaved nucleic acid strand of the modified polony of the first polony type is cleaved downstream from the region capable of binding to the target nucleic acid region (Capture) by enzymatic cleavage using Bspll9l, such as the region capable of binding to the target nucleic acid region (Capture) is obtained at the distal end, such as at the 3'-end, of the capture probe. (UMI: unique barcode region; A, B, C and D regions correspond to nucleic acid sequences of A, B, C and D primers linked to the surface and A, B, C and D are primers linked to the surface, respectively; LT bridge: low temperature bridge region; Amp primer: forward primer binding region suitable for amplification for sequencing; Capture: a region capable of binding to a target nucleic acid region; rc: reverse complement of the respective regions)

[0030] Figure 5 shows representative microscope images of two types of polonies grown simultaneously at different seed concentrations on a surface as described in Examples 3 and 4. Surfaces were seeded with either 60 pM or 600 pM of each of Alpha and Beta seed strands and grown via bridge PCR for 35 cycles. The two polony types were labelled by fluorescent DNA probes and imaged by microscope. View size is 100 pm.

[0031] Figure 6 shows agarose gel electrophoresis of DNA strands recovered from a capture surface according to the present disclosure following a first and a second PCR reaction, as described in Example 6. The product of the first and second PCR before and after purification were loaded in a 2 % agarose gel and run together with gene ruler 100 BP ladder (Thermo Fisher Scientific, Waltham, Massachusetts, USA) for 40 minutes at 120 V. The gel was then stained with Thermo fisher SYBR gold dye (Thermo Fisher Scientific, Waltham, Massachusetts, USA).

[0032] Figure 7 shows sequencing data of DNA strands recovered from a capture surface as described in Example 7. Figure 7A shows the results of extracting the two unique barcode regions (the first and second barcode regions, UMI_1 and UMI_2, respectively) from read sequences, dominated by UMI's of the expected length of 24 nt. Figure 7B shows a small region of the reconstructed surface graph from the sequenced data. Figure 8 shows an exemplary process of using a capture surface according to the present disclosure for the spatial mapping of mRNA in tissue, as described in Example 8. A thin tissue section is placed on top of the capture surface. mRNA molecules present in said tissue diffuse down and hybridize via their poly-alanine tail to the target binding nucleic acid sequence (in this case to the poly-thymidine sequence) in the region of the capture probes that is capable of binding to the target nucleic acid region. The mRNA sequence information is copied onto the surface through cDNA synthesis followed by template switching, second strand synthesis, surface release of all (extended and non-extended) capture probes and the amplification of the of the extended capture probes creating a product (such as a sequenceable library) that can be sequenced using paired end sequencing.

[0033] Figure 9 shows sequences corresponding to SEQ ID NO:7, 8, 17-34 and 37-42 as referred to herein (Figure 9A-D).

[0034] Detailed description

[0035] The present disclosure relates to new capture surfaces for determining spatial location of one or more target molecules in a sample. The capture surfaces specifically bind said one or more target molecules via a target nucleic acid region present in said one or more target molecules. The present disclosure also relates to methods for creating capture surfaces as disclosed herein. The capture surfaces may be used in methods for creating a spatial map of a plurality of target molecules in a sample.

[0036] The aim of the present disclosure is to provide new capture surfaces for determining spatial location of one or more target molecules in a sample, which are also useful in creating a spatial map of a plurality of target molecules in a sample.

[0037] Aspects of the present disclosure will be described more fully hereinafter with reference to the accompanying drawings. The capture surfaces and methods disclosed herein can, however, be realized in many different forms and should not be construed as being limited to the aspects set forth herein. The terminology used herein is for the purpose of describing particular aspects of the disclosure only, and is not intended to limit the disclosure. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0038] In some embodiments a non-limiting term "polony" is used. The term "polony" as referred to herein is a so-called polymerase colony, i.e. a colony of DNA nucleic acid strands. Polonies are discrete clonal amplifications of a single DNA nucleic acid strand. In other words, a polony comprises nucleic acid strands (i.e. DNA nucleic acid strands), wherein each nucleic acid strand comprises a nucleic acid sequence corresponding to either the forward or the reverse read of the nucleic acid sequence of the DNA nucleic acid strand which was used to generate the polony. Said DNA nucleic acid strands are also referred to herein as "template nucleic acid strands", "seeds" and "seed strands". It is to be understood that a seed strand used for generating a polony is a single stranded nucleic acid strand that corresponds to either the forward or the reverse strand of a double stranded seed strand. A polony as referred to herein is grown on a surface using said clonal amplification. Accordingly, nucleic acid strands of a polony as referred to herein are coupled to the surface via their 5'-end. It is to be understood that each nucleic acid strand of a polony is a single stranded nucleic acid strand linked to the surface according to the present disclosure. As explained above, a polony comprises single stranded nucleic acid strands, which single stranded nucleic acid strands are the reverse complement of each other. Accordingly, said single stranded nucleic acid strands of a polony may thus form double stranded nucleic strands on the surface, as demonstrated in the drawings. It is to be understood that said double stranded nucleic strands are formed during the cleavage at the first cleavage site of said nucleic acid strands, as explained below.

[0039] In some embodiments a non-limiting term "polony type" is used. The term

[0040] "polony type" as referred to herein corresponds to a set of polonies that are or may be generated by clonal amplification of a set of template nucleic acid strands, wherein each template nucleic acid strand can be amplified using the same oligonucleotide pair. Each template nucleic acid strand of said set of template nucleic acid strands comprises at least one sequence region that is unique for the respective template nucleic acid strand in said set, which may be referred to as a unique barcode region as explained below.

[0041] In some embodiments a non-limiting term "modified polony" is used. The term "modified polony" as referred to herein is obtainable from a polony, by performing certain modifications to said polony, such as cleaving the nucleic acid strands and substantially removing either the nucleic acid strands that comprise the nucleic acid sequence corresponding to the reverse read or the forward read of the nucleic acid sequence of the template nucleic acid strand used to generate the polony. A modified polony comprises cleaved nucleic acid strands. The cleaved nucleic acid strands derive from the nucleic acid strands from which the modified polony is obtained. In particular, each of said cleaved nucleic acid strands derives from nucleic acid strands of the polony that comprise the nucleic acid sequence corresponding to the forward read of the nucleic acid sequence of the template nucleic acid strand which was used to generate the polony; or each of said cleaved nucleic acid strands derives from nucleic acid strands of the polony that comprise the nucleic acid sequence corresponding to the reverse read of the nucleic acid sequence of the template nucleic acid strand which was used to generate the polony. Respectively, in a modified polony, nucleic acid strands of the polony, from which the modified polony is obtained, comprising the nucleic acid sequence corresponding to the reverse read of the nucleic acid sequence of the template nucleic acid strand, which was used to generate the polony, are selectively substantially removed; or nucleic acid strands of the polony, from which the modified polony is obtained, comprising the nucleic acid sequence corresponding to the forward read of the nucleic acid sequence of the template nucleic acid strand, which was used to generate the polony, are selectively substantially removed. In context of the present disclosure, sequence information encoded by polonies of different polony types is transferred between modified polonies of the two polony types, which is considered advantageous. This is thought to be useful in controlling desired hybridization events between nucleic acid strands present on the surface, as sequence information transfer between modified polonies of the two polony types is separated from the generation of polonies of the two polony types.

[0042] In some embodiments a non-limiting term "metapolony" is used. The term "metapolony" as referred to herein is obtainable from two overlapping or neighboring modified polonies of two polony types, such as a first and a second polony types. Accordingly, a metapolony is considered to be generated from a modified polony of a first polony type and a modified polony of a second polony type, moreover, is considered to be generated from a polony of the first polony type and a polony of the second polony type from which said modified polonies are obtained. Overlapping polonies, and in particular, surfaces that have been saturated by overlapping polonies, of the two polony types are considered particularly beneficial for superior network formation in context of the present disclosure. Thus, said polonies of the two polony types, from which the modified polonies (and the metapolonies) are generated, may be overlapping polonies, such as overlapping polonies saturating the surface. Accordingly, said modified polonies of the two polony types from which the metaplonies are obtained may also preferably be overlapping. A meta polony comprises extended cleaved nucleic acid strands and / or capture probes that comprise nucleic acid sequence information encoded by a cleaved nucleic acid strand of a modified polony of the first polony type and a cleaved nucleic acid strand of a modified polony of the second polony type. Said information is obtained by elongating the cleaved nucleic acid strand of a modified polony of the first polony type based on the nucleic acid sequence of said cleaved nucleic acid strand of a modified polony of the second polony type. The term "elongating a nucleic acid strand based on a nucleic acid sequence of another nucleic acid strand" corresponds to the use of said nucleic acid sequence as template for extending said nucleic acid strand that is elongated, for example in an enzymatic reaction using a DNA polymerase. In a metapolony that comprises capture probes according to the present disclosure, cleaved nucleic acid strands of modified polonies of the second polony type may be selectively substantially removed. Metapolonies being generated from two overlapping or neighboring modified polonies of two polony types, such as a first and a second polony type, will comprise a unique barcode region from each polony, i.e. a first and a second unique barcode region, which combination will be unique for said metapolony, and which combination will be used for mapping the location of the metapolony on the surface.

[0043] In some embodiments a non-limiting term "capture probe" is used. The term "capture probe" as referred to herein is a nucleic acid strand that derives from an extended cleaved nucleic acid strand of a metapolony and it comprises a first and a second unique barcode region and a region capable of binding a target nucleic acid region of at least one target molecule according to present disclosure. Accordingly, after further cleavage of extended cleaved nucleic acid strands of a metapolony, the metapolony comprises capture probes.

[0044] In some embodiments a non-limiting term "orthogonal" is used. The term "orthogonal" as referred to herein defines that two or more entities comprising a nucleic acid sequence, for example two or more nucleic acid strands, two or more oligonucleotides, two or more nucleic acid sequence regions, two or more polonies and / or two or more polony types, are non-interacting, i.e. comprise primarily different nucleic acid sequences. The term "orthogonal" as used herein refers to that said two or more entities comprise substantially different sequence information which denote these two or more entities as two different classes of nucleic acid molecules. Such two different classes of nucleic acid molecules are for example Alpha and Beta seed strands as described below in Example 1.

[0045] In some embodiments non-limiting terms "distal" and "distally" as well as "proximal" and "proximally" are used. The terms "distal" and "distally" as well as "proximal" and "proximally" as referred to herein are used with respect to the surface as disclosed herein. For example, a sequence region that is more distally positioned in a surface-linked nucleic acid strand than another nucleic acid sequence region of the surface-linked nucleic acid strand means that said sequence region is further away from the point of attachment of said nucleic acid strand on the surface. Thus, if a nucleic acid strand that is linked to the surface via the 5'-end thereof, the more distally positioned sequence region is closer to the 3'-end of said nucleic acid strand than the other nucleic acid region. Accordingly, said 3'-end is the distal end of said surface-linked nucleic acid strand. Vice versa, a sequence region that is more proximally positioned in a surface-linked nucleic acid strand than another nucleic acid sequence region of the surface-linked nucleic acid strand means that said sequence region is closer to the point of attachment of said nucleic acid strand on the surface. Thus, if a nucleic acid strand that is linked to the surface via the 5'-end thereof, the more proximally positioned sequence region is closer to the 5'-end of said nucleic acid strand than the other nucleic acid region. Accordingly, said 5'-end is the proximal end of said surface-linked nucleic acid strand.

[0046] In some embodiments a non-limiting term "unique barcode region" is used. The term "unique barcode region" as used herein is a nucleic acid sequence region of a nucleic acid strand comprising or consisting of a short random nucleotide sequence. The terms "unique barcode region" and "UMI" i.e. "unique molecular identifier" are used interchangeably herein. Unique barcode regions are also known as molecular barcodes or random barcodes. Unique barcode regions as referred to herein are unique for each polony grown on the surface, for each modified polony that is obtained therefrom as well as for each meta polony of the capture surface according to the present disclosure. It is to be understood that the same unique barcode region is encoded by polony and a modified polony that derives from said polony. Furthermore, the unique barcode regions, such as said first and said second unique barcode regions, encoded by a metapolony are the same unique barcode regions encoded by the two overlapping or neighboring modified polonies of two polony types from which the metapolony derives. Accordingly, each nucleic strand of a polony comprises the same unique barcode region or the reverse complement thereof. Moreover, each cleaved nucleic acid strand of a modified polony comprises the same unique barcode region or each cleaved nucleic acid strand of a modified polony comprises the reverse complement of the same unique barcode region. Similarly, each extended cleaved nucleic acid strand and each capture probe of a metapolony comprises the same unique barcode regions, which combination is unique for each metepolony. In addition, each template nucleic acid strand of a set of template nucleic acid strands according to the present invention encodes a unique barcode region that is unique in said set of template nucleic acid sequences. It is to be understood, that a unique barcode region encoded by a template nucleic acid strand is the same unique barcode region that is encoded by the polony which is generated by clonal amplification using said template nucleic acid strand as seed.

[0047] In some embodiments a non-limiting term "surface" is used. The term "surface" as referred to herein is a type is surface that is suitable for growing (i.e. generating) one or more polony therein and / or thereon. The surface may be three dimensional. The surface may comprise a matrix, such as a hydrogel. Alternatively, the surface or the substrate as referred to herein may constitute a matrix, such as a hydrogel. The terms "surface" and "substrate" may be used interchangeably herein.

[0048] In some embodiments a non-limiting term "oligonucleotide" is used. The terms "primer", "oligo" and "oligonucleotide" are used interchangeably herein and refer to nucleic acid strands which may be used in an amplification reaction according to the present disclosure for amplifying a template nucleic acid strand.

[0049] In some embodiments a non-limiting term "low temperature bridge region" is used. The term "low temperature bride region" as referred to herein is a nucleic acid sequence region of a nucleic acid strand which is capable of hybridizing to a nucleic acid sequence region comprising the reverse complement of said low temperature bride region of another nucleic acid strand at a low temperature. It is to be understood that said low temperature is a temperature at which other regions of said nucleic acid strands do not hybridize. The low temperature bridge region enables two nucleic acid strands, such as said cleaved nucleic acid strands of two modified polonies of the two polony types, to hybridize. It is designed so that the hybridization occurs at a lower temperature than what is used in the bridge amplification according to the present disclosure to enable interaction only in the post-processing steps. Said low temperature bridge region is a type of "bridge region". Accordingly, the term "bridge region" as referred to herein denotes a nucleic acid sequence region which enables hybridization of two nucleic acid strands, such as two cleaved nucleic acid strands a two modified polonies of two polony types, as explained below, which do not hybridize in the bridge amplification according to the present disclosure. This is considered advantageous in context of the present disclosure, as generation of the two polony types and the sequence information transfer between these two polony types is separated. This is thought to be useful in controlling desired hybridization events between nucleic acid strands present on the surface.

[0050] In some embodiments a non-limiting term "neighboring" is used. The term "neighboring" as referred to herein denotes that two entities according to the present disclosure, such as a cleaved nucleic acid strand of a modified polony of the first polony type and a cleaved nucleic acid strand of a modified polony of the second polony type, a polony of the first polony type and a polony of the second polony type as well as a modified polony of the first polony type and a modified polony of the second polony type, are in close proximity. A cleaved nucleic acid strand of a modified polony of the first polony type and a cleaved nucleic acid strand of a modified polony of the second polony type are neighboring if they are capable of hybridizing. A modified polony of the first polony type and a modified polony of the second polony type are neighboring and / or overlapping if a meta polony may be derived therefrom. A polony of the first polony type and a polony of the second polony type are neighboring and / or overlapping if a meta polony may be derived from modified polonies originating from these polonies.

[0051] As used herein, the term "Y capable of binding X", wherein Y is a region, such as a nucleic acid strand sequence region and X is a target nucleic acid region, refers to that said regions are able to hybridize, i.e. are the reverse complement of each other.

[0052] In some embodiments non-limiting terms "selective substantial removal of X" and / or "X is selectively substantially removed" is used, wherein X is a nucleic acid strand, such as a nucleic acid strand of a polony and / or a cleaved nucleic acid strand of a modified polony and / or a metapolony, linked to a surface as disclosed herein. The terms "selective substantial removal of X" and / or "X is selectively substantially removed" as referred to herein define that said nucleic acid strands are removed from said surface to such extent that any nucleic acid region thereof that remains linked to the surface is unable to anneal to any surface-linked, and not selectively substantially removed, nucleic acid strand, such as a nucleic acid strand of a polony and / or a cleaved nucleic acid strand of a modified polony and / or a metapolony. Remaining surface-linked nucleic acid regions of selectively substantially removed nucleic acid strands do not comprise any unique barcode region and / or the low temperature bridge region, or the reverse complement of these regions.

[0053] In some embodiments non-limiting terms "selective complete removal of X" and / or "X is selectively completely removed" is used, wherein X is a capture probe and / or a first oligonucleotide, linked to a surface, as disclosed herein. The terms "selective complete removal of X" and / or "X is selectively completely removed" as referred to herein define the complete removal of X from the surface. For example, a nucleic acid sequence that enables said selective complete removal of a capture probe may thus be located at the most proximal, such as at the 5'-end, of said capture probe, as demonstrated by the present inventors. However, a nucleic acid sequence that enables said selective complete removal of X may be located more proximally from said most proximal end, such as said 5'-end, of the capture probe. Importantly, said selective complete removal defines that the selectively completely removed capture probe comprises a first and a second unique barcode region according to the present disclosure. Accordingly, the nucleic acid sequence that enables said selective complete removal of a capture probe may thus be located more proximal, such as upstream, from said first and said second barcode region.

[0054] The term "selective" in the above describe terms "selective substantial removal of X" and / or "selective complete removal of X" refers herein to that a selected set of entities, such as nucleic acid strands, cleaved nucleic acid strands, oligonucleotides and capture probes according to the present disclosure, can be selectively removed from the surface as defined herein. Said selectivity is encoded by the nucleic acid sequences of said set of entities. In some embodiments non-limiting terms "upstream" and "downstream" are used. The term "upstream" as referred to herein is to be understood in a context wherein a nucleic acid sequence region is positioned upstream from another nucleic acid sequence region in a nucleic acid strand, i.e. is located towards the 5'-end of a single-stranded nucleic acid, located towards the 5'-end of the forward strand of a double-stranded nucleic acid, located towards the 5'-end of the reverse strand of a double-stranded nucleic acid and / or located towards the 5'-end of a doublestranded nucleic acid (i.e. if the forward or the reverse strand of a double-stranded nucleic acid is not defined, it is to be understood with reference to the forward strand). The term "downstream" as referred to herein is to be understood in a context wherein a nucleic acid sequence region is positioned downstream from another nucleic acid sequence region in a nucleic acid strand, i.e. located towards the 3'-end of a single-stranded nucleic acid, located towards the 3'-end of the forward strand of a double-stranded nucleic acid, located towards the 3'-end of the reverse strand of a double-stranded nucleic acid, located towards the 3'-end of a double-stranded nucleic acid (i.e. if the forward or the reverse strand of a doublestranded nucleic acid is not defined, it is to be understood with reference to the forward strand).

[0055] In some embodiments, non-limiting terms "consecutive", "consecutively", "inconsecutive" and "inconsecutively" are used. The terms "consecutive" and "consecutively", as referred to herein, denote that two nucleic acid sequence regions follow each other in a nucleic acid strand continuously. The terms "inconsecutive" and "inconsecutively", as referred to herein, denote that two nucleic acid sequence regions do not follow each other in a nucleic acid strand continuously. For example, in some embodiments of the present disclosure, two nucleic acid sequence regions in a nucleic acid strand may be inconsecutive, wherein a spacer region according to the present disclosure may be positioned between said nucleic acid regions.

[0056] In some embodiments, a non-limiting term "sequenceable library" is used. As used herein, the term "sequenceable library" denotes a pool of DNA fragments containing adapter sequences compatible with a specific sequencing platform and indexing barcodes for individual sample identification. Preparation of a sequencable library according to the present disclosure is for example demonstrated in Fig. 8 and Examples 6-8.

[0057] Spatial transcriptomics refers to methods for studying cell states and how their genes vary in space across a tissue, which enables profiling of relationships in development, physiology, and pathology. Similarly, spatial proteomics analysis may reveal disease-specific molecular signatures in their native tissue context, directly from tissue slices. For the purpose of explaining the methods and advantages of the present disclosure, examples using spatial transcriptomics may be used. It should be noted however that the same would apply to spatial proteomics, where the surfaces would be adapted for protein capture.

[0058] In spatial transcriptomics, a surface for spatial barcoding of mRNA in tissues will feature an array of capture spots (consisting of DNA strands linked to the surface). Each spot includes a unique barcode sequence, and the position of each spot on the surface needs to be known in order to decode the 2D position of the mRNA in the tissue. Ideally, the spots should be: small to allow high resolution, densely packed to avoid dead areas, and on a 'large' surface to allow the study of many cells at once. In real numbers we would like spots that are 0.5-10 pm in diameter (similar to the size of individual cells in a tissue), that are packed with no gaps on areas from lxl to 20x20 mm resulting in somewhere between 1-100 million spots. The exact values here may vary depending on the application and an ideal technology should be scalable to meet the demands of different users. This creates a fundamental engineering challenge: how to manufacture and place small DNA spots densely on a surface in a way where the location of the spots are known? And how to make the process economical enough for use research and diagnostics?

[0059] In the prior art, conducting e.g. spatial transcriptomics relies on manufactured substrates (e.g. on surfaces), including arrays of mRNA capture spots comprising a single barcode, that are either printed in known positions or scattered randomly and decoded with in situ sequencing by microscopy. Currently available research methods in spatial transcriptomics are however associated with high-costs. The cost of generating these surfaces is a major roadblock to widespread spatial transcriptomics adoption in research, high throughput analysis of multiple samples, or applications in clinical diagnostics. The same applies to corresponding surfaces used for proteomics.

[0060] There are currently two main routes to achieve surfaces for the spatial barcoding of e.g. RNA in tissues, both using a single barcode in capture spots. The first route, involves the use of 'printed arrays' and is based on the principle of microarray technology (Stahl et al. 2016), wherein a special printer is used to deposit an array of small drops of solution containing mRNA capture DNA oligonucleotides on a functionalized glass slide so that they get covalently linked to the slide. Capture oligonucleotides comprising a single unique barcode are deposited in each spot creating an array of capture spots, thus, the position of each capture oligonucleotide in the array is known due to the controlled printing process. In an example, tissue sections of cells with mRNA that can be sequenced at scale using high throughput sequencing is used. In order to record their spatial position they are first placed on an array with barcoded capture spots. A sample, such as a slice of tissue (from a research animal or a diagnostic sample) is placed on the manufactured surface and the mRNA molecules in the sample diffuse down toward the surface, get captured (hybridizes with the array) and being spatially labeled by the single barcodes so that the spatial location thereof in the tissue can be reconstructed after sequencing based on a priori known positions of the capture spots. For example, the mRNA is barcoded through cDNA synthesis, and after the cDNA is sequenced using high throughput sequencing, the barcode information can be used to reconstruct the original location of the mRNA in the tissue section. Thus, importantly, the position of each capture oligonucleotide in the array is known due to the controlled printing process, which positioning is a challenge using other methods where the positions are not printed in a known manner. Since the positions are known by the printing process, the read out sequencing is facilitated (high throughput sequencing possible). Such printed arrays or surfaces are known to comprise 1000-5000 unique printed capture spots that are spaced about 200 pm apart and each having a diameter of about 55-100 pm. However, this technique has several key shortcomings: cells in a tissue are typically a few micrometres in diameter, meaning that each capture spot will mix material from hundreds of cells. The spots are also interspaced by 'dead area' where no mRNA is captured, and finally the number of spots is low relative to the millions of cells in a piece of tissue. The surfaces are produced via a mature technology originally developed for microarray production, and it would thus be challenging to significantly increase printed spot density to overcome these limitations. Thus, this technique is typically expensive, give rise to coarse readings and is hard to scale up. Hence, methods of making cheaper substrate capture surfaces, which may provide finer read out and allows up-scaling are desired.

[0061] In subsequent years, a second main route of alternative technologies have appeared based on randomly scattering / packing spots of mRNA capture sites on a surface. This removes the need for a printer and allows for denser (< 10 pm) spot packing approaching the size of cells in tissues. However, randomly packing spots raises a problem: how do you connect sequenced mRNA to spot locations on the surface if you don't know how the spots are distributed? This has been solved by advanced microscopy methods, combinatorial fluidics setups, or in situ sequencing- by-microscopy which must be performed individually for each surface (Rodriques et al. 2019), making the technology labor intensive and challenging to deploy on a large scale.

[0062] Thus, to locate a target molecule in a sample, current methods for spatial transcriptomics or proteomics using surfaces for capturing targets molecules relies of surfaces or chips that have capturing spots that haven been printed at known positions, or random surfaces where the read out sequencing need to locate the target molecule using e.g. in situ sequencing. The (single) unique barcode used may not singly indicate the target molecule and its position, and hence either known positions must be used, or in situ sequencing. Both this methods thus suffer from major draw-backs preventing effective scale-up of the methods. Accordingly, an aim of the present disclosure is to provide methods for manufacturing of capturing surfaces for spatial transcriptomics and proteomics that are cheaper than the printed arrays, allow for dense read outs, and which avoids the need for labor intensive read-outs such as in situ sequencing. This is achieved by applying a radically different approach to fabricating capture substrates / surfaces, by the production of a new type of capture surface referred to as a MESH CHIP (Molecular Encoding of Spatiogenetic Heterogeneity via Connected Hierarchically Integrated Polonies) or as MESHTRIX (Molecular Encoding of Spatiogenetic Heterogeneity by Topological Recombination and Integrative extension). The methods of the present disclosure include a different approach to fabricating barcoded mRNA capture substrates based on scattering and growing polonies of capture spots on a functionalized glass surface. When the surface gets saturated with polonies an enzymatic method is used to copy barcode information between adjacent polonies to create a connected surface network. Thus, each capture spot will attain two unique barcodes, their own and the one copied from the neighbor polony. This means that it is possible to reconstruct the distribution of the scattered colonies on the surface solely from reading their barcode information using high throughput sequencing. Accordingly, both the draw-back of printing the array surfaces, and the need for in situ sequencing are overcome by the proposed methods. The capture substrates or surfaces obtained are large, dense, and high- resolution while generated at a fraction of the cost with a bottom-up self-assembly approach. The proposed technique constitutes a qualitative shift in substrate fabrication by dramatically lowering the substrate production cost and complexity, while providing low cost, high-resolution and high-throughput when used in spatial transcriptomics or proteomics.

[0063] An aspect of the present disclosure is the copying of the unique barcodes from a neighboring polony, to obtain a capture probe comprising two barcodes, as it is the read out of these two barcodes that allow for localizing the capture spot on the surface. Even though growth of saturated capture surfaces could be performed without said step, such surfaces would still need the use of in situ sequencing to obtain the spatial location, as hence would not address this draw-back. Moreover, even though theoretical approaches deducing spatial positions of molecules from sequencing for polony adjacency reconstruction for spatial inference and topology have been proposed on an abstract level (Hoffecker et al. 2019), no strategy has been demonstrated that can be considered useful in providing spatially barcoded DNA surface for target (such as mRNA or protein) capture. Thus, a key point of the present invention is the development of a spatially barcoded DNA surface for mRNA or protein capture, random surfaces that are networked so the spatial distribution, i.e. locations of the spatial barcodes, can be decoded from sequencing data alone.

[0064] Manufacturing of capture surfaces

[0065] The productions of the capture surface, the MESHCHIP and / or MESHTRIX, comprises several steps, such as seeding polonies on a surface, using bridge PCR to saturate the surface, post-processing to copy barcode information between neighboring polonies and prepare a networked capture surface. Seeding and saturating the surface with polonies of two polony types (e.g. orthogonal polony types) may be achieved as follows: A surface is first prepared with a dense lawn of four types of primers. Thus, the surfaces are seeded with two types of template strands, containing unique barcode regions. Two types of template strands are added and copied in using a polymerase enzyme. The template strands are copied locally via bridge PCR and the two types of seed are able to grow independently over each other to form two saturated surfaces on the same substrate. Bridge PCR is used to saturate the surface with local copy polonies of the templates. The barcode information is then copied between neighboring strands from one type of polony to the other. Multistep post-processing is then performed to copy barcode information between neighboring polonies and prepare a networked capture surface for mRNA. A short summary of an example embodiment of producing the surface is included below.

[0066] Surface substrate generation The substrate for polony growth constitutes of a dense lawn of primers covalently linked at the 5' end to the substrate. Four primers are used (A,B,C and D) which have been designed to be orthogonal and have similar melting temperatures. They were ordered with an amine group (-NH2) at the 5' end. Surface functionalized glass slides from Surmodics (Tridia NHS slides) were used, that feature an activated hydrogel layer. The primers were mixed and diluted in a surface coupling buffer and added to the center of the slides followed by an overnight incubation to covalently link the four primers to the slide surface.

[0067] Template generation

[0068] Two types of templates were used to grow two types of polonies on the surfaces. The two types of templates are in turn terminated with the binding site for the orthogonal primers linked to the surface, where one template is designed to bind to primer A and B and the other is designed to bind to primer C and D. Both templates were designed to be 600nt long, the length is needed to create 'long enough' bridges on the surface for effective polony growth, the bulk of the templates was a spacer region (475 and 499 nt respectively) that was designed to have minimal secondary structure and cross-reaction between template species. Each individual template strand should have a unique (24 nt) barcode region, which is achieved by ordering the core of the templates (excluding the barcode region) as double stranded gene fragments. The barcode region in this example was purchased as PCR primers including a segment of 24 random nucleotides. PCR is then used to add the barcode region to the core region to create the full template strands.

[0069] Bridge PCR

[0070] The surfaces are generated via bridge-PCR where polymerase colonies, 'polonies' are grown on a glass slide featuring a dense lawn of covalently linked oligonucleotides. In bridge PCR, in contrast to standard PCR, the pair of PCR primers are not free in solution but are covalently linked to a solid surface, the PCR reactions are typically done isothermally in a flow cell by flushing in various reaction solutions / liquids. In the first cycle, a template strand is added (typically > 200 nt long) and hybridized to one of the primers. A polymerase enzyme is then added, extending the primer stand to create a reverse complement of the template covalently linked to the surface. The surface is then harshly washed (ex 100 % Formamide at 60 °C), removing the template strand and leaving only the extended copy. The template was designed in a way so that the end of it is complementary to the other primer immobilized on the surface and it can thus hybridize with a primer in close proximity on the surface forming a 'bridge'. A polymerase enzyme is then added to the surface extending the now hybridized primer and making a second covalently linked copy of the template on the surface. A denaturation solution is again added (100% formamide) breaking the hybridization between the template and extended copy, making them unpaired. A hybridization buffer solution is then flushed in allowing the single strands to again hybridize with new primers on the surface by forming 'bridges'. The polymerase extension is then performed again creating more surface linked copies. This means that the original template is copied at a close to exponential rate as in standard PCR, but the copies remain spatially locked in position on the surface forming a polymerase colony 'polony'. The density of the polonies is controlled by the density of the template seeding where a lower concentration of template will lead to fewer polonies on the surface.

[0071] The amplification of the primers on the substrate is performed isothermally in flow cell PCR. A sticky flow cell is first mounted on the substrate slide, the two templates are then diluted in a PCR solution including the polymerase enzyme Taq and added to the flow cell. The assembly is then placed in a PCR machine where it is heated to 95 °C to dehybridize the double stranded templates followed by a drop in temperature to anneal the template strands on the primer lawn. The temperature is then increased to 72 °C to start the extension by the polymerase enzyme. The assembly is then moved to a 60 °C incubator and connected to a computer- controlled fluidics system. First 100 % formamide is flushed in to remove the hybridized template strands from the lawn. After this the bridge PCR amplification cycle is started. First, annealing buffer is pumped in to remove the formamide and allow the extended strands to bridge over and hybridize with other primers on the surface. Then a polymerase mixture is pumped in containing Bst polymerase leading to the copying of the template onto a surface primer. The cycle is completed by a denaturation step where 100 % formamide is pumped in to denature the extended strands. Typically 35-40 of these cycles are performed to grow the template strands into polonies.

[0072] Two large distinctions to standard bridge-PCR polony growth are performed in the methods of the current invention. First, intentionally seeding of the surfaces more densely to achieve a completely saturated surface is performed. Secondly, instead of using one pair of forward and backward primers, two pairs of primers are used (a total of four primers), and two types of templates that are designed to be non-interacting to grow two types of orthogonal polonies on the same surface. This enables the forming of capture probes comprising two unique barcode regions.

[0073] Post-processing

[0074] The working principle of the capture surfaces of the present disclosure is that the spots on the mRNA capture array encode not just their own polony barcode information, but also the barcode information of one neighbor polony. This is achived by growing the two types of polonies, overlapping on the same surface and then copying the barcode information from one type of template polonies to neighboring / overlapping other type of template polonies, followed by the removal of the one type of tempate polonies. This is achieved by a multi-step postprocessing. After the bridge PCR, the surface is saturated with forward and backward strands from the two polony types, a restriction enzyme is added that targets the B and C primers on the surface. This cleaves the strands that are extended from the B and C primers (the backward strands of the first type of polonies and the forward strand of the other second type of polonies) and they are washed away using 100 % formamide. After this, an annealing buffer is added and the temperature is lowered to 30 °C allowing for a programmed weaker hybridization between the tip of the remaining 0 strands and the base of the 0 strands. A polymerase enzyme is then added to extend the first stype of polony strand with the reverse complement of the base of the seciond type of polony strands, thus copying the barcode information from the second onto the of the first. The seciond strands are also designed so that a poly-thymine region is copied onto the tip of the first strand. After this, another restriction enzyme is added, cleaving the D primer at the tip, releasing the second strands that are washed away and leaving the first strands single stranded and terminated with the poly thymine region (poly-thymine regions are used to capture mRNA as they are terminated with complementary poly-adenine regions).

[0075] In current methods for performing spatial transcriptomics, spots are either printed at known locations or scattered with the locations decoded by microscopy, and the production methods are limited by extensive time in costly machinery. The high costs of spatial transcriptomics are due to two factors: surface generation and sequencing. The cost of high-throughput sequencing has fallen drastically over the last decade, and this trend is expected to continue. Thus, methods of growing random surfaces where the spatial distribution can be decoded from sequencing information alone is disclosed, which overcome the drawback of the prior art.

[0076] In a first aspect of the present disclosure is thus provided a method for creating a capture surface for at least one target molecule in a sample, each target molecule comprising a target nucleic acid region, wherein said method comprises generating at least one metapolony comprising at least one capture probe linked to a surface; wherein each capture probe of a metapolony comprises a first and a second unique barcode region that are unique for said metapolony and a region capable of binding the target nucleic acid region of said at least one target molecule; wherein each meta polony is generated from a polony of a first polony type and a polony of a second polony type grown on said surface; and wherein the second unique barcode region and the region capable of binding the target nucleic acid region are obtained in each capture probe by (i) extending a cleaved nucleic acid strand of a modified polony of the first polony type using a neighboring cleaved nucleic acid strand of a modified polony of the second polony type as template for said extension, wherein the cleaved nucleic acid strand extended in step (i) comprises said first unique barcode region that is unique for said modified polony of the first polony type and said neighboring cleaved nucleic acid strand comprises a reverse complement of said second unique barcode region that is unique for said modified polony of the second polony type.

[0077] It is to be understood that said first unique barcode regions of the capture probes are encoded by polonies of the first polony type as well as by modified polonies of the first polony type that are obtainable from said polonies. Moreover, said second unique barcode regions obtainable in the capture probes are encoded by polonies of the second polony type as well as by modified polonies of the second polony type that are obtainable from said polonies. In some embodiments, the method is provided for creating the capture surface for a plurality of said at least one target molecule in said sample. In some embodiments, said at least one metapolony is a plurality of metapolonies. In some embodiments, said at least one capture probe is a plurality of capture probes.

[0078] In some cases, each modified polony of said first polony type comprises a plurality of the cleaved nucleic acid strands extendable in step (i), wherein each cleaved nucleic acid strand of a modified polony of the first polony type comprises a first unique barcode region unique for said modified polony; and each modified polony of said second polony type comprises a plurality of the cleaved nucleic acid strands suitable as template in step (i), wherein each nucleic acid strand of a modified polony of the second polony type comprises a reverse complement of a second unique barcode region unique for said modified polony. It is to be understood that any of said plurality of the cleaved nucleic acid strands that is extendable in step (i) is extendible provided that it is positioned in closed proximity to a cleaved nucleic acid strand of a modified polony of the second polony type, i.e. said cleaved nucleic acid strands are neighboring.

[0079] In one embodiment, said region capable of binding the target nucleic acid region is at the distal end, such as at the 3'-end, of each capture probe. In one embodiment, each cleaved nucleic acid strand of said modified polonies of the second polony type comprises a reverse complement of said region capable of binding the target nucleic acid region. Said reverse complement of the region capable of binding the target nucleic acid region may be upstream, such as consecutively upstream, in said cleaved nucleic acid strands of said modified polonies of the second polony type from the reverse complement of the unique barcode region encoded by said cleaved nucleic acid strands. This is considered advantageous for obtaining the region capable of binding the target nucleic acid region downstream from the second unique barcode region in the extended cleaved nucleic acid strands obtained in step (i), and thus in the capture probes of the disclosure.

[0080] In one embodiment, each cleaved nucleic acid strand of said modified polonies of the first polony type comprises a bridge region capable of hybridizing (i.e. annealing) to any neighboring cleaved nucleic acid strand of said modified polonies of the second polony type. It is to be understood that each cleaved nucleic acid strand of said modified polonies of the second polony type comprises a reverse complement of said bridge region. Said bridge region may be downstream, such as consecutively downstream, from the first unique barcode region encoded by said cleaved nucleic acid strands of said modified polonies of the first polony type. Moreover, the reverse complement of said bridge region may be downstream, such as consecutively downstream, from the reverse complement of the second unique barcode region encoded by said cleaved nucleic acid strands of said modified polonies of the second polony type. Said bridge region may be at the 3'-end of said cleaved nucleic acid strands of said modified polonies of the first polony type. Said bridge region may be a low temperature bridge region. Accordingly, in one embodiment, each cleaved nucleic acid strand of said modified polonies of the first polony type comprises a low temperature bridge region, and each cleaved nucleic acid strand of said modified polonies of the second polony type comprises a reverse complement of said low temperature bridge region; or each cleaved nucleic acid strand of said modified polonies of the second polony type comprises the low temperature bridge region and each cleaved nucleic acid strand of said modified polonies of the first polony type comprises the reverse complement of said low temperature bridge region. As appreciated by those skilled in the art, if cleaved nucleic acid strands of said modified polonies of the first polony type comprise said bridge region, such as said low temperature bridge region, said cleaved nucleic acid strands of said modified polonies of the second polony type comprise the reverse complement of said bridge region, such as the reverse complement of said low temperature bridge region, for successful hybridization as described above. On the other hand, if cleaved nucleic acid strands of said modified polonies of the first polony type comprise the reverse complement of said bridge region, such as the reverse complement of said low temperature bridge region, said cleaved nucleic acid strands of said modified polonies of the second polony type comprise the bridge region, such as the low temperature bridge region, for successful hybridization as described above. In one embodiment, the low temperature bridge region or the reverse complement thereof is downstream, such as consecutively downstream, in said cleaved nucleic acid strands of said modified polonies of the first polony type from the first unique barcode region encoded by said cleaved nucleic acid strands; and the low temperature bridge region or the reverse complement thereof is downstream, such as consecutively downstream, in said cleaved nucleic acid strands of said modified polonies of the second polony type from the reverse complement of the second unique barcode region encoded by said cleaved nucleic acid strands. In one embodiment, the low temperature bridge region or the reverse complement thereof is at the distal end, such as at the 3'-end, of said cleaved nucleic acid strands of said modified polonies of the first polony type. The position of said bridge region and the reverse complement thereof, such as said low temperature bridge region and the reverse complement thereof, in said cleaved nucleic acid strands of said modified polonies of the first and second polony types are such that they enable extending a cleaved nucleic acid strand of a modified polony of the first polony type based on the nucleic acid sequence of a neighboring cleaved nucleic acid strand of a modified polony of the second polony type, such as wherein the second unique barcode region encoded by said cleaved nucleic acid strand of said modified polony of the second polony type is obtained in said cleaved nucleic acid strand of said modified polony of the first polony type. Moreover, as described above, the position of said bridge region and the reverse complement thereof (such as said low temperature bridge region and the reverse complement thereof) in said cleaved nucleic acid strands of said modified polonies of the first and second polony types are such that they enable the region capable of binding the target nucleic acid region encoded by said cleaved nucleic acid strand of said modified polony of the second polony type to be obtained in said cleaved nucleic acid strand of said modified polony of the first polony type during the extension. The term "encoded" as used herein refers to that a nucleic acid strand comprises a nucleic acid sequence region or the reverse complement thereof. Advantageously, the region capable of binding the target nucleic acid region may be obtained downstream from the second unique barcode region in the extended cleaved nucleic acid strands obtained in step (i) by the herein disclosed sequence domain architectures, as demonstrated in the appended drawings. Accordingly, the above described positioning of said bridge region and the reverse complement thereof (such as said low temperature bridge region and the reverse complement thereof) in said cleaved nucleic acid strands of said modified polonies of the first and second polony types may be particularly advantageous. In particular, it is considered beneficial if the bridge region is at the 3'-end of said cleaved nucleic acid strands of said modified polonies of the first polony type (and consequently also downstream, such as consecutively downstream, from the first unique barcode region encoded by said cleaved nucleic acid strands of said modified polonies of the first polony type); and the reverse complement of said bridge region is downstream, such as consecutively downstream, from the reverse complement of the second unique barcode region (which is downstream from the reverse complement of the region capable of binding the target nucleic acid region) encoded by said cleaved nucleic acid strands of said modified polonies of the second polony type. This is exemplified in Fig. 4D. The above described positioning is considered useful for obtaining the two unique barcode regions as well as the region capable of binding the target nucleic acid region (in step (i)) in a beneficial sequence domain architecture in the capture probes of the disclosure for allowing both spatial positioning and target capture.

[0081] In some embodiments, each cleaved nucleic acid strand of said modified polonies of the first polony type is cleaved at a reverse complement of a first cleavage site, such as a reverse complement of a first restriction enzyme site, downstream, such as inconsecutively downstream, from the first unique barcode region of by said cleaved nucleic acid strands; and each cleaved nucleic acid strand of said modified polonies of the second polony type is cleaved at the reverse complement of the first cleavage site, such as the reverse complement of the first restriction enzyme site, downstream, such as inconsecutively downstream, from the reverse complement of the second unique barcode region of said cleaved nucleic acid strands. In some embodiments, the reverse complement of the first cleavage site, such as the reverse complement of the first restriction enzyme site, is downstream, such as consecutively downstream, from the bridge region or the reverse complement thereof, such as from the low temperature bridge region or the reverse complement thereof, of said cleaved nucleic acid strands of said modified polonies of the first polony type; and the reverse complement of the first cleavage site, such as the reverse complement of the first restriction enzyme site, is downstream, such as inconsecutively downstream, from the bridge region or the reverse complement thereof, such as from the low temperature bridge region or the reverse complement thereof, of said cleaved nucleic acid strands of said modified polonies of the second polony type.

[0082] In some embodiments, the method for creating a capture surface according to the present disclosure prior to step (i) comprises (ii) obtaining said modified polonies of said first and said second polony types from the polonies of said first and said second polony types grown on the surface. Said modified polonies of said first and said second polony types may be obtained by a selective substantial removal of each nucleic acid strand of each polony of the first polony type that comprises the reverse complement of the low temperature bridge region and each nucleic acid strand of each polony of the second polony type that comprises the low temperature bridge region and the region capable of binding the target nucleic acid region; or each nucleic acid strand of each polony of the first polony type that comprises the low temperature bridge region and each nucleic acid strand of each polony of the second polony type that comprises the reverse complement of the low temperature bridge region and the region capable of binding the target nucleic acid region. Said modified polonies of said first and said second polony types may be obtained by a selective substantial removal of each nucleic acid strand of each polony of the first polony type that comprises the reverse complement of the first unique barcode region unique for said polonies and each nucleic acid strand of each polony of the second polony type that comprises the second unique barcode region unique for said polonies and the region capable of binding the target nucleic acid region. Thus, in some embodiments, each nucleic acid strand of a polony of said polonies of the first polony type that is selectively substantially removed in step (ii) comprises a reverse complement of the first unique barcode region unique for said polony and the therefrom obtained modified polony; and each nucleic acid strand of a polony of said polonies of the second polony type that is selectively substantially removed in step (ii) comprises the second unique barcode region unique for said polony and the therefrom obtained modified polony. Consequently to the above, in some embodiments, each nucleic acid strand that is selectively substantially removed in step (ii) comprises the first cleavage site, such as the first restriction enzyme site. The selective substantial removal as defined in step (ii) may be performed using a first enzyme, such as a first restriction enzyme. Said first enzyme may be specific for the first cleavage site and the reverse complement thereof, such as said first restriction enzyme may be specific for said first restriction enzyme site and the reverse complement thereof. Said first cleavage site may be upstream, such as consecutively upstream, in said nucleic acid strands of said polonies of the first polony type that are selectively substantially removed in step (ii) from said bridge region, such as said low temperature bridge region, or the reverse complement thereof in said nucleic acid strands; and said first cleavage site may be upstream, such as inconsecutively upstream, in said nucleic acid strands of said polonies of the second polony type that are removed in step (ii) from said bridge region, such as said low temperature bridge region, or the reverse complement thereof in said nucleic acid strands. In one embodiment, said first cleavage site comprises or consists of a palindromic nucleic acid sequence, such as a nucleic acid sequence according to SEQ ID NO:1. The first cleavage site and the reverse complement thereof may be a palindromic sequence. It is to be understood that when a singlestranded nucleic acid strand comprising said first cleavage site and a single-stranded nucleic acid sequence comprising the reverse complement of said first cleavage site anneal and form a double-stranded nucleic acid strand, the first cleavage site and the reverse complement thereof form a palindromic sequence in the doublestranded nucleic acid strand whereby reading in a certain direction (e.g. 5' to 3') on one strand is identical to the sequence read in the same direction (e.g. 5' to 3') on the complementary strand. In one embodiment, said first restriction enzyme is EcoRI. The inventors demonstrated in appended Example 4 the use of EcoRI and the first cleavage site according to SEQ ID NO:1 in a method as disclosed herein. The inventors however envision that other enzymes, such as other restriction enzymes, as well as other nucleic acid sequences, such as other restriction enzyme sites respective to the chosen restriction enzyme, may be suitable in the disclosed method as the first enzyme and the first cleavage site. As demonstrated in the appended Examples, each nucleic acid strand of said polonies of the first polony type that are selectively substantially removed in step (ii) may comprise or consist of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NQ:20-22. Said nucleic acid strands of said polonies of the first polony type that are selectively substantially removed in step (ii) may comprise or consist of a nucleic acid sequence according to SEQ ID NQ:20. Said nucleic acid strands of said polonies of the first polony type that are selectively substantially removed in step (ii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:21. Said nucleic acid strands of said polonies of the first polony type that are selectively substantially removed in step (ii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:22. Moreover, each nucleic acid strand of said polonies of the second polony type that are selectively substantially removed in step (ii) may comprise or consist of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:23-25. Said nucleic acid strands of said polonies of the second polony type that are selectively substantially removed in step (ii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:23. Said nucleic acid strands of said polonies of the second polony type that are selectively substantially removed in step (ii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:24. Said nucleic acid strands of said polonies of the second polony type that are selectively substantially removed in step (ii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:25. In some embodiment, each nucleic acid strand of said polonies of the first and the second polony types that remain on the surface in step (ii) comprise the reverse complement of the first cleavage site. Said reverse complement of the first cleavage site may be downstream, such as consecutively downstream, from the bridge region, such as the low temperature bridge region, or the reverse complement thereof in said nucleic acid strands of said polonies of the first polony type that remain on the surface in step (ii). Said reverse complement of the first cleavage site may be downstream, such as inconsecutively downstream, from the bridge region, such as the low temperature bridge region, or the reverse complement thereof in said nucleic acid strands of said polonies of the second polony type that remain on the surface in step (ii). Accordingly, the method as disclosed herein may comprise in step (ii) obtaining said cleaved nucleic acid strands of said modified polonies of said first and said second polony types by a cleavage at said reverse complement of the first cleavage site in each nucleic acid strand of said polonies of the first and the second polony types that remain on the surface in step (ii). This is considered advantageous in context of the present disclosure, as generation of polonies of the two polony types is separated from sequence information transfer between modified polonies of these two polony types. This is thought to be useful in controlling desired hybridization events between nucleic acid strands present on the surface. Moreover, said cleavage may be performed using the first enzyme, such as the first restriction enzyme. Furthermore, said selective substantial removal and said cleavage in step (ii) may be performed simultaneously in step (ii), such as performed in the same enzymatic reaction. As explained above and demonstrated in Fig. 4C, nucleic acid strands of a polony of the two polony types are able to hybridize. Accordingly, they are able to form a double stranded nucleic acid strand, wherein said selective substantial removal and said cleavage according to step (ii) may occur. In some embodiments, each cleaved nucleic acid strand of said modified polonies of the first polony type may be cleaved downstream, such as consecutively downstream, from the bridge region, such as the low temperature bridge region, or the reverse complement thereof, in said cleaved nucleic acids. Moreover, each cleaved nucleic acid strand of said modified polonies of the second polony type may be cleaved downstream, such as inconsecutively downstream, from the bridge region, such as the low temperature bridge region, or the reverse complement thereof in said cleaved nucleic acids. As demonstrated in the appended Examples, each nucleic acid strand of said polonies of the first polony type that remain on the surface in step (ii) may comprise or consist of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:17-19 prior to said cleavage by which said cleaved nucleic acid strands of said modified polonies of the first polony type may be obtained. Nucleic acid strands of said polonies of the first polony type that remain on the surface in step (ii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:17 prior to said cleavage by which said cleaved nucleic acid strands of said modified polonies of the first polony type may be obtained. Nucleic acid strands of said polonies of the first polony type that remain on the surface in step (ii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:18 prior to said cleavage by which said cleaved nucleic acid strands of said modified polonies of the first polony type may be obtained. Nucleic acid strands of said polonies of the first polony type that remain on the surface in step (ii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:19 prior to said cleavage by which said cleaved nucleic acid strands of said modified polonies of the first polony type may be obtained. As demonstrated in the appended Examples, each nucleic acid strand of said polonies of the second polony type that remain on the surface in step (ii) may comprise or consist of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:26-28 prior to said cleavage by which said cleaved nucleic acid strands of said modified polonies of the second polony type may be obtained. Nucleic acid strands of said polonies of the second polony type that remain on the surface in step (ii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:26 prior to said cleavage by which said cleaved nucleic acid strands of said modified polonies of the second polony type may be obtained. Nucleic acid strands of said polonies of the second polony type that remain on the surface in step (ii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:27 prior to said cleavage by which said cleaved nucleic acid strands of said modified polonies of the second polony type may be obtained. Nucleic acid strands of said polonies of the second polony type that remain on the surface in step (ii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:28 prior to said cleavage by which said cleaved nucleic acid strands of said modified polonies of the second polony type may be obtained. As shown in the Examples below, each cleaved nucleic acid strand of said modified polonies of the first polony type may comprise or consist of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:29-31. Cleaved nucleic acid strands of said modified polonies of the first polony type may comprise or consist of a nucleic acid sequence according to SEQ ID NO:29. Cleaved nucleic acid strands of said modified polonies of the first polony type may comprise or consist of a nucleic acid sequence according to SEQ ID NQ:30. Cleaved nucleic acid strands of said modified polonies of the first polony type may comprise or consist of a nucleic acid sequence according to SEQ ID NO:31. As exemplified below, each cleaved nucleic acid strand of said modified polonies of the second polony type may comprise or consist of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:32-34. Cleaved nucleic acid strands of said modified polonies of the second polony type may comprise or consist of a nucleic acid sequence according to SEQ ID NO:32. Cleaved nucleic acid strands of said modified polonies of the second polony type may comprise or consist of a nucleic acid sequence according to SEQ ID NO:33. Cleaved nucleic acid strands of said modified polonies of the second polony type may comprise or consist of a nucleic acid sequence according to SEQ ID NO:34.

[0083] In some embodiments, each nucleic acid strand of said polonies of the second polony type that remains linked to the surface in step (ii) and / or each cleaved nucleic acid strand of said modified polonies of the second polony type comprises a second cleavage site, such as a second restriction enzyme site, upstream, such as inconsecutively upstream, from the reverse complement of the second unique barcode region encoded by said nucleic acid strands and / or by said cleaved nucleic acid strands. Said second cleavage site in said nucleic acid strands of said polonies of the second polony type and / or said cleaved nucleic acid strands of said modified polonies of the second polony type may be upstream, such as consecutively upstream, from the reverse complement of the region capable of binding the target nucleic acid region in said nucleic acid strands and / or in said cleaved nucleic acid strands. In some embodiments, the method for creating a capture surface according to the present disclosure comprises in step (i) obtaining a reverse complement of the second cleavage site, such as a reverse complement of the second restriction enzyme site, downstream, such as consecutively downstream, in each extended cleaved nucleic acid strand of said modified polonies of the first polony type from the region capable of binding the target nucleic acid region in said extended cleaved nucleic acid strands. As demonstrated in the extended Examples, each extended cleaved nucleic acid strand of said modified polonies of the first polony type may comprise or consist of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:37-39. Extended cleaved nucleic acid strands of said modified polonies of the first polony type may comprise or consist of a nucleic acid sequence according to SEQ ID NO:37. Extended cleaved nucleic acid strands of said modified polonies of the first polony type may comprise or consist of a nucleic acid sequence according to SEQ ID NO:38. Extended cleaved nucleic acid strands of said modified polonies of the first polony type may comprise or consist of a nucleic acid sequence according to SEQ ID NO:39. In some embodiments, the method for creating a capture surface as disclosed herein subsequent to step (i) comprises (iii) a selective substantial removal of each cleaved nucleic acid strand of said modified polonies of the second polony type, such as a selective substantial removal by a cleavage at the second cleavage site, such as at the second restriction enzyme site. In some embodiments, each of said cleaved nucleic acid strands that is selectively substantially removed in step (iii) comprises the second cleavage site, such as the second restriction enzyme site. Said second cleavage site may be different from the first cleavage site, such as said second restriction enzyme site may be different from the first restriction enzyme site. Said selective substantial removal as defined in step (iii) may be performed using a second enzyme, such as a second restriction enzyme. Said second enzyme may be different from the first enzyme, such as said second restriction enzyme may be different from the first restriction enzyme. Said second enzyme may be specific for the second cleavage site and the reverse complement thereof, such as said second restriction enzyme may be specific for said second restriction enzyme site and the reverse complement thereof. As demonstrated by the appended Examples, said second cleavage site may comprise or consist of a palindromic nucleic acid sequence, such as a nucleic acid sequence according to SEQ ID NO:2. Moreover, said second restriction enzyme may be Bspll9L The present inventors envision that other enzymes, such as other restriction enzymes, as well as other nucleic acid sequences, such as other restriction enzyme sites respective to the chosen restriction enzyme, may be suitable in the disclosed method as the second enzyme and the second cleavage site. In some embodiments, as demonstrated in the Examples below, each cleaved nucleic acid strand of polonies of the second polony type removed in step (iii) may comprise or consist of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:32-34. Cleaved nucleic acid strands of said modified polonies of the second polony type removed in step (iii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:32. Cleaved nucleic acid strands of said modified polonies of the second polony type removed in step (iii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:33. Cleaved nucleic acid strands of said modified polonies of the second polony type removed in step (iii) may comprise or consist of a nucleic acid sequence according to SEQ ID NO:34. The method for creating a capture surface as disclosed herein may comprise in step (iii) a cleavage at the reverse complement of the second cleavage site of each extended cleaved nucleic acid strand of said modified polonies of the first polony type. Said cleavage may be performed using the second enzyme, such as the second restriction enzyme. Said selective substantial removal and said cleavage in step (iii) may be performed simultaneously in step (iii), such as performed in the same enzymatic reaction. This is considered advantageous because the cleavage of each extended cleaved nucleic acid strand of said modified polonies of the first polony type and the selective substantial removal of each cleaved nucleic acid strand of said modified polonies of the second polony type can be performed (e.g. by using the second enzyme) simultaneously in step (iii) by the herein demonstrated sequence domain design. As demonstrated in Fig, 4D, the region capable of binding the target nucleic acid region may thus advantageously be obtained at the 3'-end of the capture probes, while nucleic strands which are not suitable for target capture may be removed from the surface. As demonstrated in Fig. 4D, said extended cleaved nucleic acid strands obtained in step (i) are able to hybridize partially to the cleaved nucleic acid strand which served as template in the extension in step (i). Accordingly, they are able to form a locally double stranded nucleic acid strand, wherein said selective substantial removal and said cleavage according to step (iii) may occur.

[0084] In some embodiments, each unique barcode region, such as said first and said second unique barcode regions, comprises a nucleic acid sequence having a length of at least about 6 nucleotides, such as at least about 8 nucleotides, such as at least about 10 nucleotides, such as at least about 12 nucleotides, such as at least about 14 nucleotides, such as at least about 16 nucleotides, such as at least about 18 nucleotides, such as at least about 20 nucleotides, such as at least about 22 nucleotides, such as at least about 24 nucleotides, such as at least about 26 nucleotides, such as at least about 28 nucleotides, such as at least about 30 nucleotides, such as at least about 32 nucleotides, such as at least about 34 nucleotides, such as at least about 36 nucleotides, such as at least about 38 nucleotides, such as at least about 40 nucleotides. In some embodiments, each unique barcode region, such as said first and said second unique barcode regions, comprises a nucleic acid sequence having a length of at least about 20 nucleotides, such as a length of at least about 24 nucleotides. In some embodiments, each unique barcode region, such as said first and said second unique barcode regions, comprises a nucleic acid sequence having a length of from about 6 to about 46 nucleotides, such as from about 8 to about 44 nucleotides, such as from about 10 to about 42 nucleotides, such as from about 12 to about 40 nucleotides, such as from about 14 to about 38 nucleotides, such as from about 16 to about 36 nucleotides, such as from about 18 to about 34 nucleotides, such as from about 20 to about 32 nucleotides, such as from about 22 to about 30 nucleotides, such as from about 24 to about 28 nucleotides. In some embodiments, each unique barcode region, such as said first and said second unique barcode regions, comprises a nucleic acid sequence having a length of from about 12 to about 40 nucleotides, such as a length of about 24 nucleotides. In one embodiment, each unique barcode region, such as said first and said second unique barcode regions, comprises about 24 nucleotides.

[0085] In some embodiments, each of said cleaved nucleic acid strands of said modified polonies of said first and said second polony types is a single stranded nucleic acid strand, such as a single stranded DNA strand.

[0086] In some embodiments, said target nucleic acid region comprises or consists of an RNA sequence, a pseudo-RNA sequence or a DNA sequence. Said target nucleic acid region may comprise or consist of an RNA sequence. Said target nucleic acid region may comprise or consist of a pseudo-RNA sequence or a DNA sequence, such as a DNA sequence. For example, said target nucleic acid region may comprise or consist of a poly-adenine sequence. Accordingly, said region capable of binding the target nucleic acid region may comprise a target binding nucleic acid sequence, such as a poly-thymidine sequence. Said poly-thymidine sequence may comprise or consist of from about 10 to about 30 consecutive thymidine nucleotides, such as from about 15 to about 25 consecutive thymidine nucleotides, such as about 20 consecutive thymidine nucleotides. Said region capable of binding the target nucleic acid region may further comprise at least one spacer nucleotide upstream from the target binding nucleic acid sequence. Said at least one spacer nucleotide may be alanine. Said at least one spacer nucleotide may be positioned between the second unique barcode region and the target binding nucleic acid sequence in each capture probe. The present inventors envision that such spacer nucleotide may be useful in defining the position of the second unique barcode regions encoded by the capture probes following using a capture surface according to the present disclosure. As discussed above, said target nucleic acid region may be a poly-adenine sequence. Accordingly, a capture probe according to the present disclosure may be used to bind target molecules that comprise said poly-adenine sequence, such as mRNA molecules. As known to those skilled in the art, mRNA molecules comprise a poly-adenine tail independently of the protein-encoding region of said mRNAs. Said poly-adenine tail is a suitable target nucleic acid region according to the present disclosure. Accordingly, a capture surface as disclosed herein may be used to bind mRNA molecules in the sample, wherein each mRNA molecule may encode a different protein, for example by using the method according to the third aspect of the present disclosure. Thus, the present disclosure may be particularly useful in spatial transcriptomics applications. Furthermore, said target nucleic acid region, such as a DNA sequence, may be a region of a nucleic acid probe, such as a DNA probe. Said DNA probe may be a synthetic DNA probe. Accordingly, target molecules which comprise said nucleic acid probe may be captured by a capture surface as herein disclosed. The present inventors envision that such nucleic acid probes may be used to tag for example binding molecules, such as antibody molecules or a fragment thereof, that are capable of binding to an antigen, such as a polypeptide and / or a peptide, in the sample. Accordingly, a capture surface as disclosed herein may be used for obtaining information about the spatial location of a plurality of said antigen in the sample, for example by using the method according to the third aspect of the present disclosure. Such nucleic acid probes may be designed to comprise a third unique barcode region specific for such binding molecule. For example, a set of such nucleic acid probe-labeled binding molecules may be designed that comprise a nucleic acid probe comprising the target nucleic acid region and a third unique barcode region specific for a binding molecule, wherein each nucleic acid probe-labeled binding molecule in said set may be captured by a capture surface according to the present disclosure and wherein each nucleic acid probe-labeled binding molecule may encode a different antigen in the sample by the respective third unique barcode regions. Thus, when such nucleic acid probe-labeled binding molecules are used to label a plurality of one or more antigens in the sample, a capture surface as disclosed herein may be used for obtaining information about the spatial location of said plurality of said one or more antigens in the sample, for example by using the method according to the third aspect of the present disclosure. Accordingly, the present disclosure may be particularly useful in spatial proteomics applications.

[0087] As discussed above, said target molecule may be selected from a group consisting of an RNA molecule, a DNA molecule, a peptide and a polypeptide. Said target molecule may for example be an RNA molecule or a DNA molecule, such as an RNA molecule. Said RNA molecule may be an mRNA molecule, such as an mRNA molecule comprising a poly-adenine tail. Moreover, said target molecule may be a peptide or a polypeptide, such as a nucleic acid probe-labeled peptide or a nucleic acid probe- labeled polypeptide. Said nucleic acid probe-labeled peptide or said nucleic acid probe-labeled polypeptide may be a DNA-probe-labeled peptide or a DNA probe- labeled polypeptide. As explained above, said nucleic acid-probe labeled polypeptide, such as said DNA probe-labeled polypeptide, may be a nucleic acid probe-labeled binding molecule, such as a DNA probe-labeled binding molecule.

[0088] In some embodiments, each capture probe may be a single stranded nucleic acid strand, such as a single stranded DNA strand.

[0089] In some embodiments, each capture probe comprises an extension at the proximal end, such as at the 5'-end, thereof. Said extension may be useful for creating an extra spacing from the surface, such as the extra spacing described in Example 2. Moreover, said extension may comprise a nucleic acid sequence that enables the selective complete removal of said capture probes from said surface. The nucleic acid sequence of the extension may be different from the nucleic acid sequence of said first cleavage site and said second cleavage site. The present inventors envision that several nucleic acid sequences may be suitable for the herein indicated purposes of said extension of the capture probes. The skilled person is aware of such nucleic acid sequences. For example, said extension may comprise or consist of a nucleic acid sequence comprising at least one deoxy-uridine nucleotide. In some embodiments, each capture probe thus comprises at least one deoxyuridine nucleotide. Said at least one deoxy-uridine nucleotide may be at the 5'-end of the capture probes. Said at least one deoxy-uridine nucleotide may be from about two to about eight deoxy-uridine nucleotides, such as about four deoxy-uridine nucleotides.

[0090] In some embodiments, each capture probe is linked to said surface at the 5'-end thereof. Each capture probe may be covalently linked to said surface. As demonstrated in the appended Examples, each capture probe may comprise at the 5'-end thereof an amine group (-NH2). Thus, each capture probe may be linked to said surface via said amine group (-NH2). The present inventors however envision that several means may be suitable for the herein indicated purposes of said amine group of said capture probes. The skilled person is aware of such means.

[0091] In some embodiments, said first and said second unique barcode regions are upstream from said region capable of binding the target nucleic acid region in each capture probe. In some embodiments, each capture probe comprises the low temperature bridge region (or another suitable bridge region) or the reverse complement thereof positioned between said first and said second unique barcode regions. As discussed above, the herein described sequence domain architecture may be particularly advantagous in context of the present disclosure, wherein said first and said second unique barcode regions are upstream from said region capable of binding the target nucleic acid region in each capture probe, and wherein the low temperature bridge region (or another suitable bridge region) or the reverse complement thereof positioned between said first and said second unique barcode regions (see e.g. Fig. 4D). In some embodiments, each capture probe comprises a forward primer binding region suitable for amplification for sequencing upstream from the first unique barcode region. It is to be understood that said forward primer binding region may be useful for an amplification as demonstrated in Examples 6 and 8. The inventors envision that the nucleic acid sequence and the position of said forward primer binding region may be adapted according to the length of the nucleic acid sequence present in the target molecule, which nucleic acid sequence may be copied into the capture probe upon binding, for obtaining constructs of sufficient length for sequencing as described in Examples 6 and 7.

[0092] In some embodiments, each capture probe comprises a nucleic acid sequence having a length of at least about 100 nucleotides, such as at least about 150 nucleotides, such as at least about 160 nucleotides, such as at least about 170 nucleotides, such as at least about 180 nucleotides, such as at least about 190 nucleotides, such as at least about 200 nucleotides, such as at least about 210 nucleotides, such as at least about 220 nucleotides, such as at least about 230 nucleotides, such as at least about 240 nucleotides, such as at least about 250 nucleotides, such as at least about 300 nucleotides, such as at least about 400 nucleotides, such as at least about 500 nucleotides, such as at least about 600 nucleotides, such as at least about 700 nucleotides, such as at least about 800 nucleotides, such as at least about 900 nucleotides, such as at least about 1000 nucleotides, such as at least about 1100 nucleotides, such as at least about 1200 nucleotides, such as at least about 1300 nucleotides, such as at least about 1400 nucleotides, such as at least about 1500 nucleotides, such as at least about 1600 nucleotides, such as at least about 1700 nucleotides, such as at least about 1800 nucleotides, such as at least about 1900 nucleotides, such as at least about 2000 nucleotides. In some embodiments, each capture probe comprises a nucleic acid sequence having a length of at least about 600 nucleotides. In some embodiments, each capture probe comprises a nucleic acid sequence having a length of at least about 200 nucleotides, such as at least about 210 nucleotides, such as at least about 220 nucleotides, such as at least about 230 nucleotides, such as at least about 240 nucleotides, such as at least about 250 nucleotides, such as at least about 300 nucleotides, such as at least about 400 nucleotides, such as at least about 500 nucleotides, such as at least about 600 nucleotides, such as at least about 700 nucleotides, such as at least about 800 nucleotides, such as at least about 900 nucleotides, such as at least about 1000 nucleotides, such as at least about 1100 nucleotides, such as at least about 1200 nucleotides, such as at least about 1300 nucleotides, such as at least about 1400 nucleotides, such as at least about 1500 nucleotides, such as at least about 1600 nucleotides, such as at least about 1700 nucleotides, such as at least about 1800 nucleotides, such as at least about 1900 nucleotides, such as at least about 2000 nucleotides. In some embodiments, each capture probe comprises a nucleic acid sequence having a length of from about 100 to about 2500 nucleotides, such as from about 150 to about 2400 nucleotides, such as from about 160 to about 2300 nucleotides, such as from about 170 to about 2200 nucleotides, such as from about 180 to about 2100 nucleotides, such as from about 190 to about 2000 nucleotides, such as from about 200 to about 2000 nucleotides. In some embodiments, each capture probe comprises a nucleic acid sequence having a length of from about 200 to about 2000 nucleotides. In some embodiments, each capture probe comprises a nucleic acid sequence having a length of about 630 nucleotides.

[0093] In some embodiments, said extension in step (i) is performed using a third enzyme, such as a first nucleic acid polymerase enzyme. Said first nucleic acid polymerase enzyme may be a polymerase enzyme that is enzymatically active at low temperature, such as at about 30°C. Said low temperature may be a temperature at which said low temperature bridge region and the reverse complement thereof are capable of hybridizing. Such polymerase may for example be Bst polymerase. In some embodiments, said extension in step (i) comprises (i-a) hybridizing said cleaved nucleic acid strand of the modified polony of the first polony type to the neighboring cleaved nucleic acid strand of the modified polony of the second polony type, and

[0094] (i-b) elongating said cleaved nucleic acid strand of the modified polony of the first polony type based on the nucleic acid sequence of said neighboring cleaved nucleic acid strand of the modified polony of the second polony type. The term "based on" in the present context, and as referred to in some embodiments of the present disclosure, is to be understood that a nucleic acid strand is elongated using another nucleic acid strand as template. Said cleaved nucleic acid strand of the modified polony of the first polony type and the neighboring cleaved nucleic acid strand of the polony of the second polony type may hybridize at the low temperature bridge region and the reverse complement thereof in step (i-a). Said extension in step (i) may be performed at a low temperature, such as at a temperature of from about 10°C to about 50°C, such as from about 12°C to about 48°C, such as from about 14°C to about 46°C, such as from about 16°C to about 44°C, such as from about 18°C to about 42°C, such as from about 20°C to about 40°C. Said extension may be performed at a temperature of from about 20°C to about 40°C, such as at a temperature of about 30°C. Said extension in step (i) may be performed for from about 1 to about 60 min, such as from about 5 to about 60 min, such as from about 10 to about 50 min, such as from about 20 to about 40 min. Said extension may be performed for from about 1 to about 60 min, such as for about 30 min.

[0095] In some embodiments, each capture probe comprises or consists of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:40-42. The capture probes may comprise or consist of a nucleic acid sequence according to SEQ ID NO:40. The capture probes may comprise or consist of a nucleic acid sequence according to SEQ ID NO:41. The capture probes may comprise or consist of a nucleic acid sequence according to SEQ ID NO:42.

[0096] In some embodiments, said first and said second polony types are orthogonal.

[0097] In some embodiments, said method prior to step (i) and / or step (ii) comprises (iv) generating each polony of said first and said second polony types, for example by bridge amplification, on said surface, wherein said modified polonies of said first and said second polony types are obtainable from said polonies generated in step (iv). Overlapping polonies, and in particular, surfaces that have been saturated by overlapping polonies, of the two polony types are considered particularly beneficial for superior network formation in context of the present disclosure. Thus, in some embodiments, said method prior to step (i) and / or step (ii) comprises (iv) generating each polony of said first and said second polony types, for example by bridge amplification, on said surface, wherein said modified polonies of said first and said second polony types are obtainable from said polonies generated in step (iv), and wherein said polonies of the two polony types are overlapping polonies, such as overlapping polonies saturating the surface. In some embodiments, said polonies of said first polony type comprising or consisting of a plurality of nucleic acid strands comprising a first unique barcode region or a reverse complement thereof unique for said polony and said polonies of said second polony type comprising a plurality of nucleic acid strands comprising a second unique barcode region or a reverse complement thereof unique for said polony are obtained in step (iv). In some embodiments, in step (iv), each polony of said first polony type is generated by bridge amplification of a template nucleic acid strand of a first set of template nucleic acid strands using a plurality of a first oligonucleotide pair linked to said surface, wherein said first oligonucleotide pair is capable of amplifying each template nucleic acid strand of the first set of template nucleic acid strands, and each polony of said second polony type is generated by bridge amplification of a template nucleic acid strand of a second set of template nucleic acid strands using a plurality of a second oligonucleotide pair linked to said surface, wherein said second oligonucleotide pair is capable of amplifying each template nucleic acid strand of the second set of template nucleic acid strands. Said polonies of said first and said second polony types may be generated simultaneously. Said bridge amplification for generating polonies of the first and the second polony types may be performed by isothermal amplification or by thermal cycling, such as by isothermal amplification. Said isothermal amplification may be performed at a temperature of at least about 40°C, such as at least about 45°C, such as at least about 50°C, such as at least about 55°C, such as at least about 60°C. Said isothermal amplification may be performed at a temperature of from about 40°C to about 80°C, such as from about 45°C to about 75°C, such as from about 50°C to about 70°C. Said isothermal amplification may be performed at a temperature of from about 50°C to about 70°C, such as at a temperature of about 60°C. Each nucleic acid strand obtained in step (iv) may be a single-stranded nucleic acid strand, such as a single stranded DNA strand. It is to be understood that complementary nucleic acid strands of a polony generated in step (iv) may form a double-stranded strand, such as a double-stranded DNA strand, on the surface. In some embodiments, each of said template nucleic acid strands used for generating a polony is a single stranded nucleic acid strand, such as a single stranded DNA strand. Such single stranded nucleic acid strands may be obtained by for example denaturing double stranded template nucleic acid strands of the first and the second set of template nucleic strands. In some embodiments, said polonies of said first and said second polony types are obtained in step (iv) at a density of at least about 50000 polonies per mm2, such as at least about 100 000 polonies per mm2, such as at least about 200000 polonies per mm2, such as at least about 300 000 polonies per mm2, such as at least about 400 000 polonies per mm2, such as at least about 500000 polonies per mm2, such as at least about 600000 polonies per mm2, such as at least about 700000 polonies per mm2, such as at least about 800 000 polonies per mm2, such as at least about 900 000 polonies per mm2, such as at least about 1 million polonies per mm2, such as at least about 2 million polonies per mm2, such as at least about 3 million polonies per mm2, such as at least about 4 million polonies per mm2, such as at least about 5 million polonies per mm2, such as at least about 6 million polonies per mm2, such as at least about 7 million polonies per mm2, such as at least about 8 million polonies per mm2, such as at least about 9 million polonies per mm2, such as at least about 10 million polonies per mm2. In some embodiments, said polonies of said first and said second polony types are obtained in step (iv) at a density of from about 50 000 polonies per mm2to about 50 million polonies per mm2, such as from about 50 000 polonies per mm2to about 50 million polonies per mm2, such as from about 60000 polonies per mm2to about 40 million polonies per mm2, such as from about 70000 polonies per mm2to about 30 million polonies per mm2, such as from about 80000 polonies per mm2to about 20 million polonies per mm2, such as from about 90000 polonies per mm2to about 10 million polonies per mm2, such as from about 100000 polonies per mm2to about 10 million polonies per mm2. In some embodiments, said polonies of said first and said second polony types are obtained in step (iv) at a density of from about 100000 polonies per mm2to about 5 million polonies per mm2, such as from about 200000 polonies per mm2to about 4 million polonies per mm2, such as from about 300000 polonies per mm2to about 3 million polonies per mm2, such as from about 400000 polonies per mm2to about 2 million polonies per mm2, such as from about 500000 polonies per mm2to about 1 million polonies per mm2. In some embodiments, said polonies of said first and said second polony types are obtained in step (iv) at a density of from about 500000 polonies per mm2to about 1 million polonies per mm2. In some embodiments, said step (iv) comprises

[0098] (iv-a) linking of said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair to the surface at one end, such as at the 5'-end, of the oligonucleotides,

[0099] (iv-b) seeding of at least one template nucleic acid strand of said first set of template nucleic acid strands and at least one template nucleic acid strand of said second set of template nucleic acid strands onto said surface, wherein each seeded template nucleic acid strand serves as template for elongating an oligonucleotide of said plurality of the first oligonucleotide pair or said plurality of the second oligonucleotide pair, respectively, linked to the surface in step (iv-a),

[0100] (iv-c) removal of each template nucleic acid strand from the surface which has been seeded onto the surface in step (iv-b),

[0101] (iv-d) bridge amplification of each elongated nucleotide obtained in step (iv-b), wherein each elongated oligonucleotide obtained in step (iv-b) or (iv-d) is a nucleic acid strand of a polony of said first or said second polony types comprising a first or a second unique barcode region or a reverse complement thereof unique for said polony. Step (iv-a) and (iv-b) may also be referred to herein as generation of a primer lawn on the surface and seeding of template nucleic acid strands for bridge amplification thereof for generating the polonies, respectively. In some embodiments, a plurality of said first set of template nucleic acid strands and a plurality of said second set of template nucleic acid strands are seeded on the surface in step (iv-b). As appreciated by the skilled person, bridge amplification may be performed as described in the art, for example as described in WO9844151. As demonstrated in the appended Examples, each seeded template nucleic acid strand in step (iv-b) may be obtained by hybridizing a template nucleic acid strand of the first set of template nucleic acid strands to an oligonucleotide of said plurality of the first oligonucleotide pair, wherein the template nucleic acid strand comprises a sequence region complementary to a sequence region of said oligonucleotide and hybridizing a template nucleic acid strand of the second set of template nucleic acid strands to an oligonucleotide of said plurality of the second oligonucleotide pair, wherein the template nucleic acid strand comprises a sequence region complementary to a sequence region of said oligonucleotide; and elongating said oligonucleotides which were hybridized to a template nucleic acid strand using the template nucleic acid strand to which they are hybridized to as template. Said hybridization may be performed at about 60°C and / or said elongation may be performed at about 72°C. Said hybridization may be performed for about 5 minutes and / or said elongation may be performed for about 15 minutes. Said elongation may be performed using a fourth enzyme, such as a second nucleic acid polymerase enzyme. Such polymerase enzyme may for example be Taq polymerase, Fusion polymerase an KAPA polymerase. In some embodiments, said first and said second set of template nucleic acid strands comprise double stranded template nucleic acid strands. Said double stranded template nucleic acid strands may be denatured, such as denatured at about 95°C for about 5 min, in step (iv-b). Such denaturation may thus occur prior to said hybridization in step (iv-b). In some embodiments, each template nucleic acid strand seeded in step (iv-b) is unique on said surface. Said template nucleic acid sequences in step (iv-c) may be removed by denaturation, such as by using formamide and / or NaOH. Said formamide may be 100% formamide. Said NaOH may be IM NaOH. Said bridge amplification in step (iv- d) may be performed using the third enzyme, such as the first nucleic acid polymerase enzyme. In one embodiment, said nucleic acid polymerase enzyme is an enzyme suitable for isothermal amplification, such as for isothermal amplification at a temperature of about 60°C. Such enzyme may be Bst polymerase. Said bridge amplification may be performed at a temperature of at least about 40°C, such as at least about 45°C, such as at least about 50°C, such as at least about 55°C, such as at least about 60°C. Said bridge amplification may be performed at a temperature of from about 40°C to about 80°C, such as from about 45°C to about 75°C, such as from about 50°C to about 70°C. Said bridge amplification may be performed at a temperature of from about 50°C to about 70°C, such as at a temperature of about 60°C. In some embodiments, said bridge amplification comprises at least one cycle of

[0102] - an annealing step, such as an annealing step performed for about 1 min;

[0103] - an elongation step, such as an elongation step performed for about 4 min;

[0104] - a denaturing step, such as a denaturing step performed for about 1 min. The present inventors envision that the above referred temperatures and / or incubation time may be adapted according to the nucleic acid sequence and / or the length of the template nucleic acid strands of said first and said second set of template nucleic acid strands. Said denaturing step of said cycle may be performed using formamide, such as 100% formamide. In some embodiments, said bridge amplification comprises at least about 30 cycles, such as at least about 35 cycles, such as at least about 40 cycles. Said bridge amplification may comprise from about 35 cycles to about 40 cycles. In some embodiments, said first and said second set of template nucleic acid sequences are orthogonal. In some embodiments, the reverse complement of the first unique barcode region of the cleaved nucleic acid strand of the modified polony of the first polony type extended in step (i) is encoded by the template nucleic acid strand used for generating the polony of the first polony type from which said modified polony is obtained, and the reverse complement of the second unique barcode region obtained in said extension in step (i) is encoded by the template nucleic acid strand used for generating the polony of the second polony type from which said modified polony of the second polony type is obtained. In some embodiments, the reverse complement of the low temperature bridge region of the cleaved nucleic acid strand of the modified polony of the first polony type extended in step (i) is encoded by the template nucleic acid strand used for generating the polony of the first polony type from which said modified polony is obtained, and / or the reverse complement of the low temperature bridge region of the cleaved nucleic acid strand of the modified polony of the second polony type that is used as template in step (i) is encoded by the template nucleic acid strand used for generating the polony of the second polony type from which said modified polony is obtained. In some embodiments, said reverse complement of the low temperature bridge region is upstream, such as consecutively upstream, from said reverse complement of the first unique barcode region in said template nucleic acid strand used for generating said polony of the first polony type. In some embodiments, said reverse complement of the low temperature bridge region is downstream, such as consecutively downstream, from the reverse complement of the second unique barcode region in said template nucleic acid strand used for generating said polony of the second polony type. In some embodiments, a reverse complement of the forward primer binding region suitable for amplification for sequencing of the cleaved nucleic acid strand of the modified polony of the first polony type extended in step (i) is encoded by the template nucleic acid strand used for generating the polony of the first polony type from which said modified polony is obtained. In some embodiments, said reverse complement of the forward primer binding region suitable for amplification for sequencing is downstream, such as consecutively downstream, from the reverse complement of the first unique barcode region in the template nucleic acid strand used for generating said polony of the first polony type. In some embodiments, the reverse complement of the region capable of binding the target nucleic acid region that is obtained in said extension in step (i) is encoded by the template nucleic acid strand used for generating the polony of the second polony type from which said modified polony of the second polony type is obtained. In some embodiments, said reverse complement of the region capable of binding the target nucleic acid region is upstream, such as consecutively upstream, from the reverse complement of the second unique barcode region in the template nucleic acid strand used for generating said polony of the second polony type. In some embodiments, the first cleavage site is encoded by the template nucleic acid strand used for generating the polony of the first polony type from which said modified polony of the first polony type as defined in step (i) is obtained, and the reverse complement of the first cleavage site is encoded by the template nucleic acid strand used for generating the polony of the second polony type from which said modified polony of the second polony type as defined in step (i) is obtained.

[0105] Said first cleavage site may be upstream, such as consecutively upstream, from said reverse complement of the low temperature bridge region in said template nucleic acid strand used for generating said polony of the first polony type. Said reverse complement of the first cleavage site may be downstream, such as inconsecutively downstream, from said reverse complement of the low temperature bridge region in said template nucleic acid sequence used for generating said polony of the second polony type. In some embodiments, the second cleavage site is encoded by the template nucleic acid sequence used for generating the polony of the second polony type from which said modified polony of the second polony type as defined in step (i) is obtained. Said second cleavage site may be upstream, such as consecutively upstream, from the reverse complement of the region capable of binding the target nucleic acid region in said template nucleic acid sequence used for generating said polony of the second polony type. In some embodiments, the template nucleic acid strand used for generating said polony of the first polony type comprises the regions as defined immediately above or the reverse complement thereof, and the template nucleic acid strand used for generating said polony of the second polony type comprises the regions as defined immediately above or the reverse complement thereof. In some embodiments, each template nucleic acid strand comprises a spacer region. The spacer region in template nucleic acid strands of the first set of template nucleic acid strands and the spacer region in template nucleic acid strands of the second set of template nucleic acid strands may be orthogonal. Thus, said spacer regions, as demonstrated in Example 1, may be designed so that two polony types may be simultaneously grown on said surface. Moreover, as appreciated by those skilled in the art, a length of the spacer regions may also be selected to obtain longer or shorter template nucleic acid sequences for efficient bridge amplification. In some embodiments, each template nucleic acid strand gives rise to the growth of only one polony on said surface. The present inventors envision that the length of said template nucleic acid strands of said first and said second set of template nucleic acid strands may be adapted for efficient bridge amplification. For example, the length of said template nucleic acid strands of said first and said second set of template nucleic acid strands may be adapted based on a density of said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair linked to said surface in step (iv-a). The density of the linked plurality of said first oligonucleotide pair and the linked said plurality of the second oligonucleotide pair may be monitored for example my microscopy using fluorescent labeling.

[0106] In some embodiments, each template nucleic acid strand comprises a nucleic acid sequence having a length of at least about 100 nucleotides, such as at least about 150 nucleotides, such as at least about 160 nucleotides, such as at least about 170 nucleotides, such as at least about 180 nucleotides, such as at least about 190 nucleotides, such as at least about 200 nucleotides, such as at least about 210 nucleotides, such as at least about 220 nucleotides, such as at least about 230 nucleotides, such as at least about 240 nucleotides, such as at least about 250 nucleotides, such as at least about 300 nucleotides, such as at least about 400 nucleotides, such as at least about 500 nucleotides, such as at least about 600 nucleotides, such as at least about 700 nucleotides, such as at least about 800 nucleotides, such as at least about 900 nucleotides, such as at least about 1000 nucleotides, such as at least about 1100 nucleotides, such as at least about 1200 nucleotides, such as at least about 1300 nucleotides, such as at least about 1400 nucleotides, such as at least about 1500 nucleotides, such as at least about 1600 nucleotides, such as at least about 1700 nucleotides, such as at least about 1800 nucleotides, such as at least about 1900 nucleotides, such as at least about 2000 nucleotides. In some embodiments, each template nucleic acid strand comprises a nucleic acid sequence having a length of at least about 200 nucleotides, such as at least about 210 nucleotides, such as at least about 220 nucleotides, such as at least about 230 nucleotides, such as at least about 240 nucleotides, such as at least about 250 nucleotides, such as at least about 300 nucleotides, such as at least about 400 nucleotides, such as at least about 500 nucleotides, such as at least about 600 nucleotides, such as at least about 700 nucleotides, such as at least about 800 nucleotides, such as at least about 900 nucleotides, such as at least about 1000 nucleotides, such as at least about 1100 nucleotides, such as at least about 1200 nucleotides, such as at least about 1300 nucleotides, such as at least about 1400 nucleotides, such as at least about 1500 nucleotides, such as at least about 1600 nucleotides, such as at least about 1700 nucleotides, such as at least about 1800 nucleotides, such as at least about 1900 nucleotides, such as at least about 2000 nucleotides. In some embodiments, each template nucleic acid strand comprises a nucleic acid sequence having a length of from about 100 to about 2500 nucleotides, such as from about 150 to about 2400 nucleotides, such as from about 160 to about 2300 nucleotides, such as from about 170 to about 2200 nucleotides, such as from about 180 to about 2100 nucleotides, such as from about 190 to about 2000 nucleotides, such as from about 200 to about 2000 nucleotides. In some embodiments, each template nucleic acid strand comprises a nucleic acid sequence having a length of from about 200 to about 2000 nucleotides, such as a length of about 600 nucleotides. In some embodiments, the concentration of template nucleic acid strands in each of said first and second set of template nucleic acid sequences is selected to enable only one bridge amplification reaction of a template nucleic acid sequence on said surface in step (iv), such as a concentration of about 400 pM. In some embodiment, the number of template nucleic acid strands is at least about 2.4 x 1010molecules in each of said first and second set of template nucleic acid sequences. In some embodiments, the oligonucleotides of said first and said second oligonucleotide pairs are orthogonal. In some embodiments, each template nucleic acid strand of said first set of template nucleic acid strands comprise or consist of a nucleic acid sequence according to SEQ ID NO:7. In some embodiments, each template nucleic acid strand of said second set of template nucleic acid strands comprise or consist of a nucleic acid sequence according to SEQ ID NO:8. Each oligonucleotide of the first and the second oligonucleotide pairs may comprise a nucleic acid sequence having a length of at least about 10 nucleotides, such as at least about 11 nucleotides, such as at least about 12 nucleotides, such as at least about 13 nucleotides, such as at least about 14 nucleotides, such as at least about 15 nucleotides, such as at least about 16 nucleotides. Each oligonucleotide of the first and the second oligonucleotide pairs may comprise a nucleic acid sequence having a length of from about 10 to about 60 nucleotides, such as from about 15 to about 55 nucleotides, such as from about 16 to about 50 nucleotides, such as from about 16 to about 40 nucleotides, such as from about 16 to about 30 nucleotides, such as from about 16 to about 20 nucleotides. Each oligonucleotide of the first and the second oligonucleotide pairs may comprise a nucleic acid sequence having a length of about 20 nucleotides, such as a length of 22 nucleotides. The oligonucleotides of said first and said second oligonucleotide pairs may be guanine-cytosine rich. The oligonucleotides of said first and said second oligonucleotide pairs may have a similar melting temperature, such as a melting temperature of from about 50°C to about 60°C. Said melting temperature may be about 55°C. Said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair may be linked to said surface at a high density. In some embodiments, said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair are linked to said surface at the 5'-end of the oligonucleotides. Said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair may be covalently linked to said surface. Said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair may comprise said amine group (- NH2) as defined above at the 5' end of the oligonucleotides. Said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair may thus be covalently linked to said surface via said amine group (-NH2). In some embodiments, the first oligonucleotide pair comprises a first and a second oligonucleotide. In some embodiments, the first oligonucleotide comprises a nucleic acid sequence corresponding to a reverse complement of a nucleic acid region at the 3'-end and the second oligonucleotide comprises a nucleotide sequence identical to a nucleic acid region comprising the first cleavage site at the 5'-end of the template nucleic acid strand used for generating the polony of the first polony type from which said modified polony of the first polony type as defined in step (i) is obtained, or the first oligonucleotide comprises a nucleic acid sequence identical to a nucleic acid region at the 5'-end and the second oligonucleotide comprises a nucleotide sequence corresponding to a reverse complement of a nucleic acid region comprising the reverse complement of the first cleavage site at the 3'-end of the template nucleic acid strand used for generating the polony of the first polony type from which said modified polony of the first polony type as defined in step (i) is obtained. Accordingly, in some embodiments, the nucleic acid sequence of said second oligonucleotide comprises the first cleavage site. As demonstrated in the appended Examples, said first oligonucleotide may comprise a nucleic acid sequence according to SEQ ID NO:3. In some embodiments, said first oligonucleotide comprises an extension at the 5'-end thereof, wherein said extension is the same extension as the extension of the capture probes, as described above. As explained above, said extension may be useful for creating an extra spacing from the surface, such as the extra spacing described in Example 2. Moreover, said extension may comprise a nucleic acid sequence that enables the selective complete removal of said first oligonucleotide from said surface. The nucleic acid sequence of the extension may be different from the nucleic acid sequence of said first cleavage site and said second cleavage site. The present inventors envision that several nucleic acid sequences may be suitable for the herein indicated purposes of said extension of the first oligonucleotide. The skilled person is aware of such nucleic acid sequences. For example, said extension may comprise or consist of a nucleic acid sequence comprising at least one deoxy-uridine nucleotide. In some embodiments, the first oligonucleotide thus comprises at least one deoxy-uridine nucleotide. Said at least one deoxy-uridine nucleotide may be at the 5'-end of the first oligonucleotide. Said at least one deoxy-uridine nucleotide may be from about two to about eight deoxy-uridine nucleotides, such as about four deoxy-uridine nucleotides. Accordingly, said first oligonucleotide may comprise a nucleic acid sequence according to SEQ ID NO:9. Said one or more deoxy-uridine nucleotides may be useful for creating an extra spacing from the surface, such as the extra spacing described in Example 2. Said one or more deoxy-uridine nucleotides may also be useful for a selective complete removal of the capture probes from said surface as shown in the appended Examples, for example using a fifth enzyme, such as an enzyme mix having a DNA endonuclease activity. Such enzyme mix may be a USER enzyme mix. In some embodiments, the first oligonucleotide does not comprise said first and said second cleavage sites. As described above, said first oligonucleotide may comprise the amine group (-NH2), as defined above, at the 5' end thereof. Accordingly, said first oligonucleotide may comprise a nucleic acid sequence according to SEQ ID NO:13. As demonstrated in the appended Examples, said second oligonucleotide may comprise a nucleic acid sequence according to SEQ ID NO:4. In some embodiments, said second oligonucleotide comprises an extension at the 5'-end thereof. Said extension may be useful for creating an extra spacing from the surface, such as the extra spacing described in Example 2. The present inventors envision that several nucleic acid sequences may be suitable for the herein indicated purposes of said extension of the second oligonucleotide. The skilled person is aware of such nucleic acid sequences. For example, said second oligonucleotide may comprise at least one nucleotide, such as at least one thymidine nucleotide, at the 5'-end thereof. Said at least one nucleotide may be from about two to about eight nucleotides, such as about four nucleotides. Accordingly, said second oligonucleotide may comprise a nucleic acid sequence according to SEQ ID NO:10. Moreover, as described above, said second oligonucleotide may comprise the amine group (-NH2) as defined above at the 5' end thereof. Accordingly, said second oligonucleotide may comprise a nucleic acid sequence according to SEQ ID NO:14. In some embodiments, the second oligonucleotide pair comprises a third and a fourth oligonucleotide. In some embodiments, the third oligonucleotide comprises a nucleotide sequence corresponding to a reverse complement of a nucleic acid sequence of a region comprising the reverse complement of the first cleavage site at the 3'-end and the fourth oligonucleotide comprises a nucleic acid sequence identical to a nucleic acid sequence of a region comprising the second cleavage site at the 5'-end of the template nucleic acid strand used for generating the polony of the second polony type from which said modified polony of the second polony type as defined in step (i) is obtained, or the third oligonucleotide comprises a nucleotide sequence identical to a nucleic acid sequence of a region comprising the first cleavage site at the 5'-end and the fourth oligonucleotide comprises a nucleic acid sequence corresponding to a reverse complement of a nucleic acid region comprising the reverse complement of the second cleavage site at the 3'-end of the template nucleic acid strand used for generating the polony of the second polony type from which said modified polony of the second polony type as defined in step (i) is obtained. Accordingly, in some embodiments, the nucleic acid sequence of said third oligonucleotide comprises the first cleavage site and the nucleic acid sequence of said fourth oligonucleotide comprises the second cleavage site. As demonstrated in the appended Examples, said third oligonucleotide may comprise a nucleic acid sequence according to SEQ ID NO:5. In some embodiments, said third oligonucleotide comprises an extension at the 5'-end thereof. Said extension may be useful for creating an extra spacing from the surface, such as the extra spacing described in Example 2. The present inventors envision that several nucleic acid sequences may be suitable for the herein indicated purposes of said extension of the third oligonucleotide. The skilled person is aware of such nucleic acid sequences. For example, said third oligonucleotide may comprise at least one nucleotide, such as at least one thymidine nucleotide, at the 5'-end thereof. Said at least one nucleotide may be from about two to about eight nucleotides, such as about four nucleotides. Accordingly, said third oligonucleotide may comprise a nucleic acid sequence according to SEQ ID NO:11. Moreover, as described above, said third oligonucleotide may comprise the amine group (-NH2) as defined above at the 5' end thereof. Accordingly, said third oligonucleotide may comprise a nucleic acid sequence according to SEQ ID NO:15. As demonstrated in the appended Examples, said fourth oligonucleotide may comprise a nucleic acid sequence according to SEQ ID NO:6. In some embodiments, said fourth oligonucleotide comprises an extension at the 5'-end thereof. Said extension may be useful for creating an extra spacing from the surface, such as the extra spacing described in Example 2. The present inventors envision that several nucleic acid sequences may be suitable for the herein indicated purposes of said extension of the second oligonucleotide. The skilled person is aware of such nucleic acid sequences. For example, said fourth oligonucleotide may comprise at least one nucleotide, such as at least one thymidine nucleotide, at the 5'-end thereof. Said at least one nucleotide may be from about two to about eight nucleotides, such as about four nucleotides. Accordingly, said fourth oligonucleotide may comprise a nucleic acid sequence according to SEQ ID NO:12. Moreover, as described above, said fourth oligonucleotide may comprise the amine group (-NH2) as defined above at the 5' end thereof. Accordingly, said fourth oligonucleotide may comprise a nucleic acid sequence according to SEQ ID NO:16.

[0107] In some embodiments, said surface comprises a glass surface or a silicon surface. In some embodiments, said surface is functionalized, such as is functionalized by an activated polymer. Such functionalization of said surface may be useful for linking said plurality of oligonucleotides of said first and said second pair of oligonucleotides to said surface. Accordingly, said surface may comprise a reactive binding group, such as a binding group that enables covalent linkage of said amine groups, as described above, to said surface. The surface may comprise a matrix, such as a hydrogel which may allow to perform the methods as disclosed herein in three dimensions (3D). The surface or the substrate as referred to herein may constitute a matrix, such as a hydrogel. The surface may have a size of from about 1 mm x 1 mm to about 20 mm x 20 mm. The surface may be a matrix, such as a three dimensional (3D) matrix that is suitable for growing (i.e. generating) one or more polony therein.

[0108] In some embodiments, said sample is a tissue sample. Said tissue sample may be a tissue section. As appreciated by those skilled in the art, there are several suitable methods available in the art for obtaining the tissue sample from a tissue. For example, to prepare tissue sections for mapping of nucleic acids, the tissue may first be embedded in a matrix and then sectioned into thin slices using a microtome or a cryostat. The sections may then be placed on top of a capture surface according to the present disclosure manually or by a special instrument. Said tissue may for example be a non-human or a human tissue. Said tissue may be an animal tissue and / or a plant tissue. Said tissue sample may be obtained by biopsy. Said tissue sample may be obtained for diagnostic purposes. Said capture surface may be suitable for determining the spatial location of said target molecule in the sample. By placing a sample on a capture surface comprising capture probes, the spatial location of the target molecules in the sample will be corresponding to their location on the surface, i.e. the location of the capture probe capturing the target molecule.

[0109] In some embodiments, said cleaved nucleic acid strands of modified polonies of the second polony type, such as the cleaved nucleic acid strand used as template in step (i), that are in close proximity to and are capable to hybridize with at least one cleaved nucleic acid strand of modified polonies of the first polony type, such as said cleaved nucleic acid strand extended in step (i), correspond to neighboring nucleic acid strands for the extension as defined in step (i). Said close proximity may correspond to less than from about 100 nm to about 300 nm, such as less than from about 150 nm to about 250 nm, such as less than about 200 nm. In some embodiments, said at least one metapolony, such as said plurality of meta polonies, is generated at a density of at least about 50000 polonies per mm2, such as at least about 100 000 polonies per mm2, such as at least about 200 000 polonies per mm2, such as at least about 300 000 polonies per mm2, such as at least about 400 000 polonies per mm2, such as at least about 500 000 polonies per mm2, such as at least about 600 000 polonies per mm2, such as at least about 700 000 polonies per mm2, such as at least about 800 000 polonies per mm2, such as at least about 900 000 polonies per mm2, such as at least about 1 million polonies per mm2, such as at least about 2 million polonies per mm2, such as at least about 3 million polonies per mm2, such as at least about 4 million polonies per mm2, such as at least about 5 million polonies per mm2, such as at least about 6 million polonies per mm2, such as at least about 7 million polonies per mm2, such as at least about 8 million polonies per mm2, such as at least about 9 million polonies per mm2, such as at least about 10 million polonies per mm2. In some embodiments, said at least one metapolony, such as said plurality of metapolonies, is generated at a density of from about 50000 polonies per mm2to about 50 million polonies per mm2, such as from about 50000 polonies per mm2to about 50 million polonies per mm2, such as from about 60000 polonies per mm2to about 40 million polonies per mm2, such as from about 70000 polonies per mm2to about 30 million polonies per mm2, such as from about 80000 polonies per mm2to about 20 million polonies per mm2, such as from about 90000 polonies per mm2to about 10 million polonies per mm2, such as from about 100 000 polonies per mm2to about 10 million polonies per mm2. In some embodiments, said at least one metapolony, such as said plurality of metapolonies, is generated at a density of from about 100 000 polonies per mm2to about 5 million polonies per mm2, such as from about 200 000 polonies per mm2to about 4 million polonies per mm2, such as from about 300000 polonies per mm2to about 3 million polonies per mm2, such as from about 400000 polonies per mm2to about 2 million polonies per mm2, such as from about 500000 polonies per mm2to about 1 million polonies per mm2. In some embodiments, said at least one metapolony, such as said plurality of metapolonies, is generated at a density of from about 500 000 polonies per mm2to about 1 million polonies per mm2. The inventors envision that the density of said at least one metapolony, such as said plurality of metapolonies, may be adapted according to the planned use of a capture probe according to the present disclosure. The density of said at least one metapolony, such as said plurality of metapolonies, may for example be chosen so that one or more metapolonies having a diameter of about 0.5 pm to 10 pm may be obtained. Said diameter of 0.5 pm to 10 pm may for example enable single cell resolution of said at least one target molecule, such as said plurality of target molecules, in said sample, for example by using a method as disclosed herein with relation to the third aspect of the present disclosure. Accordingly, a capture surface as disclosed herein may comprise from about 1 to about 100 million metapolonies of said at least one metapolony on the surface, wherein said surface may have a size of from about 1 mm x 1 mm to about 20 mm x 20 mm, respectively. As demonstrated in the appended Examples and in Fig. 5, the density of polonies, modified polonies and metapolonies as disclosed herein may be evaluated using standard microscopic methods and fluorescence technologies that are well known to those skilled in the art. The present inventors envision, that the desired density of said metapolonies may be obtained by generating said polonies of said first and said second polony types on the surface at suitable density therefor. As discussed above, overlapping polonies, and in particular, surfaces that have been saturated by overlapping polonies, of the two polony types are considered particularly beneficial for superior network formation in context of the present disclosure. Thus, in some embodiments, said polonies of the two polony types, from which the metapolonies are generated, are overlapping polonies, such as overlapping polonies saturating the surface. For example, a suitable density of said polonies of said first and said second polony types may be achieved by linking said plurality of said first and said second oligonucleotide pairs to the surface at a high density, for example as demonstrated in the appended Examples. Moreover, said suitable density of said polonies of said first and said second polony types may be achieved by adapting the number and / or concentration of said template nucleic acid strands of said first and said second set of template nucleic acid strands, as demonstrated in the appended Examples and Fig. 5. Moreover, said suitable density of said polonies of said first and said second polony types may be achieved by adapting the number of cycles of said bridge amplification. As envisioned by the present inventors and as exemplified below, a saturated surface of said metapolonies may be achieved by adapting the number and / or concentration of said template nucleic acid strands of said first and said second set of template nucleic acid strands; and / or the number of cycles of said bridge amplification. Accordingly, a saturated surface may be obtained by using a higher number of bridge amplification cycles and a lower number and / or concentration of said template nucleic acid strands of said first and said second set of template nucleic acid strands, wherein said polonies of said first and said second polony types are obtained in smaller number but with a larger diameter. On the other hand, if said plurality of metapolonies are desired to be obtained at a single cell resolution, the number and / or concentration of said template nucleic acid strands of said first and said second set of template nucleic acid strands may be increased and the number of bridge amplification cycles may be decreased to a suitable amount. As described above and demonstrated below, said parameters may be easily adapted and controlled by known methods to obtain a suitable density and resolution of said at least one metapolony, such as the plurality of metapolonies.

[0110] In a second aspect of the present disclosure there is provided a capture surface for at least one target molecule in a sample, each target molecule comprising a target nucleic acid region, said capture surface comprising a surface and a plurality of metapolonies, each metapolony comprising at least one capture probe linked to said surface, wherein each capture probe of a metapolony comprises a first and a second unique barcode region that are unique for said metapolony and a region capable of binding the target nucleic acid region of said at least one target molecule.

[0111] Said capture surface may be suitable for determining the spatial location of said target molecule in the sample. Said at least one target molecule may be a plurality of target molecules. Said at least one capture probe may be a plurality of capture probes. In some embodiments, a combination of the first and the second unique barcode regions encoded by a capture probe of said at least one capture probe, such as said plurality of capture probes, of a metapolony of said plurality of metapolonies indicates information about the spatial position of said capture probe on said surface, which may be correlated to a position of the target molecule in the sample. Said information may be obtained by sequencing, such as by high-throughput sequencing, of said at least one capture probe, such as said plurality of captures probes, of said plurality of metapolonies. Said information may be obtained subsequent to capturing said at least one target molecule, such as said plurality of target molecules, from said sample using said capture surface. Said spatial position may be a relative spatial position obtained for said capture probe relative to one or more other capture probes of said at least one capture probe, such as said plurality of capture probes, of said plurality of metapolonies. In some embodiments, said spatial position is obtained for a capture probe of said at least one capture probe, such as said plurality of capture probes, of a metapolony of said plurality of meta polonies based on the information indicated by the combinations of the first and the second barcode regions encoded by said at least one capture probe, such as said plurality of capture probes, of said plurality of metapolonies. Said information may be obtained by sequencing, such as by high-throughput sequencing, of said at least one capture probe, such as said plurality of captures probes, of said plurality of metapolonies. Said information may be obtained subsequent to capturing said at least one target molecule, such as said plurality of target molecules, from said sample using said capture surface. Thus, for example after DNA recovery and amplification, sequencing of the capture probes and their captured targets may be performed. By obtaining information regarding the two unique barcode regions, a relative map may be created, by positioning the capture probes in relation to each other. This relative positioning may then be used to find their absolute position by positioning all of the probes relative to each other. The position of each capture probe correlates to the position of the target molecule, captured by said capture probe, in the sample, thus the relative and / or the absolute position of the target molecules in the sample may be obtained. It is to be understood that the information obtained from the combination of the first and the second unique barcode regions of two or more capture probes of said at least one capture probe, such as said plurality of capture probes, of said plurality of metapolonies indicates if said two or more capture probes belong to the same meta polony or belong to two or more different metapolonies of said plurality of metapolonies. Moreover, it is to be understood that if two or more capture probes of said at least one capture probe, such as said plurality of capture probes, of said plurality of metapolonies comprise the same first and the same second unique barcode regions, said two or more capture probes belong to the same metapolony and their spatial position in relation to each other within the metapolony, to which they belong to, cannot be obtained. In some embodiments, said plurality of metapolonies are generated from a plurality of polonies of two polony types, such as two orthogonal polony types, grown on said surface, wherein a metapolony may be generated from two neighboring or overlapping polonies of the two polony types. As discussed above, overlapping polonies, and in particular, surfaces that have been saturated by overlapping polonies, of the two polony types are considered particularly beneficial for superior network formation in context of the present disclosure. Thus, in some embodiments, said polonies of the two polony types, from which the metapolonies are generated, are overlapping polonies, such as overlapping polonies saturating the surface. It is to be understood that each of said two neighboring or overlapping polonies belongs to a different polony type of said two polony types. In some embodiments, said two polony types comprise a first polony type and a second polony type, wherein said first and said second polony types may be orthogonal. Accordingly, one of said two neighboring or overlapping polonies may belong to the first polony type and one of said two neighboring or overlapping polonies may belong to the second polony type. Said plurality of polonies of said two polony types, such as said first and said second polony types, may encode said first and said second barcode regions, respectively, of said at least one capture probe, such as said plurality of capture probes, of said plurality of metapolonies, wherein each first and each second unique barcode region is unique for the respective polonies of said plurality of polonies. Accordingly, in some embodiments, each polony of said first polony type encodes a first unique barcode region, wherein a first unique barcode region encoded by a polony is unique for said polony; and each polony of said second polony type encodes a second unique barcode region, wherein a second unique barcode region encoded by a polony is unique for said polony. It is to be understood that said first unique barcode region of a capture probe of said at least one capture probe, such as said plurality of capture probes, of said plurality of meta polonies may be encoded by a polony of said polonies the first polony type. Moreover, said second unique barcode region of a capture probe of said at least one capture probe, such as said plurality of capture probes, of said plurality of metapolonies may be encoded by a polony of said polonies the second polony type. It is to be understood that the information obtained from the first barcode regions of two or more capture probes of said at least one capture probe, such as said plurality of capture probes, of said plurality of meta polonies indicates if said two or more capture probes derive from the same polony of one of said two polony types, such as the same polony of said first polony type, or derive from two or more different polonies of one of said two polony types, such as two or more different polonies of said first polony type. Furthermore, the information obtained from the second barcode regions of two or more capture probes of said at least one capture probe, such as said plurality of capture probes, of said plurality of metapolonies indicates if said two or more capture probes derive from the same polony of one of said two polony types, such as the same polony of said second polony type, or derive from two or more different polonies of one of said two polony types, such as two or more different polonies of said second polony type. Thus, in some embodiments, the combination of the first and the second unique barcode regions encoded by a capture probe of said at least one capture probe, such as said plurality of capture probes, of a metapolony of said plurality of metapolonies indicates information about the spatial position of said capture probe on said surface with respect to said plurality of meta polonies as well as said plurality of polonies of two polony types, such as two orthogonal polony types, grown on said surface, from which said metapolonies have been generated. As defined above in further details, meta polonies are also considered to be generated from modified polonies of the two polony types, such as the two orthogonal polony types, according to present disclosure (which are in turn generated from polonies of the first and the second polony types). This is considered advantageous in context of the present disclosure, as generation of the two polony types and the sequence information transfer between these two polony types is separated. This is thought to be useful in controlling desired hybridization events between nucleic acid strands present on the surface.

[0112] It is to be understood that that embodiments discussed above in relation to the first aspect of the disclosure relating to the capture probe and sequence regions thereof as disclosed herein are equally relevant for the second aspect of the disclosure. For the sake of brevity, these will not be repeated herein or just briefly mentioned below. In some embodiments, each capture probe is a single stranded nucleic acid strand, such as a single stranded DNA strand. In some embodiments, said region capable of binding the target nucleic acid region is at the distal end, such as at the 3'-end, of the capture probes. In some embodiments, each capture probe comprises a bridge region, such as a low temperature bridge region, or a reverse complement thereof. Said bridge region, such as the low temperature bridge region, or the reverse complement thereof may be positioned between said first and said second unique barcode regions in each capture probe. As discussed above, the herein described sequence domain architecture is particularly advantagous in the context of the present disclosure for allowing both spatial positioning and target capture, wherein said first and said second unique barcode regions are upstream from said region capable of binding the target nucleic acid region in each capture probe (which is positioned at the distal end, such as at the 3'-end, of the capture probe), and wherein the bridge region, such as the low temperature bridge region, or the reverse complement thereof is positioned between said first and said second unique barcode regions (see e.g. Fig. 4D). In some embodiments, each capture probe comprises a forward primer binding region suitable for amplification and sequencing more proximally, such as upstream, from the first unique barcode region. In some embodiments, each capture probe comprises an extension at the proximal end, such as at the 5'-end, thereof. Said extension may be useful for creating an extra spacing from the surface, such as the extra spacing described in Example 2. Moreover, said extension may comprise a nucleic acid sequence that enables the selective complete removal of said capture probes from said surface. The nucleic acid sequence of the extension may be different from the nucleic acid sequence of said first cleavage site and said second cleavage site described above. The present inventors envision that several nucleic acid sequences may be suitable for the herein indicated purposes of said extension of the capture probes. The skilled person is aware of such nucleic acid sequences. For example, said extension may comprise or consist of a nucleic acid sequence comprising at least one deoxy-uridine nucleotide. In some embodiments, each capture probe thus comprises at least one deoxy-uridine nucleotide. Said at least one deoxy-uridine nucleotide may be at the 5'-end of the capture probes. Said at least one deoxy-uridine nucleotide may be from about two to about eight deoxyuridine nucleotides, such as about four deoxy-uridine nucleotides. In some embodiments, each capture probe is linked to said surface at the 5'-end thereof. Each capture probe may be covalently linked to said surface. As demonstrated in the appended Examples, each capture probe may comprise at the 5'-end thereof an amine group (-NH2). Thus, each capture probe may be linked to said surface via said amine group (-NH2). The present inventors however envision that several means may be suitable for the herein indicated purposes of said amine group of said capture probes. The skilled person is aware of such means. In some embodiments, the first and the second unique barcode regions are located more proximally, such as upstream, from said region capable of binding the target nucleic acid region in each capture probe. In some embodiments, the first barcode region is positioned more proximally, such as upstream, from the second barcode region in each capture probe. In some embodiments, a proximal to distal end order, such as a 5'-end to 3'- end order, of said regions defined immediately above in each capture probe is: the extension, such as said at least one deoxy-uracil uridine nucleotide comprising nucleic acid region, the forward primer binding region suitable for amplification for sequencing, the first unique barcode region, the low temperature bridge region, the second unique barcode region and the region capable of binding the target nucleic acid region. In some embodiments, a spacer region is located between said extension, such as the at least one deoxy-uracil uridine nucleotide comprising nucleic acid sequence region, and the forward primer binding region suitable for amplification for sequencing. In some embodiments, each capture probe comprises a nucleic acid sequence having a length of at least about 100 nucleotides, such as at least about 150 nucleotides, such as at least about 160 nucleotides, such as at least about 170 nucleotides, such as at least about 180 nucleotides, such as at least about 190 nucleotides, such as at least about 200 nucleotides, such as at least about 210 nucleotides, such as at least about 220 nucleotides, such as at least about 230 nucleotides, such as at least about 240 nucleotides, such as at least about 250 nucleotides, such as at least about 300 nucleotides, such as at least about 400 nucleotides, such as at least about 500 nucleotides, such as at least about 600 nucleotides, such as at least about 700 nucleotides, such as at least about 800 nucleotides, such as at least about 900 nucleotides, such as at least about 1000 nucleotides, such as at least about 1100 nucleotides, such as at least about 1200 nucleotides, such as at least about 1300 nucleotides, such as at least about 1400 nucleotides, such as at least about 1500 nucleotides, such as at least about 1600 nucleotides, such as at least about 1700 nucleotides, such as at least about 1800 nucleotides, such as at least about 1900 nucleotides, such as at least about 2000 nucleotides. In some embodiments, each capture probe comprises a nucleic acid sequence having a length of at least about 200 nucleotides, such as at least about 210 nucleotides, such as at least about 220 nucleotides, such as at least about 230 nucleotides, such as at least about 240 nucleotides, such as at least about 250 nucleotides, such as at least about 300 nucleotides, such as at least about 400 nucleotides, such as at least about 500 nucleotides, such as at least about 600 nucleotides, such as at least about 700 nucleotides, such as at least about 800 nucleotides, such as at least about 900 nucleotides, such as at least about 1000 nucleotides, such as at least about 1100 nucleotides, such as at least about 1200 nucleotides, such as at least about 1300 nucleotides, such as at least about 1400 nucleotides, such as at least about 1500 nucleotides, such as at least about 1600 nucleotides, such as at least about 1700 nucleotides, such as at least about 1800 nucleotides, such as at least about 1900 nucleotides, such as at least about 2000 nucleotides. In some embodiments, each capture probe comprises a nucleic acid sequence having a length of from about 100 to about 2500 nucleotides, such as from about 150 to about 2400 nucleotides, such as from about 160 to about 2300 nucleotides, such as from about 170 to about 2200 nucleotides, such as from about 180 to about 2100 nucleotides, such as from about 190 to about 2000 nucleotides, such as from about 200 to about 2000 nucleotides. In some embodiments, each capture probe comprises a nucleic acid sequence having a length of from about 200 to about 2000 nucleotides. In some embodiments, each capture probe comprises a nucleic acid sequence having a length of about 630 nucleotides. In some embodiments, each capture probe comprises or consists of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:40-42. The capture probes may comprise or consist of a nucleic acid sequence according to SEQ ID NO:40. The capture probes may comprise or consist of a nucleic acid sequence according to SEQ ID NO:41. The capture probes may comprise or consist of a nucleic acid sequence according to SEQ ID NO:42.

[0113] It is to be understood that that embodiments discussed above in relation to the first aspect of the disclosure relating to the target molecule, target nucleic acid region and the region capable of binding the target nucleic acid region as disclosed herein are equally relevant for the second aspect of the disclosure. For the sake of brevity, these will not be repeated herein or just briefly mentioned below. In some embodiments, said target nucleic acid region comprises or consists of an RNA sequence, a pseudo-RNA sequence or a DNA sequence, such as an RNA sequence. In some mebodiment, said target nucleic acid region comprises or consists of a polyadenine sequence. In some embodiments, said region capable of binding the target nucleic acid region comprises a target binding nucleic acid sequence, such as a poly- thymidine sequence. In some embodiments, said poly-thymidine sequence comprises or consists of from about 10 to about 30 consecutive thymidine nucleotides, such as from about 15 to about 25 thymidine nucleotides, such as about 20 thymidine nucleotides. In some embodiments, said region capable of binding the target nucleic acid region further comprises at least one spacer nucleotide more proximal, such as upstream, from the target binding nucleic acid sequence. Said at least one spacer nucleotide may be alanine. Said at least one spacer nucleotide may be positioned between the second unique barcode region and the target binding nucleic acid sequence in each capture probe. In some embodiments, said target molecule is selected from a group consisting of an RNA molecule, a DNA molecule, a peptide and a polypeptide. Said target molecule may an RNA molecule or a DNA molecule, such as an RNA molecule. Said RNA molecule may be an mRNA molecule, such as an mRNA molecule comprising a poly-adenine tail. Said target molecule may be a peptide or a polypeptide, such as a DNA probe labeled peptide or a DNA-probe labeled polypeptide.

[0114] It is to be understood that that embodiments discussed above in relation to the first aspect of the disclosure relating to the sample and the surface as disclosed herein are equally relevant for the second aspect of the disclosure. For the sake of brevity, these will not be repeated herein or just briefly mentioned below. In some embodiments, said sample is a tissue sample. In some embodiments, said surface comprises a glass surface or a silicon surface, such as a glass surface. Said surface may be functionalized, such as functionalized by an activated polymer.

[0115] It is to be understood that that embodiments discussed above in relation to the first aspect of the disclosure relating to polonies, modified polonies and / or meta polonies as disclosed herein are equally relevant for the second aspect of the disclosure. For the sake of brevity, these will not be repeated.

[0116] In some embodiments, the capture surface according to the second aspect of the present disclosure is manufactured according to any one of the embodiments of the method as described above in relation to the first aspect of the present disclosure. In a third aspect of the present disclosure, there is provided a method for creating a spatial map of a plurality of target molecules in a sample, each target molecule comprising a target nucleic acid region, said method comprising

[0117] (a) capturing a plurality of target molecules using a capture surface obtained by the method as defined in any one of the embodiments of the method as described above in relation to the first aspect of the present disclosure, or a capture surface as defined in any one of the embodiments as described above in relation to the second aspect of the present disclosure,

[0118] (b) extending each capture probe of said capture surface that binds a target molecule of said plurality of target molecules based on a nucleic acid sequence region of the captured target molecule;

[0119] (c) producing a sequenceable library of a plurality of extended capture probes obtained in step (b);

[0120] (d) sequencing said sequenceable library obtained in step (c);

[0121] (e) defining the spatial position of said plurality of extended capture probes on the capture surface based on the information indicated by the combinations of the first and the second unique barcode regions encoded by each of said plurality of extended capture probes;

[0122] (f) creating a spatial map of said plurality of target molecules in said sample based on the spatial position of said plurality of extended capture probes and the nucleic acid sequence regions of the captured plurality of target molecules.

[0123] In some embodiments, said method comprises in step (c), synthesizing a second strand of each extended capture probe comprising a nucleic acid sequence corresponding to a reverse complement of the nucleic acid sequence of the respective extended capture probe. In some embodiments, said method comprises in step (c), the removal of said plurality of extended capture probes from the surface of the capture surface. Said removal may be performed by a cleavage of each capture probe at said extension at the proximal end, such as at the 5'-end, thereof, as described with relation to the first and second aspects of the present disclosure. Said removal may be performed using the fifth enzyme, such as the enzyme mix having a DNA endonuclease activity, as described with relation to the first and second aspects of the present disclosure. Said fifth enzyme mix may be the USER enzyme mix. Accordingly, said removal may be the selective complete removal of said plurality of extended capture probes as well as each capture probe of said surface which has not been extended. In some embodiments, said method comprises in step (c), amplifying said plurality of extended capture probes and / or second strand thereof prior to said sequencing. A non-limiting way to perform the method according to the third aspect of the present disclosure is illustrated in Examples 6-8. For example, said extension in step (b) may correspond to extension of said capture probes by cDNA synthesis based on the nucleic acid sequence of the captured target molecules. For example, if said plurality of target molecules is a plurality of mRNA molecules, reverse complements of the mRNA sequences of said plurality of mRNA molecules may be obtained in said extended capture probes. In some cases, wherein said plurality of target molecules is a plurality of nucleic acid probe-labeled binding molecules, such as a plurality of DNA probe-labeled binding molecules, reverse complements of nucleic acid sequences of said nucleic acid probes, such as said DNA probes, of said plurality of nucleic acid probe-labeled binding molecules, such as a plurality of DNA probe-labeled binding molecules, may be obtained in said extended capture probes. As explained above in relation to the first aspect of the present disclosure, based on the specificity of said binding molecules, spatial location of one or more antigens in the sample may be obtained. The present inventors envision that a method for creating the capture surface according to the first aspect of the present disclosure, a capture surface according to the second aspect of the present disclosure as well as the method according to the third aspect of the present disclosure may be particularly advantageous for spatial transcriptomics and / or spatial proteomics applications. It is to be understood that sequencable library is only obtained for said plurality of extended capture probes. Capture probes of said capture surface that are not extended do not form basis for producing said sequencable library. This may be achieved by selecting a reverse primer binding region suitable for amplification for sequencing that is obtained during said extension according to step (b). A non-limiting example of such reverse primer binding region suitable for amplification for sequencing is demonstrated in Example 8 and Fig. 8. Accordingly, the forward primer binding region, as described with relation to the first and the second aspects of the present disclosure, and the reverse primer binding region may be utilized in producing a sequenceable library, as disclosed herein.

[0124] It is to be understood that that embodiments discussed above in relation to the first and / or the second aspect of the disclosure relating to the spatial position of and the information indicating said spatial information as disclosed herein are equally relevant for the third aspect of the disclosure. It is to be understood, that said embodiments are equally relevant for the spatial position of said plurality of extended capture probes as well as the spatial position of said plurality of target molecules. For the sake of brevity, these will not be repeated herein or just briefly mentioned below. In some embodiments, said spatial position in step (d) is a relative spatial position obtained for each extended capture probe relative to other extended capture probes of said plurality of extended capture probes. Said spatial map may define the spatial position of said plurality of target molecules. Said spatial position may be a relative spatial position obtained for each target molecule relative to other target molecules of said plurality of target molecules. Said spatial position may be an absolute spatial position obtained for each target molecule in said sample. It is to be understood that said spatial position obtained for said plurality of target molecules is obtainable based on the first and the second unique barcode regions encoded by said capture probes of said capture surface that bind a target molecule of said plurality of target molecules.

[0125] It is to be understood that that embodiments discussed above in relation to the first and / or the second aspect of the disclosure relating to the sample as disclosed herein are equally relevant for the third aspect of the disclosure. For the sake of brevity, these will not be repeated herein or just briefly mentioned below. In some embodiments, said sample is a tissue sample. As illustrated in Fig. 8, said sample may be placed on the capture surface as disclosed herein such that said target molecules are able to diffuse towards the capture surface and thus may be bound by the capture probes. As demonstrated in Fig. 8 by overlaying the sample and the capture surface according to present disclosure, the spatial position of the plurality of metapolonies of a capture surface as disclosed herein may be corresponded to specific tissue sections in said sample. Accordingly, the absolute position of said plurality of target molecules in said sample may be obtained in a method as disclosed herein. The present inventors envision that by adapting the density of said plurality of metapolonies of the capture surface as disclosed herein, a resolution of the spatial map obtained in step (f) may be selected.

[0126] It is to be understood that that embodiments discussed above in relation to the first and / or the second aspect of the disclosure relating to the target molecule, target nucleic acid region and the region capable of binding the target nucleic acid region as disclosed herein are equally relevant for the third aspect of the disclosure. For the sake of brevity, these will not be repeated herein or just briefly mentioned below. In some embodiments, said sample is a tissue sample. In some embodiments, said target nucleic acid region comprises or consists of an RNA sequence, a pseudo- RNA sequence or a DNA sequence, such as an RNA sequence. In some embodiments, said target nucleic acid region comprises or consists of a poly-adenine sequence. In some embodiments, said target molecule is selected from a group consisting of an RNA molecule, a DNA molecule, a peptide and a polypeptide. Said target molecule may be an RNA molecule or a DNA molecule, such as an RNA molecule. Said RNA molecule may be an mRNA molecule, such as an mRNA molecule comprising a polyadenine tail. Said target molecule may be a peptide or a polypeptide, such as a DNA probe labeled peptide or a DNA-probe labeled polypeptide.

[0127] In some embodiments, said sequencing is high-throughput sequencing.

[0128] It is to be understood that that embodiments discussed above in relation to the first and / or the second aspect of the disclosure relating to polonies, modified polonies and / or meta polonies as disclosed herein are equally relevant for the third aspect of the disclosure. For the sake of brevity, these will not be repeated. In a fourth aspect of the present disclosure, there is provided a kit comprising a capture surface obtained by the method as defined in any one of the embodiments of the method as described above in relation to the first aspect of the present disclosure, or a capture surface as defined in any one of the embodiments as described above in relation to the second aspect of the present disclosure. Said kit may be suitable for use in a method according to the third aspect of the present disclosure. Accordingly, said kit may comprise one or more reagents suitable for use in the method according to the third aspect of the present disclosure. In some embodiments, said kit comprises one or more reagents selected from the group consisting of reagents for RNA reverse transcription, reagents for second strand synthesis and reagents for producing a sequenceable library. Said reagents may be as defined above with respect to the third aspect of the present disclosure and / or in the appended Examples relating thereto.

[0129] Examples

[0130] While the invention has been described with reference to various exemplary aspects and embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. In addition, many modifications may be made to adapt a particular situation or molecule to the teachings of the invention without departing from the essential scope thereof. Therefore, it is intended that the invention is not to be limited to any particular embodiment, but that the invention will include all embodiments falling within the scope of the appended claims.

[0131] The invention will be further illustrated by the following non-limiting Examples. They are offered for illustrative purposes only and are not intended to limit the invention in any manner. Those of skill in the art will readily recognize a variety of non-critical parameters which can be changed or modified to yield essentially the same results. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperatures, etc.), but some experimental error and deviations may be present. Unless otherwise indicated, the practice of the invention employs conventional methods of nucleic acid chemistry, biochemistry, molecular biology techniques and bioinformatics, within the skill of the art. Such techniques are explained fully in the existing literature. Additionally, it will be apparent to one of skill in the art that the methods for nucleic acid strand engineering applied herein can also be applied to other constructs described herein and contemplated by the present inventors to fall within the scope of the disclosure.

[0132] For the sake of clarity, each sequence described in the present disclosure is written in a 5'-end to 3'-end direction. Sequences identified with SEQ ID NOs as referred to herein are described below and / or presented in Fig. 9A-D.

[0133] Example 1

[0134] Design of DNA primers and seed strands

[0135] This example demonstrates non-limiting examples of primers as well as nucleic acid strands suitable for generating two types of polonies on a surface according to the present disclosure, wherein each polony encodes a unique barcode region. The example also presents primer and template nucleic acid strand design strategies suitable for designing such primers and template nucleic acid strands.

[0136] Primer design

[0137] For the sake of clarity, the terms "primer" and "oligonucleotide" are used interchangeably herein and refer to nucleic acid strands which may be used in an amplification reaction according to the present disclosure for amplifying a template nucleic acid strand.

[0138] As demonstrated in the following examples, two different types of polonies as disclosed herein may be produced by bridge PCR, also known as bridge amplification, on a dense lawn of primer DNA strands that are covalently linked at their 5'-end to a surface. Growing two types of polonies, Alpha and Beta, simultaneously on the same surface by bridge PCR, may be achieved by using two pairs of primers, such as A and B primers for Alpha polonies and C and D primers for Beta polonies, wherein the two primer pairs are specific for amplifying two different sets of template nucleic acid strands.

[0139] The present inventors have found that for simultaneous bridge PCR of the two polony types, it is advantageous that primers of the two primer pair have a similar melting temperature. Moreover, the present inventors have found that for preventing miss-priming between the polony types it is beneficial if the primers are orthogonal.

[0140] Additionally, enzymatic postprocessing as described in Examples 4 and 5 below may be enabled by primers B and C comprising the sequence 'GAATTC' (SEQ ID NO:1) at their 3' end, which is a restriction site for the restriction enzyme EcoRI, and by primer D comprising the sequence 'TTCGAA' (SEQ ID NO:2) at its 3' end, which is a restriction site for the restriction enzyme Bspll9L These specific restriction sites in the subset of primers enable the selective removal of these primers when linked to a surface, as well as nucleic acid strands which have been obtained by extending these primers, using the above specified restriction enzymes in an enzymatic reaction. Since restriction enzymes are only active if their corresponding restriction site is present in a nucleotide, choosing a different restriction enzyme-restriction site pair for each primer which is intended to be removed from the surface enables the removal of these primers or an extended nucleotide thereof selectively. Accordingly, if two primers comprise the same restrictions site, these will be equally removed in an enzymatic reaction using the respective restriction enzyme. It is to be understood that the herein present examples of restriction sites and restriction enzymes are non-limiting examples suitable for the selective removal as discussed herein and the skilled person is aware of various restriction enzyme-restriction site pairs which may be employed for such purpose. Moreover, while the herein shown exemplary restriction sites are located at the 3'-end of the primers in question, the present inventors envision that the restriction site may be located anywhere within the primer sequence, as long as the respective restriction enzyme is not hindered from binding to the nucleic acid strand and it remains capable of cleaving the nucleic acid strand at the specific restriction site.

[0141] In the present example, each primer was designed to be 22 nucleotides long and have a GC content between 45-55 % using the DNA sequence design tool NUPACK. The skilled person appreciates that primer length and GC content may be optimized without undue burden, for example by using bioinformatic tools available in the field. Moreover, it is to be understood that primers with a length and / or GC content that is different from those demonstrated herein may be suitable for the method as disclosed herein, as for example conditions of an amplification reaction may be adapted according to the selected set of primers.

[0142] Exemplary primer pairs for generating two types of polonies on a surface by bridge PCR as demonstrated herein comprise nucleic acid sequences according to

[0143] A: GGCCAACGGTGTCTCAATCAAC (SEQ ID NO:3),

[0144] B: GCTGCTAAGCCGGACTGAATTC (SEQ ID NO:4),

[0145] C: CGCACTGCCGCAGAATGAATTC (SEQ ID NO:5) and

[0146] D: GCGGTTCCTGAACACGTTCGAA (SEQ ID NO:6), wherein A and B form a primer pair and C and D form a primer pair, which primer pairs are designed to be capable of amplifying two different sets of template nucleic acid strands. The calculated melting temperature of these exemplary primers is similar for each primer and is about at 54.75 °C.

[0147] Seed strand design

[0148] For the sake of clarity, the terms "seed strands" and "template nucleic acid strands" are used interchangeably herein and refer to nucleic acid strands which may be used in a bridge amplification reaction according to the present disclosure as templates.

[0149] Two exemplary seed strand sets, such as a first and a second set of template nucleic acid strands, are Alpha strands and Beta strands, respectively, that are suitable for generating two types of polonies according to the present disclosure. Alpha strands and Beta strands are 600nt long double stranded DNA strands that may be used to extend the primer pairs A / B and C / D, respectively, as described above, thereby creating an origin strand for each polony before bridge PCR. Sequence regions of such Alpha and Beta seed strands are demonstrated in Fig. 1. As apparent from Fig. 1, the first and the second set of template nucleic acid strands may be double stranded strands, such as double stranded DNA strands. It is to be understood that both forward and reverse strands of the double stranded seed strands are able to hybridize to a primer of the respective primer pairs which are able to amplify the given set of template nucleic acid strands and it is either the forward or the reverse strand of a double stranded seed strand that serves as an origin strand for growing a polony. This may be achieved by denaturing said double stranded seed strands prior to said hybridization. Accordingly, and as shown in Fig.

[0150] 1, Alpha and Beta strands are designed to comprise at their 3' and 5' ends nucleic acid sequence regions corresponding to the primer sequences according to SEQ ID NO:3 / SEQ ID NO:4and SEQ ID NO:5 / SEQ ID NO:6, respectively. In particular, forward strands of the double stranded Alpha seed strands comprise at one end, such as at the 3'-end, a nucleic acid sequence region corresponding to the reverse complement of the nucleic acid sequence according to SEQ ID NO:3 and at the other end, such as at the 5'-end, a nucleic acid sequence region that is identical to the nucleic acid sequence according to SEQ ID NO:4, while reverse strands of the double stranded Alpha seed strands comprise at one end, such as at the 3'-end, a nucleic acid sequence region corresponding to the reverse complement of the nucleic acid sequence according to SEQ ID NO:4 and at the other end, such as at the 5'-end, a nucleic acid sequence region that is identical to the nucleic acid sequence according to SEQ ID NO:3. Similarly, forward strands of the double stranded Beta seed strands comprise at one end, such as at the 3'-end, a nucleic acid sequence region corresponding to the reverse complement of the nucleic acid sequence according to SEQ ID NO:5 and at the other end, such as at the 5'-end, a nucleic acid sequence region that is identical to the nucleic acid sequence according to SEQ ID NO:6, while reverse strands of the double stranded Beta seed strands comprise at one end, such as at the 3'-end, a nucleic acid sequence region corresponding to the reverse complement of the nucleic acid sequence according to SEQ ID NO:6 and at the other end, such as at the 5'-end, a nucleic acid sequence region that is identical to the nucleic acid sequence according to SEQ ID NO:5. Accordingly, forward and reverse strands of Alpha seed strands may be used as template for extending A and B primers, respectively, while forward and reverse strands of Beta seed strands may be used as template for extending C and D primers, respectively.

[0151] The length of the seed strands is chosen to enable an effective bridge PCR reaction, as discussed further below, wherein surface-linked primer strands that are extended using these seed strands as template are able to reach and hybridize with non-extended primers linked to the surface. The present inventors envision that depending on the density of the primers seeded on the surface, i.e. depending on the proximity of surface-anchored primer pairs, various lengths may be selected for the template nucleic acid strands as disclosed herein.

[0152] Alpha and Beta seed strands comprise a combination of specific sequence regions as discussed below and a central spacer region designed to achieve a full length suitable for effective bridge PCR. Each Alpha and Beta seed strand comprises a random sequence region of 24 nucleotides that form a unique molecular identifier (UMI, also referred to herein as unique barcode region) for each polony created by bridge PCR, as explained below. It is to be understood that in the following examples each polony is generated based on one template nucleic acid strand of the sets of Alpha and Beta nucleic acid template strands and each template nucleic acid strand gives rise to the growth of one polony on the surface. It is to be understood that each template nucleic acid strand of the Alpha seed strands may be amplified using the A / B primer pair, independently of the UMI encoded by the template nucleic acid strand, and similarly, each template nucleic acid strand of the Beta seed strands may be amplified using the C / D primer pair, independently of the UMI encoded by the template nucleic acid strand.

[0153] Alpha seed forward strands at the 5'-end comprise a nucleic acid region identical to the nucleic acid sequence according to SEQ ID NO:4, followed by a nucleic acid region corresponding to the reverse complement of a low temperature bridge region suitable for the information transfer step as described in Example 5. Downstream to these regions, Alpha seed forward strands comprise a nucleic acid sequence region corresponding to the reverse complement of a UMI region, a nucleic acid sequence region corresponding to the reverse complement of a primer binding region that may be used for amplification for sequencing, as well as a 475 nt long central spacer region. Alpha seed forward strands at the 3'-prime end further comprise a nucleic acid region corresponding to the reverse complement of the nucleic acid sequence according to SEQ ID NO:3. As discussed above, Alpha seed strands are double stranded thus Alpha seed reverse strands comprise nucleic acid regions corresponding to the reverse complement of each of the above discussed regions. Accordingly, exemplary Alpha seed forward strands may thus comprise or consist of a nucleic acid seq ue nee :GCTGCTAAGCCGG ACTG AATTCG AAATTTAAACN N NNNNNNNNNNNNNNNN N N N N N N AG ATCG G AAG AGCGTCGTGTCCCTATAGTG AGTCGTATTACG AGTCGCTC AAAG AGCATGACACCGATAGTCCCAGTTGCCAAGCATTTGCGTAGGAACTGAAGTCTAACTTGAC GAATGTGTACCATGGCTAGACACGAGTATTGCGCGAGTCATAAATGCTACTCAGGGTTCAA TCGCCTACCTCAGCGCTCGTCATGTATGCTAGGAGTACTGCGATGGCGACTGAAGTACACTT AAG AC ACTTG GTATG CAC AGTAAACCCTCG CCTACCTGTTTAG CCAATTTG CTTTTTCTTAG A CACCCGTACTTCTAGTGAAAACGAATTACGCACAACTCAGAACACTTGAAGGACGCTGTAA CTGAAATCCGTATCCGGTACCCTTACGTATTGCTTATGAGCTGCGATCTGTAATACTGTTTAG ATCAGCGGTCCCGAGCGTCTGAGGGGACTCTGCTGAGGCGTCTGATCCTCGATTGTATCCT TAGAGCCCTCCGTACCCGAACGTGCGATCGTGGATGTTGATTGAGACACCGTTGGCC (SEQ ID NO:7), wherein nucleotides designated as "N" correspond to nucleotides of the reverse complement of the UMI unique for each template seed strand. In the nucleic acid sequence according to SEQ ID NO:7, the above described regions are positioned as: nucleic acid region identical to the nucleic acid sequence of according to SEQ ID NO:4: between positions 1-22; the reverse complement of the low temperature bridge region between positions 23-33; the reverse complement of the UMI between positions 34-57; the reverse complement of the primer binding region for amplification and sequencing between positions 58-103; the reverse complement of the alpha spacer region between positions 104-578; and the reverse complement of SEQ ID NO:3: between positions 579-600.

[0154] According to the above discussed regions of the Alpha seed strands, Alpha seed forward strands are able to hybridize to A primers. Moreover, by extending A primers using Alpha seed forward strands as template, for example using a nucleic acid polymerase enzyme, nucleic acid strands may be obtained that comprise in a 5' to 3' order: the nucleic acid sequence of primer A, the reverse complement of the spacer region encoded by the Alpha seed strands, the primer binding region for amplification for sequencing, the UMI encoded by the Alpha seed strand, the low temperature bride region and a nucleic acid region corresponding to the reverse complement of the nucleic acid sequence according to SEQ ID NO:4.

[0155] Beta seed forward strands at the 5'-end comprise a nucleic acid region identical to the nucleic acid sequence according to SEQ ID NO:6, followed by the reverse complement of a region capable of binding to a target nucleic acid region, such as a poly-adenine region,, a nucleic acid sequence region corresponding to the reverse complement of a UMI region and a nucleic acid sequence region corresponding to the reverse complement of the low temperature bridge region. Downstream from these regions, Beta seed reverse strands comprise a 499 nt long central spacer region and at the 3' end, a nucleic acid region corresponding to the reverse complement of the nucleic acid sequence according to SEQ ID NO:5. As discussed above, Beta seed strands are double stranded thus Beta seed reverse strands comprise nucleic acid regions corresponding to the reverse complement of each of the above discussed regions. Accordingly, exemplary Beta seed forward strands may thus comprise or consist of a nucleic acid sequence:

[0156] G CG GTTCCTG AAC ACGTTCG AAAAAAAAAAAAAAAAAAAAAATN N NNNNNNNNNNNNN NNNNNNNNNCGAAATTTAAACAGTGTACCTGATGACGTAATACTGCACGTGGTGGACGG GTGATCCCTCCGATGTATACACCGACTGTCTAGCGGTGCTATCGACGGCCCTGGAAGCTTTT ACGCACTACGATCGATGATGTGCGGGGAATTGCCCATTGGTGACTCCACTCGAAACTATTG CTATCTCG G AAATC AAC AGC AATGTTAG CC ATCTAG CCAG ATG CG CG ATTATCTCG AG CTAA GACATCATCAGTAACACTTCGTTCAAGACATCCAGCCATACGATCGAAAGCGTCATCCGTTT AACGTTCCTGACCCACTTGTGAAACACGTCTGTAAGATCGCCCAGATACCGCTGGGCATTG ACTTGCTTGTATAGCCTTTCACAGCTGATCGTAGCCGGGCTAAAGGCCCATGAACCTTGACA CGCGTGACTTGATTGCAGTTATAGCATCAGTCGTTGTGAAACACGTGCTTAGAGATGCCAC GCGTTGACAAGGGTCACAGATAACGGTTGTGAATTCATTCTGCGGCAGTGCG (SEQ ID NO:8), wherein nucleotides designated as "N" correspond to nucleotides of the reverse complement of the UMI unique for each template seed strand. In the nucleic acid sequence according to SEQ ID NO:8, the above described regions are positioned as: nucleic acid region identical to the nucleic acid sequence of according to SEQ ID NO:6: between positions 1-22; the reverse complement of the region capable of binding a nucleic acid target strand between positions 23-43; the reverse complement of the UMI between positions 44-67; the reverse complement of the low temperature bridge region between positions 68-79; the spacer domain between positions 80-578; and the reverse complement of SEQ ID NO:5 between positions 579-600.

[0157] According to the above discussed regions of the Beta seed strands, Beta seed forward strands are able to hybridize to C primers. Moreover, by extending C primers using Beta seed reverse strands as template, for example using a nucleic acid polymerase enzyme, nucleic acid strands may be obtained that comprise in a 5' to 3' order: the nucleic acid sequence according to SEQ ID NO:5, the reverse complement of the spacer region encoded by the Beta seed strands, the low temperature bride region, the UMI encoded by the Beta seed strand, the region capable of binding to a target nucleic acid region, such as a poly-thymidine region, and a nucleic acid region corresponding to the reverse complement of the nucleic acid sequence according to SEQ ID NO:6.

[0158] Nucleic acid sequences of the two central spacer regions present in the Alpha and the Beta strands, respectively, were optimized using NUPAC, with respect to the above discussed specific nucleic acid regions to minimize unwanted interactions between the sequences. The spacer region between the two set of template nucleic acid strands (such as the two central spacer regions between the Alpha and the Beta seed strands) thus may be orthogonal, i.e. non-interacting. It is to be understood that orthogonal spacer regions have a low probability of hybridizing to each other. This may be useful for generating, such as simultaneously generating, two orthogonal types of polonies using said strands as seeds.

[0159] The above presented exemplary primer pairs comprising the nucleic acid sequences according to SEQ ID NO:3-6, respectively, and exemplary template nucleic acid strands of the two sets of template nucleic acid strands comprising the nucleic acid sequences according to SEQ ID NO:7 and 8, respectively, have been utilized in the below described examples with the indicated modifications where applicable. It is to be understood that unique barcode regions (UMIs) encoded by the first set of template nucleic acid sequences (such as said Alpha seed strands) are referred to herein as first unique barcode regions obtainable in a capture probe according to the present disclosure. Moreover, unique barcode regions (UMIs) encoded by the second set of template nucleic acid sequences (such as said Beta seed strands) are referred to herein as second unique barcode regions obtainable in a capture probe according to the present disclosure.

[0160] Example 2

[0161] Preparation of primer lawn surface and seed strands

[0162] Primer lawn preparation

[0163] Primers A, B, C and D comprising the nucleic acid sequences according to SEQ ID NO:3-6, respectively, as described in Example 1 were ordered from Integrated DNA Technologies (Leuven, Belgium) with the following modifications. The nucleic acid sequences of the primers were extended at the 5' end to create extra spacing from the surface to which the primers were linked as described below. In primers B, C and D this was done with four thymine nucleotides, and in primer A this was done with four deoxy-uridine nucleotides, wherein said four deoxy-uridine nulceotides allow for enzymatic cleavage of said primer A and / or a nucleic acid strand obtained by the extension of primer A, for example by using an endonuclease, such as a USER enzyme mix. All primers were synthesized with a 5' amine group modification which allows for coupling of the primers to a surface, as described below.

[0164] According to the above described extension, primers A, B, C and D comprise nucleic acid sequences according to

[0165] A: ideoxyU / / ideoxyU / / ideoxyU / / ideoxyU / GGCCAACGGTGTCTCAATCAAC (SEQ ID NO:9),

[0166] B: TTTTGCTGCTAAGCCGGACTGAATTC (SEQ ID NO:10),

[0167] C: TTTTCGCACTGCCGCAGAATGAATTC (SEQ ID NO:11) and

[0168] D: TTTTGCGGTTCCTGAACACGTTCGAA (SEQ ID NO:12).

[0169] Moreover, according to the above described 5'-end modification for surface coupling, primers A, B, C and D, as used in the herein presented examples, comprise nucleic acid sequences according to

[0170] A:

[0171] / 5AmMC6 / / ideoxyU / / ideoxyU / / ideoxyU / / ideoxyU / GGCCAACGGTGTCTCAATCAAC (SEQ ID NO:13),

[0172] B: / 5AmMC6 / TTTTGCTGCTAAGCCGGACTGAATTC (SEQ ID NO:14),

[0173] C: / 5AmMC6 / TTTTCGCACTGCCGCAGAATGAATTC (SEQ ID NO:15) and

[0174] D: / 5AmMC6 / TTTTGCGGTTCCTGAACACGTTCGAA (SEQ ID NO:16).

[0175] The primers were obtained from the supplier in a lyopholized state and upon receival were diluted in pure water to a concentration of 100 pM. As a surface, Surmodics Tridiaa (Eden Prairie, MN, USA) activated glass slides were used. The four primers were diluted to 5 pM each in spotting buffer (150 mM sodium phosphate pH 8.5 with 0.06% sarcosyl) and 50 pl of this was spotted on top of an activated glass slide. After 1 minute, a pipette was used to remove excess liquid and the remaining solution on the activated glass slide was air-dried at room temperature. The slides where then placed in a closed container in a slide rack over a sodium chloride / water slurry (to prevent the slides from drying out) and incubated overnight. After the incubation, the slides were first blocked in blocking solution (0.1 M TRIS pH 9.0 with 50 mM Ethanolamine) and then prewarmed to 50 °C by shaking in a Coplin jar for 30 minutes. This was followed by a rinse with pure water and a transfer to a second Coplin jar containing prewarmed cleaning solution (4 X saline-sodium citrate (SSC) buffer with 0.1 % SDS) followed by a second 30-minute shaking incubation. The slides were rinsed again with pure water and then dried by blowing.

[0176] Preparation of seed strands

[0177] As explained above in Example 1, the two types of seed strands used in the present examples, were each 600 nt long, wherein each seed strand contained a 24 nt long random UMI region. Long DNA fragments can be synthesized via gene synthesis but cannot incorporate random regions. Shorter oligonucleotides can be produced by phosphoramidite synthesis including random regions. For both the Alpha and the Beta seed strands, gene fragments were ordered that contained the largest portion possible of the seed strands excluding the random regions. The remaining section including the random region was ordered as oligonucleotides that included overlapping regions with the gene fragments allowing them to function as PCR primers and enabling to add the random regions to the gene fragments to create the full seed strands.

[0178] The gene fragments and oligonucleotide PCR primers were purchased from integrated DNA technologies and resuspended in pure water at 10 ng / pl and at 100 pM, respectively. A PCR reaction was mixed as follows:

[0179] Table 1. PCR reaction for generation of Alpha and Beta seed strands

[0180] The mixture was split in two 50 pl aliquots, placed in a thermal cycler and run in the following PCR program: Initial denaturation at 95 pC for 1 min, followed by 7 cycles of denaturation at 95 °C for 30 seconds, annealing at 60 °C for 30 seconds and extension at 72 °C for 1 minute. The program was completed with a final extension at 72 °C for 5 minutes.

[0181] In order to clean the seed strands from excess primers and polymerase 90 pl of each PCR product was cleaned with Beckman Coulter (Brea, CA, USA) Ampure XP beads, according to the manufacturer's instructions. The seed strand products before and after clean-up was assayed on an agarose gel (Fig. 2) and the concentration of the seeds was measured using a Thermo Fisher Qubit High sensitivity dsDNA assay (Thermo Fisher Scientific, Waltham, Massachusetts, USA). As demonstrated in Fig. 2, Alpha and Beta seed strands were obtained in high purity.

[0182] Evaluation of UMI collisions during seed strand generation and seeding thereof

[0183] The distinguishability of UMI's, which is necessary for the identification of polonies and meta polonies originating from different parent seed strands, depends on the chance that two UMIs (e.g. two first unique barcode regions or two second unique barcode regions) coincidentally have identical or nearly identical sequences as a result of independent identical synthesis by random base incorporation rather than originating from a shared parent seed strand.

[0184] The expected number of collisions, where a collision is defined according to a threshold Hamming distance between two sequences, below which the sequences are considered indistinguishably similar, and above which they are considered different sequences, can be estimated with the formula: where d is the Hamming distance between two sequences, dmaxis the threshold Hamming distance, p is the probability of a single mismatch occurring for an individual position for two sequences of equal length, k is the number of sequences sampled, and I is sequence length. Thus, it is possible to design UMI's of sufficient length that the expected number of collisions is close to zero (for example, less than 1% or less than 0.1%) for a given number of sequences sampled, i.e. the number of polonies which must be distinguished from one another. While the possibility of generating random UMI's with indistinguishable sequences cannot be fully eliminated, a sufficiently long UMI will lead to conditions likely to produce zero or very few collisions.

[0185] A related problem is that of UMI collisions due to polonies seeded by the reverse complementary strand of a seed duplex dsDNA molecule, which contains a UMI on one strand and the reverse complementary sequence of that UMI on the other strand, potentially leading to separate polonies located in spatially different regions but with identical sequence-identifying information.

[0186] There are N unique double stranded dsDNA molecules in the starting pool, and 2N ssDNA single stranded molecules formed from denaturing the dsDNA, where N have unique sequences and N have the reverse complements of those sequences. We sample M strands from the pool of 2N ssDNA strands, and we wish to know what the probability is that we achieve fewer than k collisions, a collision being 2 molecules that are reverse complementary to one another.

[0187] Assuming that all N strands are denatured, and that all starting dsDNA strands are unique, the probability of exactly k collisions can be expressed as

[0188] And thus the probability of fewer than k collisions is the sum of probabilities of having exactly 0, 1, 2,...k-l collisions.

[0189] So for example, if one starts with a tube of 100 microliters of 100 pM dsDNA seed strands, then there is approximately 0.948 probability of achieving fewer than k=3 collisions if one samples M=100000 seeded polonies.

[0190] Thus, given the appropriate choice of experiment parameters, e.g. choosing a sufficiently long UMI or sampling from seed solutions with sufficiently high concentration prior to seeding, it is possible to avoid a situation in which collisions significantly interfere with the identification of polonies or meta polonies or the determination of their locations. In the marginal cases when such collisions do arise, their influence can be mitigated by computational methods performed after sequencing as described in the respective examples below. Accordingly, said first and said second unique barcode regions are considered unique for said polonies, modified polonies and / or meta polonies according to the present disclosure.

[0191] Example 3

[0192] Seeding of primer lawn and growth via bridge PCR

[0193] Surface seeding

[0194] Seeding and bridge PCR was performed inside a flow cell attached to the primer lawn obtained as described in Example 2. An ibidi sticky-Slide VI 0.4 (Grafelfing, Germany) was attached to a slide coated with a primer lawn, secured with binder clips, and incubated overnight in room temperature to assure a strong seal. Seeding was performed by preparing a mixture of Alpha and Beta seed strands (obtained as described in Example 2), polymerase, dNTPs and buffers (Table 2), and adding 180 pl of this mixture to the channel. Different concentrations of the seed strands was tested to control the density of polonies grown on the surface, as demonstrated below.

[0195] Table 2. PCR reaction for seeding of Alpha and Beta seed strands

[0196] For each individual surface seeding reaction, the channel was closed with an adhesive PCR plate sealer film. Thereafter, the slide and channel were placed in a flatbed thermal cycler and exposed to a single PCR cycle of 5 minutes at 95 °C to denature the seed strands, 5 minutes at 60 °C to anneal them to the primer surface and 15 minutes at 72 °C to extend the primer surface with the seed strand sequences. Afterwards, the adhesive PCR plate sealer film was removed from the channel, and the slide was placed in an incubator at 60 °C, connected to a fluidics pump (Elveflow OBI mk3 combined with the Elveflow Mux distributor 12 (Paris, France)), primed with prewarmed 100 % formamide. This was pumped through the channel for 5 minutes to remove all seed strands from the surface. The process of surface seeding for growing two types of polonies by bridge amplification on the surface is illustrated in Fig. 4 and Fig. 5A.

[0197] Growth of polonies on surface through bridge PCR

[0198] After seeding, the slide was retained connected to the fluidics pump in the incubator set to 60 °C. The fluidics pump was prepared with three liquid reservoirs for the denaturing, annealing and extension cycles of bridge PCR. The denaturing liquid was 100 % formamide, the annealing liquid was a polymerase compatible buffer (20 mM TRIS pH 8.8, 10 mM (NH4)2SO4, 2 mM MgSO4, 2M Betaine, 1.3% DMSO, 0.05% Tween 20). The extension liquid was the same buffer as the annealing liquid, supplemented with 80 U / ml Bst polymerase (New England Biolabs (Ipswich, MA, USA)) and 0.2 mM each of dNTPs. The bridge PCR was performed isothermally at 60 °C by cycling the liquids flowed over the surface. The extended strands as obtained during surface seeding were first annealed to the respective non-extended surface-linked primers by flowing the annealing liquid at 200 mbar for 1.5 minutes followed by a 10 second incubation. Extension was performed by flowing in extension liquid at 80 pl / minute for 1 minute and 25 seconds. This was followed by the flow of annealing liquid at 80 pl / minute for 2 minutes and 10 seconds to pushing in the extension liquid through the channels onto the surface. After this the flow was stopped for 4 minutes to allow for the polymerase extension. The extended strands were then denatured by flowing denaturing liquid at 200 mbar for 1.5 minutes over the surface followed by a 10 second incubation with no flow. This was repeated for 30 to 40 cycles to allow the two types of polonies to grow on the surface via bridge PCR. In the final cycle, no denaturing step was performed at the end, instead annealing liquid was flushed at 200 mbar for 2 minutes after the extension to remove the polymerase. The flow setting described here were calibrated before the bridge PCR experiments by running the fluidics system with liquids colored by food coloring and by visually adjusting the flow speeds and timing.

[0199] Nucleic acid strands of polonies of the first polony type that are obtained by bridge amplification according to the present disclosure may comprise a nucleic acid sequence according to SEQ ID NO:17-22. In particular, nucleic acid strands of polonies of the first polony type that are obtained by the extension of a first oligonucleotide as disclosed herein (such as primer A) may comprise a nucleic acid sequence according to SEQ ID NO:17-19. Nucleic acid strands of polonies of the first polony type that are obtained by the extension of a second oligonucleotide as disclosed herein (such as primer B) may comprise a nucleic acid sequence according to SEQ ID NQ:20-22. Nucleic acid strands of polonies of the first polony type that are obtained by the extension of primer A in the present Example comprise a nucleic acid sequence according to SEQ ID NO:19. Nucleic acid strands of polonies of the first polony type that are obtained by the extension of primer B in the present Example comprise a nucleic acid sequence according to SEQ ID NO:22.

[0200] Nucleic acid strands of polonies of the second polony type that are obtained by bridge amplification according to the present disclosure may comprise a nucleic acid sequence according to SEQ ID NO:23-28. In particular, nucleic acid strands of polonies of the second polony type that are obtained by the extension of a third oligonucleotide as disclosed herein (such as primer C) may comprise a nucleic acid sequence according to SEQ ID NO:23-25. Nucleic acid strands of polonies of the second polony type that are obtained by the extension of a fourth oligonucleotide as disclosed herein (such as primer D) may comprise a nucleic acid sequence according to SEQ ID NO:26-28. Nucleic acid strands of polonies of the second polony type that are obtained by the extension of primer C in the present Example comprise a nucleic acid sequence according to SEQ ID NO:25. Nucleic acid strands of polonies of the second polony type that are obtained by the extension of primer D in the present Example comprise a nucleic acid sequence according to SEQ ID NO:28. The process of polony growth for two types of polonies by bridge amplification as described in Example 3 is demonstrated in Fig. 4 and Fig. 5B. It is to be understood that unique barcode regions (UMIs) encoded by polonies of the first polony type grown on the surface (such as Alpha type polonies obtained by seeding of Alpha seed strands and by using a plurality of the A / B primer pairs) are referred to herein as first unique barcode regions obtainable in a capture probe according to the present disclosure. Moreover, unique barcode regions (UMIs) encoded by polonies of the second polony type grown on the surface (such as Beta type polonies obtained by seeding of Beta seed strands and by using a plurality of the C / D primer pairs) are referred to herein as second unique barcode regions obtainable in a capture probe according to the present disclosure.

[0201] Restriction di, and fluorescence

[0202] Restriction digestion of nucleic acid strands of polonies of the first and second polony types (Alpha and Beta polonies) obtained by bridge amplification using EcoRI

[0203] After the bridge PCR process described in Example 3, the present inventors have found that many of the extended strands may remain hybridized with their extended partners on the surface. The slide was disconnected from the fluidics pump and removed from the incubator. A restriction digestion with the enzyme EcoRI was performed to target digestion sites in primers B and C and the reverse complement thereof in primers A and D, as explained in Example 1. A solution was prepared with 2 pl of EcorRI-HF with 20 pl 10 x Cutsmart® buffer (both from New England Biolabs) and 178 pl H2O. From this restriction enzyme reaction mix 100 pl was added to one port of the flow cell and immediately removed via the other port to exchange the buffer, then a further 100 pl of the restriction enzyme reaction mix was added and the flow cell was closed with PCR plate sealer. The channel was placed in a 37 °C incubator for 60 minutes to perform the restriction digestion. After this, the cannel was placed in a 60 °C incubator, connected to the fluidics pump, as described in Examples 2 and 3. The pump was used to flush 100 % formamide through the flow cell for 5 minutes to remove the strands that had been digested. After this, the pump was disconnected, and the flow cell was flushed with 1 x TBE buffer to remove the formamide.

[0204] As demonstrated in Fig. 4C, the enzymatic reaction as described above is suitable for the selective essential removal of nucleic acid strands obtained by the extension of B and C primers. Accordingly, nucleic acid strands of polonies of the first polony type (such as Alpha type polonies obtained by seeding of Alpha seed strands and by using a plurality of the A / B primer pairs) that comprise the first cleavage site upstream, such as consecutively upstream, from the reverse complement of the low temperature bridge region (rcLT bridge) encoded by said nucleic acid strands are cleaved such that the remaining nucleic acid strand regions of said nucleic acid strands that remain anchored to the surface do not comprise the reverse complement of the unique barcode region (rcUMI) encoded by said polonies nor the reverse complement of the low temperature bridge region (rcLT bridge). In other words, these remaining nucleic acid strand regions are not suitable for the information transfer step as described below in Example 5. Furthermore, nucleic acid strands of polonies of the second polony type (such as Beta type polonies obtained by seeding of Beta seed strands and by using a plurality of the C / D primer pairs) that comprise the first cleavage site upstream, such as inconsecutively upstream, from the low temperature bridge region (LT bridge) are cleaved such that the remaining nucleic acid strand regions of said nucleic acid strands that remain anchored to the surface do not comprise the unique barcode region (UMI) encoded by said polonies nor the low temperature bridge region (LT bridge). In other words, these remaining nucleic acid strand regions are not suitable for the information transfer step as described below in Example 5.

[0205] In addition, as demonstrated in Fig. 4, the enzymatic reaction as described above is suitable for the cleavage of nucleic acid strands obtained by the extension of A and D primers. Accordingly, nucleic acid strands of polonies of the first polony type (such as Alpha type polonies obtained by seeding of Alpha seed strands and by using a plurality of the A / B primer pairs) that comprise the reverse complement of the first cleavage site downstream, such as consecutively downstream, from the low temperature bridge region (LT bridge) are cleaved such that the remaining cleaved nucleic acid strands that remain anchored to the surface comprise the unique barcode region (UMI) encoded by said polonies and the low temperature bridge region (LT bridge). In other words, these remaining cleaved nucleic acid strands are suitable for the information transfer step as described below in Example 5. Furthermore, nucleic acid strands of polonies of the second polony type (such as Beta type polonies obtained by seeding of Beta seed strands and by using a plurality of the C / D primer pairs) that comprise the reverse complement of the first cleavage site downstream, such as inconsecutively downstream, from the reverse complement of the low temperature bridge region (rcLT bridge) are cleaved such that that the remaining cleaved nucleic acid strands that remain anchored to the surface comprise the reverse complement of the unique barcode region (rcUMI) encoded by said polonies and the reverse complement of the low temperature bridge region (rcLT bridge). Moreover, said cleaved nucleic acid strands further comprise the reverse complement of the region capable of binding the target nucleic acid region (rcCapture). In other words, these remaining cleaved nucleic acid strands are suitable for the information transfer step as described below in Example 5.

[0206] As exemplified above, modified polonies of the first and the second polony types may be obtained from polonies of the first and the second polony types grown on the surface, wherein information transfer between two polony types may occur, as described in Example 5. Said modified polonies may thus be obtained by a selective substantial removal and / or a cleavage according to step (ii) of the method as disclosed herein. It is to be understood that cleaved nucleic acid strands of modified polonies of the first polony type comprise the unique barcode regions (UMIs) encoded by polonies of the first polony type grown on the surface (such as Alpha type polonies obtained by seeding of Alpha seed strands and by using a plurality of the A / B primer pairs) that are referred to herein as first unique barcode regions obtainable in a capture probe according to the present disclosure. Moreover, cleaved nucleic acid strands of modified polonies of the second polony type comprise the unique barcode regions (UMIs) encoded by polonies of the second polony type grown on the surface (such as Beta type polonies obtained by seeding of Beta seed strands and by using a plurality of the C / D primer pairs) that are referred to herein as second unique barcode regions obtainable in a capture probe according to the present disclosure.

[0207] According to the above, cleaved nucleic acid strands of modified polonies of the first polony type thus may comprise a nucleic acid sequence according to SEQ ID NO:29. Furthermore, with reference to the extension and modification of primer A, as described above, cleaved nucleic acid strands of modified polonies of the first polony type may comprise a nucleic acid sequence according to SEQ ID NO:30 and / or SEQ ID NO:31. Cleaved nucleic acid strands of modified polonies of the first polony type (Alpha polonies) as of the herein presented Examples comprise a nucleic acid sequence according to SEQ ID NO:31.

[0208] Moreover, cleaved nucleic acid strands of modified polonies of the second polony type thus may comprise a nucleic acid sequence according to SEQ ID NO:32. Furthermore, with reference to the extension and modification of primer D, as described above, cleaved nucleic acid strands of modified polonies of the second polony type may comprise a nucleic acid sequence according to SEQ ID NO:33 and / or SEQ ID NO:34. Cleaved nucleic acid strands of modified polonies of the second polony type (Beta polonies) as of the herein presented Examples comprise a nucleic acid sequence according to SEQ ID NO:34.

[0209] Furthermore, nucleic acid strands of polonies of the second polony type that may be selectively substantially removed in step (ii) according to the method as disclosed herein may comprise a nucleic acid sequence according to SEQ ID NO:23, 24 and / or 25. Nucleic acid strands of polonies of the first polony type that may be selectively substantially removed in step (ii) according to the method as disclosed herein may comprise a nucleic acid sequence according to SEQ ID NQ:20, 21 and / or 22.

[0210] Fluorescence probing of polonies In order to validate the growth of polonies, two fluorescent DNA probes were designed that bind to either polony types, such as Alpha or Beta type polonies, respectively. When fluorescence probing was performed, the ibidi sticky flow cell manifold was first removed from the slide surface and the chip was washed with water followed by air drying. The two DNA probes were manufactured by Integrated DNA Technologies, wherein the probe for Alpha polonies was functionalized with the fluorophore Cy3: TGTTTAGCCAATTTGCTT / 3Cy3Sp / (SEQ ID NO:35) and the probe for Beta polonies was functionalized with Cy5: / 5Cy5 / GATCTTACAGACGTGTTTCACAAGT (SEQ ID NO:36). After obtaining the DNA probes in a lyophilized state, they were resuspended at 100 pM in water. For probing, 2.5 pl of each probe strand was added to 95 pl of probing buffer (5x SSC with 0.05 % Tween 20). This solution was added by pipette to the top of the chip where the flow cell manifold had previously been attached, and the sample was incubated for 5 minutes at room temperature in the dark. After this, the chip was moved to a Coplin jar with 4 x SSC buffer prewarmed to 37 °C in a heated shaking incubator and lightly shaken for 5 minutes. This was followed by a rapid dipping in 0.1 x SSC buffer followed by drying by air flow. This dry chip could then be imaged in a scanner or microscope as seen in Fig. 5. As demonstrated in Fig. 5, densities of polonies of the two polony types may be adjusted using different concentrations of Alpha and Beta seed strands, respectively, for surface seeding as described in Example 3.

[0211] Example 5

[0212] Surface processing for UMI information transfer

[0213] In order to construct the information network on the surface, the UMI region and the region capable of binding the target nucleic acid region encoded by cleaved nucleic acid strands of Beta type modified polonies which remained on the surface after the restriction digestion were copied to neighboring strands of Alpha type modified polonies which also remained on the surface after the restriction digestion, as explained in Example 4. Thus, the second unique barcode region and the region capable of binding the target nucleic acid region were obtained in each capture probe according to step (i) of the method as disclosed herein. This was performed via the commentary bridge region (LT bridge and the reverse complement thereof) between modified polonies of the two polony types that allows for a polymerase to copy the UMI region and the region capable of binding the target nucleic acid region encoded by cleaved nucleic acid strands of modified Beta polonies onto the cleaved nucleic acid strands of modified Alpha polonies. This was performed by the mounting of an ibidi flow cell manifold over the area, or if no fluorescent probing was done, the manifold used in bridge PCR was still placed on the surface and could be re-used. If the manifold had been replaced to allow for probing, a new manifold was placed on the surface, and this second manifold could be placed at a 90° rotation compared to the previous manifold to only perform processing on a smaller area, in particular at the intersection of the two flow channels.

[0214] The first step of the processing was to allow a polymerase to copy said regions of said cleaved nucleic acid strands of modified Beta polonies onto the distal end, such as the 3'-end, of said cleaved nucleic acid strands of modified Alpha polonies by hybridizing said strands which are in close proximity via the low temperature bridge region and the reverse complement thereof designed into the two types of seed strands, Alpha and Beta. A 200 pl Bst polymerase solution was prepared (80 U / ml with 0.2 mM dNTPs in Bst buffer) and 100 pl thereof was added to one flow channel port followed by the immediate removal from the other port and the addition of a further 100 pl to the first port. The flow cell was sealed with PCR plate sealer and incubated at 30 °C for 30 minutes. The seal was then removed, and the channel was flushed with 1 x TBE buffer.

[0215] Accordingly, cleaved nucleic acid strands of modified polonies of the first polony type that are extended in step (i) may comprise a nucleic acid sequence according to SEQ ID NO:37. Furthermore, with reference to the extension and modification of primer A, as described above, cleaved nucleic acid strands of modified polonies of the first polony type that are extended in step (i) may comprise a nucleic acid sequence according to SEQ ID NO:38 and / or SEQ ID NO:39.

[0216] This was followed by a restriction digestion of a Bspll9l site on cleaved nucleic acid strands of modified polonies of the second (Beta) polony type and on extended cleaved nucleic acid strands of modified polonies of the first (Alpha) polony type as illustrated in Fig. 4D. Accordingly, the cleaved nucleic acid strands of each modified Beta polony were selectively substantially removed from the surface and the 3' end nucleic acid region downstream from the Bspll9l site (located downstream from the poly-thymidine region) of the extended cleaved nucleic acid strands of each modified Apha polony was cleaved off. Accordingly, capture probes were obtained wherein the region capable of binding the target nucleic acid region is located at the distal end, such as at the 3'-end, of the capture probes. A mix of 2 pl of Fastdigest Bspll9l, 20 pl of lOx fast digest buffer (both from Thermo Fisher Scientific, Waltham, Massachusetts, USA) and 178 pl of water was made. Of this, 100 pl was added to one port of the flow cell followed by the immediate removal from the second port, and the addition of a further 100 pl to the first port. The slide was sealed with PCR plate sealer and placed in a 37 °C incubator for 30 minutes. The plate sealer was then removed, and the flow cell placed in a 60 °C incubator connected to the fluidics pump and flushed with 100 % formamide for 5 minutes to remove digestion products.

[0217] A capture probe according to the present disclosure may thus comprise a nucleic acid sequence according to SEQ ID NO:40. Furthermore, with reference to the extension and modification of primer A, as described above, a capture probe according to the present disclosure may comprise a nucleic acid sequence according SEQ ID NO:41 and / or SEQ ID NO:42. Moreover, and as illustrated above, cleaved nucleic acid strands of modified polonies of the second (Beta) polony type that are selectively substantially removed after said extension step may comprise a nucleic acid sequence according to SEQ ID NO:32, 33 and / or 34.

[0218] The above described information transfer between the two polony types and enzymatic cleavage are illustrated in Fig. 3 and Fig. 4D. Example 6

[0219] Sequence extension from pseudo-mRNA and DNA recovery and amplification

[0220] Sequence extension from pseudo-mRNA

[0221] After the information copy and enzymatic digestion between modified polonies of Alpha and Beta polony types, as described above in Example 5, the capture probes were terminated with a 20 nt long poly-thymidine region at their distal end, such as at their 3'-end. In in order to make these strands double stranded a pseudo- mRNA DNA oligonucleotide, corresponding to a target nucleic acid region to which capture probes as generated above are capable of binding, was added with the sequence AAAAAAAAAAAAAAAAAAAAAAT (SEQ ID NO:43) which was extended onto the capture probes using a polymerase. A 200 pl Bst polymerase solution was prepared (80 U / ml with 0.2 mM dNTPs in Bst buffer) with 1 pM of the pseudo-mRNA oligonucleotide and 100 pl thereof was added to one flow channel port followed by the immediate removal from the other port, and the addition of a further 100 pl to the first port. The flow cell was sealed with PCR plate sealer and placed in 37 °C for 30 minutes. This was followed by the removal of the seal and a flush with 1 x TBE buffer, and finally, by drying by air flow.

[0222] DNA recovery and amplification

[0223] In order to recover the DNA from the surface, the enzyme mix USER was used to cleave the deoxy-Uridine groups incorporated in primer A, and thereby the capture probes generated according to the above Examples, at the proximal end, such as at the 5'-end. A 50 pl mix was prepared with 1 pl of USER enzyme, 5 pl of 10 x Cutsmart® buffer (both from New England Biolabs) and 44 pl of water. From this, 35 pl was added into the flow channel and the cannel ports were sealed by PCR plate sealer film. The sample was incubated at 37 °C for 30 minutes. The sample was then recovered by adding 100 pl of water to one port and recovering the sample from the other port. This was repeated 4 times to recover a total of 400 pl of sample.

[0224] In order to amplify the recovered DNA strands, a PCR was performed, targeting the 3' end of the extended capture probes and a central site of the Alpha strand to create a shorter PCR product suitable for sequencing by Illumina instruments. The primers also included binding sites for the Illumina read primers. The primer targeting the 3' end had the sequence of ACACTCTTTCCCTACACGACGCTCTTCCGATCTAAAAAAAAAAAAAAAAAAAAAAT (SEQ ID NO:44) and the primer targeting the central site had the sequence of

[0225] GTG ACTG G AGTTCAG ACGTGTG CTCTTCCG ATCTTACTCCTAG CATACATG ACG AG C (S EQ ID NO:45). Both primers where synthesized by Integrated DNA technologies and resuspended in water at 100 pM. The primer binding sites were selected to enable obtaining PCR products of sufficient length for subsequent sequencing, as described below, considering the length of the pseudo-mRNA DNA oligonucleotides as target molecules. The inventors envision that the forward primer binding region suitable for amplification for sequencing may be advantageous for certain target molecules, such as mRNA molecules present in a tissue sample. The PCR reaction was performed on all the 400 pl of recovered DNA, creating a PCR mix of 500 pl (Table 3).

[0226] Table 3. PCR reaction for amplification of recovered DNA strands

[0227] The mix was split into ten 50 pl aliquots, placed in a thermal cycler and run in the following PCR program: Initial denaturation at 95 °C for 1 min, followed by 25 cycles of denaturation at 95 °C for 30 seconds, annealing at 50 °C for 30 seconds and extension at 72 °C for 1 minute. The program was completed with a final extension at 72 °C for 5 minutes.

[0228] After the PCR, 40 pl was purified from excess primers and PCR enzymes with Beckman Coulter Ampure XP beads, according to the manufacturer's instructions. After cleanup, this sample was used as a template for a second PCR reaction where Illumina clustering sequences were added to the end of products to allow for sequencing on Illumina instruments. The primers used had the sequences AATGATACGGCGACCACCGAGCTCTACACTAGATCGCACACTCTTTCCCTAC (SEQ ID NO:46) and CAAGCAGAAGACGGCATACGAGATTAAGGCGAGTGACTGGAGTTCAG (SEQ ID NO:47). They were purchased from integrated DNA technologies, resuspended at 100 pM in water and then diluted to 10 pM in water. The polymerase Kapa HIFI was used (Roche).

[0229] Table 4. PCR reaction for adding clustering seguences

[0230] The mix was split in two 50 pl aliquots and placed in a thermal cycler and run in the following PCR program: Initial denaturation at 98 °C for 2 min, followed by 8 cycles of denaturation at 98 °C for 20 seconds, annealing at 55 °C for 20 seconds and extension at 72 °C for 15 seconds. The program was completed with a final extension at 72 °C for 2 minutes. After the PCR, 80 pl was purified from excess primers and PCR enzymes with Beckman Coulter Ampure XP beads, according to the manufacturer's instructions. Aliquots of the products of both PCR reaction before and after purification were assayed in an agarose gel (Fig. 6).

[0231] Example 7

[0232] Sequencing of library of recovered DNA and information extraction The cleaned up product of reaction two was sequenced on a Illumina nextseq 2000 instrument using a P2 flow cell with a 100 cycle read from read primer 1 and a 50 % spike in of PhiX to increase diversity. This resulted in around 214 million sample reads where UMI information could be extracted. Each read started with the polythymidine mRNA capture region followed by the 24 nucleotide UMI 2 region (second barcode region) encoded by a second (Beta) polony type that have been obtained in a capture probe. This was followed by the low temperature bridge region and then the 24 nucleotide UMI 1 region (first barcode region) originating from an first (Alpha) polony type followed by the spacer region. From these reads, only the pairs of UMI regions were of interest. A python script was created that located the known regions that flanked the UMI regions. From this it was possible to extract around 120 million of UMI 2 and 180 million of UMI 1 with the expected length of 24 nt (Fig. 7A). Each UMI combination in the data corresponded to a metapolony on the surface comprising capture probes comprising the combination of the respective UMIs unique for said metapolony, and a node in the reconstructed graph. Each pair of UMI's extracted from one read in the sequencing data corresponded to the proximity of one alpha type polony with one beta type polony grown on the surface, and thus an edge in the reconstructed graph. By parsing all extracted UMI pairs from the data, a graph with around 900 000 nodes was created. A spring directed network layout was used to relax and place the graph in a 2D space, and a section of this graph is shown in Fig. 7B.

[0233] Reconstruction of tissue ics data using a MESH CHIP surface

[0234] The process of depositing the mRNA of a tissue section on a surface capture arrays is established in several research papers (e.g. Stahl et al., 2016, Rodriques et al., 2019, Chen, et al., 2022). The principle is that a thin fresh-frozen tissue section is placed on the array surface and the mRNA is allowed to diffuse down to the surface where it hybridizes with a poly-thymidine region at the 3' region of the capture sequences. These capture sequences are used as primers for cDNA synthesis, copying mRNA information onto the array. For capture surface according to the present disclosure, this approach will be adapted as illustrated in Fig. 8. First the tissue section will be placed onto a capture surface according to the present disclosure, for example as prepared in example 1 to 5. The mRNA inside the tissue will be allowed to diffuse down to the surface and hybridize with the poly-thymidine region of the capture probes. A superscript III polymerase will be added to perform reverse transcription and copy the mRNA sequence onto the surface strand. Superscript III is known to add additional cytosines to the end to the end to the cDNA product. An oligonucleotide containing a sequencing primer and terminated with two deoxy-guanine and a locked nucleic acid guanine will be added to the reaction and serving as a template switch primer causing and extension of the cDNA product with the sequencing primer sequence. This will be followed by enzymatic tissue removal and degradation of the mRNA, and a primer complementary to a sequencing primer extended onto the cDNA will be used to synthesize the second DNA strand. The double stranded cDNA will then be released from the substrate using the USER enzyme mix followed by the addition of a PCR mixture including primers targeting both ends of the cDNA duplex. This will be amplified by PCR twice, for example based on the reactions as described in Example 6, where illumina clustering sequences are added in the second PCR. This will then be sequenced using paired end sequencing on an illumina instrument where one read will include the two UMI regions encoded by the capture probes, and the other read will include the 5' end of the attached mRNA, allowing for mRNA identification. The UMI information will be used to create a 2D graph network, for example as described in Example 7, allowing for the spatial decoding of the coupled mRNA data.

[0235] References

[0236] Stahl PL, Salmen F, Vickovic S, Lundmark A, Navarro JF, Magnusson J, Giacomello S, Asp M, Westholm JO, Huss M, Mollbrink A, Linnarsson S, Codeluppi S, Borg A, Ponten F, Costea PI, Sahlen P, Mulder J, Bergmann O, Lundeberg J, Frisen J. Visualization and analysis of gene expression in tissue sections by spatial transcriptomics. Science. 2016 Jul l;353(6294):78-82.

[0237] Rodriques, Samuel G., et al. "Slide-seq: A scalable technology for measuring genome-wide expression at high spatial resolution." Science 363.6434 (2019): 1463- 1467.

[0238] Hoffecker IT, Yang Y, Bernardi nelli G, Orponen P, Hbgberg B. A computational framework for DNA sequencing microscopy. Proceedings of the National Academy of Sciences. 2019 Sep 24;116(39):19282-7.

[0239] Chen, Ao, et al. "Spatiotemporal transcriptomic atlas of mouse organogenesis using DNA nanoball-patterned arrays." Cell 185.10 (2022): 1777-1792.

[0240] Itemized List of embodiments

[0241] 1. A method for creating a capture surface for at least one target molecule in a sample, each target molecule comprising a target nucleic acid region, wherein said method comprises generating at least one metapolony comprising at least one capture probe linked to a surface; wherein each capture probe of a metapolony comprises a first and a second unique barcode region that are unique for said metapolony and a region capable of binding the target nucleic acid region of said at least one target molecule; wherein each meta polony is generated from a polony of a first polony type and a polony of a second polony type grown on said surface; and wherein the second unique barcode region and the region capable of binding the target nucleic acid region are obtained in each capture probe by (i) extending a cleaved nucleic acid strand of a modified polony of the first polony type using a neighboring cleaved nucleic acid strand of a modified polony of the second polony type as template for said extension, wherein the cleaved nucleic acid strand extended in step (i) comprises said first unique barcode region that is unique for said modified polony of the first polony type and said neighboring cleaved nucleic acid strand comprises a reverse complement of said second unique barcode region that is unique for said modified polony of the second polony type.

[0242] 2. The method according to item 1, wherein each modified polony of said first polony type comprises a plurality of the cleaved nucleic acid strands extendable in step (i), wherein each cleaved nucleic acid strand of a modified polony of the first polony type comprises a first unique barcode region unique for said modified polony; and each modified polony of said second polony type comprises a plurality of the cleaved nucleic acid strands suitable as template in step (i), wherein each nucleic acid strand of a modified polony of the second polony type comprises a reverse complement of a second unique barcode region unique for said modified polony.

[0243] 3. The method according item 1 or 2, wherein said region capable of binding the target nucleic acid region is at the distal end, such as at the 3'-end, of each capture probe.

[0244] 4. The method according any one of items 1 to 3, wherein each cleaved nucleic acid strand of said modified polonies of the second polony type comprises a reverse complement of said region capable of binding the target nucleic acid region.

[0245] 5. The method according to item 4, wherein said reverse complement of the region capable of binding the target nucleic acid region is upstream, such as consecutively upstream, in said cleaved nucleic acid strands of said modified polonies of the second polony type from the reverse complement of the unique barcode region encoded by said cleaved nucleic acid strands.

[0246] 6. The method according to any one of items 1 to 5, wherein each cleaved nucleic acid strand of said modified polonies of the first polony type comprises a bridge region, such as a low temperature bridge region, capable of hybridizing to any neighboring cleaved nucleic acid strand of said modified polonies of the second polony type. 7. The method according to any one of items 1 to 6, wherein each cleaved nucleic acid strand of said modified polonies of the first polony type comprises the low temperature bridge region, and each cleaved nucleic acid strand of said modified polonies of the second polony type comprises a reverse complement of said low temperature bridge region; or wherein each cleaved nucleic acid strand of said modified polonies of the second polony type comprises the low temperature bridge region and each cleaved nucleic acid strand of said modified polonies of the first polony type comprises the reverse complement of said low temperature bridge region.

[0247] 8. The method according to item 7, wherein the low temperature bridge region or the reverse complement thereof is downstream, such as consecutively downstream, in said cleaved nucleic acid strands of said modified polonies of the first polony type from the first unique barcode region encoded by said cleaved nucleic acid strands; and the low temperature bridge region or the reverse complement thereof is downstream, such as consecutively downstream, in said cleaved nucleic acid strands of said modified polonies of the second polony type from the reverse complement of the second unique barcode region encoded by said cleaved nucleic acid strands.

[0248] 9. The method according to item 7 or 8, wherein the low temperature bridge region or the reverse complement thereof is at the distal end, such as at the 3'-end, of said cleaved nucleic acid strands of said modified polonies of the first polony type.

[0249] 10. The method according to any one of items 1 to 9, wherein each cleaved nucleic acid strand of said modified polonies of the first polony type is cleaved at a reverse complement of a first cleavage site, such as a reverse complement of a first restriction enzyme site, downstream, such as inconsecutively downstream, from the first unique barcode region of said cleaved nucleic acid strands; and each cleaved nucleic acid strand of said modified polonies of the second polony type is cleaved at the reverse complement of the first cleavage site, such as the reverse complement of the first restriction enzyme site, downstream, such as inconsecutively downstream, from the reverse complement of the second unique barcode region of said cleaved nucleic acid strands.

[0250] 11. The method according to any one of items 1 to 10, wherein said method prior to step (i) comprises (ii) obtaining said modified polonies of said first and said second polony types from the polonies of said first and said second polony types grown on the surface, such as by a selective substantial removal of each nucleic acid strand of each polony of the first polony type that comprises the reverse complement of the low temperature bridge region and each nucleic acid strand of each polony of the second polony type that comprises the low temperature bridge region and the region capable of binding the target nucleic acid region; or each nucleic acid strand of each polony of the first polony type that comprises the low temperature bridge region and each nucleic acid strand of each polony of the second polony type that comprises the reverse complement of the low temperature bridge region and the region capable of binding the target nucleic acid region.

[0251] 12. The method according to item 11, wherein each nucleic acid strand of a polony of said polonies of the first polony type that is selectively substantially removed in step (ii) comprises a reverse complement of the first unique barcode region unique for said polony and the therefrom obtained modified polony; and each nucleic acid strand of a polony of said polonies of the second polony type that is selectively substantially removed in step (ii) comprises the second unique barcode region unique for said polony and the therefrom obtained modified polony.

[0252] 13. The method according to item 11 or 12, wherein each nucleic acid strand that is selectively substantially removed in step (ii) comprises a first cleavage site, such as a first restriction enzyme site.

[0253] 14. The method according to any one of items 11 to 13, wherein said selective substantial removal as defined in step (ii) is performed using a first enzyme, such as a first restriction enzyme. 15. The method according to item 14, wherein said first enzyme is specific for the first cleavage site and the reverse complement thereof, such as said first restriction enzyme is specific for said first restriction enzyme site and the reverse complement thereof.

[0254] 16. The method according to any one of items 11 to 15, wherein said first cleavage site is upstream, such as consecutively upstream, in said nucleic acid strands of said polonies of the first polony type that are selectively substantially removed in step (ii) from said low temperature bridge region or the reverse complement thereof in said nucleic acid strands; and said first cleavage site is upstream, such as inconsecutively upstream, in said nucleic acid strands of said polonies of the second polony type that are removed in step (ii) from said low temperature bridge region or the reverse complement thereof in said nucleic acid strands.

[0255] 17. The method according to any one of items 11 to 16, wherein said first cleavage site comprises or consists of a palindromic nucleic acid sequence, such as a nucleic acid sequence according to SEQ ID NO:1.

[0256] 18. The method according to item 14 or 15, wherein said first restriction enzyme is EcoRI.

[0257] 19. The method according to any one of items 11 to 18, wherein each nucleic acid strand of said polonies of the first polony type that are selectively substantially removed in step (ii) comprises or consists of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:20-22, such as a nucleic acid sequence according to SEQ ID NQ:20.

[0258] 20. The method according to any one of items 11 to 19, wherein each nucleic acid strand of said polonies of the second polony type that are selectively substantially removed in step (ii) comprises or consists of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:23-25, such as a nucleic acid sequence according to SEQ ID NO:23. 21. The method according to any one of items 11 to 20, wherein each nucleic acid strand of said polonies of the first and the second polony types that remain on the surface in step (ii) comprise the reverse complement of the first cleavage site.

[0259] 22. The method according to any one of items 11 to 21, wherein said reverse complement of the first cleavage site is downstream, such as consecutively downstream, from the low temperature bridge region or the reverse complement thereof in said nucleic acid strands of said polonies of the first polony type that remain on the surface in step (ii).

[0260] 23. The method according to any one of items 11 to 22, wherein said reverse complement of the first cleavage site is downstream, such as inconsecutively downstream, from the low temperature bridge region or the reverse complement thereof in said nucleic acid strands of said polonies of the second polony type that remain on the surface in step (ii).

[0261] 24. The method according to any one of items 21 to 23, wherein said method comprises in step (ii) obtaining said cleaved nucleic acid strands of said modified polonies of said first and said second polony types by a cleavage at said reverse complement of the first cleavage site in each nucleic acid strand of said polonies of the first and the second polony types that remain on the surface in step (ii).

[0262] 25. The method according item 24, wherein said cleavage is performed using the first enzyme, such as the first restriction enzyme, as defined in any one of items 14, 15 and 18.

[0263] 26. The method according to item 24 or 25, wherein said selective substantial removal in step (ii) and said cleavage as defined in any one of items 24 and 25 are performed simultaneously in step (ii), such as performed in the same enzymatic reaction.

[0264] 27. The method according to any one of items 1 to 26, wherein each cleaved nucleic acid strand of said modified polonies of the first polony type is cleaved downstream, such as consecutively downstream, from the low temperature bridge region or the reverse complement thereof in said cleaved nucleic acids.

[0265] 28. The method according to any one of items 1 to 27, wherein each cleaved nucleic acid strand of said modified polonies of the second polony type is cleaved downstream, such as inconsecutively downstream, from the low temperature bridge region or the reverse complement thereof in said cleaved nucleic acids.

[0266] 29. The method according to any one of items 11 to 28, wherein each nucleic acid strand of said polonies of the first polony type that remain on the surface in step (ii) comprises or consists of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:17-19, such as a nucleic acid sequence according to SEQ ID NO:17, prior to said cleavage as defined in any one of items 24 to 26.

[0267] 30. The method according to any one of items 11 to 28, wherein each nucleic acid strand of said polonies of the second polony type that remain on the surface in step (ii) comprises or consists of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:26-28, such as a nucleic acid sequence according to SEQ ID NO:26 prior to said cleavage as defined in any one of items 24 to 26.

[0268] 31. The method according to any one of items 1 to 30, wherein each cleaved nucleic acid strand of said modified polonies of the first polony type comprises or consists of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:29-31, such as a nucleic acid sequence according to SEQ ID NO:29.

[0269] 32. The method according to any one of items 1 to 31, wherein each cleaved nucleic acid strand of said modified polonies of the second polony type comprises or consists of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:32-34, such as a nucleic acid sequence according to SEQ ID NO:32. 33. The method according to any one of items 1 to 32, wherein each nucleic acid strand of said polonies of the second polony type that remains linked to the surface in step (ii) and / or each cleaved nucleic acid strand of said modified polonies of the second polony type comprises a second cleavage site, such as a second restriction enzyme site, upstream, such as inconsecutively upstream, from the reverse complement of the second unique barcode region encoded by said nucleic acid strands and / or by said cleaved nucleic acid strands.

[0270] 34. The method according to item 33, wherein said second cleavage site in said nucleic acid strands of said polonies of the second polony type and / or said cleaved nucleic acid strands of said modified polonies of the second polony type is upstream, such as consecutively upstream, from the reverse complement of the region capable of binding the target nucleic acid region in said nucleic acid strands and / or in said cleaved nucleic acid strands.

[0271] 35. The method according to any one of items 1 to 34, wherein said method comprises in step (i) obtaining a reverse complement of the second cleavage site, such as a reverse complement of the second restriction enzyme site, downstream, such as consecutively downstream, in each extended cleaved nucleic acid strand of said modified polonies of the first polony type from the region capable of binding the target nucleic acid region in said extended cleaved nucleic acid strands.

[0272] 36. The method according to any one of items 1 to 35, wherein each extended cleaved nucleic acid strand of said modified polonies of the first polony type comprises or consists of a nucleic acid sequence according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:37-39, such as a nucleic acid sequence according to SEQ ID NO:37.

[0273] 37. The method according to any one of items 1 to 36, wherein said method subsequent to step (i) comprises (iii) a selective substantial removal of each cleaved nucleic acid strand of said modified polonies of the second polony type, such as a selective substantial removal by a cleavage at the second cleavage site, such as at the second restriction enzyme site. 38. The method according to item 37, wherein each of said cleaved nucleic acid strands that is selectively substantially removed in step (iii) comprises the second cleavage site, such as the second restriction enzyme site.

[0274] 39. The method according to any one of items 33 to 38, wherein said second cleavage site is different from the first cleavage site, such as said second restriction enzyme site is different from the first restriction enzyme site.

[0275] 40. The method according to any one of items 33 to 39, wherein said selective substantial removal as defined in step (iii) is performed using a second enzyme, such as a second restriction enzyme.

[0276] 41. The method according to item to 40, wherein said second enzyme is different from the first enzyme, such as said second restriction enzyme is different from the first restriction enzyme.

[0277] 42. The method according to item 40 or 41, wherein said second enzyme is specific for the second cleavage site and the reverse complement thereof, such as said second restriction enzyme is specific for said second restriction enzyme site and the reverse complement thereof.

[0278] 43. The method according to any one of items 33 to 42, wherein said second cleavage site comprises or consists of a palindromic nucleic acid sequence, such as a nucleic acid sequence according to SEQ ID NO:2.

[0279] 44. The method according to any one of items 40 to 43, wherein said second restriction enzyme is Bspll9L

[0280] 45. . The method according to any one of items 37 to 45, wherein each cleaved nucleic acid strand of polonies of the second polony type removed in step (iii) comprises or consists of a nucleic acid sequence according to according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:32-34, such as a nucleic acid sequence according to SEQ ID NO:32. 46. The method according to any one of items 35 to 45, wherein said method comprises in step (iii) a cleavage at the reverse complement of the second cleavage site of each extended cleaved nucleic acid strand of said modified polonies of the first polony type.

[0281] 47. The method according item 46, wherein said cleavage is performed using the second enzyme, such as the second restriction enzyme, as defined in any one of items 40 to 42 and 44.

[0282] 48. The method according to item 46 or 47, wherein said selective substantial removal in step (iii) and said cleavage as defined in item 46 or 47 are performed simultaneously in step (iii), such as performed in the same enzymatic reaction.

[0283] 49. The method according to any one of items 1 to 48, wherein each unique barcode region, such as said first and said second unique barcode regions, comprises a nucleic acid sequence having a length of at least about 6 nucleotides, such as at least about 8 nucleotides, such as at least about 10 nucleotides, such as at least about 12 nucleotides, such as at least about 14 nucleotides, such as at least about 16 nucleotides, such as at least about 18 nucleotides, such as at least about 20 nucleotides, such as at least about 22 nucleotides, such as at least about 24 nucleotides, such as at least about 26 nucleotides, such as at least about 28 nucleotides, such as at least about 30 nucleotides, such as at least about 32 nucleotides, such as at least about 34 nucleotides, such as at least about 36 nucleotides, such as at least about 38 nucleotides, such as at least about 40 nucleotides.

[0284] 50. The method according to any one of items 1 to 49, wherein each unique barcode region, such as said first and said second unique barcode regions, comprises a nucleic acid sequence having a length of from about 6 to about 46 nucleotides, such as from about 8 to about 44 nucleotides, such as from about 10 to about 42 nucleotides, such as from about 12 to about 40 nucleotides, such as from about 14 to about 38 nucleotides, such as from about 16 to about 36 nucleotides, such as from about 18 to about 34 nucleotides, such as from about 20 to about 32 nucleotides, such as from about 22 to about 30 nucleotides, such as from about 24 to about 28 nucleotides.

[0285] 51. The method according to any one of items 1 to 50, wherein each unique barcode region, such as said first and said second unique barcode regions, comprises a nucleic acid sequence having a length of from about 12 to about 40 nucleotides, such as a length of about 24 nucleotides.

[0286] 52. The method according to any one of items 1 to 51, wherein each of said cleaved nucleic acid strands of said modified polonies of said first and said second polony types is a single stranded nucleic acid strand, such as a single stranded DNA strand.

[0287] 53. The method according to any one of items 1 to 52, wherein said target nucleic acid region comprises or consists of an RNA sequence, a pseudo-RNA sequence or a DNA sequence, such as an RNA sequence.

[0288] 54. The method according to any one of items 1 to 53, wherein said target nucleic acid region comprises or consists of a poly-adenine sequence.

[0289] 55. The method according to any one of items 1 to 54, wherein said region capable of binding the target nucleic acid region comprises a target binding nucleic acid sequence, such as a poly-thymidine sequence.

[0290] 56. The method according to item 55, wherein said poly-thymidine sequence comprises or consists of from about 10 to about 30 consecutive thymidine nucleotides, such as from about 15 to about 25 consecutive thymidine nucleotides, such as about 20 consecutive thymidine nucleotides.

[0291] 57. The method according to item 55 or 56, wherein said region capable of binding the target nucleic acid region further comprises at least one spacer nucleotide upstream from the target binding nucleic acid sequence.

[0292] 58. The method according to item 57, wherein said at least one spacer nucleotide is alanine. 59. The method according to item 57 or 58, wherein said at least one spacer nucleotide is positioned between the second unique barcode region and the target binding nucleic acid sequence in each capture probe.

[0293] 60. The method according to any one of items 1 to 59, wherein said target molecule is selected from a group consisting of an RNA molecule, a DNA molecule, a peptide and a polypeptide.

[0294] 61. The method according to item 60, wherein said target molecule is an RNA molecule or a DNA molecule, such as an RNA molecule.

[0295] 62. The method according to item 60 or 61, wherein said RNA molecule is an mRNA molecule, such as an mRNA molecule comprising a poly-adenine tail.

[0296] 63. The method according to item 60, wherein said target molecule is a peptide or a polypeptide, such as a DNA probe-labeled peptide or a DNA probe-labeled polypeptide.

[0297] 64. The method according to any one of items 1 to 63, wherein each capture probe is a single stranded nucleic acid strand, such as a single stranded DNA strand.

[0298] 65. The method according to any one of items 1 to 64, wherein each capture probe is linked to said surface at the 5'-end thereof.

[0299] 66. The method according to any one of items 1 to 65, wherein each capture probe is covalently linked to said surface.

[0300] 67. The method according to any one of items 1 to 67, wherein each capture probe comprises at the 5'-end thereof an amine group (-NH2).

[0301] 68. The method according to item 67, wherein each capture probe is linked to said surface via said amine group (-NH2).

[0302] 69. The method according to any one of items 1 to 68, wherein said first and said second unique barcode regions are upstream from said region capable of binding the target nucleic acid region in each capture probe. 70. The method according to any one of items 1 to 69, wherein the first barcode region is upstream from the second barcode region in each capture probe.

[0303] 71. The method according to any one of items 1 to 70, wherein each capture probe comprises the low temperature bridge region or the reverse complement thereof positioned between said first and said second unique barcode regions.

[0304] 72. The method according to any one of items 1 to 71, wherein each capture probe comprises a forward primer binding region suitable for amplification for sequencing upstream from the first unique barcode region.

[0305] 73. The method according to any one of items 1 to 72, wherein each capture probe comprises a nucleic acid sequence having a length of at least about 100 nucleotides, such as at least about 150 nucleotides, such as at least about 160 nucleotides, such as at least about 170 nucleotides, such as at least about 180 nucleotides, such as at least about 190 nucleotides, such as at least about 200 nucleotides, such as at least about 210 nucleotides, such as at least about 220 nucleotides, such as at least about 230 nucleotides, such as at least about 240 nucleotides, such as at least about 250 nucleotides, such as at least about 300 nucleotides, such as at least about 400 nucleotides, such as at least about 500 nucleotides, such as at least about 600 nucleotides, such as at least about 700 nucleotides, such as at least about 800 nucleotides, such as at least about 900 nucleotides, such as at least about 1000 nucleotides, such as at least about 1100 nucleotides, such as at least about 1200 nucleotides, such as at least about 1300 nucleotides, such as at least about 1400 nucleotides, such as at least about 1500 nucleotides, such as at least about 1600 nucleotides, such as at least about 1700 nucleotides, such as at least about 1800 nucleotides, such as at least about 1900 nucleotides, such as at least about 2000 nucleotides.

[0306] 74. The method according to any one of items 1 to 73, wherein each capture probe comprises a nucleic acid sequence having a length of at least about 200 nucleotides, such as at least about 210 nucleotides, such as at least about 220 nucleotides, such as at least about 230 nucleotides, such as at least about 240 nucleotides, such as at least about 250 nucleotides, such as at least about 300 nucleotides, such as at least about 400 nucleotides, such as at least about 500 nucleotides, such as at least about 600 nucleotides, such as at least about 700 nucleotides, such as at least about 800 nucleotides, such as at least about 900 nucleotides, such as at least about 1000 nucleotides, such as at least about 1100 nucleotides, such as at least about 1200 nucleotides, such as at least about 1300 nucleotides, such as at least about 1400 nucleotides, such as at least about 1500 nucleotides, such as at least about 1600 nucleotides, such as at least about 1700 nucleotides, such as at least about 1800 nucleotides, such as at least about 1900 nucleotides, such as at least about 2000 nucleotides.

[0307] 75. The method according to any one of items 1 to 74, wherein each capture probe comprises a nucleic acid sequence having a length of from about 100 to about 2500 nucleotides, such as from about 150 to about 2400 nucleotides, such as from about 160 to about 2300 nucleotides, such as from about 170 to about 2200 nucleotides, such as from about 180 to about 2100 nucleotides, such as from about 190 to about 2000 nucleotides, such as from about 200 to about 2000 nucleotides.

[0308] 76. The method according to any one of items 1 to 75, wherein each capture probe comprises a nucleic acid sequence having a length of from about 200 to about 2000 nucleotides.

[0309] 77. The method according to any one of items 1 to 76, wherein said extension in step (i) is performed using a third enzyme, such as a first nucleic acid polymerase enzyme.

[0310] 78. The method according to any one of items 1 to 77, wherein said extension in step (i) comprises

[0311] (i-a) hybridizing said cleaved nucleic acid strand of the modified polony of the first polony type to the neighboring cleaved nucleic acid strand of the modified polony of the second polony type, and (i-b) elongating said cleaved nucleic acid strand of the modified polony of the first polony type based on the nucleic acid sequence of said neighboring cleaved nucleic acid strand of the modified polony of the second polony type.

[0312] 79. The method according to item 78, wherein said cleaved nucleic acid strand of the modified polony of the first polony type and the neighboring cleaved nucleic acid strand of the polony of the second polony type hybridize at the low temperature bridge region and the reverse complement thereof.

[0313] 80. The method according to item 78 or 79, wherein said extension is performed at a low temperature, such as at a temperature of from about 10°C to about 50°C, such as from about 12°C to about 48°C, such as from about 14°C to about 46°C, such as from about 16°C to about 44°C, such as from about 18°C to about 42°C, such as from about 20°C to about 40°C.

[0314] 81. The method according to any one of items 78 to 80, wherein said extension is performed at a temperature of from about 20°C to about 40°C, such as at a temperature of about 30°C.

[0315] 82. The method according to any one of items 78 to 81, wherein said extension is performed for from about 1 to about 60 min, such as from about 5 to about 60 min, such as from about 10 to about 50 min, such as from about 20 to about 40 min.

[0316] 83. The method according to any one of items 78 to 82, wherein said extension is performed for from about 1 to about 60 min, such as for about 30 min.

[0317] 84. The method according to any one of items 78 to 83, wherein each capture probe comprises or consists of a nucleic acid sequence according to according to a nucleic acid sequence selected from the group consisting of SEQ ID NO:40-42, such as a nucleic acid sequence according to SEQ ID NO:40.

[0318] 85. The method according to any one of items 1 to 84, wherein said first and said second polony types are orthogonal. 86. The method according to any one of items 1 to 85, wherein said method prior to step (i) and / or step (ii) comprises (iv) generating each polony of said first and said second polony types by bridge amplification on said surface, wherein said modified polonies of said first and said second polony types are obtainable from said polonies generated in step (iv).

[0319] 87. The method according to item 86, wherein said polonies of said first polony type comprising or consisting of a plurality of nucleic acid strands comprising a first unique barcode region or a reverse complement thereof unique for said polony and said polonies of said second polony type comprising a plurality of nucleic acid strands comprising a second unique barcode region or a reverse complement thereof unique for said polony are obtained.

[0320] 88. The method according to item 86 or 87, wherein each polony of said first polony type is generated by bridge amplification of a template nucleic acid strand of a first set of template nucleic acid strands using a plurality of a first oligonucleotide pair linked to said surface, wherein said first oligonucleotide pair is capable of amplifying each template nucleic acid strand of the first set of template nucleic acid strands, and each polony of said second polony type is generated by bridge amplification of a template nucleic acid strand of a second set of template nucleic acid strands using a plurality of a second oligonucleotide pair linked to said surface, wherein said second oligonucleotide pair is capable of amplifying each template nucleic acid strand of the second set of template nucleic acid strands.

[0321] 89. The method according to any one of items 86 to 88, wherein said polonies of said first and said second polony types are generated simultaneously.

[0322] 90. The method according to any one of items 86 to 89, wherein said bridge amplification for generating polonies of the first and the second polony types is performed by isothermal amplification or by thermal cycling, such as by isothermal amplification. 91. The method according to item 90, wherein said isothermal amplification is performed at a temperature of at least about 40°C, such as at least about 45°C, such as at least about 50°C, such as at least about 55°C, such as at least about 60°C.

[0323] 92. The method according to item 90 or 91, wherein said isothermal amplification is performed at a temperature of from about 40°C to about 80°C, such as from about 45°C to about 75°C, such as from about 50°C to about 70°C.

[0324] 93. The method according to any one of items 90 to 92, wherein said isothermal amplification is performed at a temperature of from about 50°C to about 70°C, such as at a temperature of about 60°C.

[0325] 94. The method according to any one of items 86 to 93, wherein each nucleic acid strand obtained in step (iv) is a single-stranded nucleic acid strand, such as a single stranded DNA strand.

[0326] 95. The method according to any one of items 88 to 94, wherein each of said template nucleic acid strands used for generating a polony is a single stranded nucleic acid strand, such as a single stranded DNA strand.

[0327] 96. The method according to any one of items 86 to 95, wherein said polonies of said first and said second polony types are obtained in step (iv) at a density of at least about 50000 polonies per mm2, such as at least about 100 000 polonies per mm2, such as at least about 200000 polonies per mm2, such as at least about

[0328] 300 000 polonies per mm2, such as at least about 400 000 polonies per mm2, such as at least about 500000 polonies per mm2, such as at least about 600000 polonies per mm2, such as at least about 700000 polonies per mm2, such as at least about 800 000 polonies per mm2, such as at least about 900 000 polonies per mm2, such as at least about 1 million polonies per mm2, such as at least about 2 million polonies per mm2, such as at least about 3 million polonies per mm2, such as at least about 4 million polonies per mm2, such as at least about 5 million polonies per mm2, such as at least about 6 million polonies per mm2, such as at least about 7 million polonies per mm2, such as at least about 8 million polonies per mm2, such as at least about 9 million polonies per mm2, such as at least about 10 million polonies per mm2.

[0329] 97. The method according to any one of items 86 to 96, wherein said polonies of said first and said second polony types are obtained in step (iv) at a density of from about 50000 polonies per mm2to about 50 million polonies per mm2, such as from about 50000 polonies per mm2to about 50 million polonies per mm2, such as from about 60000 polonies per mm2to about 40 million polonies per mm2, such as from about 70000 polonies per mm2to about 30 million polonies per mm2, such as from about 80000 polonies per mm2to about 20 million polonies per mm2, such as from about 90000 polonies per mm2to about 10 million polonies per mm2, such as from about 100 000 polonies per mm2to about 10 million polonies per mm2.

[0330] 98. The method according to any one of items 86 to 97, wherein said polonies of said first and said second polony types are obtained in step (iv) at a density of from about 100 000 polonies per mm2to about 5 million polonies per mm2, such as from about 200 000 polonies per mm2to about 4 million polonies per mm2, such as from about 300 000 polonies per mm2to about 3 million polonies per mm2, such as from about 400 000 polonies per mm2to about 2 million polonies per mm2, such as from about 500 000 polonies per mm2to about 1 million polonies per mm2.

[0331] 99. The method according to any one of items 86 to 98, wherein said polonies of said first and said second polony types are obtained in step (iv) at a density of from about 500 000 polonies per mm2to about 1 million polonies per mm2.

[0332] 100. The method according to any one of items 88 to 99, wherein said step (iv) comprises

[0333] (iv-a) linking of said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair to the surface at one end, such as at the 5'-end, of the oligonucleotides,

[0334] (iv-b) seeding of at least one template nucleic acid strand of said first set of template nucleic acid strands and at least one template nucleic acid strand of said second set of template nucleic acid strands onto said surface, wherein each seeded template nucleic acid strand serves as template for elongating an oligonucleotide of said plurality of the first oligonucleotide pair or said plurality of the second oligonucleotide pair, respectively, linked to the surface in step (iv-a),

[0335] (iv-c) removal of each template nucleic acid strand from the surface which has been seeded onto the surface in step (iv-b),

[0336] (iv-d) bridge amplification of each elongated nucleotide obtained in step (iv-b), wherein each elongated oligonucleotide obtained in step (iv-b) or (iv-d) is a nucleic acid strand of a polony of said first or said second polony types comprising a first or a second unique barcode region or a reverse complement thereof unique for said polony.

[0337] 101. The method according to item 100, wherein each seeded template nucleic acid strand in step (iv-b) is obtained by hybridizing a template nucleic acid strand of the first set of template nucleic acid strands to an oligonucleotide of said plurality of the first oligonucleotide pair, wherein the template nucleic acid strand comprises a sequence region complementary to a sequence region of said oligonucleotide and hybridizing a template nucleic acid strand of the second set of template nucleic acid strands to an oligonucleotide of said plurality of the second oligonucleotide pair, wherein the template nucleic acid strand comprises a sequence region complementary to a sequence region of said oligonucleotide; and elongating said oligonucleotides which were hybridized to a template nucleic acid strand using the template nucleic acid strand to which they are hybridized to as template.

[0338] 102. The method according to item 101, wherein said hybridization is performed at about 60°C and / or said elongation is performed at about 72°C. 103. The method according to item 101 or 102, wherein said hybridization is performed for about 5 minutes and / or said elongation is performed for about 15 minutes.

[0339] 104. The method according to any one of items 101 to 103, wherein said first and said second set of template nucleic acid strands comprise double stranded template nucleic acid strands that are denatured, such as denatured at about 95°C for about 5 min, in step (iv-b).

[0340] 105. The method according to any one of items 101 to 104, wherein each template nucleic acid strand seeded in step (iv-b) is unique on said surface.

[0341] 106. The method according to any one of items 101 to 105, wherein said template nucleic acid sequences in step (iv-c) are removed by denaturation, such as by using formamide and / or NaOH.

[0342] 107. The method according to any one of items 101 to 106, wherein said bridge amplification in step (iv-d) is performed using the third enzyme, such as the first nucleic acid polymerase enzyme.

[0343] 108. The method according to item 101 to 107, wherein said bridge amplification is performed at a temperature of at least about 40°C, such as at least about 45°C, such as at least about 50°C, such as at least about 55°C, such as at least about 60°C.

[0344] 109. The method according to any one of items 101 to 108, wherein said bridge amplification is performed at a temperature of from about 40°C to about 80°C, such as from about 45°C to about 75°C, such as from about 50°C to about 70°C.

[0345] 110. The method according to any one of items 101 to 109, wherein said bridge amplification is performed at a temperature of from about 50°C to about 70°C, such as at a temperature of about 60°C.

[0346] 111. The method according to any one of items 101 to 110, wherein said bridge amplification comprises at least one cycle of

[0347] - an annealing step, such as an annealing step performed for about 1 min; - an elongation step, such as an elongation step performed for about 4 min;

[0348] - a denaturing step, such as a denaturing step performed for about 1 min.

[0349] 112. The method according to item 111, wherein said bridge amplification comprises at least about 30 cycles, such as at least about 35 cycles, such as at least about 40 cycles.

[0350] 113. The method according to item 111 or 112, wherein said bridge amplification comprises from about 35 cycles to about 40 cycles.

[0351] 114. The method according to any one of items 88 to 113, wherein said first and said second set of template nucleic acid sequences are orthogonal.

[0352] 115. The method according to any one of items 88 to 114, wherein the reverse complement of the first unique barcode region of the cleaved nucleic acid strand of the modified polony of the first polony type extended in step (i) is encoded by the template nucleic acid strand used for generating the polony of the first polony type from which said modified polony is obtained, and the reverse complement of the second unique barcode region obtained in said extension in step (i) is encoded by the template nucleic acid strand used for generating the polony of the second polony type from which said modified polony of the second polony type is obtained.

[0353] 116.The method according to any one of items 88 to 115, wherein the reverse complement of the low temperature bridge region of the cleaved nucleic acid strand of the modified polony of the first polony type extended in step (i) is encoded by the template nucleic acid strand used for generating the polony of the first polony type from which said modified polony is obtained, and / or the reverse complement of the low temperature bridge region of the cleaved nucleic acid strand of the modified polony of the second polony type that is used as template in step (i) is encoded by the template nucleic acid strand used for generating the polony of the second polony type from which said modified polony is obtained. 117. The method according to item 116, wherein said reverse complement of the low temperature bridge region is upstream, such as consecutively upstream, from said reverse complement of the first unique barcode region in said template nucleic acid strand used for generating said polony of the first polony type.

[0354] 118. The method according to item 116 or 117, wherein said reverse complement of the low temperature bridge region is downstream, such as consecutively downstream, from the reverse complement of the second unique barcode region in said template nucleic acid strand used for generating said polony of the second polony type.

[0355] 119. The method according to any one of items 88 to 118, wherein a reverse complement of the forward primer binding region suitable for amplification for sequencing of the cleaved nucleic acid strand of the modified polony of the first polony type extended in step (i) is encoded by the template nucleic acid strand used for generating the polony of the first polony type from which said modified polony is obtained.

[0356] 120. The method according to item 119, wherein said reverse complement of the forward primer binding region suitable for amplification for sequencing is downstream, such as consecutively downstream, from the reverse complement of the first unique barcode region in the template nucleic acid strand used for generating said polony of the first polony type.

[0357] 121. The method according to any one of items 88 to 120, wherein the reverse complement of the region capable of binding the target nucleic acid region that is obtained in said extension in step (i) is encoded by the template nucleic acid strand used for generating the polony of the second polony type from which said modified polony of the second polony type is obtained.

[0358] 122. The method according to item 121, wherein said reverse complement of the region capable of binding the target nucleic acid region is upstream, such as consecutively upstream, from the reverse complement of the second unique barcode region in the template nucleic acid strand used for generating said polony of the second polony type.

[0359] 123. The method according to any one of items 88 to 122, wherein the first cleavage site is encoded by the template nucleic acid strand used for generating the polony of the first polony type from which said modified polony of the first polony type as defined in step (i) is obtained, and the reverse complement of the first cleavage site is encoded by the template nucleic acid strand used for generating the polony of the second polony type from which said modified polony of the second polony type as defined in step (i) is obtained.

[0360] 124. The method according to item 123, wherein said first cleavage site is upstream, such as consecutively upstream, from said reverse complement of the low temperature bridge region in said template nucleic acid strand used for generating said polony of the first polony type.

[0361] 125. The method according to item 123 or 124, wherein said reverse complement of the first cleavage site is downstream, such as inconsecutively downstream, from said reverse complement of the low temperature bridge region in said template nucleic acid sequence used for generating said polony of the second polony type.

[0362] 126. The method according to any one of items 88 to 125, wherein the second cleavage site is encoded by the template nucleic acid sequence used for generating the polony of the second polony type from which said modified polony of the second polony type as defined in step (i) is obtained.

[0363] 127. The method according to item 126, wherein said second cleavage site is upstream, such as consecutively upstream, from the reverse complement of the region capable of binding the target nucleic acid region in said template nucleic acid sequence used for generating said polony of the second polony type.

[0364] 128. The method according to any one of items 115 to 127, wherein the template nucleic acid strand used for generating said polony of the first polony type comprises the regions as defined in any one of items 115 to 128 or the reverse complement of the regions as defined in any one of items 115 to 128, and the template nucleic acid strand used for generating said polony of the second polony type comprises the regions as defined in any one of items 115 to 127 or the reverse complement of the regions as defined in any one of items 115 to 127.

[0365] 129. The method according to any one of items 88 to 128, wherein each template nucleic acid strand comprises a spacer region.

[0366] 130. The method according to item 129, wherein the spacer region in template nucleic acid strands of the first set of template nucleic acid strands and the spacer region in template nucleic acid strands of the second set of template nucleic acid strands are orthogonal.

[0367] 132. The method according to any one of items 88 to 131, wherein each template nucleic acid strand gives rise to the growth of only one polony on said surface.

[0368] 133. The method according to any one of items 88 to 132, wherein each template nucleic acid strand comprises a nucleic acid sequence having a length of at least about 100 nucleotides, such as at least about 150 nucleotides, such as at least about 160 nucleotides, such as at least about 170 nucleotides, such as at least about 180 nucleotides, such as at least about 190 nucleotides, such as at least about 200 nucleotides, such as at least about 210 nucleotides, such as at least about 220 nucleotides, such as at least about 230 nucleotides, such as at least about 240 nucleotides, such as at least about 250 nucleotides, such as at least about 300 nucleotides, such as at least about 400 nucleotides, such as at least about 500 nucleotides, such as at least about 600 nucleotides, such as at least about 700 nucleotides, such as at least about 800 nucleotides, such as at least about 900 nucleotides, such as at least about 1000 nucleotides, such as at least about 1100 nucleotides, such as at least about 1200 nucleotides, such as at least about 1300 nucleotides, such as at least about 1400 nucleotides, such as at least about 1500 nucleotides, such as at least about 1600 nucleotides, such as at least about 1700 nucleotides, such as at least about 1800 nucleotides, such as at least about 1900 nucleotides, such as at least about 2000 nucleotides. 134. The method according to any one of items 88 to 135, wherein each template nucleic acid strand comprises a nucleic acid sequence having a length of at least about 200 nucleotides, such as at least about 210 nucleotides, such as at least about 220 nucleotides, such as at least about 230 nucleotides, such as at least about 240 nucleotides, such as at least about 250 nucleotides, such as at least about 300 nucleotides, such as at least about 400 nucleotides, such as at least about 500 nucleotides, such as at least about 600 nucleotides, such as at least about 700 nucleotides, such as at least about 800 nucleotides, such as at least about 900 nucleotides, such as at least about 1000 nucleotides, such as at least about 1100 nucleotides, such as at least about 1200 nucleotides, such as at least about 1300 nucleotides, such as at least about 1400 nucleotides, such as at least about 1500 nucleotides, such as at least about 1600 nucleotides, such as at least about 1700 nucleotides, such as at least about 1800 nucleotides, such as at least about 1900 nucleotides, such as at least about 2000 nucleotides.

[0369] 135. The method according to any one of items 88 to 134, wherein each template nucleic acid strand comprises a nucleic acid sequence having a length of from about 100 to about 2500 nucleotides, such as from about 150 to about 2400 nucleotides, such as from about 160 to about 2300 nucleotides, such as from about 170 to about 2200 nucleotides, such as from about 180 to about 2100 nucleotides, such as from about 190 to about 2000 nucleotides, such as from about 200 to about 2000 nucleotides.

[0370] 136. The method according to any one of items 88 to 135, wherein each template nucleic acid strand comprises a nucleic acid sequence having a length of from about 200 to about 2000 nucleotides, such as a length of about 600 nucleotides.

[0371] 137. The method according to any one of items 88 to 136, wherein the concentration of template nucleic acid strands in each of said first and second set of template nucleic acid sequences is selected to enable only one bridge amplification reaction of a template nucleic acid sequence on said surface in step (iv), such as a concentration of about 400 pM. 138. The method according to any one of items 88 to 137, wherein the number of template nucleic acid strands is at least about 2.4 x IO10molecules in each of said first and second set of template nucleic acid sequences.

[0372] 139. The method according to any one of items 88 to 138, wherein the oligonucleotides of said first and said second oligonucleotide pairs are orthogonal.

[0373] 140. The method according to any one of items 88 to 139, wherein each oligonucleotide of the first and the second oligonucleotide pairs comprises a nucleic acid sequence having a length of at least about 10 nucleotides, such as at least about 11 nucleotides, such as at least about 12 nucleotides, such as at least about 13 nucleotides, such as at least about 14 nucleotides, such as at least about 15 nucleotides, such as at least about 16 nucleotides.

[0374] 141. The method according to any one of items 88 to 140, wherein each oligonucleotide of the first and the second oligonucleotide pairs comprises a nucleic acid sequence having a length of from about 10 to about 60 nucleotides, such as from about 15 to about 55 nucleotides, such as from about 16 to about 50 nucleotides, such as from about 16 to about 40 nucleotides, such as from about 16 to about 30 nucleotides, such as from about 16 to about 20 nucleotides.

[0375] 142. The method according to any one of items 88 to 141, wherein each oligonucleotide of the first and the second oligonucleotide pairs comprises a nucleic acid sequence having a length of about 20 nucleotides, such as a length of 22 nucleotides.

[0376] 143. The method according to any one of items 88 to 142, wherein the oligonucleotides of said first and said second oligonucleotide pairs are guanine- cytosine rich.

[0377] 144. The method according to any one of items 88 to 143, wherein the oligonucleotides of said first and said second oligonucleotide pairs have a similar melting temperature. 145. The method according to any one of items 88 to 144, wherein said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair are linked to said surface at a high density.

[0378] 146. The method according to any one of items 88 to 145, wherein said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair are linked to said surface at the 5'-end of the oligonucleotides.

[0379] 147. The method according to any one of items 88 to 146, wherein said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair are covalently linked to said surface.

[0380] 148. The method according to any one of items 88 to 146, wherein said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair comprise said amine group (-NH2) defined in item 67 at the 5' end of the oligonucleotides.

[0381] 149. The method according to item 148, wherein said plurality of the first oligonucleotide pair and said plurality of the second oligonucleotide pair are covalently linked to said surface via said amine group (-NH2).

[0382] 150. The method according to any one of items 88 to 149, wherein the first oligonucleotide pair comprises a first and a second oligonucleotide, such as wherein the first oligonucleotide comprises a nucleic acid sequence corresponding to a reverse complement of a nucleic acid region at the 3'-end and the second oligonucleotide comprises a nucleotide sequence identical to a nucleic acid region comprising the first cleavage site at the 5'-end of the template nucleic acid strand used for generating the polony of the first polony type from which said modified polony of the first polony type as defined in step (i) is obtained, or the first oligonucleotide comprises a nucleic acid sequence identical to a nucleic acid region at the 5'-end and the second oligonucleotide comprises a nucleotide sequence corresponding to a reverse complement of a nucleic acid region comprising the reverse complement of the first cleavage site at the 3'-end of the template nucleic acid strand used for generating the polony of the first polony type from which said modified polony of the first polony type as defined in step (i) is obtained.

[0383] 151. The method according to item 150, wherein the first oligonucleotide comprises at least one deoxy-uridine nucleotide.

[0384] 152. The method according to item 150 or 151, wherein the first oligonucleotide does not comprise any cleavage site, such as any restriction enzyme cleavage site.

[0385] 153. The method according to any one of items 88 to 152, wherein the second oligonucleotide pair comprises a third and a fourth oligonucleotide, such as wherein the third oligonucleotide comprises a nucleotide sequence corresponding to a reverse complement of a nucleic acid sequence of a region comprising the reverse complement of the first cleavage site at the 3'-end and the fourth oligonucleotide comprises a nucleic acid sequence identical to a nucleic acid sequence of a region comprising the second cleavage site at the 5'-end of the template nucleic acid strand used for generating the polony of the second polony type from which said modified polony of the second polony type as defined in step (i) is obtained, or the third oligonucleotide comprises a nucleotide sequence identical to a nucleic acid sequence of a region comprising the first cleavage site at the 5'-end and the fourth oligonucleotide comprises a nucleic acid sequence corresponding to a reverse complement of a nucleic acid region comprising the reverse complement of the second cleavage site at the 3'-end of the template nucleic acid strand used for generating the polony of the second polony type from which said modified polony of the second polony type as defined in step (i) is obtained.

[0386] 154. The method according to any one of items 1 to 153, wherein said surface comprises a glass surface or a silicon surface, such as a glass surface.

[0387] 155. The method according to any one of items 1 to 154, wherein said surface is functionalized, such as is functionalized by an activated polymer. 156. The method according to any one of items 1 to 155, wherein said sample is a tissue sample.

[0388] 157. The method according to any one of items 1 to 156, wherein said cleaved nucleic acid strands of modified polonies of the second polony type, such as the cleaved nucleic acid strand used as template in step (i), that are in close proximity to and are capable to hybridize with at least one cleaved nucleic acid strand of modified polonies of the first polony type, such as said cleaved nucleic acid strand extended in step (i), correspond to neighboring nucleic acid strands for the extension as defined in step (i).

[0389] 158. The method according to item 157, wherein said close proximity corresponds to less than from about 100 nm to about 300 nm, such as less than from about 150 nm to about 250 nm, such as less than about 200 nm.

[0390] 159. The method according to any one of items 1 to 158, wherein said at least one capture probe is a plurality of capture probes.

[0391] 160. The method according to any one of items 1 to 159, wherein the capture surface enables determining the spatial location of said at least one target molecule, such as a plurality of said target molecules, in said sample.

[0392] 161. A capture surface for at least one target molecule in a sample, each target molecule comprising a target nucleic acid region, said capture surface comprising a surface and a plurality of metapolonies, each metapolony comprising at least one capture probe linked to said surface, wherein each capture probe of a metapolony comprises a first and a second unique barcode region that are unique for said meta polony and a region capable of binding the target nucleic acid region of said at least one target molecule.

[0393] 162. The capture surface according to item 161 for determining the spatial location of said target molecule in the sample.

[0394] 163. The capture surface according to item 161 or 162, wherein a combination of the first and the second unique barcode regions encoded by a capture probe of said at least one capture probe, such as a plurality of capture probes, of a metapolony of said plurality of meta polonies indicates information about the spatial position of said capture probe on said surface.

[0395] 164. The capture surface according to item 163, wherein said spatial position is a relative spatial position obtained for said capture probe relative to one or more other capture probes of said at least one capture probe, such as said plurality of capture probes, of said plurality of metapolonies.

[0396] 165. The capture surface according to item 163 or 164, wherein said spatial position is obtained for said capture probe based on the information indicated by the combinations of the first and the second barcode regions encoded by said at least one capture probe, such as said plurality of capture probes, of said plurality of meta polonies.

[0397] 166. The capture surface according to any one of items 163 to 165, wherein said information is obtained by sequencing, such as by high-throughput sequen...

Claims

Claims1. A method for creating a capture surface for at least one target molecule in a sample, each target molecule comprising a target nucleic acid region, wherein said method comprises generating at least one metapolony comprising at least one capture probe linked to a surface; wherein each capture probe of a metapolony comprises a first and a second unique barcode region that are unique for said metapolony and a region capable of binding the target nucleic acid region of said at least one target molecule; wherein each meta polony is generated from a polony of a first polony type and a polony of a second polony type grown on said surface; and wherein the second unique barcode region and the region capable of binding the target nucleic acid region are obtained in each capture probe by (i) extending a cleaved nucleic acid strand of a modified polony of the first polony type using a neighboring cleaved nucleic acid strand of a modified polony of the second polony type as template for said extension, wherein the cleaved nucleic acid strand extended in step (i) comprises said first unique barcode region that is unique for said modified polony of the first polony type and said neighboring cleaved nucleic acid strand comprises a reverse complement of said second unique barcode region that is unique for said modified polony of the second polony type.

2. The method according to claim 1, wherein each cleaved nucleic acid strand of said modified polonies of the first polony type comprises a bridge region, such as a low temperature bridge region, capable of hybridizing to any neighboring cleaved nucleic acid strand of said modified polonies of the second polony type.

3. The method according to claim 1 or 2, wherein said region capable of binding the target nucleic acid region is at the distal end, such as at the 3'-end, of each capture probe.

4. The method according to any one of claims 1 to 3, wherein said method prior to step (i) comprises (ii) obtaining said modified polonies of said first and said secondpolony types from polonies of said polonies of said first and said second polony types grown on the surface.

5. The method according to any one of claims 1 to 4, wherein said modified polonies of said first and said second polony types are obtained by a selective substantial removal of each nucleic acid strand of a polony of said polonies of the first polony type that comprises a reverse complement of the first unique barcode region unique for said polony and the therefrom obtained modified polony, and each nucleic acid strand of a polony of said polonies of the second polony type that comprises the second unique barcode region unique for said polony and the therefrom obtained modified polony.

6. The method according to any one of claims 1 to 5, wherein said method subsequent to step (i) comprises (iii) a selective substantial removal of each cleaved nucleic acid strand of said modified polonies of the second polony type.

7. The method according to any one of claims 1 to 6, wherein said method prior to step (i) and / or step (ii) comprises (iv) generating each polony of said first and said second polony types by bridge amplification on said surface, wherein said modified polonies of said first and said second polony types are obtainable from said polonies generated in step (iv).

8. The method according to claim 7, wherein said polonies of said first polony type comprising or consisting of a plurality of nucleic acid strands comprising a first unique barcode region or a reverse complement thereof unique for said polony and said polonies of said second polony type comprising a plurality of nucleic acid strands comprising a second unique barcode region or a reverse complement thereof unique for said polony are obtained.

9. The method according to claim 7 or 8, wherein each polony of said first polony type is generated by bridge amplification of a template nucleic acid strand of a first set of template nucleic acid strands using a plurality of a first oligonucleotide pairlinked to said surface, wherein said first oligonucleotide pair is capable of amplifying each template nucleic acid strand of the first set of template nucleic acid strands, and each polony of said second polony type is generated by bridge amplification of a template nucleic acid strand of a second set of template nucleic acid strands using a plurality of a second oligonucleotide pair linked to said surface, wherein said second oligonucleotide pair is capable of amplifying each template nucleic acid strand of the second set of template nucleic acid strands.

10. A capture surface for at least one target molecule in a sample, each target molecule comprising a target nucleic acid region, said capture surface comprising a surface and a plurality of metapolonies, each metapolony comprising at least one capture probe linked to said surface, wherein each capture probe of a metapolony comprises a first and a second unique barcode region that are unique for said metapolony and a region capable of binding the target nucleic acid region of said at least one target molecule.

11. The capture surface according to claim 10, wherein a combination of the first and the second unique barcode regions encoded by a capture probe of said at least one capture probe, such as a plurality of capture probes, of a metapolony of said plurality of meta polonies indicates information about the spatial position of said capture probe on said surface.

12. The capture surface according to claim 10 or 11, wherein said plurality of meta polonies are generated from a plurality of polonies of two polony types, such as two orthogonal polony types, grown on said surface.

13. The capture surface according to any one of claims 10 to 12, wherein the capture surface is manufactured using the method as defined in any one of claims 1 to 9.

14. A method for creating a spatial map of a plurality of target molecules in a sample, each target molecule comprising a target nucleic acid region, said method comprising(a) capturing a plurality of target molecules using a capture surface obtained by the method as defined in any one of claims 1 to 9, or a capture surface as defined in any one of claims 10 to 13,(b) extending each capture probe of said capture surface that binds a target molecule of said plurality of target molecules based on a nucleic acid sequence region of the captured target molecule;(c) producing a sequenceable library of a plurality of extended capture probes obtained in step (b);(d) sequencing said sequenceable library obtained in step (c);(e) defining the spatial position of said plurality of extended capture probes on the capture surface based on the information indicated by the combinations of the first and the second unique barcode regions encoded by each of said plurality of extended capture probes;(f) creating a spatial map of said plurality of target molecules in said sample based on the spatial position of said plurality of extended capture probes and the nucleic acid sequence regions of the captured plurality of target molecules.

15. The method according to claim 14, wherein said method comprises in step (c), the removal of said plurality of extended capture probes from the surface of the capture surface.

16. The method according to any one of claims 1 to 9, the capture surface according to any one of claims 10 to 13 or the method according to claim 14 or 15, wherein said sample is a tissue sample.

17. The method according to any one of claims 1 to 9 and 16, the capture surface according to any one of claims 10 to 13 and 16, or the method according to any one of claims 14 to 16, wherein said target molecule is selected from a group consisting of an RNA molecule, a DNA molecule, a peptide and a polypeptide.

18. A kit comprising a capture surface obtained by the method as defined in any one of claims 1 to 9, 16 and 17, or a capture surface as defined in any one of items 10 to 13, 16 and 17; and instructions for use thereof.

Citation Information

Patent Citations

  • Method of nucleic acid amplification

    WO1998044151A1

  • Materials and methods for localized detection of nucleic acids in a tissue sample

    US20220372547A1

  • High-resolution spatial transcriptome

    WO2022192721A2