Host cells for enhanced plant growth

Abstract

Provided herein are novel non-naturally occurring bacteria that exhibit enhanced nitrogen fixation activity. Such non-naturally occurring bacteria are useful in providing plants (e.g., food crops) with useable nitrogen nutrients and, therefore, enhancing plant growth and development.

Description

HOST CELLS FOR ENHANCED PLANT GROWTHINCORPORATION OF THE SEQUENCE LISTING

[0001] The contents of the .xml file submitted electronically herewith are incorporated herein by reference in their entirety: A computer readable format copy of the Sequence Listing (filename: PIV00058 WO. xml, date recorded January 13. 2025, file size 51 kilobytes).BACKGROUND

[0002] Nitrogen is a critical limiting element for plant growth and production. It is a major component of many important biomolecules such as chlorophyll, amino acids, ATP and nucleic acids. While nitrogen is an essential nutrient for plant grow th and development, it is unavailable in its most prevalent form as atmospheric nitrogen. Rather, plants can only utilize reduced forms of nitrogen, for example, in the form of ammonia and nitrate.

[0003] Fertilizers (e.g., organic manure and inorganic ammonia) are a main source of useable forms of nitrogen for commercial crops, but come at a cost. Manufacturing fertilizer processes account three percent of the world’s carbon emissions. Soil bacteria process ammonia from fertilizers and turn it into nitrates and nitrous oxide, a significant greenhouse gas. Nitrates produced from fertilizers can be leached into the groundw ater or be w ashed out of the soil surface into washed into rivers, lakes and oceans. Nitrogen in these bodies of water increases the population of microscopic organisms, including toxic cyanobacteria that can poison fish and other aquatic animals.

[0004] Thus, there is a need for alternative nitrogen sources for plants, particularly food crops, in light of the growing need for increased food production.SUMMARY

[0005] Provided herein are novel non-naturally occurring bacteria that exhibit enhanced nitrogen fixation activity'. Such non-naturally occurring bacteria are useful in providing plants (e.g., food crops) with useable nitrogen nutrients and, therefore, enhancing plantgrow th and development. Bacteria that include the modifications provided herein advantageously exhibit increased ammonia production under anaerobic and / or hypoxic conditions. In embodiments, the non-naturally occurring bacteria provided herein exhibit increased ammonia production in excess nitrogen conditions.BRIEF DESCRIPTION OF THE DRAWINGS

[0006] Figure 1 depicts the results of studies to assess biomass and ammonia production under limited oxygen conditions: Batch 0%, Batch 1% and Batch 2% scatter plots display the ammonia titer (mM) and biomass (OD) of each strain in 0%, 1% and 2% oxygen conditions. Strains 1. 2, 3, 4, a, b, c, and d (see Table 19) were compared to and plotted with 6 reference strains: A, B. C, D. E, and F.DETAILED DESCRIPTIONI. Overview

[0007] Provided herein are novel non-naturally occurring bacteria that exhibit enhanced nitrogen fixation activity. Such bacteria include modifications in genes that affect the expression and / or activity of the nitrogenase complex. The subject non-naturally occurring bacterium provided herein find use in enhancing plant growth and development.

[0008] In embodiments, the non-naturally occurring bacterium provided herein includes a modification wherein a constitutive promoter (see, e.g., Table 1) is operably linked to one of the following genes: nifKl, mdh. glnL, hyp A. yci F, atpC. yhgF. serB. and pykA. In embodiments, the non-naturally occurring bacterium includes a partial or complete deletion of an endogenous nasA, yjjG, purU, or tauR gene. In embodiments, the subject bacteria further include an additional modification that enhances nitrogen fixation. In embodiments, the additional modifications is a nrfLA operation modification, a. glnE modification, and / or a glnD modification. Bacteria that include the modifications provided herein advantageously exhibit increased ammonia production under anaerobic and / or hypoxic conditions. Inembodiments, the non-naturally occurring bacteria provided herein exhibit increased ammonia production in excess nitrogen conditions.II. Definitions

[0009] In order that the application may be more completely understood, several definitions are set forth below. Such definitions are meant to encompass grammatical equivalents.

[0010] The term “a” or "an" refers to one or more of that entity, i.e. can refer to a plural referent. As such, the terms '‘a” or “an”, “one or more” and “at least one” are used interchangeably herein. In addition, reference to “an element” by the indefinite article “a” or “an” does not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there is one and only one of the elements.

[0011] “Bacteria” or “eubacteria” refers to a domain of prokaryotic organisms. Bacteria include at least 11 distinct groups as follows: (1) Gram-positive (gram+) bacteria, of which there are two major subdivisions: (1) high G+C group (Actinomycetes, Mycobacteria, Micrococcus, others) (2) low G+C group (Bacillus, Clostridia, Lactobacillus, Staphylococci, Streptococci, Mycoplasmas).' (2) Proteobacteria. e.g, Purple photosy nthetic+non- photosynthetic Gram-negative bacteria (includes most “common” Gram-negative bacteria); (3) Cyanobacteria, e.g., oxygenic phototrophs; (4) Spirochetes and related species; (5) Planctomyces; (6) Bacteroides, Flavobacteria; (7) Chlamydia,' (8) Green sulfur bacteria; (9) Green non-sulfur bacteria (also anaerobic phototrophs); (10) Radioresistant micrococci and relatives; and (11) Thermotoga and Thermosipho thermophiles.

[0012] The terms “non-naturally occurring bacterium” refers to a bacterium that has been modified by the cloning and transformation methods of the present disclosure. Thus, the terms include a bacterium that has been altered, modified, or engineered, such that it exhibits an altered, modified, or different genotype and / or phenotype (e.g., when the modification affects coding nucleic acid sequences of the bacteria), as compared to the naturally-occurring bacterium from which it was derived. It is understood that in embodiments, the terms refernot only to the particular recombinant bacterium in question, but also to the progeny or potential progeny of such a bacterium.

[0013] The term “wild-ty pe bacterium” describes a bacterium having a genotype that occurs in a natural population of bacteria.

[0014] The term “engineered” or “modified” may refer to any manipulation of a host cell’s genome (e.g. by insertion, deletion, mutation, or replacement of nucleic acids).

[0015] The term “control” or “control host cell” or “control bacterium” refers to an appropriate comparator host cell for determining the effect of a modification or experimental treatment. In embodiments, the control host cell is a wild-ty pe cell. In other embodiments, a control host cell is genetically identical to the modified host cell, save for the modification(s) differentiating the modified host cell.

[0016] As used herein, the term “locus” (loci plural) means a specific place or places or a site on a chromosome where for example a gene or genetic marker is found.

[0017] A “recombination” or “recombination event” as used herein refers to a chromosomal crossing over.

[0018] As used herein, the term “phenotype” refers to the observable characteristics of an individual cell, cell culture, organism, or group of organisms which results from the interaction between that individual’s genetic makeup (i.e., genotype) and the environment.

[0019] As used herein, the term “chimeric” or “recombinant” when describing a nucleic acid sequence or a protein sequence refers to a nucleic acid, or a protein sequence, that links at least two heterologous polynucleotides, or two heterologous polypeptides, into a single macromolecule, or that re-arranges one or more elements of at least one natural nucleic acid or protein sequence. For example, the term “recombinant” can refer to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques.

[0020] As used herein, a “synthetic nucleotide sequence” or “synthetic polynucleotide sequence” is a nucleotide sequence that is not known to occur in nature or that is not naturally occurring.

[0021] As used herein, the term “nucleic acid” refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs thereof. This term refers to the primary structure of the molecule, and thus includes double- and single-stranded DNA, as well as double- and single-stranded RNA. It also includes modified nucleic acids such as methylated and / or capped nucleic acids, nucleic acids containing modified bases, backbone modifications, and the like. The terms “nucleic acid” and “nucleotide sequence” are used interchangeably.

[0022] As used herein, the term “gene” refers to any segment of DNA associated with a biological function. Thus, genes include, but are not limited to, coding sequences and / or the regulatory sequences required for their expression. Genes can also include non-expressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.

[0023] As used herein, the term “endogenous” or “endogenous gene,” refers to the naturally occurring gene, in the location in which it is naturally found within the host cell genome. An endogenous gene as described herein can include alleles of naturally occurring genes that have been mutated according to any of the methods of the present disclosure.

[0024] As used herein, a “heterologous promoter” refers to a promoter that is located at a non-native location in the host genome. In embodiments, a heterologous promoter may be derived from the same host species. In the context of the present disclosure, a heterologous promoter that is “operably linked” to an endogenous gene controls expression of the endogenous gene.

[0025] As used herein, the term '‘nucleotide change” refers to, e.g., nucleotide substitution, deletion, and / or insertion, as is well understood in the art. For example, mutations contain alterations that produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded protein or how the proteins are made.

[0026] As used herein, the term "protein modification” refers to, e.g.. amino acid substitution, amino acid modification, deletion, and / or insertion, as is well understood in the art.

[0027] As used herein, the term “at least a portion” or “fragment” of a nucleic acid or polypeptide means a portion having the minimal size characteristics of such sequences, or any larger fragment of the full-length molecule, up to and including the full-length molecule. A fragment of a polynucleotide of the disclosure may encode a biologically active portion of a genetic regulatory element. A biologically active portion of a genetic regulator}7element can be prepared by isolating a portion of one of the polynucleotides of the disclosure that comprises the genetic regulatory element and assessing activity as described herein.Similarly, a portion of a polypeptide may be 4 amino acids, 5 amino acids, 6 amino acids, 7 amino acids, and so on, going up to the full-length polypeptide. The length of the portion to be used will depend on the particular application. A portion of a nucleic acid useful as a hybridization probe may be as short as 12 nucleotides; in embodiments, it is 20 nucleotides. A portion of a polypeptide useful as an epitope may be as short as 4 amino acids. A portion of a polypeptide that performs the function of the full-length polypeptide would generally be longer than 4 amino acids.

[0028] Variant polynucleotides also encompass sequences derived from a mutagenic and recombinogenic procedure such as DNA shuffling. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer (1994) PNAS 91 : 10747-10751; Stemmer (1994) Nature 370:389-391; Crameri et a / .(1997) Nature Biotech. 15:436-438; Moore et a / .(1997) J. Mol. Biol. 272:336-347; Zhang et a / .(1997) PNAS 94:4504-4509; Crameri et a / .(1998) Nature 391:288-291: and U.S. Patent Nos. 5,605,793 and 5,837,458.

[0029] As used herein, “promoter” refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. In embodiments, the promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an “enhancer” is a DNA sequence that can stimulate promoter activity, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of some variation may have identical promoter activity.

[0030] As used herein, the phrases “recombinant construct”, “expression construct”, “chimeric construct”, “construct”, and “recombinant DNA construct” are used interchangeably herein. A recombinant construct comprises an artificial combination of nucleic acid fragments, e.g., regulatory’ and coding sequences that are not found together in nature. For example, a chimeric construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. Such constructs may be used by itself or may be used in conjunction with a vector. If a vector is used then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art. For example, a plasmid vector can be used. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid fragments of the disclosure. The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al., (1985) EMBO J. 4:2411-2418; De Almeida et al., (1989) Mol. Gen. Genetics 218:78-86), and thus that multiple events must be screened inorder to obtain lines displaying the desired expression level and pattern Such screening may be accomplished by Southern analysis of DNA, Northern analysis of mRNA expression, immunoblotting analysis of protein expression, or phenotypic analysis, among others. Vectors can be plasmids, viruses, bacteriophages, pro-viruses, phagemids, transposons, artificial chromosomes, and the like, that replicate autonomously or can integrate into a chromosome of a host cell. A vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of both DNA and RNA within the same strand, a poly-lysine-conjugated DNA or RNA. a peptide-conjugated DNA or RNA, a liposome- conjugated DNA, or the like, that is not autonomously replicating. As used herein, the term “expression” refers to the production of a functional end-product e.g., an mRNA or a protein (precursor or mature).

[0031] The term percent "identity," in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequence being compared, e.g.. over a functional domain, or. alternatively, exist over the full length of the two sequences to be compared. For sequence comparison, ty pically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

[0032] It is noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as an antecedent basis for use of such exclusive terminology as “solely,” “only,” and the like in connection with the recitation of claim elements or use of a “negative” limitation. As will be apparent to those of skill in the artupon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the invention. Any recited method may be carried out in the order of events recited or in any other order that is logically possible. Although any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the invention, representative illustrative methods and materials are now described.

[0033] Before the invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0034] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention. Certain ranges are presented herein with numerical values being preceded by the term "‘about / ’ The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number, which, in the context presented, provides the substantial equivalent of the specifically recited number.

[0035] All publications, patents, and patent applications cited in this specification are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application were specifically and individually indicated to be incorporated by reference. Furthermore, each cited publication, patent, or patent application is incorporated herein by reference to disclose and describe the subject matter in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the invention described herein is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided might be different from the actual publication dates, which may need to be independently confirmed.III. Non-naturally occurring bacterium

[0036] The non-naturally occurring bacteria provided herein exhibit enhanced nitrogen fixation activity that find use, for example, as alternative nitrogen sources for plants, particularly food crops.

[0037] In embodiments the non-naturally occurring bacterium is a modified Klebsiella. In embodiments, the non-naturally occurring bacterium is a modified Klebsiella variicola. Klebsiella oxytoca, or Klebsiella pneumoniae. In embodiments, the non-naturally occurring bacterium is a modified Klebsiella variicola.

[0038] In embodiments, non-naturally occurring bacteria provided herein exhibit modified expression of one of the following genes as compared to a control bacterium (e.g., a bacterium without the modification): nifKl, mdh. glnL, hypA,yciV, atpGyhgF serB,pykA, nasA, yjjG, purU, or tauR. In embodiments, non-naturally occurring bacteria provided herein exhibit increased expression of one of the following genes: nifKl, mdh, glnL, hyp A. yciV, atpC.yhgF, serB, and pykA and / or decreased expression of one or more of the following genes: nasA, yjjG, purU, or tauR, as compared to a control bacterium. In embodiments, the non-naturally occurring bacterium provided herein includes a modification wherein a heterologous promoter (e.g., a heterologous constitutive promoter) is operably linked to oneof the following genes: nifKl, mdh, glnL, hypA, yciV, aip('. yhgF, serB, and pykA. In embodiments, the non-naturally occurring bacterium provided herein includes a modification wherein a constitutive promoter in Table 1 is operably linked to one of the following genes: nifKl, mdh, glnL, hypA, yciV, atpC, yhgF. serB. and pykA. In particular embodiments of the non-naturally occurring bacteria, the modified nifKl , mdh, glnL. hypA, yciV, atpC,yhgF, serB, and pykA gene is a modified endogenous copy of the gene. In embodiments, the constitutive promoter is active beginning at a particular stage of cell grow th of the non- naturally occurring bacterium. In embodiments, the promoter is active beginning during lag growth phase of the non-naturally occurring bacterium. In embodiments, the promoter is active beginning at exponential growth phase of the non-naturally occurring bacterium. In embodiments, the promoter is active beginning at stationary growth phase.Table 1

[0039] In embodiments of the non-naturally occurring bacteria, the bactena include a modification wherein an endogenous nasA, yjjG, purU, and / or tauR gene is partially or completely deleted.

[0040] In embodiments, the subject non-naturally occurring bacteria provided herein exhibit increased ammonia production. In particular embodiments, the non-naturally occurring bacterium produces ammonia under conditions wherein ammonia is present in the culture medium for culturing the bacterium or in high intracellular nitrogen / glutamine conditions. Ammonia produced by the non-naturally occurring bacterium can be measured using any suitable technique known in the art including, for example, fluorimetry (with o- phthalaldehyde) or spectrophotometry techniques. Nitrogen fixation can be measured using a single fermentative assay that measures nitrogen excretion, or an acetylene reduction assay(ARA). Nitrogen fixation can be assessed in bacteria by measuring 15N gas / fertilizer (dilution) with IRMS or NanoSIMS.

[0041] In embodiments, the non-naturally occurring bacterium produces at least about 5%, about 10%. about 15%, about 20%, about 25%, about 30%, about 35%. about 40%, about 45%. about 50%. about 55%, about 60%, about 65%. about 70%. about 75%. about 80%, about 85%, about 90%, about 95%, or about 99% more ammonia than a control (e.g., a wildtype counterpart bacterium). In embodiments, the non-naturally occurring bacterium produces at least about 1-10%. about 10-20%. about 20-30%, about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100%, about 1-30%, about 10-40%, about 20-50%, about 30-60%, about 40-70%, about 50-80%, about 60-90%, or about 70-100% more ammonium as compared to a control bacterium.

[0042] In embodiments, the non-naturally occurring bacterium exhibits enhanced ammonia excretion. In embodiments, the non-naturally occurring bacterium excretes at least about 5%, about 10%. about 15%, about 20%, about 25%, about 30%. about 35%. about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% more ammonia than a control (e.g., a wildtype counterpart bacterium). In embodiments, the non-naturally occurring bacterium excretes at least about 1-10%, about 10-20%. about 20-30%. about 30-40%, about 40-50%, about 50- 60%, about 60-70%, about 70-80%, about 80-90%, about 90-100%, about 1-30%, about 10- 40%, about 20-50%, about 30-60%, about 40-70%, about 50-80%, about 60-90%, or about 70-100% more ammonium as compared to a control bacterium.

[0043] In embodiments, the non-naturally occurring bacterium exhibits at least about 5%, about 10%. about 15%, about 20%, about 25%, about 30%. about 35%. about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% greater nitrogen fixation than a control (e.g., a wild-type counterpart bacterium). In embodiments, the non-naturally occurring bacterium exhibits at least about 1-10%. about 10-20%, about 20-30%, about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100%. about1-30%, about 10-40%, about 20-50%, about 30-60%, about 40-70%, about 50-80%, about 60-90%, or about 70-100% greater nitrogen fixation as compared to a control bacterium.

[0044] In embodiments, the non-naturally occurring bacterium is capable of enhanced nitrogen fixation under excess nitrogen conditions. In embodiments, the non-naturally occurring bacterium is capable of enhanced ammonia production under excess nitrogen conditions. In embodiments, the non-naturally occurring bacterium is capable of enhanced nitrogen fixation under excess ammonia conditions. In embodiments, the non-naturally occurring bacterium is capable of enhanced nitrogen fixation under excess ammonia conditions.

[0045] In embodiments, the non-naturally occurring bacterium is capable of enhanced nitrogen fixation under anaerobic (0% oxygen) or hypoxic (2% or less oxygen) conditions. In embodiments, the non-naturally occurring bacterium is capable of enhanced ammonia production under anaerobic or hypoxic conditions. In embodiments, the non-naturally occurring bacterium is capable of enhanced nitrogen fixation under anaerobic or hypoxic conditions. In embodiments, the non-naturally occurring bacterium is capable of enhanced nitrogen fixation under excess under anaerobic or hypoxic conditions.

[0046] In embodiments, the non-naturally occurring bacterium exhibits increased expression of one or more endogenous nif operon genes. Exemplary nif operon genes that can be increased in the non-naturally occurring bacteria provided herein include, but are not limited to: niff niJH, nifD, niJK, niff, nifY, nifE, niJN, nifX. niflf nifS, niff nifW, nifZ, nijM, nifF, nifB, and nifQ. In certain bacteria, nifH, nifD and nifK encode the nitrogenase subunits, while nifE, nifN, nifU, nijS, nijV, niJW, nijX, nifB, nifQ encode proteins involved in the assembly of iron and molybdenum atoms into the nitrogenase subunits. In embodiments, the non- naturally occurring bacterium exhibits at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% greater expression of one or more nif operon genes as compared to a control (e.g., a wild-type counterpart). In embodiments, the non-naturally occurring bacterium exhibits atleast about 1-10%, about 10-20%, about 20-30%, about 30-40%, about 40-50%, about 50- 60%, about 60-70%, about 70-80%, about 80-90%, about 90-100%, about 1-30%, about 10- 40%, about 20-50%, about 30-60%, about 40-70%, about 50-80%, about 60-90%, or about 70-100% greater expression of one or more nif operon genes as compared to a control (e.g., a wild-type counterpart). In embodiments, the non-naturally occurring bacterium exhibits increased expression of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or more nif operon genes.

[0047] In embodiments, the subject bacterium provided herein enhances the growth of a plant grown in the presence of the bacterium. Growth enhancement can be assessed by measuring one of the following traits and comparing with a control plant grown under similar conditions in the absence of the bacterium: height, overall biomass, root and / or shoot biomass, seed germination, seedling survival, photosynthetic efficiency, transpiration rate, seed / fruit number or mass, plant grain or fruit yield, leaf chlorophyll content, photosynthetic rate, root length, or any combination thereof. In embodiments, the non-naturally occurring bacterium enhances the growth of a plant by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%. about 65%, about 70%, about 75%, about 80%, about 85%. about 90%, about 95%. or about 99% more than a control plant grown under similar conditions in the absence of the bacterium. In embodiments, the non-naturally occurring bacterium enhances the growth of a plant by at least about 1-10%, about 10-20%, about 20-30%, about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, 8 about 0-90%, about 90-100%, about 1-30%, about 10-40%. about 20-50%. about 30-60%. about 40-70%. about 50-80%, about 60-90%, or about 70-100% more than a control plant grown under similar conditions in the absence of the bacterium.

[0048] Source bacteria for producing the subject non-naturally occurring bacteria disclosed herein can be obtained by extracting bacteria from surfaces or tissues of native plants. Source bacteria can be obtained by grinding seeds to isolate bacteria. Bacteria can be obtained by planting seeds in diverse soil samples and recovering bacteria from tissues. Additionally, bacteria can be obtained by inoculating plants with exogenous bacteria and determiningwhich bacteria appear in plant tissues. Non-limiting examples of plant tissues may include a seed, seedling, leaf, cutting, plant, bulb, or tuber.

[0049] Source bacteria can be isolated from plant tissues to assess microbial traits. The parameters for processing tissue samples may be varied to isolate different types of associative Source bacteria, such as rhizosphenc bacteria, epiphytes, or endophytes. The isolates can be cultured in nitrogen-free media to enrich for bacteria that perform nitrogen fixation. Alternatively, source bacteria can be obtained from global strain banks.

[0050] Bacteria for modification can be isolated from soils. Bacteria may be collected from various soil types . In some examples, the soil can be characterized by traits such as high or low fertility, levels of moisture, levels of minerals, and various cropping practices. For example, the soil may be involved in a crop rotation where different crops are planted in the same soil in successive planting seasons. The sequential grow th of different crops on the same soil may prevent disproportionate depletion of certain minerals. The bacteria can be isolated from the plants growing in the selected soils. The seedling plants can be harvested at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12 weeks of growth. For example, at least 400 isolates can be collected in a round of harvest. Soil and plant types reveal the plant phenotype as well as the conditions, which allow for the downstream enrichment of certain phenotypes.

[0051] The subject non-naturally occurring bacterium provided herein include modifications that increase the expression of an endogenous gene and / or replaces an endogenous gene with a mutant allele that increases nitrogen fixation. Any suitable technique can be used to modify a source bacterium to produce a non-naturally occurring bacterium provided herein.Exemplary techniques for modifying microbes, including bacteria, include but are not limited to: polymerase chain reaction (PCR) mutagenesis (error-prone PCR), oligonucleotide- directed mutagenesis, multiplex automated genome engineering (MAGE), PFunkel, homologous recombination including those that utilize programmable nucleases (e.g., ZFNs, TALENS, CRISPR / Cas9), orthogonal DNA polymerase-plasmid pairs, targeting glycosylase to embedded arrays for mutagenesis (TaGTEAM), retrotransposons-based and targeted mutagenesis, saturation mutagenesis, fragment shuffling mutagenesis (DNA shuffling). Seealso U.S. Pat. No. 8,795,965, 7,132,265, 6,713,285, 6,673,610, 6,391,548, 5,789,166, 5,780,270, 5,354,670, 5,071,743, and US20050266541 and US20100267147, which are incorporated by reference herein, particularly in pertinent parts relating to modification methods.

[0052] In embodiments, the modifications are introduced in a parent bacterium by homologous recombination mutagenesis. Homologous recombination mutagenesis involves recombination between a DNA fragment that includes replacement nucleic acid of interest and the targeted endogenous polynucleotide sequence. After a double-stranded break occurs, sections of DNA around the 5' ends of the break are cut away in a process called resection. In the strand invasion step that follows, an overhanging 3' end of the broken DNA molecule then “invades” a similar or identical DNA molecule that is not broken. The method can be used, for example, to delete a gene or regulatory element, add a gene or regulatory element, and introduce point mutations. Homologous recombination mutagenesis can be permanent or conditional. Typically, a recombination template is also provided. A recombination template may be a component of another vector, contained in a separate vector, or provided as a separate polynucleotide. In embodiments, a recombination template is designed to serve as a template in homologous recombination, such as within or near a target sequence nicked or cleaved by a site-specific nuclease. A template polynucleotide may be of any suitable length, such as about or more than about 10, 15, 20, 25, 50, 75, 100, 150, 200, 500, 1000, or more nucleotides in length. In embodiments, the template polynucleotide is complementary to a portion of a polynucleotide comprising the target sequence. When optimally aligned, a template polynucleotide might overlap with one or more nucleotides of a target sequences (e.g., about or more than about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or more nucleotides). In embodiments, when a template sequence and a polynucleotide comprising a target sequence are optimally aligned, the nearest nucleotide of the template polynucleotide is within about 1, 5, 10, 15, 20, 25, 50, 75. 100, 200, 300, 400, 500. 1000, 5000, 10000, or more nucleotides from the target sequence. Non-limiting examples of site- directed nucleases useful in methods of homologous recombination include zinc finger nucleases, CRISPR nucleases, TALE nucleases, and meganucleases. See, e.g., U.S. Pat. No.Y18,795,965 and US20140301990, which are incorporated by reference herein, particularly in pertinent parts relating to homologous recombination mutagenesis techniques. In embodiments, homologous recombination is performed using a suicide plasmid that includes the replacement nucleic acid of interest and one or more selectable markers.

[0053] Introducing genetic variation may be an incomplete process, such that some bacteria in a treated population of bacteria carry a desired mutation while others do not. In some cases, it is desirable to apply a selection pressure so as to enrich for bacteria carrying a desired genetic variation. Traditionally, selection for successful genetic variants involved selection for or against some functionality imparted or abolished by the genetic variation, such as in the case of inserting antibiotic resistance gene or abolishing a metabolic activity capable of converting a non-lethal compound into a lethal metabolite. It is also possible to apply a selection pressure based on a polynucleotide sequence itself, such that only a desired genetic variation need be introduced (e.g.. without also requiring a selectable marker). In this case, the selection pressure can comprise cleaving genomes lacking the genetic variation introduced to a target site, such that selection is effectively directed against the reference sequence into which the genetic variation is sought to be introduced. Typically, cleavage occurs within 100 nucleotides of the target site (e.g., within 75, 50, 25, 10, or fewer nucleotides from the target site, including cleavage at or within the target site). Cleaving may be directed by a site-specific nuclease selected from the group consisting of a Zinc Finger nuclease, a CRISPR nuclease, a TALE nuclease (TALEN), or a meganucleases. Such a process is similar to processes for enhancing homologous recombination at a target site, except that no template for homologous recombination is provided. As a result, bacteria lacking the desired genetic variation are more likely to undergo cleavage that, left unrepaired, results in cell death. Bacteria surviving selection may then be isolated for use in exposing to plants for assessing conferral of an improved trait.A. Nitrogen Fixation Modifications

[0054] In embodiments, the non-naturally occurring bacteria provided herein include one or more modifications that provide enhanced nitrogen fixation activity. Bacteria that include themodifications provided herein advantageously exhibit increased ammonia production under anaerobic and / or hypoxic conditions. In embodiments, the non-naturally occurring bacteria provided herein exhibit increased ammonia production in excess nitrogen conditions. In embodiments, the non-naturally occurring bacterium provided herein includes a modification of one of more of the following endogenous genes in the bacterium: nifKl, mdh, glnL, hypA, yciV, atpC,yhgF, serB, and pykA, wherein a heterologous promoter is operably linked to one or more of the genes. As used herein, a “heterologous promoter” refers to a promoter that is located at a non-native location in the host genome. In embodiments, the heterologous promoter may be derived from the same host species. In embodiments, the heterologous promoter is a constitutive promoter. In embodiments, the non-naturally occurring bacterium provided herein includes a modification wherein a heterologous promoter in Table 1 is operably linked to one of the following genes: nifKl, mdh, glnL. hypA,yciV, atpC, yhgF, serB. and pykA. In embodiments, the non-naturally occurring bacterium includes a partial or complete deletion of an endogenous nasA, yjjG, purU, or tauR gene. In embodiments, the non-naturally occurring bacterium includes a modification of two, three, four, five, six, seven, eight, nine or ten or more of the following genes: nifKl, mdh, glnL, hyp A. yciV, alpC. yhgF, serB, pykA, nasA, yjjG. purU, or tauR gene. In embodiments, the non-naturally occurring bacterium further includes one more additional modifications that enhance nitrogen fixation (e.g., a nifLA, glnE, and / or glnD modification). In embodiments, the non-naturally occurring bacterium is a modified K. variicola. Exemplary7modifications are discussed in further detail below.1. nifKl

[0055] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression of nifKl as compared to a control bacterium (e.g., a bacterium without the modification). The nifKl gene encodes for the Nif nitrogenase molybdenum-iron protein beta chain that forms the active site for Nif nitrogenases. Thus, without being bound by any particular theory of operation, it is believed that a modification that increases the expression of nifKl contributes to increased nitrogen fixation activity in the subject bacteria.

[0056] In embodiments, the non-naturally occurring bacterium includes a modification wherein the endogenous nifKl gene is operably linked to a heterologous promoter that increases the expression of nifKl. Any suitable heterologous promoter that increases expression of nifKl can be used. In particular embodiments, the non-naturally occurring bacterium includes a modification where the endogenous nifKl promoter or a portion thereof is replaced with a heterologous promoter that enhances expression of nifKl. In embodiments, the heterologous promoter is a promoter derived from the same species as the non-naturally occurring bacteria. For example, in embodiments wherein the bacterium is K. variicola. the endogenous nifKl gene is operably linked to aK. variicola derived promoter. In other embodiments, the endogenous c nifKl gene is operably linked to a heterologous promoter derived from a different species as the non-naturally occurring bacterium. In embodiments, the heterologous promoter is a constitutive promoter.

[0057] In embodiments, the non-naturally occurring bacterium is a K. variicola with a constitutive K. variicola promoter operably linked to its endogenous nifKl gene. Exemplary' suitable promoters that can be operably linked to the endogenous nifKl gene are shown in Table 1 (SEQ ID NOs: l-5) provided herein.

[0058] In embodiments, the non-naturally occurring bacterium includes an endogenous nifKl gene operably linked to a Pcs pE 120 promoter or a variant thereof. In embodiments, the non- naturally occurring bacterium includes an endogenous nifKl gene operably linked to a PfrdA promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous nifKl gene operably linked to a PompC l promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous nifKl gene operably linked to a Psra promoter or a variant thereof. In embodiments, the non- naturally occurring bacterium includes an endogenous nifKl gene operably linked to a PgapA200 promoter or a variant thereof.

[0059] In embodiments, the variant promoter has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with any of the promoters included in Table 1.

[0060] In embodiments, the non-naturally occurring bacterium is a modified K. variicokt that includes a modification wherein the endogenous nifKl gene is operably linked to the Psra promoter (Table 1, SEQ ID NO:4). In embodiments, a terminator sequence is included to eliminate expression of the native promoter (e.g.,TCAAATAAAACAAAAGGCCCAGTCGAAAGACTGGGCCTTTTGTTTTTGTTATATCT GTTGTTT, SEQ ID NO:26). In embodiments, the endogenous nifKl is operably linked to a variant of the Psra promoter that has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with Psra (SEQ ID NO:4).Table 2

[0061] In embodiments, the non-naturally occurring bacteria exhibit at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% nifKl more transcription as compared to a control bacterium (e.g., a bacterium without the nifKl modification or a wild- fi pe counterpart bacterium).2. mdh

[0062] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression of mdh as compared to a control bacterium (e.g., a bacterium without the modification). The mdh gene encodes for malate dehydrogenase. Without being bound by any particular theory of operation, it is believed that a modification that increases the expression of mdh contributes to increased nitrogen fixation activity in the subject bacteria.

[0063] In embodiments, the non-naturally occurring bacterium includes a modification wherein the endogenous mdh gene is operably linked to a heterologous promoter that increases the expression of mdh. Any suitable heterologous promoter that increases expression of mdh can be used. In particular embodiments, the non-naturally occurring bacterium includes a modification where the endogenous mdh promoter or a portion thereof is replaced with a heterologous promoter that enhances expression of mdh. In embodiments, the heterologous promoter is a promoter derived from the same species as the non-naturally occurring bacteria. For example, in embodiments wherein the bacterium is K. variicola. the endogenous mdh gene is operably linked to a K. variicola derived promoter. In other embodiments, the endogenous c mdh gene is operably linked to a heterologous promoter derived from a different species as the non-naturally occurring bacterium. In embodiments, the heterologous promoter is a constitutive promoter.

[0064] In embodiments, the non-naturally occurring bacterium is a K. variicola with a constitutive K. variicola promoter operably linked to its endogenous mdh gene. Exemplarysuitable promoters that can be operably linked to the endogenous mdh gene are shown in Table 1 (SEQ ID NOs: l-5) provided herein.

[0065] In embodiments, the non-naturally occurring bacterium includes an endogenous mdh gene operably linked to a PcspEI20 promoter or a variant thereof. In embodiments, the non- naturally occurring bacterium includes an endogenous mdh gene operably linked to a PfrdA promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous mdh gene operably linked to a PompC _1 promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous mdh gene operably linked to a P.sra promoter or a variant thereof. In embodiments, the non- naturally occurring bacterium includes an endogenous mdh gene operably linked to a PgapA200 promoter or a variant thereof.

[0066] In embodiments, the variant promoter has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with any of the promoters included in Table 1.

[0067] In embodiments, the non-naturally occurring bacterium is a modified K. variicola that includes a modification wherein the endogenous mdh gene is operably linked to the PfraL4 promoter (Table 1, SEQ ID NO:2). In embodiments, a terminator sequence is included to eliminate expression of the native promoter (e.g., TCAAATAAAACAAAAGGCCCAGTCGAAAGACTGGGCCTTTTGTTTTTGTTATATCT GTTGTTT, SEQ ID NO:26). In embodiments, the endogenous mdh is operably linked to a variant of the P / raL4 promoter that has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with PfrdA (SEQ ID NO:2).Table 3

[0068] In embodiments, the non-naturally occurring bacteria exhibit at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% mdh more transcription as compared to a control bacterium (e.g., a bacterium without the mdh modification or a wildtype counterpart bacterium).3. glnL

[0069] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression of glnL as compared to a control bacterium (e g., a bacterium without the modification). In embodiments, the non-naturally occurring bacteria provided herein include a modification that increases the expression of glnL. In embodiments, the non- naturally occurring bacterium is a K. variicola with a constitutive K. variicola promoter shown in Table 1 operably linked to its endogenous glnL gene. The glnL gene encodes for the histidine kinase NtrB, which regulates the activation and deactivation of the nifLA promoter. Without being bound by any particular theory of operation, it is believed that a modification that increases the expression of glnL contributes to increased nitrogen fixation activity in the subject bacteria.

[0070] In embodiments, the non-naturally occurring bacterium is a K. variicola with a constitutive K. variicola promoter operably linked to its endogenous glnL gene. Exemplary suitable promoters that can be operably linked to the endogenous glnL gene are shown in Table 1 (SEQ ID NOs: 1-5) provided herein.

[0071] In embodiments, the non-naturally occurring bacterium includes a modification wherein the endogenous glnL gene is operably linked to a heterologous promoter that increases the expression of glnL. Any suitable heterologous promoter that increases expression of glnL can be used. In particular embodiments, the non-naturally occurring bacterium includes a modification where the endogenous glnL promoter or a portion thereof is replaced with a heterologous promoter that enhances expression of glnL. In embodiments,the heterologous promoter is a promoter derived from the same species as the non-naturally occurring bacteria. For example, in embodiments wherein the bacterium is K. variicola. the endogenous glnL gene is operably linked to a K. variicola derived promoter. In other embodiments, the endogenous glnL gene is operably linked to a heterologous promoter derived from a different species as the non-naturally occurring bacterium. In embodiments, the heterologous promoter is a constitutive promoter.

[0072] In embodiments, the non-naturally occurring bacterium includes an endogenous hypA gene operably linked to a PcspE120 promoter or a variant thereof. In embodiments, the non- naturally occurring bacterium includes an endogenous hypA gene operably linked to a PfrdA promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous hypA gene operably linked to a PompC l promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous hypA gene operably linked to a Psra promoter or a variant thereof. In embodiments, the non- naturally occurring bacterium includes an endogenous hypA gene operably linked to a PgapA200 promoter or a variant thereof.

[0073] In embodiments, the variant promoter has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with any of the promoters included in Table 1.

[0074] In embodiments, the non-naturally occurring bacteria is a modified K. variicola that includes a modification wherein the endogenous glnL gene is operably linked to the Psra promoter (Table 1, SEQ ID NO:4). In embodiments, a terminator sequence is included to eliminate expression of the native promoter (e.g., TCAAATAAAACAAAAGGCCCAGTCGAAAGACTGGGCCTTTTGTTTTTGTTATATCT GTTGTTT, SEQ ID NO:26). In embodiments, the endogenous glnL is operably linked to a variant of the Psra promoter that has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity’ with Psra (SEQ ID NO:4).Table 4

[0075] In embodiments, the non-naturally occurring bacteria exhibit at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% more glnL transcription as compared to a control bacterium (e.g., a bacterium without the glnL modification or a wildtype counterpart bacterium).4. hypA

[0076] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression of hypA as compared to a control bactenum (e.g., a bacterium without the modification). In embodiments, the non-naturally occurring bacteria provided herein include a modification that increases the expression of hypA. The hypA gene encodes for hydrogenase maturation factor HypA. Hydrogenase maturation factor HypA is involved in the maturation of [NiFe] hydrogenases. Without being bound by any particular theory of operation, it is believed that a modification that increases the expression of hypA contributes to increased nitrogen fixation activity in the subject bacteria.

[0077] In embodiments, the non-naturally occurring bacterium is a K. variicola with a constitutive K. variicola promoter operably linked to its endogenous hypA gene. Exemplary suitable promoters that can be operably linked to the endogenous hypA gene are shown in Table 1 (SEQ ID NOs: 1-5) provided herein.

[0078] In embodiments, the non-naturally occurring bacterium includes a modification wherein the endogenous hypA gene is operably linked to a heterologous promoter that increases the expression of hypA. Any suitable heterologous promoter that increases expression of hypA can be used. In particular embodiments, the non-naturally occurring bacterium includes a modification where the endogenous hypA promoter or a portion thereof is replaced with a heterologous promoter that enhances expression of hypA. In embodiments, the heterologous promoter is a promoter derived from the same species as the non-naturally occurring bacteria. For example, in embodiments wherein the bacterium is K. variicola. the endogenous hypA gene is operably linked to aK. variicola derived promoter. In other embodiments, the endogenous hypA gene is operably linked to a heterologous promoter derived from a different species as the non-naturally occurring bacterium. In embodiments, the heterologous promoter is a constitutive promoter.

[0079] In embodiments, the non-naturally occurring bacterium includes an endogenous hypA gene operably linked to a PcspE120 promoter or a variant thereof. In embodiments, the non- naturally occurring bacterium includes an endogenous hypA gene operably linked to a PfrdA promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous hypA gene operably linked to a PompC l promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous hypA gene operably linked to a Psra promoter or a variant thereof. In embodiments, the non- naturally occurring bacterium includes an endogenous hypA gene operably linked to a PgapA200 promoter or a variant thereof.

[0080] In embodiments, the variant promoter has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with any of the promoters included in Table 1.

[0081] In embodiments, the non-naturally occurring bacteria is a modified K. variicola that includes a modification wherein the endogenous hypA gene is operably linked to the Psra promoter (Table 1, SEQ ID NO:4). In embodiments, a terminator sequence is included to eliminate expression of the native promoter (TCAAATAAAACAAAAGGCCCAGTCGAAAGACTGGGCCTTTTGTTTTTGTTATATCTGTTGTTT, SEQ ID NO:26). In embodiments, the endogenous hypA is operably linked to a variant of the Psra promoter that has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with Psra (SEQ ID NO:4).Table 5

[0082] In embodiments, the non-naturally occurring bacteria exhibit at least about 5, 10, 15, 20. 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80. 85. 90 or 95% more hypA transcription as compared to a control bacterium (e g., a bacterium without the hypA modification or a wildtype counterpart bacterium).5. yciV

[0083] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression of yciV as compared to a control bacterium (e.g., a bacterium without the modification). In embodiments, the non-naturally occurring bacteria provided hereininclude a modification that increases the expression of yciV. The yciV gene encodes for a 5’- 3’ exoribonuclease. Without being bound by any particular theory of operation, it is believed that a modification that increases the expression of yci V contributes to increased nitrogen fixation activity in the subject bacteria.

[0084] In embodiments, the non-naturally occurring bacterium is a K. variicola with a constitutive K. variicola promoter operably linked to its endogenous yci V gene. Exemplary suitable promoters that can be operably linked to the endogenous yci V gene are shown in Table 1 (SEQ ID NOs: 1-5) provided herein.

[0085] In embodiments, the non-naturally occurring bacterium includes a modification wherein the endogenous yciV gene is operably linked to a heterologous promoter that increases the expression of yciV Any suitable heterologous promoter that increases expression of yciV can be used. In particular embodiments, the non-naturally occurring bacterium includes a modification where the endogenous yci V promoter or a portion thereof is replaced with a heterologous promoter that enhances expression of yciV. In embodiments, the heterologous promoter is a promoter derived from the same species as the non-naturally occurring bacteria. For example, in embodiments wherein the bacterium is K. variicola, the endogenous yci V gene is operably linked to a K. variicola derived promoter. In other embodiments, the endogenous yciV gene is operably linked to a heterologous promoter derived from a different species as the non-naturally occurring bacterium. In embodiments, the heterologous promoter is a constitutive promoter.

[0086] In embodiments, the non-naturally occurring bacterium includes an endogenous yci V gene operably linked to a PcspE120 promoter or a variant thereof. In embodiments, the non- naturally occurring bacterium includes an endogenous yciV gene operably linked to a Pfrd 4 promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous yciV gene operably linked to a TompC l promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous yciV gene operably linked to a Tsra promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous yciV gene operably linked to a PgapA200 promoter or a variant thereof.

[0087] In embodiments, the variant promoter has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with any of the promoters included in Table 1.

[0088] In embodiments, the non-naturally occurring bacteria is a modified K. variicola that includes a modification wherein the endogenous yciV gene is operably linked to the PfrdA promoter (Table 1, SEQ ID NO:2). In embodiments, a terminator sequence is included to eliminate expression of the native promoter(TCAAATAAAACAAAAGGCCCAGTCGAAAGACTGGGCCTTTTGTTTTTGTTATATC TGTTGTTT. SEQ ID NO:26). In embodiments, the endogenous yciV is operably linked to a variant of the PfrdA promoter that has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with PfrdA (SEQ ID NO:2).Table 6

[0089] In embodiments, the non-naturally occurring bacteria exhibit at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% more yciV transcription as compared to a control bacterium (e.g., a bacterium without the yciV modification or a wildtype counterpart bacterium).6. atpC

[0090] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression of atpC as compared to a control bacterium (e.g., a bacterium without the modification). In embodiments, the non-naturally occurring bacteria provided herein include a modification that increases the expression of atpC. The atpC gene encodesfor ATP synthase epsilon chain ATPC. Without being bound by any particular theory of operation, it is believed that a modification that increases the expression of atpC contributes to increased nitrogen fixation activity in the subject bacteria.

[0091] In embodiments, the non-naturally occurring bacterium is aK. variicola with a constitutive K. variicola promoter operably linked to its endogenous atpC gene. Exemplary suitable promoters that can be operably linked to the endogenous atpC gene are shown in Table 1 (SEQ ID NOs: l-5) provided herein.

[0092] In embodiments, the non-naturally occurring bacterium includes a modification wherein the endogenous atpC gene is operably linked to a heterologous promoter that increases the expression of atpC. Any suitable heterologous promoter that increases expression of atpC can be used. In particular embodiments, the non-naturally occurring bacterium includes a modification where the endogenous atpC promoter or a portion thereof is replaced with a heterologous promoter that enhances expression of atpC. In embodiments, the heterologous promoter is a promoter derived from the same species as the non-naturally occurring bacteria. For example, in embodiments wherein the bacterium is K. variicola, the endogenous atpC gene is operably linked to a K. variicola derived promoter. In other embodiments, the endogenous atpC gene is operably linked to a heterologous promoter derived from a different species as the non-naturally occurring bacterium. In embodiments, the heterologous promoter is a constitutive promoter.

[0093] In embodiments, the non-naturally occurring bacterium includes an endogenous atpC gene operably linked to a PcspE120 promoter or a variant thereof. In embodiments, the non- naturally occurring bacterium includes an endogenous atpC gene operably linked to a PfrdA promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous atpC gene operably linked to a PompC l promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous atpC gene operably linked to a Psra promoter or a variant thereof. In embodiments, the non- naturally occurring bacterium includes an endogenous atpC gene operably linked to a PgapA200 promoter or a variant thereof.

[0094] In embodiments, the variant promoter has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with any of the promoters included in Table 1.

[0095] In embodiments, the non-naturally occurring bacteria is a modified K. variicola that includes a modification wherein the endogenous atpC gene is operably linked to the PfrdA promoter (Table 1. SEQ ID NO:2). In embodiments, a terminator sequence is included to eliminate expression of the native promoter(TCAAATAAAACAAAAGGCCCAGTCGAAAGACTGGGCCTTTTGTTTTTGTTATATC TGTTGTTT. SEQ ID NO:26). In embodiments, the endogenous atpC is operably linked to a variant of the PfrdA promoter that has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity’ with PfrdA (SEQ ID NO:2).Table 7

[0096] In embodiments, the non-naturally occurring bacteria exhibit at least about 5. 10. 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% more atpC transcription as compared to a control bacterium (e.g., a bacterium without the atpC modification or a wildtype counterpart bacterium).7. yhgF

[0097] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression oF hgF as compared to a control bacterium (e.g., a bacteriumwithout the modification). In embodiments, the non-naturally occurring bacteria provided herein include a modification that increases expression oiyhgF. Without being bound by any particular theory of operation, it is believed that a modification that increases the expression otyhgF contributes to increased nitrogen fixation activity and / or bacterial mass in the subject bacteria

[0098] In embodiments, the non-naturally occurring bacterium is a K. variicola with a constitutive K. variicola promoter operably linked to its endogenous yhgF gene. Exemplary7suitable promoters that can be operably linked to the endogenous yhgF gene are shown in Table 1 (SEQ ID NOs: 1-5) provided herein.

[0099] In embodiments, the non-naturally occurring bacterium includes a modification wherein the endogenous yhgF gene is operably linked to a heterologous promoter that increases the expression of yhgF. Any suitable heterologous promoter that increases expression yhgF can be used. In particular embodiments, the non-naturally occurring bacterium includes a modification where the endogenous yhgF promoter or a portion thereof is replaced with a heterologous promoter that enhances expression of yhgF. In embodiments, the heterologous promoter is a promoter derived from the same species as the non-naturally occurring bacteria. For example, in embodiments wherein the bacterium is K. variicola, the endogenous yhgF gene is operably linked to a k. variicola derived promoter. In other embodiments, the endogenous yhgF gene is operably linked to a heterologous promoter derived from a different species as the non-naturally occurring bacterium. In embodiments, the heterologous promoter is a constitutive promoter.

[0100] In embodiments, the non-naturally occurring bacterium includes an endogenous yhgF gene operably linked to a YcspE120 promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous yhgF gene operably linked to a VfrdA promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous yhgF gene operably linked to a VompC 1 promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous yhgF gene operably linked to a \Fra promoter or a variant thereof.In embodiments, the non-naturally occurring bacterium includes an endogenous yhgF gene operably linked to a PgapA200 promoter or a variant thereof.

[0101] In embodiments, the variant promoter has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with any of the promoters included in Table 1.

[0102] In embodiments, the non-naturally occurring bacteria is a modified K. variicola that includes a modification wherein the endogenous yhgF gene is operably linked to the VcspE120 promoter (Table 1, SEQ ID NO: 1). In embodiments, a terminator sequence is included to eliminate expression of the native promoter(TCAAATAAAACAAAAGGCCCAGTCGAAAGACTGGGCCTTTTGTTTTTGTTATATC TGTTGTTT. SEQ ID NO:26). In embodiments, the endogenous yhgF is operably linked to a variant of the PcspE120 promoter that has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with PcspE120 (SEQ ID NO: 1).Table 8

[0103] In embodiments, the non-naturally occurring bacteria exhibit at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70. 75, 80, 85, 90 or 95% more yhgF transcription as compared to a control bacterium (e.g., a bacterium without the yhgF modification or a wild-type counterpart bacterium).8. serB

[0104] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression of serB as compared to a control bacterium (e.g., a bacterium without the modification). In embodiments, the non-naturally occurring bacteria provided herein include a modification that increases expression of serB. The serB gene encodes for a phosphoserine phosphatase SerB. Without being bound by any particular theory of operation, it is believed that a modification that increases the expression of serB contributes to increased nitrogen fixation activity and / or bacterial mass in the subject bacteria.

[0105] In embodiments, the non-naturally occurring bacterium includes a modification wherein the endogenous serB gene is operably linked to a heterologous promoter that increases the expression of serB. Any suitable heterologous promoter thatincreases expression of serB can be used. In particular embodiments, the non-naturally occurring bacterium includes a modification where the endogenous serB promoter or a portion thereof is replaced with a heterologous promoter that enhances expression of serB. In embodiments, the heterologous promoter is a promoter derived from the same species as the non-naturally occurring bacteria. For example, in embodiments wherein the bacterium is K. variicola, the endogenous serB gene is operably linked to a K. variicola derived promoter. In other embodiments, the endogenous serB gene is operably linked to a heterologous promoter derived from a different species as the non-naturally occurring bacterium. In embodiments, the heterologous promoter is a constitutive promoter.

[0106] In embodiments, the non-naturally occurring bacterium includes an endogenous gene operably linked to apromoter or a variant thereof. Inembodiments, the non-naturally occurring bacterium includes an endogenous serB gene operably linked to a promoter or a variant thereof. In embodiments, the non-naturallyoccurring bacterium includes an endogenous serB gene operably linked to a VompC 1 promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous serB gene operably linked to apromoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous serB gene operably linked to &PgapA2()0 promoter or a variant thereof.

[0107] In embodiments, the variant promoter has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with any of the promoters included in Table 1.

[0108] In embodiments, the non-naturally occurring bacteria is a modified K. variicola that includes a modification wherein the endogenous serB gene is operably linked to the Vsra promoter (Table 1, SEQ ID NO:4). In embodiments, a terminator sequence is included to eliminate expression of the native promoter (TCAAATAAAACAAAAGGCCCAGTCGAAAGACTGGGCCTTTTGTTTTTGTTATATC TGTTGTTT, SEQ ID NO:26). In embodiments, the endogenous serB is operably linked to a variant of the Ysra promoter that has at least about 60, 65, 70. 75. 80, 85, 90, 95 or 99% sequence identity with Psra (SEQ ID NO: 4).Table 9

[0109] In embodiments, the non-naturally occurring bacteria exhibit at least about 5, 10. 15. 20, 25, 30, 35, 40, 45, 50, 55, 60, 65. 70. 75. 80. 85. 90 or 95% more serB transcription as compared to a control bacterium (e.g., a bacterium without the serB modification or a wild-ty pe counterpart bacterium).9. pykA

[0110] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression of pykA as compared to a control bacterium (e g., a bacterium without the modification). In embodiments, the non-naturally occurring bacteria provided herein include a modification that increases expression of pykA. The pykA gene encodes for a pyruvate kinase II PykA. Without being bound by any particular theory of operation, it is believed that a modification that decreases the expression of pykA contributes to increased nitrogen fixation activity and / or bacterial mass in the subject bacteria

[0111] In embodiments, the non-naturally occurring bacterium includes an endogenous pykA gene operably linked to a PcspE120 promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous pykA gene operably linked to a VfrdA promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous pykA gene operably linked to a YompC l promoter or a variant thereof. In embodiments, the non-naturally occurring bacteriumincludes an endogenous pykA gene operably linked to a Psra promoter or a variant thereof. In embodiments, the non-naturally occurring bacterium includes an endogenous pykA gene operably linked to aPgapA200 promoter or a variant thereof.

[0112] In embodiments, the variant promoter has at least about 60, 65, 70, 75, 80, 85, 90. 95 or 99% sequence identity with any of the promoters included in Table 1.

[0113] In embodiments, the non-naturally occurring bacteria is a modified K. variicola that includes a modification wherein the endogenous glnL gene is operably linked to the PgapA200 promoter (Table 1, SEQ ID NO:5). In embodiments, a terminator sequence is included to eliminate expression of the native promoter (TCAAATAAAACAAAAGGCCCAGTCGAAAGACTGGGCCTTTTGTTTTTGTTATATC TGTTGTTT, SEQ ID NO:26). In embodiments, the endogenous pykA is operably linked to a variant of the PgapA200 promoter that has at least about 60, 65, 70, 75, 80, 85, 90, 95 or 99% sequence identity with PgapA200 (SEQ ID NO:5).Table 10

[0114] In embodiments, the non-naturally occurring bacteria exhibit at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% more pykA transcription as compared to a control bacterium (e.g., a bacterium without the pykA modification or a wild-type counterpart bacterium).10. nasA

[0115] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression of nasA as compared to a control bacterium (e g., a bacterium without the modification). In embodiments, the non-naturally occurring bacteria provided herein include a modification that decreases expression of nasA. The nasA gene encodes for a nitrate reductase. Without being bound by any particular theory of operation, it is believed that a modification that decreases the expression of nasA contributes to increased nitrogen fixation activity and / or bacterial mass in the subject bacteria

[0116] In embodiments, the non-naturally occurring bacteria include a modification of an endogenous nasA gene, wherein at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% of the endogenous nasA gene is deleted. In embodiments, the non-naturally occurring bacterium exhibits at least about 5, 10, 15, 20, 25, 30, 35, 40, 45,50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% less nasA transcription as compared to a control bacterium (e.g., a bacterium without the nasA modification or a wild-ty pe counterpart bacterium).

[0117] In embodiments, the non-naturally occurring bacteria include a knockout mutation of the endogenous nasA as shown in Table 11 below.Table 11i i-

[0118] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression oi as compared to a control bacterium (e.g.. a bacteriumwithout the modification). In embodiments, the non-naturally occurring bacteria provided herein include a modification that decreases expression oiy Vne gene encodes for aglycosyl transferase. Without being bound by any particular theory' of operation, it is believed that a modification that decreases the expression trtyjjG contributes to increased nitrogen fixation activity and / or bacterial mass in the subject bacteria

[0119] In embodiments, the non-naturally occurring bacteria include a modification of an endogenous yjjG gene, wherein at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% of the endogenous gene is deleted. In embodiments,the non-naturally occurring bacterium exhibits at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50. 55, 60, 65, 70, 75, 80, 85, 90 or 95% less yjjG transcription as compared to a control bacterium (e.g., a bacterium without the nasA modification or a wild-type counterpart bacterium).

[0120] In embodiments, the non-naturally occurring bacteria include a knockout mutation of the endogenous yjjG as shown in Table 12 below.Table 1212. purU

[0121] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression of purU as compared to a control bacterium (e.g., a bacterium without the modification). In embodiments, the non-naturally occurring bacteria provided herein include a modification that decreases expression of purU. The purU gene encodes for a formyltetrahydrofolate deformyl ase. Without being bound by any particular theory of operation, it is believed that a modification that decreases the expression of purU contributes to increased nitrogen fixation activity and / or bacterial mass in the subject bacteria

[0122] In embodiments, the non-naturally occurring bacteria include a modification of an endogenous purU gene, wherein at least about 5, 10, 15, 20, 25. 30. 35. 40. 45. 50. 55, 60, 65, 70, 75, 80, 85, 90 or 95% of the endogenous purU gene is deleted. In embodiments, the non-naturally occurring bacterium exhibits at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% less purU transcription as compared to a control bacterium (e.g., a bacterium without the nasA modification or a wild-type counterpart bacterium).

[0123] In embodiments, the non-naturally occurring bacteria include a knockout mutation of the endogenous purU as shown in Table 13 below.Table 1313. tauR

[0124] In embodiments, the non-naturally occurring bacteria include a modification that modifies the expression of tauR as compared to a control bacterium (e.g., a bacterium without the modification). In embodiments, the non-naturally occurring bacteria provided herein include a modification that decreases expression of tauR. The tauR gene encodes for the Taurine transcriptional regulator. Without being bound by any particular theory of operation, it is believed that a modification that decreases the expression of tauR contributes to increased nitrogen fixation activity7and / or bacterial mass in the subject bacteria

[0125] In embodiments, the non-naturally occurring bacteria include a modification of an endogenous tauR gene, wherein at least about 5. 10. 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% of the endogenous tauR gene is deleted. In embodiments, the non-naturally occurring bacterium exhibits at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% less tauR transcription as compared to a control bacterium (e.g., a bacterium without the nasA modification or a wild-type counterpart bacterium).

[0126] In embodiments, the non-naturally occurring bacteria include a knockout mutation of the endogenous tauR as show n in Table 14 below-.Table 14B. Additional modifications

[0127] In embodiments, the subject non-naturally occurring bacteria provided herein include one or more additional modifications that enhance nitrogen fixation. In embodiments, the additional modifications is a.nifLA operation modification, aglnE modification, and / or a glnD modification, as described below. In embodiments, the non- naturally occurring bacterium includes 1, 2, 3. or 4 of these additional modifications.Promoters useful with such modifications are depicted in Table 15.Table 151. nifLA operon modification

[0128] In embodiments, the non-naturally occurring bacterium provided herein further includes a modification that increases the expression of nifA and / or decreases the expression of nifL. In Proteobacteria, NifA and NifL are encoded by nifA and nifL of the nifLA operon, respectively. NifA activates the transcription of nitrogen fixation (nil) genes that encode the nitrogenase complex for nitrogen fixation. Intracellular levels of active NifA are controlled by two key factors: transcription of the nifLA operon, and inhibition of NifA activity by protein-protein interaction with NifL. Both of these processes are responsive to intracellular nitrogen levels via the PII protein signaling cascade. Thus, without being bound by any particular theory of operation, it is believed that a modification that increases the expression of nifA and / or decreases the expression of nifL contributes to increased expression of nif genes and nitrogen fixation activity in the subject bacteria.

[0129] In embodiments, the non-naturally occurring bacterium includes a modification in the nifLA operon wherein the endogenous nifA gene is operably linked to a constitutive promoter. In such embodiments, nifA expression is no longer regulated by intracellular nitrogen levels and nifA is expressed even under conditions where intracellular fixed-nitrogen levels are high. Any suitable promoter which increases expression of nifA can be used. In embodiments, the promoter is a promoter derived from the same species as the non-naturally occurring bacteria. For example, in embodiments wherein the bacteria is K. variicola, the endogenous nifA gene is operably linked to a K. variicola derived promoter. In other embodiments, the endogenous nifA gene is operably linked to a heterologous promoter.

[0130] In embodiments, the non-naturally occurring bacterium is a A" variicola with a constitutive K. variicola promoter operably linked to its endogenous nifA gene.

[0131] In embodiments, the subject bacterium includes a modification in the nifLA operon, wherein a constitutive promoter is operably linked to the nifA gene and is inserted in a region of the endogenous nifL gene in a manner that disrupts expression of nifL.

[0132] In embodiments the non-naturally occurring bacterium is a modified K. variicola that includes a modification, wherein an additional copy of the nifA gene is inserted into a neutral site in the host genome. In embodiments, the additional nifA gene is operably linked to a promoter.Table 16

[0133] In embodiments, the non-naturally occurring bacterium exhibits at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% more nifA transcription as compared to a control bacterium (e.g., a bacterium without the nifLA operon modification or a wild-type bacterium). In embodiments, the non-naturally occurring bacterium exhibits about 1-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70- 80%, 80-90%, 90-100%, 1-30%, 10-40%, 20-50%, 30-60%, 40-70%, 50-80%, 60-90%, or 70-100% more nifA transcription as compared to a control bacterium.

[0134] In embodiments, the non-naturally occurring bacterium exhibits at least about 99. 95. 90, 85, 80, 75, 70, 65, 60, 55, 50, 45. 40. 35. 30. 25. 20. 15. 10. 5. 4, 3, 2. 1% less nifL transcription as compared to a control bacterium (e.g., a bacterium without the nifLA operon modification or a wild-ty pe bacteria). In embodiments the non-naturally occurring bacterium exhibits about 1-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80- 90%. 90-100%, 1-30%, 10-40%. 20-50%, 30-60%, 40-70%, 50-80%. 60-90%, or 70-100% less nifL transcription as compared to a control bacterium. In embodiments, the non-naturally occurring bacterium does not exhibit any significant nifL transcription.2. glnE modification

[0135] In embodiments, the non-naturally occurring bacteria provided herein further express a modified GlnE that has reduced ability' to activate glutamine synthetase (GS). Decreasing the intracellular glutamine level prevents the cells from sensing high ammonium levels in the environment. The assimilation of fixed nitrogen by bacteria to glutamine by GSis reversibly regulated by the two-domain adenylyltransferase (ATase) enzyme GlnE through the adenylylation and deadenylylation of GS to attenuate and restore activity; respectively. Under conditions of nitrogen excess, GlnE's ATase domain is activated allosterically byglutamine, causing the adenylation and deactivation of GS. Therefore, truncation of the GlnE protein to delete its adenylyl-removing (AR) domain leads to constitutively adenylylated glutamine synthetase, limiting ammonia assimilation by the microbe and increasing intra- and extracellular ammonia.

[0136] In embodiments, the non-naturally occurring bacteria express a modified GlnE that has reduced ability- to activate glutamine synthetase (GS). In embodiments, the mutant glnE encodes for a variant GlnE with a portion or all of the adenylyl-removing (AR) domain deleted. In embodiments, the mutant glnE is encoded by the nucleic acid sequuece of SEQ ID NO:24, as shown in Table 17. In embodiments the non-naturally occurring bacterium is a modified K. variicola.Table 173. glnD modifications

[0137] In embodiments, the non-naturally occurring bacteria provided herein further express a modified GlnD. GlnD is a bifunctional uridylyltransferase / uridylyl-removing enzyme that acts as the central "switch ’ for nitrogen sensing in the cell. It contains three distinct domains: the UTase domain, which uridylylates the PII proteins GlnB and GlnK; the uridylyl-removing (UR) domain, also known as the HD domain, which remove the uridylyl group from the PII proteins; and two ACT domains, w hich regulate the activity of the other two domains in response to glutamine binding. In embodiments, the endogenous glnD is replaced with a mutant glnD that encodes for a variant GlnD with reduced uridylyltransferase activity7.

[0138] In embodiments, the modified bacterium exhibits less than about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85. 90 or 95% of the uridylyltransferase activity as compared to a control bacterium (e.g., a bacterium without the mutant glnD or a wild-type counterpart bacteria). In embodiments, the modified bacterium expresses less than about 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 5, 4, 3, 2, 1% of wild-typeglnD as compared to a control bacterium. In embodiments the modified bacterium is a modified K. vciriicola.

[0139] In embodiments, the modified bacterium includes a mutation that deactivates the GlnD uridylyltransferase domain. In such modified bacterium, GlnD has reduced ability to signal nitrogen starvation, regardless of nitrogen levels. In embodiments, the endogenous glnD is replaced with a mutant allele, wherein the mutant glnD encodes a GlnD with a portion or all of the uridylyltransferase domain deleted. In embodiments, the endogenous glnD is replaced with a mutant glnD that encodes for a variant GlnD with reduced uridylyltransferase activity. In embodiments, the modified bacterium exhibits less than about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% of the uridylyltransferase activity' as compared to a control bacterium (e.g., a bacterium without the mutant glnD or a wild-type counterpart bacteria). In embodiments, the modified bacterium expresses less than about 95. 90. 85. 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15. 10. 5, 4, 3, 2, 1% of wild-type glnD as compared to a control bacterium. In embodiments the modified bacterium is a modified K. variicola.

[0140] In embodiments, the modified bacterium includes a mutation that deactivates the GlnD uridylyltransferase domain. In such modified bacterium, GlnD has reduced ability to signal nitrogen starvation, regardless of nitrogen levels. In embodiments, the endogenous glnD is replaced with a mutant allele, wherein the mutant glnD encodes a GlnD with a portion or all of the uridylyltransferase domain deleted.Table 18C. Exemplary7non-naturally occurring bacterium

[0141] In embodiments, the non-naturally occurring bacteria provided herein includes a modification, wherein a constitutive promoter in Table 1 is operably linked to one of the following genes: nifKl, mdh, glnL, hypA. yciV, atpC, yhgF. serB, and pykA. In embodiments, the non-naturally occurring bacterium includes a partial or complete deletion of an endogenous nasA, yjjG, purU, and tauR gene.

[0142] In embodiments, the non-naturally occurring bacterium comprises: a) a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; b) a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; and 3) an endogenous nifKl gene operably linked to a second heterologous promoter. In embodiments, the first promoter has the sequence of SEQ ID NO:21 or a variant thereof, and the second heterologous promoter has the sequence of SEQ ID NO:4 or a variant thereof.

[0143] In embodiments, the non-naturally occurring bacterium comprises: a) a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; b) a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; c) a disruption of an endogenous nasA gene; d) an endogenous mdh gene operably linked to a second heterologous promoter; e) an endogenous glnL gene operably linked to a thirdheterologous promoter; f) an endogenous hypA gene operably linked to a fourth heterologous promoter; and g) a mutant glnE allele encoding a variant GlnE with reduced glutamine synthetase activation as compared to a control wild-type bacterium. In embodiments, the first heterologous promoter has the sequence of SEQ ID NO:20 or a variant thereof. In embodiments, the second heterologous promoter has the sequence of SEQ ID NO:2 or a variant thereof. In embodiments, the third heterologous promoter has the sequence of SEQ ID NO:4 or a variant thereof, and wherein the fourth heterologous promoter has the sequence of SEQ ID NO: 3 or a variant thereof.

[0144] In embodiments, the non-naturally occurring bacterium comprises: a) a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; b) a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; c) a disruption of an endogenous purU gene; and d) a disruption of an endogenous yJjG gene. In embodiments, the first heterologous promoter has the sequence of SEQ ID NO:21 or a variant thereof.

[0145] In embodiments, the non-naturally occurring bacterium comprises: a) a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; b) a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; and c) an endogenous yci Egene operably linked to a second heterologous promoter. In embodiments, the first promoter has the sequence of SEQ ID NO:21 or a variant thereof. In embodiments, the second heterologous promoter has the sequence of SEQ ID NO:2 or a variant thereof.

[0146] In embodiments, the non-naturally occurring bacterium comprises: a) a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; b) a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; and c) an endogenous atpC gene operably linked to a second heterologous promoter. Inembodiments, the first promoter has the sequence of SEQ ID NO:21 or a variant thereof. In embodiments, the second heterologous promoter has the sequence of SEQ ID NO:2 or a variant thereof.

[0147] In embodiments, the non-naturally occurring bacterium comprises: a) a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; b) a mutant glnD allele encoding a variant GlnD with reduced UTase activity7as compared to a wild-ty pe bacterium; and c) an endogenous yhgF gene operably linked to a second heterologous promoter. In embodiments, the first promoter has the sequence of SEQ ID NO:21 or a variant thereof. In embodiments, the second heterologous promoter has the sequence of SEQ ID NO: 1 or a variant thereof.

[0148] In embodiments, the non-naturally occurring bacterium comprises: a) a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; b) a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; c) an additional copy of a nifA gene inserted in a neutral site of the bacterium; d) an endogenous hypA gene operably linked to a second heterologous promoter; and e) a disruption of an endogenous tauR gene. In embodiments, the first promoter has the sequence of SEQ ID NO: 21 or a variant thereof. In embodiments, the second heterologous promoter has the sequence of SEQ ID NO: 3 or a variant thereof.

[0149] In embodiments, the non-naturally occurring bacterium comprises: a) a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; b) a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; c) an endogenous pykA gene operably linked to a second heterologous promoter; and d) an endogenous serB gene operably linked to a third heterologous promoter. In embodiments, the first promoter has the sequence of SEQ ID NO:21 or a variant thereof, the second heterologous promoter has the sequence of SEQ ID NO: 5 or a variant thereof. In nembodiments, the third heterologous promoter has the sequence of SEQ ID NO:4 or a variant thereof.

[0150] Each of the following embodiments are contemplated herein:

[0151] 1. A non-naturally occurring bacterium, wherein the non-naturally occurring bacterium exhibits increased expression of one or more of the following genes as compared to a wild-type bacterium: nifKl, mdh, glnL, hypA, yciV, atpC, yhgF, serB, and pykA; and / or decreased expression of one or more of the following genes as compared to a wild-type bacterium: nasA, yjjG, purU, and tauR.

[0152] 2. The non-naturally occurring bacterium of embodiment 1, wherein the bacterium comprises one or more of the following modifications: an endogenous nifKl, mdh, glnL, hypA, yciV, atpC, yhgF, serB, or pykA gene operably linked to a heterologous promoter; and a disruption of an endogenous nasA, yjjG, purU, or tauR gene.

[0153] 3. The non-naturally occurring bacterium of embodiment 2, wherein the heterologous promoter is derived from the same species as the non-naturally occurring bacterium.

[0154] 4. The non-naturally occurring bacterium of embodiment 3, wherein the heterologous promoter is selected from any of the promoters in Table 1 or a variant thereof.

[0155] 5. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises an endogenous nifKl operably linked to a heterologous constitutive promoter.

[0156] 6. The non-naturally occurring bacterium of embodiment 5, wherein the heterologous constitutive promoter has the sequence of SEQ ID NO:4 or a variant thereof.

[0157] 7. The non-naturally occurring bacterium of embodiment 5 or 6, wherein the bacterium exhibits at least about 10% more expression of NifKl as compared to a wild-type bacterium.

[0158] 8. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises an endogenous hypA operably linked to a heterologous constitutive promoter.

[0159] 9. The non-naturally occurring bacterium of embodiment 8, wherein the heterologous constitutive promoter has the sequence of SEQ ID NO:3 or a variant thereof.

[0160] 10. The non-naturally occurring bacterium of embodiment 8 or 9, wherein the bacterium exhibits at least about 10% more expression of HypA as compared to a wild-type bacterium.

[0161] 11. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises an endogenous mdh operably linked to a heterologous constitutive promoter.

[0162] 12. The non-naturally occurring bacterium of embodiment 11, wherein the heterologous constitutive promoter has the sequence of SEQ ID NO:2 or a variant thereof.

[0163] 13. The non-naturally occurring bacterium of embodiment 11 or 12, wherein the bacterium exhibits at least about 10% more expression of Mdh as compared to a wildtype bacterium.

[0164] 14. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises an endogenous glnL operably linked to a heterologous constitutive promoter.

[0165] 15. The non-naturally occurring bacterium of embodiment 14, wherein the heterologous constitutive promoter has the sequence of SEQ ID NO:4 or a variant thereof.

[0166] 16. The non-naturally occurring bacterium of embodiment 14 or 15. wherein the bacterium exhibits at least about 10% more expression of GlnL as compared to a wildtype bacterium.

[0167] 17. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises an endogenous y ci V operably linked to a heterologous constitutive promoter.

[0168] 18. The non-naturally occurring bacterium of embodiment 17. wherein the heterologous constitutive promoter has the sequence of SEQ ID NO:2 or a variant thereof.

[0169] 19. The non-naturally occurring bacterium of embodiment 17 or 18, wherein the bacterium exhibits at least about 10% more expression of YciV as compared to a wildtype bacterium.

[0170] 20. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises an endogenous atpC operably linked to a heterologous constitutive promoter.

[0171] 21. The non-naturally occurring bacterium of embodiment 20, wherein the heterologous constitutive promoter has the sequence of SEQ ID NO:2 or a variant thereof.

[0172] 22. The non-naturally occurring bacterium of embodiment 20 or 21, wherein the bacterium exhibits at least about 10% more expression of AtpC as compared to a wildtype bacterium.

[0173] 23. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises an endogenous yhgF operably linked to a heterologous constitutive promoter.

[0174] 24. The non-naturally occurring bacterium of embodiment 23, wherein the heterologous constitutive promoter has the sequence of SEQ ID NO: 1 or a variant thereof.

[0175] 25. The non-naturally occurring bacterium of embodiment 23 or 24. wherein the bacterium exhibits at least about 10% more expression of YhgF as compared to a wildtype bacterium.

[0176] 26. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises an endogenous serB operably linked to a heterologous constitutive promoter.

[0177] 27. The non-naturally occurring bacterium of embodiment 26. wherein the heterologous constitutive promoter has the sequence of SEQ ID NO:4 or a variant thereof.

[0178] 28. The non-naturally occurring bacterium of embodiment 26 or 27, wherein the bacterium exhibits at least about 10% more expression of SerB as compared to a wildtype bacterium.

[0179] 29. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises an endogenous pykA operably linked to a heterologous constitutive promoter.

[0180] 30. The non-naturally occurring bacterium of embodiment 29, wherein the heterologous constitutive promoter has the sequence of SEQ ID NO:5 or a variant thereof.

[0181] 31. The non-naturally occurring bacterium of embodiment 29 or 30, wherein the bacterium exhibits at least about 10% more expression of PykA as compared to a wildtype bacterium.

[0182] 32. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises a disruption of an endogenous nasA gene.

[0183] 33. The non-naturally occurring bacterium of embodiment 32, wherein the bacterium exhibits at least about 10% less NasA expression as compared to a wild-type bacterium.

[0184] 34. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises a disruption of an endogenous yjjG gene.

[0185] 35. The non-naturally occurring bacterium of embodiment 34, wherein the bacterium exhibits at least about 10% less YjjG expression as compared to a wild-type bacterium.

[0186] 36. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises a disruption of an endogenous purU gene.

[0187] 37. The non-naturally occurring bacterium of embodiment 36, wherein the bacterium exhibits at least about 10% less PurU expression as compared to a wild-type bacterium.

[0188] 38. The non-naturally occurring bacterium of embodiment 2, wherein the bacterium comprises a disruption of an endogenous tauR gene.

[0189] 39. The non-naturally occurring bacterium of embodiment 38, wherein the bacterium exhibits at least about 10% less TauR expression as compared to a wild-type bacterium.

[0190] 40. The non-naturally occurring bacterium of any one of embodiments 1 to 39, wherein the bacterium is a modified bacterium from the Klebsiella genus, optionally selected from K. variicola, K. oxytoca, and K. pneumoniae.

[0191] 41. The non-naturally occurring bacterium of any one of embodiments 1-40, wherein the non-naturally occurring bacterium further comprises one or more of the following additional modifications: a modified mfLA operon comprising an endogenous nifA gene operably linked to a heterologous promoter and a disrupted endogenous nifL gene; a mutant glnE allele encoding a variant GlnE with reduced glutamine synthetase activation as compared to a wild-type bacterium; a mutant glnD allele encoding a variant GlnD with reduced uridylyltransferase (UTase) activity as compared to a wild-type bacterium: and an additional copy of a nifA gene inserted in a neutral site of the bacterium.

[0192] 42. The non-naturally occurring bacterium of embodiment 41, wherein the bacterium comprises a modified nifLA operon comprising an endogenous nifA gene operably linked to a heterologous promoter and a disrupted endogenous nifL gene.

[0193] 43. The non-naturally occurring bacterium of embodiment 42. wherein the bacterium comprises an additional copy of a nifA gene inserted in a neutral site of the bacterium.

[0194] 44. The non-naturally occurring bacterium of embodiment 42 or 43, wherein the bacterium exhibits at least about 10% more expression of NifA as compared to a wildtype bacterium.

[0195] 45. The non-naturally occurring bacterium of embodiment 41. wherein the bacterium comprises a mutant glnE allele encoding a variant GlnE with reduced glutamine synthetase activation as compared to a wild-tj pe bacterium.

[0196] 46. The non-naturally occurring bacterium of embodiment 45, wherein the mutant glnE allele has the sequence of SEQ ID NO:24 or a variant thereof.

[0197] 47. The non-naturally occurring bacterium of embodiment 41, wherein the bacterium comprises a glnD allele encoding a variant GlnD with reduced UTase as compared to a wild-type bacterium.

[0198] 48. A non-naturally occurring bacterium comprising: a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene: a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; and an endogenous nifKl gene operably linked to a second heterologous promoter.

[0199] 49. The non-naturally occurring bacterium of embodiment 48, wherein the first promoter has the sequence of SEQ ID NO:21 or a variant thereof, and the second heterologous promoter has the sequence of SEQ ID NO:4 or a variant thereof.

[0200] 50. A non-naturally occurring bacterium comprising: a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene: a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; a disruption of an endogenous nasA gene; an endogenous mdh gene operably linked to a second heterologous promoter; an endogenous glnL gene operably linked to a third heterologous promoter; an endogenous hypA gene operably linked to a fourth heterologous promoter: and a mutant glnE alleleencoding a variant GlnE with reduced glutamine synthetase activation as compared to a control wild-ty pe bacterium.

[0201] 51. The non-naturally occurring bacterium of embodiment 50, wherein the first heterologous promoter has the sequence of SEQ ID NO:20 or a variant thereof, wherein the second heterologous promoter has the sequence of SEQ ID NO:2 or a variant thereof, wherein the third heterologous promoter has the sequence of SEQ ID NO:4 or a variant thereof, and wherein the fourth heterologous promoter has the sequence of SEQ ID NO:3 or a variant thereof.

[0202] 52. A non-naturally occurring bacterium comprising : a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-ty pe bacterium; a disruption of an endogenous purU gene; and a disruption of an endogenous yjjG gene.

[0203] 53. The non-naturally occurring bacterium of embodiment 52. wherein the first heterologous promoter has the sequence of SEQ ID NO:21 or a variant thereof.

[0204] 54. A non-naturally occurring bacterium comprising : a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; an endogenous yciV gene operably linked to a second heterologous promoter.

[0205] 55. The non-naturally occurring bacterium of embodiment 54, wherein the first promoter has the sequence of SEQ ID NO:21 or a variant thereof, and the second heterologous promoter has the sequence of SEQ ID NO:2 or a variant thereof.

[0206] 56. A non-naturally occurring bacterium comprising: a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; a mutant glnD allele encoding a variant GlnD with reducedUTase activity as compared to a wild-type bacterium; an endogenous atpC gene operably linked to a second heterologous promoter.

[0207] 57. The non-naturally occurring bacterium of embodiment 56, wherein the first promoter has the sequence of SEQ ID NO:21 or a variant thereof, and the second heterologous promoter has the sequence of SEQ ID NO:2 or a variant thereof.

[0208] 58. A non-naturally occurring bacterium comprising: a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; an endogenous yhgF gene operably linked to a second heterologous promoter.

[0209] 59. The non-naturally occurring bacterium of embodiment 58, wherein the first promoter has the sequence of SEQ ID NO:21 or a variant thereof, and the second heterologous promoter has the sequence of SEQ ID NO: 1 or a variant thereof.

[0210] 60. A non-naturally occurring bacterium comprising: a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; an additional copy of a nifA gene inserted in a neutral site of the bacterium;an endogenous hypA gene operably linked to a second heterologous promoter; and a disruption of an endogenous tauR gene.

[0211] 61. The non-naturally occurring bacterium of embodiment 60, wherein the first promoter has the sequence of SEQ ID NO: 21 or a variant thereof, and the second heterologous promoter has the sequence of SEQ ID NO: 3 or a variant thereof.

[0212] 62. A non-naturally occurring bacterium comprising: a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene: a mutant glnD allele encoding a variant GlnD with reduced UTase activity as compared to a wild-type bacterium; an endogenous pykA gene operablylinked to a second heterologous promoter; and an endogenous serB gene operably linked to a third heterologous promoter.

[0213] 63. The non-naturally occurring bacterium of embodiment 62, wherein the first promoter has the sequence of SEQ ID NO:21 or a variant thereof, the second heterologous promoter has the sequence of SEQ ID NO: 5 or a variant thereof, and the third heterologous promoter has the sequence of SEQ ID NO:4 or a variant thereof.

[0214] 64. The non-naturally occurring bacterium of any one of embodiments 1-63, wherein the non-naturally occurring bacterium exhibits at least about 10% greater ammonia production as compared to a wild-type bacterium.

[0215] 65. The non-naturally occurring bacterium of embodiment 65. wherein the non-naturally occurring bacterium is capable of excreting the produced ammonia.

[0216] 66. The non-naturally occurring bacterium of any one of embodiments 1-65, wherein the non-naturally occurring bacterium is capable of enhanced nitrogen fixation under excess nitrogen conditions.

[0217] 67. The non-naturally occurring bacterium of any one of embodiments 1-65, wherein the non-naturally occurring bacterium is capable of enhanced nitrogen fixation under hypoxic or anaerobic conditions.

[0218] 68. The non-naturally occurring bacterium of any one of embodiments 1-67, wherein the non-naturally occurring bacterium exhibits increased cellular biomass as compared to a wild-type bacterium.

[0219] 69. The non-naturally occurring bacterium of any one of embodiments 1-68, wherein the non-naturally occurring bacterium exhibits enhanced transcription of one or more nif genes as compared to a control wild-type bacterium.

[0220] 70. The non-naturally occurring bacterium of embodiment 69, wherein the one or more nif genes is selected from nifj, nifH, nifD, nifT, nifY, nifE, nifN, nifX, nifU, ni£S, nifV, nifW, nifZ, nifM. nifF, nifB, and nifQ.

[0221] 71. A method of increasing nitrogen fixation in a plant comprising exposing the plant to the non-naturally occurring bacterium of any one of embodiments 1-70.

[0222] 72. A method of producing a non-naturally occurring bacterial host cell capable of enhanced nitrogen activity comprising: introducing a vector into a host cell, the vector comprising: a constitutive promoter having the sequence of any one of SEQ ID NOs: 1- 5 or a variant thereof; and a first homologous recombination site and a second homologous recombination site, wherein the first and second homologous recombination sites flank the constitutive promoter and allows for integration of the constitutive promoter into the host cell genome; modifying the host cell by culturing the host cell under conditions that facilitate the integration of the vector into the host cell genome; and selecting and isolating the modified host cell.

[0223] 73. The method of embodiment 72, wherein the modified host cell comprises the constitutive promoter operably linked to one of the following endogenous genes in the modified host cell: nifKl, mdh, glnL, hypA. yciV. atpC, yhgF, serB, and pykA

[0224] 74. A method of producing a non-naturally occurring bacterial host cell capable of enhanced nitrogen activity comprising: modify ing the host cell to disrupt an endogenous nasA, yjjG, purU, and tauR gene; and selecting and isolating the modified host cell.

[0225] 75. The method of embodiment 73 or 74, wherein the non-naturally occurring bacterium is a modified bacterium from the Klebsiella genus, optionally selected from K. variicola, K. oxytoca, and K. pneumoniae.EXAMPLES

[0226] Examples are provided below to illustrate the present invention. These examples are not meant to constrain the present invention to any particular application or theory of operation.Modified K. variicola with enhanced nitrogen fixation activity.

[0227] Modified K. variicola was designed for improved enhanced nitrogen fixation activity. The non-naturally occurring bacteria were designed to include one or a combination of the following modifications below. Genes targeted for modification were selected based on rational design or edits from flux balance analysis computational model, wherein the edits were designed to improve a process in the non-naturally occurring bacteria.• Replacement of the nifKl promoter with a constitutive promoter (P.sro) for constitutive expression of nifKl\• Replacement of the mdh promoter with a constitutive promoter (PfrdA) for constitutive expression of mdh:• Replacement of the glnL promoter with a constitutive promoter (Psra) for constitutive expression of glnL,'• Replacement of the hypA promoter with a constitutive promoter (PompCl) for constitutive expression of hypA,• Replacement of the yci V promoter with a constitutive promoter (P / r<£4) for constitutive expression of yciV;• Replacement of the atpC promoter with a constitutive promoter (PfrdA) for constitutive expression of atpCg• Replacement of the yhgF promoter with a constitutive promoter (PcspE120) for constitutive expression ofyhgF,• Replacement of the serB promoter with a constitutive promoter (Psra) for constitutive expression of serB.,• Replacement of the pykA promoter with a constitutive promoter (PgapA200) for constitutive expression of pykA,'• Knockout deletion of nasA:Knockout deletion of yjjG\• Knockout deletion of purlf and• Knockout deletion of tauR.

[0228] Additional modifications included in some of the non-naturally occurring bacteria are shown below.• An insertion of a constitutive promoter into the endogenous nifL gene, wherein the promoter is operably linked to nifA. This mutation deletes endogenous nifL and causes constitutive expression of nifA\• A mutation in glnD that deletes the GlnD uridyly -transferase domain, thereby inhibiting GlnD from signaling nitrogen starvation regardless of the nitrogen level;• A set of point mutations that deactivates the uridyly -transferase domain of glnD that inhibits it from signaling nitrogen starvation regardless of the nitrogen level;• A mutation in glnE that causes reduced GlnE glutamine synthetase activation as compared to a control wild-type bacterium; and• An insertion of an extra copy of the nifA gene into a neutral site to increase its expression. This nifA was inserted with the constitutive promoter VcspE400 promoter.A. Materials and Methods1. Bacterial strains

[0229] To make the modified K. variicola the following bacterial strains were used:• K. variicola CI-137: gram negative strain, nitrogen fixer, non-motile. Isolated from a soil sample in Missouri.• One Shot™ PIR2 Chemically Competent E. coli (Thermo Fisher Scientific): cloning strain with the pir machinery.E. coli S 17: donor strain used to move the suicide plasmid to the host strain. See Thoma & Schobert FEMS Microbiol Lett. 294(2): 127-32 (2009).2. Assessment of promoter expression levels

[0230] Candidate K. variicola promoters were constitutive expression of target genes described above (sequence of promoters summarized in Table 1). In order to assess the expression levels of the candidate promoters, each promoter was cloned upstream of GFP- dasher (Atum) in a replicative plasmid using KLD (NEB Inc.) These plasmids were transformed into the host strain CI-137. After growth in main media for 72h at 0% oxygen in media as described below (seed train growth). GFP expression was measured using a Spark spectrophotometer (Tecan). Data was analyzed using JMP.3. Assessment of terminator activity

[0231] In order to assess the activity of the candidate terminator, the candidate termination and a control were cloned between GFP-dasher (Atum) and RFP-paprike (Atum) in a replicative plasmid using KLD (NEB Inc.). These plasmids were transformed into the host strain CI-137. After growth in main media for 72h at 0% oxygen in media as described below (seed train growth). GFP and RFP expression was measured using a Spark spectrophotometer (Tecan). Data was analyzed using JMP.4. DNA build

[0232] All genomic edits were performed using pPRD108, a suicide plasmid that contains a kanamycin resistance for positive selection and sacB for counterselection when grown in the presence of sucrose. pPRD108 also includes an R6K that requires the presence of the pir machinery to replicate. As the host K. variicola CI- 137 strain lacks the pir machinery, the only way to incorporate the plasmids is via integration in the host genome.

[0233] To produce the specific plasmids for the mutations described above, 1000 bp homology7arms of the upstream and dow nstream sequence for each genomic position were amplified by PCR using Q5 (New England Biolabs) and cloned into pPRD108 using HiFi assembly master mix (New England Biolabs). The presence of the corresponding homology arms in the plasmids was determined by Sanger sequencing.5. Strain build

[0234] The suicide plasmids were inserted into the donor strains by chemical transformation. The plasmids were integrated into the host genome by biparental conjugation on LB media. After 16h at 30°C, the mating area was plated in LB Km Carb, which allows for selection of K. varilcola that had undergone genome integration of pPRD108. Finally, the plasmids are forced to excise from the host genome by plating the integrated strain in counter selector media containing 10% sucrose. After counterselection, individual colonies were tested for Km resistance to eliminate cheaters and the presence of the edit was analyzed by DNA sequencing.6. Phenotype testing

[0235] Ammonia production was assessed for non-naturally occurring bacterial strains of interest according to the protocol below.7. Seed train growth

[0236] For testing, strains were grown using a seed train with the aim of having their growth normalized. The scheme of the seed train can be seen in Figure 6. Overall, strains are grown in 96 well plates (round w ells, 1.1 mb volume) containing 245 pL of SOB media. For each strain. 6 biological replicates were grown. The plates were incubated for 18h at 30°C at 1,000 rpm. Then 10 pL were transferred to a new plate containing 240 pL of BNP 1. 1 media(2 g / L Potassium Phosphate dibasic, 1 g / L Potassium Phosphate monobasic, 25 g / L Sodium Phosphate Dibasic, 0.1% Glycerol, 3.5 g / L Sucrose, 1.5 g / L L-Arabinose, 1.5 g / L D-Xylose, 2 g / L D-Glucose, 2 g / L D-Mannose, 2 g / L D-Fructose, 2 g / L D-Galactose, 3.5 g / L D- Trehalose, 5 g / L D-Raffinose, 0.5 g / L Fumaric Acid, 0.75 g / L D,L-Malic acid, 0.5 g / L Pyruvic, 1 g / L t-Aconitic acid, 1 .46 g / L L-Glutamine, 1 .7 g / L YNB without amino acids or Ammonium Sulfate mix, 0.005 g / L Iron Sulfate Heptahydrate, 0.0025 g / L Sodium Molybdate Dihydrate, pH 7.5 ). The plate was incubated as described before. Finally, 25 pL from each well of this plate was transferred into two new plates with 225 uL of BNI2.04 (2 g / L Potassium Phosphate dibasic, 1 g / L Potassium Phosphate monobasic, 5.12 g / L L-Arabinose, 5.12 g / L D-Xylose, 20.4 g / L D-Glucose, 10.22 g / L D-Fructose, 5.12 g / L D-Galactose, 0.486 g / L Acetic acid, 3.4 g / L Citric acid, 0.116 g / L Formic acid, 0.4 g / L t-Aconitic acid, 0.228 g / L Lactic acid, 0. 112 g / L Butyric acid, 0. 112 g / L Ascorbic acid, 0. 124 g / L Gluconic acid, 52.31 g / L Bis-Tris. 1.7 g / L YNB without amino acids or Ammonium Sulfate mix. 0.005 g / L Iron Sulfate Heptahydrate, 0.0025 g / L Sodium Molybdate Dihydrate, 0.506 g / L Sodium Nitrate, 0.267 g / L Ammonium Chloride, pH 6.25) with only 5 mM of ammonia. Plates were incubated in controlled atmosphere chambers with either 0% or 1% Oxygen content for 72 hours at 20-22°C.B. Results

[0237] Selection of promoters

[0238] In order to assess the expression levels of a selection of promoters each promoter upstream of GFP-dasher (Atum) was cloned in a replicative plasmid using KLD (NEB Inc.). These plasmids were transformed into the host strain. CL137. After growth in LB for 24h and 72h in 0% and 21% oxygen conditions, GFP expression was measured using a Spark spectrophotometer (Tecan). Data was analyzed using JMP.

[0239] Bacterial Strains

[0240] The following bacterial strains in Table 19 were made and assessed for ammonia production and bacterial biomass under hypoxic or anaerobic conditions.Table 191Strain further includes a modification that disrupts expression of nifL and increases expression of nifA2Strain further includes a glnD Utase domain modification that reduces uridylyl transferase activity3Strain further includes a modified GlnE that has reduced ability to activate glutamine synthetase (GS)4Strain further includes an additional nifA

[0241] Assessment of ammonia production, and bacterial biomass

[0242] Studies were performed to assess biomass and ammonia production of the strains in Table 19 under limited oxygen conditions, which is summarized in Figure 1. Batch 0%, Batch 1% and Batch 2% scatter plots display the ammonia titer (mM) and biomass (OD) of each strain in 0%. 1% and 2% oxygen conditions. Strains 1, 2. 3. 4, a, b. c. and d (see Table 19) were compared to and plotted with 6 reference strains: A, B, C, D, E, and F. As shown in Figures 1, the non-naturally occurring bacteria strains in Table 19 exhibited enhanced ammonia production and increased biomass in limited oxygen conditions.

Claims

WHAT IS CLAIMED IS:

1. A non-naturally occurring bacterium comprising : a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; wherein the non-naturally ocurring bacterium exhibits increased cellular biomass and increased nitrogen fixation activity as compared to a w ild-type bacterium; and w herein the non-naturally ocurring bacterium exhibits reduced nitrate reductase activity, reduced glycosyl transferase activity, reduced formyltetrahydrofolate deformylase activity, and / or reduced taurine transcriptional regulator activity as compared to a wild-type bacterium.

2. The non-naturally -occuring bacterium of claim 1. further comprising a mutant glnD allele encoding a variant GlnD w ith reduced UTase activity as compared to a wild-type bacterium.

3. The non-naturally occurring bacterium of any of claims 1 or 2, w herein the bacterium comprises a disruption of an endogenous nasA, yjjG, purU, or tauR gene.

4. The non-naturally occurring bacterium of any of claims 1 to 3, wherein the heterologous promoter is derived from the same species as the non-naturally occurring bacterium.

5. The non-naturally occurring bacterium of any of claims 1 to 4, wherein the bacterium is a modified bactenum from the Klebsiella genus, optionally selected from K. variicola, K. oxytoca, and K. pneumoniae.

6. The non-naturally occurring bacterium of any of claims 1 to 5, wherein the bacterium comprises an additional copy of a nifA gene inserted in a neutral site of the bacterium.

7. The non-naturally occurring bacterium of any of claims 1 to 6, wherein the bacterium comprises a mutant glnE allele encoding a variant GlnE with reduced glutamine synthetase activation as compared to a wild-type bacterium.

8. A non-naturally occurring bacterium comprising : a modified nifLA operon comprising an endogenous nifA gene operably linked to a first heterologous promoter and a disrupted endogenous nifL gene; a mutant glnD allele encoding a variant GlnD with reduced UTaseactivity as compared to a wild-tj pe bacterium; and wherein the non-naturally occuring bacterium exhibits reduced glycosyl transferase activity and reduced formyltetrahydrofolate deformylase activity.

9. The non-naturally occuring bacterium of claim 8. wherein the bacterium comprises a disruption of an endogenous purU gene and a disruption of an endogenous yjjG gene.

10. The non-naturally occurring bacterium of any of claims 1 to 9, wherein the non-naturally occurring bacterium exhibits at least about 10% greater ammonia production as compared to a wild-type bacterium.

11. The non-naturally occurring bacterium of claim 10, wherein the non-naturally occurring bacterium is capable of excreting the produced ammonia.

12. The non-naturally occurring bacterium of any of claims 1 to 11, wherein the non-naturally occurring bacterium is capable of enhanced nitrogen fixation under excess nitrogen conditions.

13. The non-naturally occurring bacterium of any of claims 1 to 12, wherein the non-naturally occurring bacterium is capable of enhanced nitrogen fixation under hypoxic or anaerobic conditions.

14. The non-naturally occurring bacterium of any of claims 1 to 13, wherein the non-naturally occurring bacterium exhibits enhanced transcription of one or more nif genes as compared to a control wild-ty pe bacterium.

15. The non-naturally occurring bacterium of any of claims 1 to 14, wherein the one or more nif genes is selected from nifj. nifH. nifD. nifT, nifY, nifE, nifN, nifX, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB, and nifQ.

16. A method of increasing nitrogen fixation in a plant comprising exposing the plant to the non-naturally occurring bacterium of any of claims 1 to 15.

Images