Light induced linking assay and uses thereof

The light-induced linking assay using photo-reactive linkers forms covalent bonds to enhance sensitivity and specificity in detecting analytes, overcoming enzymatic interference and enabling accurate quantification and isolation in complex samples.

WO2025155806A1PCT designated stage expired Publication Date: 2025-07-24LUMINEX CORP
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/012008
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-26
Filing Date
2025-01-17
Publication Date
2025-07-24

AI Technical Summary

Technical Problem

Existing immunoassays for detecting analytes in samples, such as proteins and nucleic acids, suffer from enzymatic inhibitor effects in complex matrices like serum or plasma, requiring significant sample dilution and compromising sensitivity.

Method used

A light-induced linking assay using photo-reactive linkers to form covalent bonds between nucleic acid domains upon exposure to light energy, allowing for direct binding and detection of analytes without enzymatic interference.

Benefits of technology

Enhances sensitivity and specificity in detecting analytes by forming stable covalent bonds, enabling accurate quantification and isolation of multiple targets in undiluted samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000053_0001
    Figure IMGF000053_0001
  • Figure IMGF000054_0001
    Figure IMGF000054_0001
  • Figure IMGF000068_0001
    Figure IMGF000068_0001
Patent Text Reader

Abstract

The present disclosure relates to light induced assays and the use of such assays to detect and / or isolate an analyte target in a sample. Also provided herein are methods of increasing the concentration of an analyte target and methods of removing impurities from a sample comprising an analyte target.
Need to check novelty before this filing date? Find Prior Art

Description

DESCRIPTIONLIGHT INDUCED LINKING ASSAY AND USES THEREOFREFERENCE TO RELATED APPLICATIONS

[0001] The present application claims the priority benefit of United States provisional application number 63 / 623,179, filed January 19, 2024, and United States provisional application number 63 / 686,997, filed August 26, 2024, the entire contents of each of which are incorporated herein by reference.REFERENCE TO A SEQUENCE LISTING

[0002] This application contains a Sequence Listing XML, which has been submitted electronically and is hereby incorporated by reference in its entirety. Said Sequence Listing XML, created on January 16, 2025, is named LUMNP0159WO.xml and is 65,692 bytes in size.BACKGROUND1. Field

[0003] The present disclosure generally relates to an assay comprising a photo-reactive linker. In some aspects, the photo-reactive linker allows the formation of a covalent bond between two or more moieties (e.g., two or more oligonucleotides) upon exposure to a light energy. Also disclosed herein are methods of using the light induced linking assay for various aspects of analyte processing e.g., identifying, tagging, and analyzing).2. Description of Related Art

[0004] Accurate detection of analytes (e.g., proteins and / or nucleic acid molecules) in a sample is essential not only in treating and / or diagnosing a disease but also in manufacturing drug products. Various immunoassays have been developed for such a purpose. For example, proximity-based immunoassays (e.g., Proximity Ligation Assay and Proximity Extension Assay) use an enzyme to ligate or extend nucleic acid molecules attached to antibodies when the antibodies are in close enough proximity (e.g., bound to a target analyte) to allow the nucleic acid molecules to interact. However, such immunoassays can suffer from enzymatic inhibitor effects of the sample matrix (e.g., typically serum or plasma) and therefore, require massive dilutions of the sample (e.g., at least 1:100). Accordingly, there remains a need in theart for a detection assay that is both highly sensitive and does not suffer from the limitations of other detection assays in the art.SUMMARY

[0005] Provided herein is a method of detecting the presence of an analyte target in a sample, comprising contacting the sample with (i) a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, and (ii) a second moiety, which comprises a second binding domain attached to a second nucleic acid domain, wherein the first binding domain and the second binding domain specifically bind to the analyte target when the analyte target is present in the sample, and wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy.

[0006] Provided herein are methods of detecting the presence of an analyte target in a sample, the method comprising contacting the sample with (i) a first moiety, which comprises a first binding domain and a first nucleic acid, and (ii) a second moiety, which comprises a second binding domain and a second nucleic acid, wherein the first binding domain and the second binding domain specifically bind to the analyte target when the analyte target is present in the sample, and wherein the first nucleic acid and / or the second nucleic acid comprise a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid and the second nucleic acid upon exposure to a light energy. The first moiety may further comprise a third nucleic acid, wherein the first binding domain is attached to the third nucleic acid, and wherein the third nucleic acid hybridizes to the first nucleic acid; and wherein the second moiety may further comprise a fourth nucleic acid, wherein the second binding domain is attached to the fourth nucleic acid, and wherein the fourth nucleic acid hybridizes to the second nucleic acid.

[0007] The first moiety may further comprise a third nucleic acid, wherein the first binding domain is attached to the third nucleic acid, and wherein the third nucleic acid hybridizes to the first nucleic acid. The second moiety may further comprise a fourth nucleic acid, wherein the second binding domain is attached to the fourth nucleic acid, and wherein the fourth nucleic acid hybridizes to the second nucleic acid.

[0008] In some aspects, the detecting comprises quantifying an amount of the analyte target present in the sample. In some aspects, the first binding domain and the second binding domain bind to the analyte target via direct binding or indirect binding. In some aspects, the analyte target comprises a nucleic acid target, a protein target, or both. In some aspects, the first binding domain and / or the second binding domain comprises a nucleic acid, an antibody, an antibody-nucleic acid complex, an aptamer, or any combination thereof.

[0009] In some aspects, the sample comprises multiple analyte targets. In some aspects, each of the multiple analyte targets is different. In some aspects, the multiple analyte targets comprise at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, at least about 1,000, or at least about 10,000 analyte targets.

[0010] Provided herein is a method of detecting the presence of a nucleic acid target in a sample, comprising contacting the sample with (i) a first moiety, which comprises a first nucleic acid domain, and (ii) a second moiety, which comprises a second nucleic acid domain, wherein the first moiety and the second moiety specifically hybridize to the nucleic acid target when the nucleic acid target is present in the sample, and wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy and when both the first moiety and the second moiety are hybridized to the nucleic acid target.

[0011] In some aspects, the detecting comprises quantifying an amount of the nucleic acid target present in the sample. In some aspects, the nucleic acid target comprises a DNA, RNA, or both. In some aspects, the RNA comprises a microRNA (miRNA), a long noncoding RNA (IncRNA), a circular RNA (circRNA), a small nucleolar RNA (snoRNA), a messenger RNA (mRNA), or any combination thereof. In some aspects, the sample comprises multiple nucleic acid targets. In some aspects, each of the multiple nucleic acid targets is different. Insome aspects, the multiple nucleic acid targets comprise at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about125, at least about 150, at least about 175, at least about 200, at least about 250, at least about300, at least about 350, at least about 400, at least about 450, at least about 500, at least about650, at least about 700, at least about 750, at least about 800, at least about 850, at least about900, at least about 950, at least about 1,000, or at least about 10,000 nucleic acid targets.

[0012] Provided herein is a method of detecting the presence of a protein target in a sample, comprising contacting the sample with (i) a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, and (ii) a second moiety, which comprises a second binding domain attached to a second nucleic acid domain, wherein the first binding domain and the second binding domain specifically bind to the protein target when the protein target is present in the sample, and wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy and when both the first moiety and the second moiety are bound to the protein target.

[0013] IThe first moiety may further comprise a third nucleic acid, wherein the first binding domain is attached to the third nucleic acid, and wherein the third nucleic acid hybridizes to the first nucleic acid. The second moiety may further comprise a fourth nucleic acid wherein the second binding domain is attached to the fourth nucleic acid, and wherein the fourth nucleic acid hybridizes to the second nucleic acid.

[0014] In some aspects, the detecting comprises quantifying an amount of the protein target present in the sample. In some aspects, the first binding domain and the second binding domain bind to the protein target via direct binding or indirect binding. In some aspects, the sample comprises multiple protein targets. In some aspects, each of the multiple protein targets is different. In some aspects, the multiple protein targets comprise at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at leastabout 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, at least about 1,000, or at least about 10,000 protein targets. In some aspects, the first binding domain and / or the second binding domain comprises an antibody, aptamer, or both.

[0015] For any of the methods provided herein, in some aspects, the methods further comprise exposing the sample to the light energy and allowing the covalent bond to form between the first nucleic acid domain and the second nucleic acid domain.

[0016] For any of the methods provided herein, in some aspects, the first moiety further comprises an additional element (first additional element) and / or the second moiety further comprises an additional element (second additional element).

[0017] In some aspects, the second additional element comprises a detectable agent. In some aspects, the methods provided herein further comprise detecting the presence of the detectable agent. In some aspects, the detectable agent comprises a fluorescent marker, a bead, a nanosphere, a catalyst, an enzyme, a chemiluminescent reagent, a particle, a polymer, a fluorochrome, an oligonucleotide, a labeled oligonucleotide, a labeled oligonucleotide greater than 2000 bases, an extensible oligonucleotide, one or more labeled oligonucleotides assembled into a construct, a polymerase extension product, or any combination thereof. In some aspects, the detecting comprises a microarray, polymerase chain reaction (PCR), Rolling Circle Amplification (RCA), flow cytometry, microscopy, fluorimetry, sequencing, or any combination thereof. In some aspects, the PCR comprises digital PCR, bridge PCR, reverse transcription-polymerase chain reaction (RT-PCR), or both. In some aspects where bridgePCR is utilized, an oligo is covalently tethered to an encoded particle after hybridizing and UV linking to a first primer, which is coupled to the surface of the encoded particle, acts as a template for polymerase extension of said first primer, and subsequently this extension product may hybridize to a second primer coupled to the encoded particle. Thermal cycling may be used to form many bridge PCR extension products, which may be detected by a number of means, including probe hybridization to the extension products. In some aspects, the microarray comprises a bead-based microarray. In some aspects, the methods provided herein further comprise amplifying the second moiety prior to the detecting.The covalent bond formedbetween the first nucleic acid and the second nucleic acid may be detected by amplification or a Polymerase Chain Reaction (PCR). The PCR may use a forward primer and a reverse primer at each proximal end of the first or second nucleic acid. The PCR may use a bridging primer that bridges the photo-reactive linker region, spanning from the first or second nucleic acid at its 5’ end to the first or second nucleic acid domain at its 3’ end, and wherein the bridging primer has at least some sequence complementarity to the first and second nucleic acids. The PCR may use a migrating primer, wherein the migrating primer migrates from either the first or second nucleic acid domain to the second or first nucleic acid domain through branch migration. The amplification may use the first and / or second nucleic acid domain to prime a plasmid, creating a rolling circle amplification product. The rolling circle amplification product may be detected by hybridization of the rolling circle amplification product to a complimentary oligomer attached to a bead or solid surface. The rolling circle amplification product may be labelled with a labelled complementary oligomer.

[0018] A covalent bond formed between the first nucleic acid and the second nucleic acid may be detected by adding a preformed nanoball, wherein the preformed nanoball is capable of hybridizing to a segment of the first and / or second nucleic acid. The preformed nanoball may be a preformed rolling circle amplification product comprising at least one label. The preformed nanoball may be a viral capsid comprising at least one label. The preformed nanoball may be a biological polymer comprising at least one label. The preformed nanoball may comprise at least one nanoparticle comprising at least one label. The preformed nanoball may comprise at least one oligonucleotide attached to the at least one nanoparticle, and wherein the at least one oligonucleotide hybridizes to the first and / or second nucleic acid. The preformed nanoball may comprise at least one branched DNA structure. The at least one branched DNA structure may hybridize to the first and / or second nucleic acid. The branched DNA structure may comprise at least one fluorochrome.

[0019] The first and / or second nucleic acid may comprise at least one ribobase. The first and / or second nucleic acid may comprise at least one extension blocker. The extension blocker may comprise a Carbon3 spacer, or an inverted dT. Any of the methods disclosed herein may further comprise an incubation at a temperature capable of denaturing any non- co valent hybridization between the first and second nucleic acids. The methods disclosed herein may further comprise adding an endoribonuclease, wherein the endoribonuclease is capable of cleaving ribobases that are in a double- stranded configuration with DNA in theopposing strand. The endoribonuclease may be RNaseHII. The cleavage by the endoribonuclease may happen in a position such that a cleaved product acts as a primer for a subsequent PCR reaction, and wherein the uncleaved first and / or second nucleic acids may not act as a primer for a subsequent PCR reaction. Detection of the cleaved product may be performed. Detection of the cleaved product may comprise PCR, dPCR, sequencing, or an isothermal amplification which may use the cleaved product as a primer for a plasmid to create a rolling circle amplification product. Where a rolling circle amplification product is produced, the rolling circle amplification product may be detected by hybridization of the rolling circle amplification product to a complimentary oligomer, which may be attached to a bead or solid surface. The rolling circle amplification product may be labelled with a labelled complementary oligomer. Detection of a cleaved product may comprise a PCR reaction, wherein the cleaved product acts as a primer to a PCR template, which may comprise a barcode, and wherein after extension, the barcode may not be incorporated into the PCR product. The barcode may hybridize to a labelled oligomer, and the labelled oligomer may comprise a fluorochrome, dyed nanosphere, or other polymeric dye structure.

[0020] The first and / or second moiety may comprise additional elements. The additional element may comprise a ligand. Any of the methods disclosed herein may further comprise a wash step, wherein a ligand-binding moiety may be added to the sample, and wherein the ligand-binding moiety may bind to the ligand, and wherein the second nucleic acid domain may be removed when the second nucleic acid has not formed a covalent bond to the first nucleic acid. The ligand may be biotin, desthiobiotin, or an oligonucleotide. The ligandbinding moiety may be a biotin-binding bead.

[0021] Any of the methods disclosed herein may further comprise an encoded particle. The encoded particle may be a solid substrate. The encoded particle may further comprise a capture sequence attached to the encoded particle. The capture sequence may hybridize to the first nucleic acid and / or the second nucleic acid. The capture sequence may comprise a photo- reactive linker. The photo-reactive linker may be configured to form a covalent bond between the first nucleic acid and / or the second nucleic acid and the capture sequence upon exposure to a light energy. The methods disclosed herein may further comprise washing. The washing may leave the first and second nucleic acids bound to the encoded particle when the first and second nucleic acids have formed a covalent bond.

[0022] In some aspects, the first additional element comprises a tag, a barcode, a unique molecular identifier (UMI), or any combination thereof. In some aspects, the methods provided herein further comprise sequencing the tag, barcode, UMI, or any combination thereof. In some aspects, method comprises amplifying the first moiety prior to the sequencing.

[0023] Any of the methods disclosed herein may further comprise adding an exonuclease. The exonuclease may remove the first and / or second nucleic acid domains that have not been covalently linked.

[0024] For any of the methods provided herein, in some aspects, the sensitivity and / or accuracy of detecting the presence of the analyte target, nucleic acid target, or protein target is increased as compared to a corresponding method that does not comprise a photo-reactive linker.

[0025] Provided herein are methods of detecting the presence of a nucleic acid target in a sample, the method comprising: (i) contacting the sample with a chimeric probe which comprises DNA / RNA / DNA; (ii) digesting the chimeric probe with an RNase, wherein the chimeric probe is digested if not hybridized to the nucleic acid target. The method may further comprise a step of detecting the non-digested chimeric probe. The step of detecting the nondigested chimeric probe may comprise contacting the non-digested chimeric probe with a first nucleic acid, wherein the first nucleic acid hybridizes to the non-digested chimeric probe. The first nucleic acid may further comprise a spectrally distinct particle. The step of detecting the non-digested chimeric probe may comprise contacting the non-digested chimeric probe with a second nucleic acid, wherein the second nucleic acid hybridizes to the non-digested chimeric probe. The second nucleic acid may further comprise a fluorochrome, branched DNA, dyed nanospheres, on bead bridge PCR, plasmids, RCA extension products, or any combination thereof. The first and / or second nucleic acid may further comprise a photo-reactive linker, which may be configured to form a covalent bond between the first and / or second nucleic acid and the chimeric probe upon exposure to a light energy. The detecting may comprise quantifying an amount of the nucleic acid target present in the sample. The nucleic acid target may comprise a DNA, RNA, or both. The RNA may comprise a microRNA (miRNA), a long noncoding RNA (IncRNA), a circular RNA (circRNA), a small nucleolar RNA (snoRNA), a messenger RNA (mRNA), or any combination thereof.

[0026] The sample may comprise multiple nucleic acid targets. The multiple nucleic acid targets may be different. The multiple nucleic acid targets may comprise at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, at least about 1,000, or at least about 10,000 nucleic acid targets.

[0027] The detecting may comprise a microarray, a polymerase chain reaction (PCR), a flow cytometry, a microscopy, a fluorimeter, a sequencing, or any combination thereof. When PCR is used, the PCR may comprise digital PCR, reverse transcription polymerase chain reaction (RT-PCR), or both.

[0028] For any of the methods provided herein, when PCR is used, the PCR may comprise a forward primer and a reverse primer at each proximal end of the first or second nucleic acid. The PCR may use a bridging primer that bridges the photo-reactive linker region, spanning from the first or second nucleic acid domain at its 5’ end to the first or second nucleic acid domain at its 3’ end, and wherein the bridging primer has at least some sequence complementarity to the first and second nucleic acid. The PCR may use a migrating primer, wherein the migrating primer migrates from either the first or second nucleic acid domain to the second or first nucleic acid through branch migration.

[0029] For any of the methods provided herein, the detecting may comprise using the first and / or second nucleic acid to prime a plasmid, creating a rolling circle amplification product. A step of detecting the rolling circle amplification product may be performed by hybridization of the rolling circle amplification product to a complimentary oligomer attached to a bead or solid surface. The rolling circle amplification product may be labelled with a labelled complementary oligomer.

[0030] Some aspects of the present disclosure relates to a method of isolating an analyte target present in a sample, comprising: (a) contacting the sample with a first moiety, whichcomprises a first binding domain attached to a first nucleic acid domain, wherein the first binding domain is capable of specifically binding to the analyte target and the first nucleic acid domain is capable of specifically binding to a capturing agent, wherein the first nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the analyte target upon exposure to a light energy; (b) exposing the sample to the light energy; and (c) contacting the sample with the capturing agent to isolate the analyte target from the sample (isolated analyte target).

[0031] In some aspects, the first binding domain binds to the analyte target via direct binding or indirect binding. In some aspects, the method further comprises amplifying the isolated analyte. In some aspects, the method further comprises separating the isolated analyte from the capturing agent. In some aspects, the separating occurs prior to the amplifying.

[0032] Provided herein is a method of increasing a concentration of an analyte target in a sample, comprising: (a) contacting the sample with a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, wherein the first binding domain is capable of specifically binding to the analyte target and the first nucleic acid domain is capable of specifically binding to a capturing agent, wherein the first nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the analyte target upon exposure to a light energy; (b) exposing the sample to the light energy; (c) contacting the sample with the capturing agent; and (d) collecting the first moiety from the capturing agent, wherein the concentration of the analyte target is directly correlated with the concentration of the first moiety collected.

[0033] In some aspects, the first binding domain binds to the analyte target via direct binding or indirect binding. In some aspects, the first nucleic acid domain binds to the capturing agent via direct binding or indirect binding.

[0034] Provided herein is a method of removing an impurity in a sample comprising an analyte target, comprising: (a) contacting the sample with (i) a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, and (ii) a second moiety, which comprises a second binding domain attached to a second nucleic acid domain, wherein the first binding domain is capable of specifically binding to the impurity and the second binding domain is capable of specifically binding to a capturing agent, wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photo-reactive linker, which isconfigured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy; (b) exposing the sample to the light energy; (c) contacting the sample with the capturing agent; and (d) removing the impurity from the sample.

[0035] In some aspects, the first binding domain binds to the impurity via direct binding or indirect binding. In some aspects, the second binding domain binds to the capturing agent via direct binding or indirect binding.

[0036] In some aspects, the analyte target comprise a nucleic acid target, a protein target, or both. In some aspects, the analyte target is a protein target. In some aspects, the first binding domain and / or the second binding domain comprises an antibody, aptamer, or both. In some aspects, the nucleic acid target comprises a DNA, RNA, or both. In some aspects, the RNA comprises a microRNA (miRNA), a long non-coding RNA (IncRNA), a circular RNA (circRNA), a small nucleolar RNA (snoRNA), a messenger RNA (mRNA), or any combination thereof.

[0037] In some aspects, the sample comprises multiple analyte targets. In some aspects, each of the multiple analyte targets is different. In some aspects, the multiple analyte targets comprise at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, at least about 1,000, or at least about 10,000 analyte targets.

[0038] In some aspects, the photo-reactive linker comprises 3-cyanovinylcarbazole nucleoside (CNVK), D-threoninol (CNVD), benzophenone, phenyl azide, tetrafluorophenyl azide, hydroxyphenyl azide, diazirine, trifluoromethylphenyl diazirine, psoralen, phenoxyl radical trapper, or any combination thereof. In some aspects, an interaction between the first moiety and the second moiety does not require an enzyme. In some aspects, the light energycomprises photoirradiation at a wavelength of about 366 nm. In some aspects, the sample is not diluted prior to contacting the sample with the first moiety and / or the second moiety.

[0039] Provided herein is a light induced assay with enhanced sensitivity in detecting a presence of an analyte target in a sample, comprising (i) a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, and (ii) a second moiety, which comprises a second binding domain attached to a second nucleic acid domain, wherein the first binding domain and / or the second binding domain is capable of specifically binding to the analyte target when the analyte target is present in the sample, wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photoreactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy, and wherein the sensitivity of the light induced assay is enhanced as compared to a corresponding assay without the photoreactive linker.

[0040] IThe first moiety may further comprise a third nucleic acid, wherein the first binding domain is attached to the third nucleic acid, and wherein the third nucleic acid hybridizes to the first nucleic acid. The second moiety may further comprise a fourth nucleic acid, wherein the second binding domain is attached to the fourth nucleic acid, and wherein the fourth nucleic acid hybridizes to the second nucleic acid.

[0041] In some aspects, the first binding domain and / or the second binding domain binds to the analyte target via direct binding or indirect binding. In some aspects, the first binding domain and / or the second binding domain comprises a nucleic acid, an antibody, an antibody-nucleic acid complex, an aptamer, or any combination thereof. In some aspects, the first moiety further comprises an additional element (first additional element) and / or the second moiety further comprises an additional element (second additional element). In some aspects, the first additional element and / or the second additional element comprises a detectable agent, a tag, a barcode, a unique molecular identifier (UMI), a ligand, an encoded particle, at least one ribobase, or any combination thereof. In some aspects, the detectable agent comprises a fluorescent marker, a bead, a nanosphere, a catalyst, an enzyme, a chemiluminescent reagent, a particle, a polymer, a fluorochrome, or any combination thereof. When the first additional element comprises a ligand, the ligand may comprise biotin.

[0042] Provided herein is a kit comprising any of the light induced assays provided herein, and instructions for use. Also provided herein is a composition comprising an analyte detected or isolated according to any of the methods provided herein. In some aspects, the composition further comprises a carrier.

[0043] Provided herein is a method of using an analyte detected or isolated using any of the methods provided herein. Provided herein is a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject a composition comprising an analyte detected or isolated using the methods provided herein.

[0044] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF DRAWINGS

[0045] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0046] FIG. 1 provides the structures of two exemplary photo-reactive linkers useful for the present disclosure — i.e., 3-cyanovinylcarbazole nucleoside (CNVK) (left) and Dthreoninol (CNVD) (right).

[0047] FIGS. 2 A and 2B provide schematics of exemplary light induced proximity linking assay described herein. In FIG. 2A, both of the analyte-specific antibodies are conjugated to an oligonucleotide (i.e., #1 and #2) and bind to the analyte. Oligonucleotide #3 is coupled to biotin (B) and forms aCNVK UV link with oligonucleotide #4. Oligonucleotide #3 can further comprise other binding moieties (e.g., oligonucleotide sequences that are hybridized for capture) and thus, allowing oligonucleotide #3 to interact with oligonucleotide #1. In some aspects, oligonucleotide #3 can also comprise barcodes or unique molecular identifiers for sequencing applications. In some aspects, oligonucleotide #4 can also comprisea binding moiety, allowing oligonucleotide to interact with oligonucleotide #2. As further described herein, in some aspects, oligonucleotides #3 and #4 can be directly conjugated to the analyte-specific antibodies such that oligonucleotides #1 and #2 are not necessary. Exemplary sequences for the oligonucleotides are as follows: (1) oligonucleotide #1: TCACGGTAGCATcAGGTGCAAGcgAATACTCTCGCACGAC / 3AmMC6T / (SEQ ID NO: 1), (2) oligonucleotide #2: / 5 AmMC 12 / CGATTAGACTCTTAGAAGGAGC ACTGTCCATCATCATGCAGACAA A (SEQ ID NO: 2); (3) oligonucleotide #3: / 5Cy3 / GTCGTGCGAGAGTATTCGCTTGCACCTGATGCTACCGTGACCTGCGAAT CCA / CNVK / TCT (SEQ ID NO: 3); and (4) oligonucleotide #4: GACTGGAGTAGCACTTTGTCTGCATGATGATGGAC / 3Bio / (SEQ ID NO: 4). In FIG. 2B, oligonucleotides #3 and #4 bind directly to the analyte target.

[0048] FIGS. 3A, 3B, and 3C provide a schematic of exemplary priming methods for PCR amplification of an oligonucleotide described herein. In FIG. 3A (bridge primer), a first primer bridges theCNVK region (triangle) spanning from the 5 ’-end of oligonucleotide #4 to the 3 '-end of oligonucleotide #3. This allows some sequence specificity from one oligonucleotide to another for confirmation of the match between oligonucleotides #3 and #4. In FIG. 3B (oligo 4 only primer), a primer specific to oligonucleotide #4 is used to amplify. In FIG. 3C (branch migration primer), a primer can migrate from oligonucleotide 3 to oligonucleotide 4 through branch migration as described in Kishi et al., Nat Methods 19(11): 1393-1402 (Nov. 19, 2022), which is incorporated herein by reference in its entirey. Exemplary primers and probe include: (a) forward primer: GTGCTGCGAGAGTAT (SEQ ID NO: 5), (b) reverse primer: TCGCAGGTCACG (SEQ ID NO: 6), and (c) probe: / 5TexRd- XN / TCGCTTGCACCTGATGCTAC / 3BHQ_2 / (SEQ ID NO: 7).

[0049] FIG. 4 provides a schematic of an exemplary microRNA (miRNA) UV linking method described herein. A 5’-biotin-labeled oligonucleotide (oligo #1) is covalently bound by a photo-reactive linker (triangle) to a second oligonucleotide (oligo #2) when both are hybridized to the miRNA. However, when one or both of the oligonucleotides are not hybridized to the miRNA, the two oligonucleotides are not in close enough proximity such that a covalent bond is not formed upon light exposure.

[0050] FIG. 5 provides a schematic of an exemplary bead-based capture and detection of UV-linked oligonucleotides for multi-omic analyte detection.

[0051] FIG. 6 provides a schematic of an exemplary method of isolating an analyte target from a sample using photo-reactive linkers provided herein.

[0052] FIG. 7 provides a schematic of an exemplary light induced proximity linking assay described herein.

[0053] FIG. 8 provides an exemplary binding location of a bridging primer. Strand 3 is SEQ ID NO: 10. Strand 4 is SEQ ID NO: 11. Bridging Primer is SEQ ID NO: 14.

[0054] FIG. 9 provides an exemplary HPLC chromatograph of the oligo conjugated anti-IL-lbeta antibody and the peaks fractioned.

[0055] FIG. 10 provides an exemplary PCR amplification with no antibody or protein target.

[0056] FIG. 11 provides an exemplary PCR amplification with antibody present, but no protein target present.

[0057] FIG. 12 provides an exemplary PCR amplification with antibody present, and the protein target present with and without UV treatment.

[0058] FIG. 13 provides an exemplary table of average Ct values for samples subjected to UV treatment.

[0059] FIG. 14 provides a schematic of an exemplary method of detecting a proximity based antibody interaction on a solid substrate such as a particle.

[0060] FIG. 15 provides a schematic of an exemplary embodiment where a blocked primer linked to a first antibody is cleaved as a result of proximity hybridization to another oligonucleotide strand linked to a second antibody.

[0061] FIG. 16 provides a schematic of an exemplary method for detection of proximity based protein assays.

[0062] FIG. 17 provides a schematic of an exemplary method of detecting a target protein by forming a covalent bond via a nucleic acid tether comprising UV linking modifications such as CNVK or CNVD.

[0063] FIG. 18 provides a schematic of an exemplary method of detecting a micro RNA or other nucleic acid target by forming a chain of nucleic acid oligomers that form covalent bonds from a spectrally distinct particle and a fluorochrome.

[0064] FIG. 19 provides a schematic of an exemplary method wherein chimeric DNA / RNA / DNA probes are digested by Rnase treatment if not perfectly hybridized to the micro RNA target.

[0065] FIG. 20 provides a schematic of an exemplary method, derived from FIG. 14, with fewer oligos needed.

[0066] FIG. 21 provides a schematic of an exemplary embodiment which directly couples the capture antibody to the encoded particle.

[0067] FIG. 22 provides a schematic of an exemplary embodiment in which exonucleases may be used to remove strands that have not been covalently bound by UV linking oligo modifications.

[0068] FIG. 23 provides a schematic of an exemplary embodiment in which a two- factor authentication of the proximity binding event through proximity hybridization and UV cross-linking occurs.

[0069] FIG. 24 provides a schematic of an exemplary embodiment in which a linear signal amplification method is generated by repeatedly cycling heat and UV light to form covalent bonds with signal generating oligos.

[0070] FIG. 25 provides a schematic of an exemplary embodiment in which a CNVK is used to lock on specific target capture oligos that are linked to antibody / oligo coupled microspheres and oligo coupled detection antibodies.

[0071] FIGS. 26A-26B provide assay results. FIG. 26A shows the results of the comparative assay (an assay using standard capture and detection antibodies with no oligos or CNVK attached) with and without a stringent wash, designated as ‘No Elution’ for the nonstringent wash procedure, and ‘with elution’ for the stringent wash procedure. FIG. 26B shows results of the capture sandwich immunoassay useing antibodies that have been pre-coupled with oligos and cnvk as described in FIG. 25. The yellow highlighted data are conditions wherea single target protein (indicated at the top of each column) was added the multiplex bead reaction.DETAILED DESCRIPTION

[0072] Disclosed herein is an UV-based assay that allows for the detection of analytes (e.g., proteins and / or nucleic acids) using multiple moieties (e.g., two or four), wherein at least one of the moieties comprises a photo-reactive linker. As further described herein, in some aspects, an UV-based assay of the present disclosure exhibits one or more of the following properties: (1) can measure protein, RNA, and DNA in a single protocol, (2) can use crude samples without a reverse transcriptase step for gene expression, (3) multi-modal readout — e.g., xMAP, PCR, dPCR, or sequencing, (4) improved sensitivity and specificity (e.g., as compared to proximity immunoassays without the use of a photo-reactive linker), (5) high multiplex analysis (e.g., >1000 plex), (6) applicable to single cell and spatial multi-omics applications, (7) can use universal primers in amplification modalities and thereby, reduce unbiased pre-amplification, (8) faster commercialization of drug products, (9) diverse applicability (e.g., sample prep / extraction / concentration methods and pull down of targeted sequences), and (10) can use isothermal amplification methods. Also disclosed herein are methods of using such UV-based assay. Non-limiting examples of the various aspects are provided throughout the present disclosure.I. Definitions

[0073] In order that the present disclosure can be more readily understood, certain terms are first defined. As used in this application, except as otherwise expressly provided herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout the application.

[0074] Throughout the disclosure, the term “a” or “an” entity refers to one or more of that entity; for example, “a chimeric polypeptide,” is understood to represent one or more chimeric polypeptides. As such, the terms “a” (or “an”), “one or more,” and “at least one” can be used interchangeably herein. In addition, “or” is used to mean an open list of the components in the list. For example, “wherein X comprises A or B” means X comprises A, X comprises B, X comprises A and B, or X comprises A or B and any other components.

[0075] Furthermore, “and / or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0076] It is understood that wherever aspects are described herein with the language “comprising,” otherwise analogous aspects described in terms of “consisting of’ and / or “consisting essentially of’ are also provided.

[0077] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure.

[0078] Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range, unless otherwise explicitly stated.

[0079] Abbreviations used herein are defined throughout the present disclosure. Various aspects of the disclosure are described in further detail in the following subsections.

[0080] The terms “about” or “comprising essentially of’ refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined, i.e., the limitations of the measurement system. For example, “about” or “comprising essentially of’ can mean within 1 or more than 1 standard deviation per the practice in the art. Alternatively, “about” or “comprising essentially of’ can mean a range of up to 10% (e.g., a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value)). For example, “about 55 mM,” as used herein,includes 49.5 mM to 60.5 mM. Furthermore, particularly with respect to biological systems or processes, the terms can mean up to an order of magnitude or up to 5-fold of a value. When particular values or compositions are provided in the application and claims, unless otherwise stated, the meaning of “about” or “comprising essentially of’ should be assumed to be within an acceptable error range for that particular value or composition.

[0081] As used herein, “essentially free,” in terms of a specified component, is used herein to mean that none of the specified component has been purposefully formulated into a composition and / or is present only as a contaminant or in trace amounts. The total amount of the specified component resulting from any unintended contamination of a composition is therefore well below 0.05%, preferably below 0.01 %. Most preferred is a composition in which no amount of the specified component can be detected with standard analytical methods.

[0082] As described herein, any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.

[0083] As used herein, the term “light energy” refers to a form of electromagnetic radiation that is capable of inducing the activation of a photo-reactive linker described herein, wherein the activation results in the formation of a covalent bond between oligonucleotides. In some aspects, “light energy” is used interchangeably with ultraviolet (UV) light. In some aspects, a light energy has a wavelength of about 365 nm.

[0084] The term “photo-reactive linker” refers to a linker that is activated upon exposure to a light energy. As further described herein, upon activation a photo-reactive linker forms a covalent bond (or linkage) with another molecule or another part of itself within its immediate vicinity. Non-limiting examples of useful photo-reactive linker are provided elsewhere in the present disclosure.

[0085] As used herein, the term “proximity assay” (or variants thereof) refers to an assay based on the principle of “proximity probing,” wherein an analyte is detected by the binding of multiple (e.g., two or more) probes (e.g., oligonucleotides described herein), which brings the probes into proximity to each other. Non-limiting examples of proximity assays known in the art include Proximity Ligation Assay (PLA) and Proximity Extension Assay(PEA). As is apparent from the present disclosure, the proximity assay described herein is fundamentally different from those known in the art.

[0086] As used herein, the term “analyte” refers to any substance that can be detected using the disclosures provided herein. Non-limiting examples of analytes include a protein, peptide, nucleic acid molecule, cell, microorganism, and fragments or variants thereof.

[0087] As used herein, the term “moiety” refers to a molecule comprising a binding domain, a nucleic acid domain, or both a binding domain and a nucleic acid domain. In some aspects, where a moiety comprises both a binding domain and a nucleic acid domain, the binding domain is attached to the nucleic acid domain. In some aspects, the binding domain can be attached directly to the nucleic acid domain. In some aspects, the binding domain is attached indirectly to the nucleic acid domain, e.g., using a spacer or a linker. The binding domain and the nucleic acid domain can be attached using any suitable methods known in the art. In some aspects, the binding domain and the nucleic acid domain both comprise nucleotides and can thereby be attached using one or more phosphodiester bonds. In some aspects, the binding domain and the nucleic acid domain both comprise nucleotides and are attached using one or more modified nucleotide bonds, e.g., phosphorothioate bond. In some aspects, the binding domain comprises a protein that is capable of specifically binding to an analyte target, e.g., an antibody. For such aspects, the binding domain can be attached to the nucleic acid domain (directly or indirectly) using any conjugation methods known in the art. As described herein, in some aspects, a first moiety and / or second moiety useful for the present disclosure comprise an oligonucleotide.

[0088] As used herein, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid and / or deoxyribonucleic acid. The term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent intersugar (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. As described herein, an oligonucleotide useful for the present disclosure comprises (a) a binding domain, (b) a nucleic acid domain, or (c) both a binding domain and a nucleic acid domain. In some aspects, an oligonucleotide described herein can further comprise one or more additional moieties (e.g., tag and / or detectable moiety).

[0089] As used herein, the term “binding domain” refers to any domain that is capable of specifically interacting and thereby, binding with an analyte of interest (also referred toherein as “analyte target”). In some aspects, a binding domain comprises an antibody (or an antigen-binding fragment thereof). For such aspects, a moiety described herein (e.g., oligonucleotide) can be conjugated to the antibody. In some aspects, a binding domain comprises an aptamer, which can be conjugated to an oligonucleotide (e.g., on the opposite end from the nucleic acid domain). In some aspects, a binding domain comprises a segment of the first and / or second moiety that is complementary to a region of the analyte target, such that the binding domain can hybridize to the analyte target. In some aspects, a binding domain binds to an analyte target via direct binding. In some aspects, a binding domain binds to an analyte target via indirect binding.

[0090] As used herein, the term “direct binding” refers to the direct interaction of two molecules. To help illustrate, a binding domain binds to an analyte target via direct binding where the binding domain directly interacts with the analyte target. Such direct binding can be observed in FIG. 2B. As shown, the binding domain is an antibody which directly interacts with the analyte target. In contrast, the term “indirect binding” refers to an interaction between two molecules where an additional element is involved. With indirect binding, the two molecules use the additional element to interact. Such indirect binding is illustrated in FIG. 2A. As shown, oligonucleotide #3 is attached or bound to the analyte target via oligonucleotide #1. More specifically, the binding domain of oligonucleotide #3 (i.e., 5'-end of the oligonucleotide) hybridizes to a region within oligonucleotide #1. And the binding domain of oligonucleotide #1 (i.e., 3'-end of the oligonucleotide) binds to the analyte target.

[0091] The term “nucleic acid domain” refers to a segment of a first and / or second moiety of the present disclosure that is capable of interacting with (e.g., hybridizing) a nucleic acid domain of another moiety. As described herein, in some aspects, a nucleic acid domain comprises a photo-reactive linker, such that upon exposure to a light energy, a covalent bond is formed between nucleic acid domain of two or more oligonucleotides.

[0092] The terms “antibody” and “antibodies” are terms of art and can be used interchangeably herein and refer to a molecule with an antigen binding site that specifically binds an antigen (e.g., analyte target). The terms as used herein include whole antibodies and any antigen binding fragments (i.e., “antigen-binding portions”) or single chains thereof. In some aspects, an antibody comprises at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds, or an antigen binding portion thereof. In some aspects, an antibody comprises a single chain antibody comprising a single variable domain, e.g., VHHdomain. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. In some aspects, the heavy chain constant region is comprised of three domains, CHI , CH2 and CH3. In some aspects, each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region is comprised of one domain, CL.

[0093] The terms “complementary” and “complementarity” refer to two or more oligomers (i.e., each comprising a nucleobase sequence), or between an oligomer and a target gene, that are related with one another by Watson-Crick base-pairing rules. For example, the nucleobase sequence “T-G-A (5’ to 3'),” is complementary to the nucleobase sequence “A-C- T (3' to 5').” Complementarity can be “partial,” in which less than all of the nucleobases of a given nucleobase sequence are matched to the other nucleobase sequence according to base pairing rules. For example, in some aspects, complementarity between a given nucleobase sequence and the other nucleobase sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. Accordingly, in some aspects, the term “complementary” refers to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% match or complementarity to a target nucleic acid sequence (e.g., analyte). Or, there can be “complete” or “perfect” (100%) complementarity between a given nucleobase sequence (e.g., binding domain of an oligonucleotide) and the other nucleobase sequence (e.g., region within an analyte). Oligonucleotides having complementary sequences are capable of base-pairing with each other during hybridization. The term “substantially complementary” refers to one nucleic acid strand that may hybridize to another nucleic acid strand in stringent conditions. A “partially complementary” refers to one nucleic acid strand that may hybridize in low stringency conditions to another nucleic acid strand. When one oligonucleotide is described as hybridizing, or being capable of hybridizing to another oligonucleotide, a portion of the oligonucleotides may be described as substantially complementary while the oligonucleotides over their entire length may be described as partially complementary or not complementary. When one oligonucleotide is described as hybridizing, or being capable of hybridizing to another oligonucleotide, a portion of the oligonucleotides may be described as at least partially complementary while the oligonucleotides over their entire length may be described as not complementary.

[0094] As used herein, the term “detectable agent” refers to a molecule or material that can produce a detectable (such as visually, electronically, or otherwise) signal that indicates the presence (qualitative) and / or concentration (quantitative) of an analyte target in a sample. Non-limiting examples of useful detectable agents are provided elsewhere in the present disclosure.

[0095] As used herein, the term “tag” refers to a molecule or material that allows for the identification of a target molecule. In some aspects, a tag comprises a unique identifier, such that a moiety conjugated to the tag can be distinguished from other moieties.11. Light-Induced Assay

[0096] Some aspects of the present disclosure relate to a light-induced assay. As is apparent from the present disclosure, a light-induced assay provided herein involves the use of a photo-reactive linker. Compared to other assays, e.g., proximity assays, known in the art, the light-induced assay described herein exhibits much improved properties (e.g., enhanced sensitivity and / or specificity). Non-limiting examples of such properties are provided elsewhere in the present disclosure.

[0097] In some aspects, a light induced assay comprises a first moiety and a second moiety, wherein the first and second moiety independently comprise a binding domain attached to a nucleic acid domain. In some aspects, the binding domain of the first moiety (first binding domain) is capable of specifically binding to an analyte target. In some aspects, the binding domain of the second moiety (second binding domain) is capable of specifically binding to an analyte target. In some aspects, both the first binding domain and the second binding domain are capable of specifically binding to an analyte target. In some aspects, the nucleic acid domain of the first moiety (first nucleic acid domain) comprises a photo-reactive linker. In some aspects, the nucleic acid domain of the second moiety (second nucleic acid domain) comprises a photo-reactive linker. In some aspects, both the first and second nucleic acid domains comprise a photo-reactive linker. Where more than one photoreactive linkers are involved, in some aspects, one or more of the photo-reactive linkers are different. In some aspects, each of the photo-reactive linkers are different. In some aspects, one or more of the photo-reactive linkers are the same. In some aspects, each of the photoreactive linkers is the same. As described herein, the photo-reactive linker is activated by exposure to a light energy, whichresults in the nucleic acid domain comprising the photoreactive linker to form a covalent bond to a different nucleic acid domain.

[0098] In some aspects, a light induced assay may comprise a first moiety, which comprises a first binding domain and a first nucleic acid domain, and a second moiety, which comprises a second binding domain and a second nucleic acid domain, wherein the first binding domain and the second binding domain specifically bind to the analyte target when the analyte target is present in the sample, and wherein the first nucleic acid domain and / or the second nucleic acid domain comprise a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy. The first moiety may further comprise a third nucleic acid, wherein the first binding domain may be attached to the third nucleic acid, and wherein the third nucleic acid may hybridize to the first nucleic acid. The second moiety may further comprise a fourth nucleic acid, wherein the second binding domain may be attached to the fourth nucleic acid, and wherein the fourth nucleic acid may hybridize to the second nucleic acid.

[0099] The first moiety may further comprise a third nucleic acid, wherein the first binding domain is attached to the third nucleic acid, and wherein the third nucleic acid hybridizes to the first nucleic acid. The second moiety may further comprise a fourth nucleic acid, wherein the second binding domain is attached to the fourth nucleic acid, and wherein the fourth nucleic acid hybridizes to the second nucleic acid.

[0100] Any photo-reactive linker known in the art can be used with the present disclosure. For example, the photo-reactive linker may comprise 3-cyanovinylcarbazole nucleoside (CNVK), D-threoninol (CNVD), benzophenone, phenyl azide, tetrafluorophenyl azide, hydroxyphenyl azide, diazirine, trifluoromethylphenyl diazirine, psoralen, phenoxyl radical trapper, or combinations thereof.

[0101] In some aspects, a photo-reactive linker isCNVK (such as that shown in FIG. 1). Accordingly, in some aspects, a light- induced assay, e.g., light- induced proximity assay, provided herein comprises: (a) a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, and (b) a second moiety, which comprises a second binding domain attached to a second nucleic acid domain, wherein the first binding domain and / or the second binding domain is capable of specifically binding to an analyte target present in asample, and wherein the first nucleic acid domain and / or the second nucleic acid domain comprisesCNVK as a photo-reactive linker.

[0102] In some aspects, a photo-reactive linker isCNVD (such as that shown in FIG. 1). Accordingly, in some aspects, a light induced assay, e.g., light induced proximity assay, provided herein comprises: (a) a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, and (b) a second moiety, which comprises a second binding domain attached to a second nucleic acid domain, wherein the first binding domain and / or the second binding domain is capable of specifically binding to an analyte target present in a sample, and wherein the first nucleic acid domain and / or the second nucleic acid domain comprisesCNVD as a photo-reactive linker.

[0103] As is apparent from the present disclosure, a binding domain of a first and / or second moiety (e.g., first binding domain and / or the second binding domain) comprises any useful binding domains known in the art. In some aspects, a binding domain comprises an antibody. In some aspects, a binding domain comprises an aptamer. In some aspects, a binding domain comprises a segment of a first and / or second moiety (e.g., oligonucleotide) that is capable of binding to an analyte. In some aspects, a light induced assay, e.g., light induced proximity assay, provided herein comprises two or more moieties, wherein at least one of the moieties comprises an antibody as a binding domain and at least one of the moieties comprises a nucleic acid segment (e.g., aptamer) as a binding domain. In some aspects, such a light induced assay, e.g., light induced proximity assay, can be useful in multi-omics applications.

[0104] In some aspects, a light induced assay, e.g., light induced proximity assay, of the present disclosure comprises a first moiety and a second moiety, wherein the first moiety and / or the second moiety further comprises one or more additional elements. Accordingly, in some aspects, a first moiety comprises a first binding domain, a first nucleic acid domain, and an additional element. In some aspects, a second moiety comprises a second binding domain, a second nucleic acid domain, and an additional element.

[0105] In some aspects, the additional element comprises a detectable agent. For example, in some aspects, a light induced assay, e.g., light induced proximity assay, described herein comprises (a) a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, and (b) a second oligonucleotide, which comprises a second binding domain attached to a second nucleic acid domain, and a detectable agent, wherein the firstbinding domain and / or the second binding domain is capable of specifically binding to an analyte target present in a sample, and wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photo-reactive linker. Because of the covalent bond between the first and second nucleic acid domains, in some aspects, the presence of an analyte target in a sample can be determined by detecting the presence of the detectable agent. Non-limiting examples of detectable agent comprise a fluorescent marker, a bead, a nanosphere, a catalyst, an enzyme, a chemiluminescent reagent, a particle, a polymer, a fluorochrome, or any combination thereof.

[0106] As will be apparent to those skilled in the art, in some aspects, an antibodyantigen affinity bond is not strong enough to keep a large mass element attached. Because of the strong covalent bond formation upon activation of the photo-reactive linker, a UV induced assay of the present disclosure allows for the attachment of a large element (e.g., nanosphere) to a target. In some aspects, because of the strong covalent bond formation, an attached element (e.g., detectable agent) will remain attached much longer as compared to other means of attachment (e.g., via antibody-antigen affinity bond).

[0107] In some aspects, the additional element comprises a tag. Accordingly, in some aspects, a light induced assay, e.g., light induced proximity assay, described herein comprises a first moiety and a second moiety, wherein the first and second moieties independently comprise a binding domain attached to a nucleic acid domain, and wherein the first and / or second moieties further comprise a tag. In some aspects, the tag comprises a unique identifier.

[0108] Also provided herein is a kit comprising any of the light induced assay, e.g., light induced proximity assay, described herein. In some aspects, the kit further comprises instructions for use.

[0109] Some aspects of the present disclosure relate to compositions comprising an analyte detected and / or isolated using the light induced assay, e.g., light induced proximity assay, described herein. In some aspects, such compositions further comprise one or more additional component, such as a carrier.III. Methods of Using

[0110] Some aspects of the present disclosure relate to methods of using a light induced assay, e.g., light induced proximity assay, described herein. As is apparent from the presentdisclosure, a light induced assay, e.g., light induced proximity assay, described herein can have diverse applicability. In some aspects, a light induced assay, e.g., light induced proximity assay, of the present disclosure can be used to detect the presence of an analyte target in a given sample. In some aspects, detecting the presence of an analyte target is qualitative (e.g., whether the analyte target is present or not in the sample). In some aspects, detecting the presence of an analyte target is quantitative (e.g., how much of the analyte target is present in the sample). In some aspects, detecting the presence of an analyte target is both qualitative and quantitative.

[0111] Accordingly, in some aspects, provided herein is a method of detecting the presence of an analyte in a sample, comprising contacting the sample with (i) a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, and (ii) a second moiety, which comprises a second binding domain attached to a second nucleic acid domain. In some aspects, the first binding domain is capable of specifically binding to the analyte target when the analyte target is present in the sample. In some aspects, the second binding domain is capable of specifically binding to the analyte target when the analyte target is present in the sample. In some aspects, both the first binding domain and the second binding domain are capable of specifically binding to the analyte target when the analyte target is present in the sample. Where both the first binding domain and the second binding domain bind to the analyte target, the binding domains bind to different regions of the analyte target.

[0112] In some aspects, a method of detecting the presence of an analyte target in a sample is provided herein, comprising contacting the sample with (i) a first moiety, which comprises a first binding domain and a first nucleic acid domain, and (ii) a second moiety, which comprises a second binding domain and a second nucleic acid domain, wherein the first binding domain and the second binding domain may specifically bind to the analyte target when the analyte target is present in the sample, and wherein the first nucleic acid domain and / or the second nucleic acid domain may comprise a photo-reactive linker, which may be configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy. The first moiety may further comprise a third nucleic acid, wherein the first binding domain may be attached to the third nucleic acid, and wherein the third nucleic acid may hybridize to the first nucleic acid; and wherein the second moiety may further comprise a fourth nucleic acid wherein the second binding domain may be attached to the fourth nucleic acid, and wherein the fourth nucleic acid may hybridize to the second nucleic acid.

[0113] As described herein, the first and / or second binding domains can comprise any suitable binding domains known in the art. In some aspects, the first binding domain comprises a nucleic acid, an antibody, an antibody-nucleic acid complex, an aptamer, or any combination thereof. In some aspects, the second binding domain comprises a nucleic acid, an antibody, an antibody-nucleic acid complex, an aptamer, or any combination thereof. As is apparent from the present disclosure, in some aspects, the first and second binding domains are of the same type (e.g., both antibodies or both nucleic acids). In some aspects, the first and second binding domains are of different types (e.g., first binding domain is an antibody and the second binding domain is a nucleic acid).

[0114] As described herein, in some aspects, the first nucleic acid domain comprises a photo-reactive linker. In some aspects, the second nucleic acid domain comprises a photoreactive linker. In some aspects, both the first and second nucleic acid domains comprise a photo-reactive linker. Where more than one photo-reactive linkers are involved, in some aspects, one or more of the photo-reactive linkers are different. In some aspects, each of the photo-reactive linkers is different. In some aspects, one or more of the photo-reactive linkers are the same. In some aspects, each of the photo-reactive linkers are the same.

[0115] In some aspects, a photo-reactive linker is configured such that a covalent bond is formed between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy.

[0116] The methods provided herein can be used to assess the presence of any suitable analyte target known in the art. For example, in some aspects, an analyte target comprises a protein. Accordingly, some aspects of the present disclosure relates to a method of assessing the presence of a protein target in a sample, comprising contacting the sample with (i) a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, and (ii) a second moiety, which comprises a second binding domain attached to a second nucleic acid domain, wherein the first binding domain and the second binding domain specifically bind to the protein target when the protein target is present in the sample, and wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy. In some aspects, the first binding domain comprises an antibody. In some aspects, the second binding domain comprises an antibody. In some aspects, both the first binding domain and the second binding domain comprise anantibody. Where multiple antibodies are used as binding domains, the antibodies binds to different epitopes of a protein target.

[0117] As described herein, for the covalent bond to form upon exposure to a light energy, the first and second nucleic acid domains must be in proximity. In some aspects, the first and second nucleic aid domains are in proximity when both the first binding domain and the second binding domain are bound to the protein target. Therefore, in some aspects, a covalent bond is formed between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy only when both the first binding domain and the second binding domain are bound to the protein.

[0118] In some aspects, an analyte target comprises a nucleic acid target. Non-limiting examples of nucleic acid targets that can be detected include a DNA, RNA, or both. In some aspects, the nucleic acid target comprises a microRNA (miRNA), a long non-coding RNA (IncRNA), a circular RNA (circRNA), a small nucleolar RNA (snoRNA), a messenger RNA (mRNA), or any combination thereof.

[0119] Accordingly, provided herein is a method of detecting the presence of a nucleic acid target in a sample, comprising contacting the sample with (i) a first moiety, which comprises a first nucleic acid domain, and (ii) a second moiety, which comprises a second nucleic acid domain, wherein the first moiety and the second moiety specifically hybridize to the nucleic acid target when the nucleic acid target is present in the sample, and wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photoreactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy and when both the first moiety and the second moiety are hybridized to the nucleic acid target. Again, as illustrated in FIG. 4, a covalent bond is formed between the first and second nucleic acid domains upon exposure to a light energy only when both the first and second binding domains are hybridized to the nucleic acid target. Where both the first and second binding domains are hybridized to the nucleic acid targets, the first and second binding domains hybridize to different regions of the nucleic acid target.

[0120] In some aspects, the methods described herein can be used to detect a single analyte target in a sample (e.g., a single protein target or a single nucleic acid target). In some aspects, the methods can be used to detect multiple analyte targets in a sample. For example,in some aspects, the methods can be used to detect multiple protein targets in a sample. In some aspects, the methods can be used to detect multiple nucleic acid targets in a sample. In some aspects, the methods can be used to detect one or more protein targets and one or more nucleic acid targets in a sample. Where multiple analyte targets are being detected, in some aspects, each of the multiple analyte targets is different. In some aspects, the multiple analyte targets (e.g., multiple protein targets, multiple nucleic acid targets, or multiple protein and nucleic acid targets) comprise at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 125, at least about 150, at least about175, at least about 200, at least about 250, at least about 300, at least about 350, at least about400, at least about 450, at least about 500, at least about 650, at least about 700, at least about750, at least about 800, at least about 850, at least about 900, at least about 950, at least about1,000, or at least about 10,000 analyte targets.

[0121] In some aspects, a first moiety and / or second moiety useful for the present disclosure further comprises an additional element. In some aspects, the first moiety comprises the additional element (first additional element). In some aspects, the second moiety comprises the additional element (second additional element). In some aspects, both the first moiety and the second moiety comprise an additional element.

[0122] In some aspects, the additional element is useful in detecting the first and / or second moieties that are bound to an analyte target and thereby, detect the presence of the analyte target in the sample. In some aspects, the additional element comprises a detectable agent. Non-limiting examples of such detectable agents comprise a fluorescent marker, a bead, a nanosphere, a catalyst, an enzyme, a chemiluminescent reagent, a particle, a polymer, a fluorochrome, or any combination thereof.

[0123] Accordingly, in some aspects, the detecting methods provided herein further comprises detecting the presence of the detectable agent. Such detectable agents can be detected using any suitable methods known in the art. In some aspects, detecting the detectable agent comprises a a microarray, a polymerase chain reaction (PCR), a flow cytometry, a microscopy, a fluorimeter, a sequencing, or any combination thereof. In some aspects, the presence of the detectable agent is determined using a microarray. In some aspects, themicroarray comprises a bead-based microarray. In some aspects, the presence of the detectable agent is determined using a PCR. In some aspects, the PCR comprises a digital PCR, reverse transcription-polymerase chain reaction (RT-PCR), or both.

[0124] In some aspects, the additional element comprises a unique identifier. Nonlimiting examples of such unique identifiers include a tag, barcode, unique molecular identifier, or any combination thereof. In some aspects, by sequencing the unique identifier, it is possible to detect the first and / or second moiety comprising the unique identifier, and thereby, determine the presence of an analyte target in a given sample. Accordingly, in some aspects, the detecting methods provided herein further comprise sequencing the unique identifier.

[0125] In some aspects, the detecting methods provided herein comprise multiple approaches to determining the presence of a first and / or second moiety, and thereby, detect the presence of an analyte target in a sample. For example, in some aspects, the detecting methods can comprise both detecting the detectable agent and sequencing the unique identifier. In some aspects, the detecting methods provided herein can further comprise amplifying the first moiety and / or the second moiety. In some aspects, the amplifying occurs prior to detecting the detectable agent. In some aspects, the amplifying occurs prior to sequencing the unique identifier. Amplifying can comprise any suitable methods known in the art. Non-limiting examples of such methods are illustrated in FIGS. 3A-3C.

[0126] For any of the methods provided herein, in some aspects wherein PCR is utilized for detecting, the PCR may use a forward primer and a reverse primer at each proximal end of the first or second nucleic acid domain. The PCR may use a bridging primer that bridges the photo-reactive linker region, spanning from the first or second nucleic acid domain at its 5 ’ end to the first or second nucleic acid domain at its 3’ end, and wherein the bridging primer has at least some sequence complementarity to the first and second nucleic acid domains. The PCR may use a migrating primer, wherein the migrating primer migrates from either the first or second nucleic acid domain to the second or first nucleic acid domain through branch migration.

[0127] For any of the methods provided herein, the detecting may comprise using the first and / or second nucleic acid domain to prime a plasmid, creating a rolling circle amplification product. In some aspects, a second detecting the rolling circle amplification product by hybridization of the rolling circle amplification product to a complimentaryoligomer attached to a bead or solid surface may be performed. The rolling circle amplification product may be labelled with a labelled complementary oligomer.

[0128] As is apparent from the present disclosure, the methods provided herein can be useful in other non-proximity -based contexts. Accordingly, some aspects of the present disclosure relate to a method of isolating an analyte target (e.g., a protein target, nucleic acid target, or both a protein target and a nucleic acid target) present in a sample. In some aspects, the method comprises (a) contacting the sample with a moiety described herein (e.g., oligonucleotide), which comprises a binding domain attached to a nucleic acid domain, wherein the binding domain is capable of specifically binding to the analyte target and the nucleic acid domain is capable of specifically binding to a capturing agent, wherein the nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the nucleic acid domain and the analyte target upon exposure to a light energy; (b) exposing the sample to the light energy; and (c) contacting the sample with the capturing agent to isolate the analyte target from the sample (isolated analyte target).

[0129] In some aspects, the capturing agent comprises any substance that is capable of binding to the nucleic acid domain and thereby, capture the moiety comprising the nucleic acid domain. In some aspects, the capturing agent comprises a bead. The use of such capturing agent in isolating an analyte target is illustrated in FIG. 5. In some embodiments, a microRNA target may be captured directly to a first oligonucleotide capture probe attached to a solid surface, a second capture probe may be used to capture another region of the microRNA, or a region that has been ligated, extended, or otherwise attached to the miRNA prior to capture with the two probes. Subsequently, amplification moieties may be used to increase signal. These may be attached to the second capture probe. In some embodiments, a t-junction is formed between the first and second capture probes, and the t-junction comprises a nucleotide modification capable of forming a covalent bond. In other embodiments, the covalent bond may be formed with the captured target nucleic acid and the probes, or with the probes and the signaling moiety which is also comprised of a labeled nucleic acid. The t-junction may be anywhere between 1 and 20 bases long. The t-junction preferably has a lower melting temperature Tm compared to all other target-probe duplex Tms in the multiplex reaction mix.

[0130] In some aspects, the isolating method provided herein further comprises amplifying the isolated analyte. In some aspects, the isolating method further comprises separating the isolated analyte from the capturing agent. In some aspects, the separatingcomprises applying a light energy of a different wavelength compared to the wavelength of the light energy to form the covalent bond. In some aspects, the separating comprises applying a light energy with a wavelength of about 312 nm. In some aspects, the separating occurs prior to the amplifying.

[0131] Some aspects of the present disclosure relate to methods of increasing a concentration of an analyte target in a sample. In some aspects, the method comprises (a) contacting the sample with a moiety described herein (e.g., oligonucleotide), which comprises a binding domain attached to a nucleic acid domain, wherein the binding domain is capable of specifically binding to the analyte target and the nucleic acid domain is capable of specifically binding to a capturing agent, wherein the nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the nucleic acid domain and the analyte target upon exposure to a light energy; (b) exposing the sample to the light energy; (c) contacting the sample with the capturing agent; and (d) collecting the moiety from the capturing agent, wherein the concentration of the analyte target is directly correlated with the concentration of the first moiety collected.

[0132] In some aspects, after the herein methods, the concentration of the analyte target is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%. In some aspects, the concentration fo the analyte target is increased by at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, or at least about 10-fold or greater.

[0133] Some aspects of the present disclosure relate to removing an impurity from a sample comprising an analyte target. In some aspects, the method comprises (a) contacting the sample with (i) a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, and (ii) a second moiety, which comprises a second binding domain attached to a second nucleic acid domain, wherein the first binding domain is capable of specifically binding to the impurity and the second binding domain is capable of specifically binding to a capturing agent, wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy;(b) exposing the sample to the light energy; (c) contacting the sample with the capturing agent; and (d) removing the impurity from the sample.

[0134] For any of the methods provided herein, the photo-reactive linker may comprise 3-cyanovinylcarbazole nucleoside (CNVK), D-threoninol (CNVD), benzophenone, phenyl azide, tetrafluorophenyl azide, hydroxyphenyl azide, diazirine, trifluoromethylphenyl diazirine, psoralen, phenoxyl radical trapper, or any combination thereof. In some aspects, the photo- reactive linker isCNVK. In some aspects, the photoreactive linker isCNVD.

[0135] A method of detection of analytes may use antibodies on spectrally distinct particles such as, for example, Luminex MagPlex particles. FIG. 14 is an illustrative method of detecting a proximity based antibody interaction on a solid substrate such as a particle.

[0136] For example, as shown in FIG. 14A, oligos 1 and 2 may be bound to a pair of antibodies and hybridize to Capture Probe oligo 3 and Reporter Probe (oligo 4) to bring them in close proximity to the target protein or antigen (denoted by the triangle). The close proximity via the protein binding increases the probability of hybridization at a set temperature in the reaction compared to oligos that are not bound by the protein. ACNVK modification in either oligo 3 or 4 (denoted by z) may covalently bind to a thymidine in the reverse compliment strand under UV irradiation if oligos 3 and 4 are hybridized via the proximity reaction to the target protein. Formation of a covalent bond (denoted by x) between two oligos by proximity immunoassay allows for subsequent specific capture (FIG. 14C) and amplification by RCA (FIG. 14D), or other amplification by enzymatic, or hybridization of polymeric fluorochrome complexes, or HCR. As shown in FIG. 14B, the protein may not be present and therefore a covalent bond may not form during the UV irradiation. Capture of oligo 3 with the sequence attached to the encoded particle may also use inducible covalent bond formation to anchor the amplification complex to the particle before and during optical interrogation.

[0137] Other forms of amplification may be possible for detecting a bimodal distribution of encoded particles, including, for example, detection of single antigen per bead binding events. As shown in FIG. 14D, a 3’ primer from covalently linked oligo 4 may hybridize to a circular DNA construct or plasmid, and Rolling Circle Amplification (RCA) may take place. Labels may be added by fluorescently labeled oligonucleotide probes that hybridize to the RCA product. FIG. 14E illustrates an RCA product that is attached to the bead after a proximity based immunoassay reaction, wherein the antibodies and attached oligos 1and 2 have been removed by stringent washing. Once the covalent bonds are formed between the Capture Probe (oligo 3) and Reporter Probe (oligo 4), the other binding events are not necessary. FIGS. 14D and 14E also represent a preformed nanoball that is capable of hybridizing to a segment of oligo 4. This preformed oligonucleotide may be manufactured ahead of the assay, and may consist of a preformed RCA product, with labels attached, a biological construct such as a viral capsid with labels attached or any other natural polymer structure with multiple fluorochromes attached. FIG. 14F illustrates the use of dyed nanoparticles, that may be internally dyed as well as have attached oligonucleotides, which are also dyed. The oligonucleotides attached to the nanospheres may hybridize with Reporter Probe oligo 4 and may also form covalent bonds with oligo 4. FIG. 14G illustrates a branched DNA structure with multiple fluorochromes that hybridize to the Reporter Probe oligo 4. In FIG. 14, Oligo 2 or Oligo 4 (Reporter Probe) comprise an additional modification or sequence such as biotin, desthiobiotin, an oligonucleotide sequence, or other binding moiety or ligand, so as to bind the Reporter Probe to a solid surface, and perform a wash step. This may remove the Oligo 3 strands that are not covalently bound to the Capture Probe, such that there is no competition for oligo 3 strands ahead of hybridization to the encoded particle surface oligos.

[0138] Yet another form of amplification may comprise premanufacture of a long DNA oligos which could be between 100 and 20,000 bases long. This long single stranded DNA molecule could be preferably 4000 to 5000 bases long. The long DNA oligo may comprise a first region which is complementary to oligo 102 or oligo 104 from FIG. 17b, and a second longer region which is complementary to labeled oligonucleotides. The labeled oligonucleotides may be labeled with a small molecule dye, biotinylation, or other label. They may be manufactured by T7 RNA polymerase methods, or oligo synthesis methods.

[0019] The methods described herein have advantages over other similar methods including PLA and PEA, as they do not require the use of enzymes to connect the proximity bound oligos, and therefore are not susceptible to enzymatic inhibition by the sample, and thus may not need as high of a dilution factor and can therefore potentially interrogate more volume of the sample, leading to higher sensitivity. Other advantages may come from covalent bonds: by forming covalent bonds after the immunoassay capture sandwich, it may be possible to tether the reporter antibody or large structure to the surface of the bead and prevent it from ripping off, whereas non-covalent bonds may not be able to hold as many fluorochormes or as large of a fluorochrome mass complex to the surface of the spectrally distinct particle. By usingDNA as the tethers, non-specific binding of other reporter antibodies may be prevented from adding to the background signal, and thus higher levels of multiplexing may be achieved on spectrally distinct particles. The methods may achieve enough signal and reach digital counting mode, which may allow for the use of more beads (to shift the antigen capture equilibrium) or more capture antibodies in favor of greater sensitivity, thus enabling more precise quantitative measurements, while using less reporter antibody (greater plex due to less cross-reactivity). The enzyme-free feature of the covalent linkage between the oligos does not negate the fact that the amplification and / or detection may be enzymatic. A binding event may turn into many reporter events by any means possible, such as, for example, hybridization of polymeric dye structures, HCR, polymerase, TSA, HRP, etc. Some amplification may need confinement such as HRP or TSA.

[0140] As depicted in FIG. 15, a blocked primer linked to a first antibody may be cleaved as a result of proximity hybridization to another oligonucleotide strand linked to a second antibody. As shown in FIG. 15 A, oligo 3 and 4 are bound in close proximity by connection to a first and second antibody that are bound to a target protein. As shown in FIG. 15B, the first and second antibodies may not be bound to a target protein, and therefore neither UV linking nor ribocleavage occur. FIG. 15C illustrates how after covalent binding of the UV linker, an endoribonuclease may be introduced to the reaction mix and incubated at a reaction temperature that would denature any non-covalent hybridization between oligos 3 and 4. An endoribonuclease (e.g., RNaseHII) may cleave the ribobases that are in a double stranded configuration with DNA in the opposing strand. This may free the oligo 3 from its 3’ blocker and may allow oligo 3 to act as a primer in a subsequent extension reaction (see, for example, FIG. 15E), extending on Rcut template. This may serve as the basis of signal generation by PCR, dPCR, or sequencing, where the amount of primer that extends on Rcut template may be directly proportional to the amount of target protein in the reaction mix.

[0141] Another option for detection in proximity -based protein assays is shown in FIGS. 16A-16D. Oligos 1 and 2 are covalently coupled to antibodies either at the ir5’ or 3’ ends. Oligos 3 and 4 hybridize to either oligos 1 or 2. Oligos 3 and 4 each comprise a sequence region that will hybridize to the other sequence and a UV linker (e.g.,CNVK orCNVD) which can form a covalent bond with a cytosine or a thymine base at the -1 position on the opposing strand. If the antibodies bind to a protein, then they are brought in close proximity to one another and the probability of hybridization between oligos 3 and 4 increases significantly.Whereas, in the case of no target protein binding between the two antibodies (FIG. 16B), the oligos 3 and 4 may not be in the hybridized state during the UV exposure period, and may, therefore, not form a covalent bond. A covalent bond formed between oligos 3 and 4, in the case where the protein is bound by both antibodies (FIG. 16A), ensures that the hybridization of these two oligos (including the region with the ribobase) maintains a hybridized state at elevated temperatures that are above the normal melt temperatures of the oligos without the covalent bond. An endoribonuclease (e.g., RNAse HII) may then be introduced at elevated temperatures, such that only the oligos that have formed a covalent bond may act as a substrate for RNAse based cleavage, and those oligos that remain in the single stranded state may not be cleaved by RNAse HII (FIG. 16C). RNAse HII requires a single ribobase hybridized opposite a DNA strand in order to act as a cleavable substrate. As shown in FIG. 16A and 16C, Oligo 3 comprises a sequence with a ribobase and a region capable of forming a covalent bond upon UV exposure to an opposing strand (Oligo 4) and also may comprise a 3’ extension blocker (e.g. Carbon3 spacer, inverted dT, etc.). As shown in FIG. 16C, the Oligo 3 strand is cleaved at the ribobase, removing the extension blocker and allowing oligo 3 to now act as a primer to extend along a template oligo in a subsequent step. An exemplary template for oligo 3 may include a plasmid for rolling circle amplification-based detection on the surface of an encoded particle, wherein a capture probe on the surface of the encoded particle has hybridized to a region of oligo 3, and may also form a UV induced covalent bond with oligo 3, in order for detection of the RCA amplification product to be multiplexed by association with the encoded particle type or bead region carrying reagents associated with a specific analyte. Another exemplary template type may be a template encoding a barcode, such that after extension with the unblocked primer, a barcode may not be incorporated into Oligo 3, and this barcode may hybridize to another sequence that has a fluorochrome or dyed nanosphere or other polymeric dye structure. Oligo 2 or Oligo 4 (Capture Probe) may comprise an additional modification or sequence such as biotin, desthiobiotin, an oligonucleotide sequence, or other binding moiety or ligand, so as to bind the Capture Probe to a solid surface and perform a wash step. This may remove the Oligo 3 priming strands that are not covalently bound to the Capture Probe, such that there is no competition for cut Oligo 3 priming strands ahead of hybridization to the encoded particle surface oligos. As shown in FIG. 16, Oligos 1 and 2 may be eliminated such that oligos 3 and 4 are attached directly to the antibodies, can form a covalent bond with each other, and the 3 ’ end of oligo 3 may still form an extension product after cleavage.

[0142] Another method of detecting a target protein by forming a covalent bond via a nucleic acid tether comprising UV linking modifications, such as, for example,CNVK orCNVD is shown in FIG. 17A and 17B. As shown in FIG. 17B, an antibody may be coupled to a DNA oligo (101) on one end, and the DNA oligo may be coupled to the surface of an encoded particle on the other end. Other options include direct coupling of the antibody to the bead surface and separately coupling DNA oligo (101) attachment probe to the same bead surface. The encoded particle (e.g., Luminex MagPlex Beads) may comprise a capture antibody and the attachment probe may be incubated with the sample that may contain the target protein. After binding to the target protein a reporter antibody may be introduced to the reaction and also incubated. The reporter antibody may be pre-coupled with reporter probe 102. The beads may then be washed and a tether oligo 103 may be incubated to allow hybridization to the reporter probe 102 and the attachment probe 101. After hybridization, the reaction may be exposed to 365 nm UV light, allowing the tether to form a covalent bond with both the reporter probe 102 and the attachment probe 101 to strengthen the complex. After UV linking, further stringent washes may be used to remove non-specific detection antibodies which do not have a matching 103 complement oligo which is specific to each bead / analyte / target combination. A non-limiting example of stringent wash mixtures may include solutions that degrade or denature proteins. Such mixtures may comprise low or high pH solutions, high temperatures, chaotropic agents, proteases, detergents, or a combination thereof. A detection probe (104) which may be linked to a polymeric fluorescent compound such as a dyed nanoparticle, a dyed organic substrate (e.g. plasmid, capsid, oligonucleotide, branched DNA, labeled nucleic acid strand hybridized to an unlabeled nucleic acid strand, etc.). The detection probe may also be incubated followed by UV light exposure, such that a covalent bond attaches each of the oligos that link between the fluorescent materials and the encoded particle. Without the covalent bond to tether the fluorescent materials to the encoded particle, the bond may not be strong enough to keep the fluorescent material and the encoded particle together during spectral analysis on the reader. Other exemplary types of readouts may include enzymatic or catalytic substances which produce signal in the presence of a substrate. These may substitute fluorescent material. In some embodiments oligo 101 may be directly attached to the solid surface, and oligo 102 may comprise a region that is complementary to 101, comprising a covalent linking modification and a second region that is complementary to 103 that does not comprise a covalent linking modification. Oligo 103 would therefore have one region complementary to 101 with no covalent linking modification and one region complementary to 103 that does comprise a covalent linking modification. Oligo 104 may comprise a region that is complementary to aregion on oligo 102 that comprises a covalent linking modification, or oligo 102 may comprise a second covalent linking modification within the region that is complementary to oligo 104.

[0143] As such in FIG. 18, microRNA (miRNA) or other nucleic acid target may be detected by forming a chain of covalently linked nucleic acid oligomers from a spectrally distinct particle (e.g., Luminex MagPlex microsphere) and a fluorochrome, which may come in the form of a fluorescent nanoparticle, or branched DNA structure, or other multidye compound. This full chain may only be formed in the presence of the target nucleic acid molecule, as hybridization brings bridging probes 111 and 112 into a t-junction structure where a nucleic acid modification such asCNVK orCNVD form a covalent bond with the opposing strand in the t-junction stem structure upon UV irradiation. After a first incubation period where bridging oligos 11 1 and 1 12 hybridize to the miRNA or other target, the reaction mix is then irradiated with 365nm UV light, to form a covalent bond between bridging probes 111 and 112. Bridging probe 112 may contain a ligand in the form of a sequence, a desthiobiotin, a biotin combined with a cleavable sequence, or other ligand to bind oligo 112 to a solid substrate which may be magnetic particles for washing. The spectrally distinct particles may then be introduced into the reaction mix and allowed to hybridize to oligo 111 by bead capture oligo 113, and UV linked by the UV linkable oligo modification. Alternatively, oligo 111 may itself be directly attached to the spectrally distinct particle. Next, the nanosphere or other fluorochrome connected to Oligo detection probe 114 may be allowed to hybridize to oligo 112 and covalently linked by UV irradiation to form a full chain of covalently bound oligos from the spectrally distinct microsphere to the fluorochrome complex for quantitative detection of miRNA that does not require a reverse transcription reaction, or any other enzymatic reaction. This reaction may be a purely chemical reaction and thus may be less susceptible to inhibition caused by the sample matrix on enzymatic reactions as well as less variability that may be associated with biological enzymatic reactions. The covalent bonds may also link directly to the microRNA or other nucleic acid target rather than through a t-junction stem. The t-junction stem covalent linkage may also be used to attach a connecting primer to the surface of a spectrally distinct particle instead of Oligo 112 and the detection probe 114. The connecting primer may be used in RCA or other amplification extension modalities to enzymatically produce extension products that may bind to oligos having fluorochromes attached thereto.

[0144] As shown in FIG. 19, chimeric DNA / RNA / DNA probes may be digested by RNase treatment if not perfectly hybridized to the microRNA target. Remaining intact probesmay be covalently bound to oligos attached to spectrally distinct particles such as Luminex beads, and also covalently bound on the other end to oligos attached to fluorochromes or fluorochrome complexes such as branched DNA as, for example, depicted in FIG. 19, or dyed nanospheres, or plasmids, or RCA extension products.

[0145] The aim of any embodiment described herein may be to achieve single molecule counting modalities wherein the signal produced by a single binding event is enough to differentiate each spectrally distinct particle from background particles. Particles or beads may be counted and examined individually in each spectrally distinct region of a multiplex bead reaction, and statistical methods may be used to quantify the starting protein from the individual bead fluorescent intensities. Some of the regions described in the oligos may be ordered differently such that what is described as a first region and a third region could interchange with each other as an example. Antibodies described herein may be substituted for other binding agents such as aptamers, proteins, or other. Aside from biotin / desthiobiotin streptavidin linkers, other linkers may be used which include chemical linkers including thiol bonds, which may bind intended oligos to solid substrates, and can subsequently released by addition of DTT or TCEP.

[0146] An example of how some oligos that connect with binding agents may be removed, FIG. 20 illustrates a derivation of FIG. 14, with fewer oligos needed. In this example, oligos 131 and 132 are coupled directly to the antibodies. A UV induced covalent bond is formed between oligo 132 and 131 in a proximity event driven by the presence of a target protein. Oligo 131 is covalently linked by UV to the encoded particle, by hybridization to oligo 134 and UV exposure. A primer (Oligo 133) is covalently linked to Oligo 132 by UV linkage to form a fluorescent extension product with a plasmid (RCA).

[0147] An example of directly coupling the capture antibody to the encoded particle to Oligo 141 is shown in FIG. 21 A. Oligo 142 may be coupled to the detection antibody and can act as a primer for RCA. The two oligos 141 and 142 may be covalently bound by a UV linkable modification (CNVK orCNVD) when held in close proximity by the presence of the target protein. A stringent wash protocol may be used, which may include use of a low pH or acid wash to remove proteins and antibodies after UV linking, or a high pH base wash (0.1N NaOH) may be used to remove non-covalently bound oligos, or a high heat wash may be used to remove either antibodies or nucleic acids that are not specifically or covalently bound.

[0148] Exonucleases may be used to remove strands that have not been covalently bound by UV linking oligo modifications, as shown in FIG. 22A. Thermolabile Exo I may catalyze the removal of nucleotides from linear single-stranded DNA in the 3’ to 5' direction and may be heat inactivated at 80°C in 1 minute. Exonuclease T may also cleave single stranded DNA in the 3’ to 5’ direction. If by proximity association via the protein, oligos 151 and 152 may have formed a double stranded confirmation that is strengthened by theCNVK covalent bond, then the Exo I may not degrade the 3’ end of oligo 151, and it may therefore be available to hybridize to the oligo 154 attached to the encoded particle. On the other hand, in FIG. 22B, when the protein is not present, then the oligos may not form a covalent bond and may not be double stranded, such that Exo I cleaves Oligo 151 from the 3’ end. This may prevent competition between positively bound and negatively bound Oligo 151 sequences during hybridization to the encoded particles, which may improve sensitivity of the reaction.

[0149] In some embodiments, a two-part or two-factor authentication of a proximity binding event may be designed as shown in FIG. 23A, with the subsequent hybridization and amplification on an encoded particle as shown in FIG. 23B. The illustrative embodiment depicted in FIG. 23A shows Oligo 232 is coupled directly the first of two target specific antibodies in an antibody pair. A first region of Oligo 232 is prehybridized with a first region of Oligo 234 and a second region of Oligo 232 is hybridized to a first region of Oligo 235, but not covalently bound. In an embodiment, Oligo 231 is directly coupled to the second of two target specific antibody pairs and is prehybridized to a first region of Oligo 233 but not covalently bound. When the two antibody pairs bind to the target protein, a second region of Oligo 233 may hybridize with a second region of Oligo 234 and a UV induced covalent bond may be formed through theCNVK modification in one of the two oligos. In an embodiment, when the two antibody pairs bind to the target protein, a third region of Oligo 233 hybridizes with a second region of Oligo 235 and a UV induced covalent bond is formed through theCNVK modification in one of the two oligos. Oligo 235 may comprise a desthiobiotin ligand in order to bind, wash and then release the oligo in order to remove excess Oligo 234, and Oligo 233 when they are not bound covalently to Oligo 235. Release of desthiobiotin after pull down to an avidin coated solid substrate which may be magnetic, may be achieved by including an excess of biotin which may have a higher affinity for the avidin or streptavidin. After desthiobiotin release of Oligo 235 and any covalently bound oligos, Oligo 234 may hybridize and UV link to an encoded particle. In an embodiment, if a covalent link has been made from Oligo 234 to Oligo 233, which is covalently linked to Oligo 235, then an amplification signalmay be generated and linked to Oligo 235. The amount of signal generated or the number of encoded particles with amplified signal may be quantified, and this may be correlated to the quantity of target protein in the reaction mix. Forms of signal amplification bound to Oligo 235 may include bDNA, RCA, nanoparticles, enzymatic reactions, catalytic reactions, or other amplification methods known in the art. In an embodiment illustrated in FIG. 23, two oligos are hybridizing to a single oligo which is connected to a first antibody, and one oligo (233) is hybridized to an oligo that is connected to a second antibody. When the first and second antibodies are bound to a target protein in close proximity, then an oligo (233) hybridizes and forms UV induced covalent bonds with the two other hybridized oligos from the first antibody complex, one oligo at the 3’end and another oligo at the 5’end. This covalently bound set of 3 oligos may produce a detectable signal that is indicative of the concentration of the target protein in the reaction mix. The signal may be generated by hybridizing one end of the set of 3 oligos to an encoded particle, and one or more labels may hybridize to another oligo in the set of 3. In an embodiment illustrated in FIG. 23C, the set of 3 covalently bound oligos forms a chain that is amplifiable by PCR, wherein a primer (236) may be partially hybridized to one oligo at its 5’ end, and partially hybridized to another covalently bound oligo at its 3’ end. Another primer (237) may be partially hybridized at its 5’ end to one of the oligos in the set of covalently bound oligos, and may hybridize to an extension product of the other primer (236). These bridging oligos may form a double stranded template for further PCR amplification. The covalent bond formation of a t-junction as a result of hybridization of t-junction forming may pair to a target oligonucleotide and subsequent priming of a bridge primer to an extension product of an opposing primer that extended one of the oligos in the t-junction may be used for target oligonucleotide detection including mRNA, miRNA, DNA, cfDNA, and other potential nucleic acid targets of interest.

[0150] In embodiments, a signal amplification method is employed that uses t-junction hybridization, covalent linking of an oligo which may comprise a label, heating to denature the hybridization pairs, cooling to hybridize new oligos, followed by subsequent cycles of t- junction hybridization, covalent linking of another oligo, heating to denature hybridization pairs and cooling for hybridization of new oligos for further covalent linking as exemplified in FIG. 24B. An embodiment is illustrated in FIG. 24B, which shows a pair of previously covalently bound oligos (241 and 242) linked as part of a proximity hybridization pair in a proximity linking assay (24A). This pair may hybridize to an oligo (243) attached to the encoded particle in 24B. Oligo 244 may hybridize to the pair by hybridizing to Oligo 241, andforming a t-junction with Oligo 243, which is attached to the encoded particle. The t-junction oligos comprise a UV inducible linking moiety, e.g., CNVK, and oligos 243 and 244 may be covalently bound at the t-junction. Oligo 244 may comprise one or more labels, or may be subsequently hybridized to other labeled oligos or primers in down stream amplification reactions. The process of denaturation, hybridization of oligo pairs to form t-junctions and covalent bonds, which may or may not be induced by UV light, followed by further cycles of denaturation, hybridization, and covalent bond formation may be a method of linear amplification which may or may not be associated with an encoded particle. For example, these covalently bound oligo pairs may be detectable by other means including bridge priming PCR, PCR, priming, sequencing, or other methods known in the art.

[0151] An issue with multiplexing immune assays is non-specific interactions between antibodies and microsphere surfaces. This non-specific interaction of detection antibodies with other assays increases non-specific background signal. In this embodiment, CNVK is used to lock on specific target capture oligos that are linked to antibody / oligo coupled microspheres and oligo coupled detection antibodies. The covalent UV linking of the oligos enable the use of a stringent wash step to remove non-specifically bound detection antibodies reducing multiplexing background signal. In FIG. 25, a target specific capture antibody and an oligo labeled 101-Oligo are directly coupled to the surface of a microsphere. The 101-Oligo contains a unique amino acid sequence that is complementary to a linker oligo labeled 103. The detection antibody in FIG. 25 has oligo labeled 102-Oligo covalently coupled to it. The 102- Oligo contains two unique nucleic acid sequences, one sequence is complementary to 103- Oligo and the other sequence is complementary to a signal oligo labeled 104-Oligo. The 104- Oligo contains four complementary binding domains for biotinylated signal probes which can bind to streptavidin phycoerythrin to generate a fluorescent signal.

[0152] When there is specific capture of a target molecule with both capture and detection antibody, 102-Oligo and 101-Oligo will be in close proximity to each other. With the addition of 103-Oligo, after washing, 101-Oligo and 102-Oligo will become linked. The 103- Oligo contains a CNVK modification in the complementary region for both 101 -Oligo and 102-Oligo. In this embodiment, 104-Oligo also contains a CNVK modification in its complementary region to 102-Oligo. After all oligos are connected, UV light is applied to covalently link them together through the CNVK modification. If a non-target specific detection antibody containing its own unique 102-Oligo binds non-specifically to this assay, itwill not be able to hybridize with 103-Oligo and be covalently linked. If specific oligos are now linked, a stringent wash can be performed to destroy all protein binding leaving behind only specific signal.

[0153] As further described elsewhere in the present disclosure, the methods provided herein do not involve the use of an enzyme, e.g., for a first moiety and a second moiety to interact. Additionally, the methods provided herein do not require substantial dilution of the sample prior to the methods. Accordingly, in some aspects, the methods provided herein do not comprise diluting the sample prior to the detecting and / or isolating.

[0154] In addition to the herein methods, some aspects of the present disclosure relates to the use of an analyte detecting and / or isolated using the methods provided herein. Also provided herein is a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject an analyte detected and / or isolated using the methods provided herein or a composition comprising such analyte.

[0155] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Sambrook et al., ed. (1989) Molecular Cloning A Laboratory Manual (2nd ed.; Cold Spring Harbor Laboratory Press); Sambrook et al., ed. (1992) Molecular Cloning: A Laboratory Manual, (Cold Springs Harbor Laboratory, NY); D. N. Glover ed., (1985) DNA Cloning, Volumes I and II; Gait, ed. (1984) Oligonucleotide Synthesis; Mullis et al. U.S. Pat. No. 4,683,195; Hames and Higgins, eds. (1984) Nucleic Acid Hybridization; Hames and Higgins, eds. (1984) Transcription And Translation; Freshney (1987) Culture Of Animal Cells (Alan R. Liss, Inc.); Immobilized Cells And Enzymes (IRL Press) (1986); Perbal (1984) A Practical Guide To Molecular Cloning; the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Miller and Calos eds. (1987) Gene Transfer Vectors For Mammalian Cells, (Cold Spring Harbor Laboratory); Wu et al., eds., Methods In Enzymology, Vols. 154 and 155; Mayer and Walker, eds. (1987) Immunochemical Methods In Cell And Molecular Biology (Academic Press, London); Weir and Blackwell, eds., (1986) Handbook Of Experimental Immunology, Volumes I- IV; Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1986); ); Crooks, Antisense drug Technology: Principles, strategies and applications,2nd Ed. CRC Press (2007) and in Ausubel et al. (1989) Current Protocols in Molecular Biology (John Wiley and Sons, Baltimore, Md.).

[0156] All of the references cited herein, as well as all references cited herein and the amino acid or nucleotide sequences (e.g., GenBank numbers and / or Uniprot numbers), are incorporated herein by reference in their entireties.

[0157] The following examples are offered by way of illustration and not by way of limitation.IV. Examples

[0158] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.Example 1 - Exemplary Method of Multiplexing

[0159] Plasma will be diluted in PBS-TBN for approximately 1 hour with a pair of moieties (e.g., oligonucleotide). One of the moieties will be attached to a marker such as biotin. The plasma containing the moieties will be incubated (e.g., at 36C on a shaker). Two pairs of moieties will be designed for protein detection, having been precoupled to a split polyclonal antibody mixes for cytokine detection (e.g., interferon gamma and IL-6). Two pairs of moieties will be designed for nucleic acid target detection (e.g., miRNAs, e.g., miR-191-5p and miR- 141 -3p). UV light at 366 nm wavelength will be illuminated on the 96 well plate for about 5 minutes. Avidin coated magnetic particles (e.g., 25uL of 1 million) will be incubated and mixed with the reaction (e.g., for 30 min. at 36C), and removed for washing (e.g., with 150uL of PBS- TBN and a final wash with PBS).

[0160] Next, the particles will be removed and placed in dPCR master mix with primers and probes for detection of the moiety pair that did not have a biotin. The number of partitionswill be counted containing positive amplification for each analyte, and the analytes will be multiplexed by using different color probes.Example 2

[0161] 3-cyanovinylcarbazole nucleoside (CNVK1) and D-threoninol (CNVD2) are members of a class of photo-cross-linkers for DNA or RNA strands.CNVK andCNVD have very high photoreactivity and they enable selective photo-cross-linking of target DNA or RNA by photo-irradiation for a few seconds (Fujimoto et al., 2018).

[0162] As an example, sequence 5’-TGCA(CNVK)YCGT-3’ will bind to the T base in Is with >90% efficiency at 366nm wavelength 3’-ACGT-Z-Y’GCA-5’

[0163] The bond will break at 312nm wavelength in 60s. An A or G in the T position will not react at all. A C in the same position will react with a lower efficiency. TheCNVK molecule does not react with the base directly across from it, but rather the pyrimidine base that is 3 ’ of the base directly across from theCNVK modification. An oligo with a normal Tm of 40°C will shift to a Tm of 75.8°C upon UV linking, suggesting that the covalent bond is still breakable, but only at higher temps (Yoshimura et al., 2008).

[0164] Proximity based immunoassays such as Proximity Ligation Assay (PLA) or Proximity Extension Assay (PEA) use an enzyme to ligate or extend nucleic acid molecules attached to antibodies presumably only when the antibodies are in close enough proximity to allow the nucleic acids to interact. These methods can suffer enzymatic inhibitory effects of the sample matrix, typically serum or plasma, and therefore require massive dilutions of the sample, at least 1:100.

[0165] The proposed solution uses nucleobase-specific photoreactive linkers, which may include, but are not limited toCNVK orCNVD linkers, to link antibody coupled oligos that are attached to a protein in close proximity, as there is no inhibition from plasma or serum to aCNVK linkage event. This will allow greater sensitivity by increasing the volume of the sample per test. Additionally, in a capture sandwich immunoassay, the reaction comes to an equilibrium, but if the UV linker is forming covalent bonds between the primary and detection antibodies in close proximity it may shift the equilibrium and increase sensitivity of the assay. One further sensitivity advantage is that with the oligonucleotide covalent bonds formed, they could allow larger fluorescent moieties to attach during detection without breaking, due to thestronger bond compared to antigen / antibody ligand binding alone. An antibody antigen affinity bond may not be strong enough to keep a large mass detection moiety attached to the bead complex. Adding a covalent bond will strengthen the attachment, such that a nanosphere, or other labeled polymer can maintain its attached configuration during optical interrogation.

[0166] In some embodiments a first oligo (oligo 3 in FIG. 2) attached to a first antibody complex comprises a biotin or other binding moiety, such that after UV linking to a second oligo (oligo 4 in FIG. 2) attached to a second antibody complex, the second oligo is removed from solution by binding of the binding moiety of the first oligonucleotide strand. The second oligo is used as a detection sequence which may be detected by multiple types of methods, including but not limited to Polymerase Chain Reaction (PCR), digital PCR, sequencing, amplification, or bead detection including xMap bead detection. The presence of the second oligo after the removal and wash procedure using magnetic or other particles can be directly correlated to the concentration of analyte or antigen in solution. Other types of analytes including but not limited to proteins, nucleic acid, mRNA, miRNA, cell-free DNA may be simultaneously interrogated in a single workflow by using similar wash and detect methods, including proximity UV linking.

[0167] In, for example FIG. 2A, a first oligo (oligo 1 in FIG. 2A) may be attached to a first antibody. A second oligo (oligo 2 in FIG. 2A) may be attached to a second antibody. A third oligo (oligo 3 in FIG. 2A) may comprise a biotin or other binding moiety and may hybridize to oligo 1. A fourth oligo (oligo 4 in FIG. 2A) may hybridize to oligo 2. Oligo 3 may comprise a photoreactive linker. Oligo 4 may comprise a photoreactive linker. The photoreactive linker of oligo 3 and / or 4 may form a covalent bond between oligos 3 and 4 upon exposure to a light energy when the first antibody and the second antibody are both bound to the target analyte. The fourth oligo may be removed from solution by binding of the binding moiety of the third oligo. The fourth oligo may be used as a detection sequence, which may be detected by multiple types of methods, including but not limited to Polymerase Chain Reaction (PCR), digital PCR, sequencing, amplification, or bead detection including xMap bead detection. The presence of the fourth oligo after the removal and wash procedure using magnetic or other particles may be directly correlated to the concentration of analyte or antigen in solution. Other types of analytes including but not limited to proteins, nucleic acid, mRNA, miRNA, cell-free DNA may be simultaneously interrogated in a single workflow by using similar wash and detect methods, including proximity UV linking.

[0168] Oligo 3 may be coupled to biotin (B) and form aCNVK UV link with Oligo 4. Oligo 3 may also use other binding moieties including oligonucleotide sequences that are hybridized for capture. Oligo 3 may also comprise barcodes or unique molecular identifiers for sequencing applications. After proximity linking induced by UV linking in the presence of analyte, the biotin may be purified and washed, while connected to oligo 4. Oligo 4 may then be detected using PCR with forward and reverse primers at each proximal end of oligo 4 (illustrated, for example, in FIG. 3B). A fluorochrome such as a small molecule dye may also be attached to oligo 4 for hybridization detection on a microarray or bead-based microarray. In other amplification methods, a first primer may bridge theCNVK region spanning from Oligo 4 at its 5’ end to Oligo 3 at its 3’ end, thus carrying some sequence specificity from one oligo to another for confirmation of the match between Oligo 3 and Oligo 4 during the assay (illustrated, for example, in FIG. 3A). In other amplification embodiments, a primer may migrate from Oligo 3 to Oligo 4 through branch migration exemplified by Kishi et.al. (2022) (illustrated, for example, in FIG. 3C). In yet further embodiments, Oligo 4 may be used to prime a plasmid to create a rolling circle amplification product which is further detected by hybridization of the RCA product to a complimentary oligo attached to a bead or solid surface and the RCA product is also labeled with a labeled complementary oligo.

[0169] In, for example, FIG. 2B, a first oligo may be attached to a first antibody and may comprise a biotin or other binding moiety, and may further comprise a photoreactive linker. A second oligo may be attached to a second antibody, and may comprise a photoreactive linker. The photoreactive linker of oligo 1 and / or 2 may form a covalent bond between oligos 1 and 2 upon exposure to a light energy. The second oligo may be removed from solution by binding of the binding moiety of the first oligo. The second oligo may be used as a detection sequence which may be detected by multiple types of methods, including but not limited to Polymerase Chain Reaction (PCR), digital PCR, sequencing, amplification, or bead detection including xMap bead detection. The presence of the second oligo after the removal and wash procedure using magnetic or other particles may be directly correlated to the concentration of analyte or antigen in solution. Other types of analytes including but not limited to proteins, nucleic acid, mRNA, miRNA, cell-free DNA may be simultaneously interrogated in a single workflow by using similar wash and detect methods, including proximity UV linking.

[0170] In FIG. 2, Oligo 3 is coupled to biotin (B) and forms aCNVK UV link with Oligo 4. Oligo 3 may also use other binding moieties including oligonucleotide sequences that arehybridized for capture. Oligo 3 may also comprise barcodes or unique molecular identifiers for sequencing applications. After proximity linking induced by UV linking in the presence of analyte, the biotin may be purified and washed, while connected to oligo 4. Oligo 4 can then be detected using PCR with forward and reverse primers at each proximal end of oligo 4. A fluorochrome such as a small molecule dye may also be attached to oligo 4 for hybridization detection on a microarray or bead-based microarray. In other amplification methods, a first primer may bridge theCNVK region spanning from Oligo 4 at its 5’ end to Oligo 3 at its 3’ end, thus carrying some sequence specificity from one oligo to another for confirmation of the match between Oligo3 and Oligo 4 during the assay. In other amplification embodiments, a primer may migrate from Oligo 3 to Oligo 4 through branch migration exemplified by Kishi et.al. (2022). In yet further embodiments, Oligo 4 may be used to prime a plasmid to create a rolling circle amplification product which is further detected by hybridization of the RCA product to a complimentary oligo attached to a bead or solid surface and the RCA product is also labeled with a labeled complementary oligo.

[0171] In the same assay and workflow as the proximity immunoassay provided herein, a nucleic acid analyte such as a miRNA or other nucleic acid target may also be processed and detected using proximity linking of two or moreCNVK orCNVD oligos. Amplification by PCR, dPCR, or sequencing may also be performed in a similar manner as the oligos recovered from the proximity immunoassay after solid surface removal and wash. One advantage to forming a t-junction cross-link for miRNA is that a reverse transcriptase step may be avoided, before other downstream amplification applications, such as sequencing or PCR.

[0172] A 5’biotin labeled first oligo is covalently bound by a UV linker to a second oligo when both are hybridized to the miRNA, but do not bind when the miRNA is not hybridized. Downstream detection methods of the second oligo are directly correlated with the amount of miRNA in solution.

[0173] Other direct bead-based proximity immunoassay methods such as when using xMap technology by Luminex are illustrated in FIG. 5.

[0174] These methods may be highly multiplexed such that thousands of protein or nucleic acid analytes are detected simultaneously.

[0175] Other workflow embodiments may include , light induced linking, followed by a sequence specific capture of a second probe and wash, followed by a sequence specificcapture of a first probe and wash, followed by amplification of the second probe or amplification of the combined first and second probe.

[0176] Other forms of amplification may include isothermal amplification techniques.

[0177] In FIG. 6: Photo-crosslinking oligos may also be useful as a specific extraction chemistry for concentrating target nucleic acid molecules and for preparing clean nucleic acid target samples for downstream applications. In this extraction embodiment, oligonucleotide sequences that are complimentary to the target of interest may hybridize to said targets after cell lysis. They may contain a photo inducible linker and also a binding moiety in order to pull the target out of solution by binding to a solid surface such as a magnetic particle. Once the target is removed from solution is may be amplified in downstream applications by PCR or RT-PCR or other amplification methods directly while attached to the solid surface, or the target may be released from solid surface prior to amplification by illumination with wavelengths near 312 nm. Other embodiments used for extraction of nucleic acid targets may replace the biotin with an oligo TAG which is captured by an anti-TAG oligo on the surface of a solid substrate such that the TAG / anti-TAG complex may be separated later by heat or pH rather than separating the photocleavable linker from its target near 312nm wavelength illumination.

[0178] In some aspects, a dual oligo linker may be used for detecting protein, while a single oligo linked to a nucleic acid target may be used in the same protocol to purify that protein signature (dual oligo complex) and the nucleic acid target (photo linked to a single oligo with binding moiety) using a solid substrate with a corresponding binding moiety to remove them from solution in preparation for downstream processing such as amplification and analysis.Example 3

[0179] A proximity-based UV locking assay usingCNVK modified oligonucleotides shows pre-optimization sensitivity for an IL-1 beta protein assay down to 100 pg / mL. This experiment showsCNVK modified signal detection oligo strands hybridize to each other due to being brought in proximity by capture oligo coupled antibodies bound to IL- 1 beta target in proximity. The experiment also shows that the UV exposed samples lock together covalently and only UV locked oligos can be detected in PCR.

[0180] In a Proximity UV Locking Assay, two antibodies are conjugated to oligol and oligo2 capture strands as illustrated, for example, in FIG 7. Oligo3 and oligo4 proximity strands will bind to oligol and oligo2 capture strands which have a hybridization melting Tm >70°C. Oligo3 has a 9-base complementary sequence containing a CNVK modified base to Oligo4. The 9-base complementary sequence has a Tm <16°C minimizing nonspecific hybridization when not bound to a target in solution. When two antibodies containing strands 1 and 2 bind to their target in proximity, strands 3 and 4 will hybridize to each other. When exposed to 366nm UV light, theCNVK base on oligo3 will covalently crosslink to an adjacent thymine or cytosine base on oligo4 locking the two strands together. The UV linked complex is pulled down by streptavidin beads through the biotin modified strand 4. The beads are then washed to remove any unbound antibodies and oligos for detection of oligo4 in PCR by bridge priming with bound oligo3.

[0181] Specific detection of UV linked strands 3 and 4 is capable through a reverse primer that will only bind to the two strands hybridized together. If strands 3 and 4 are only hybridized and not UV linked through theCNVK bond they will denature during a hot start 95 °C pre-incubation phase of PCR and not rehybridize at a 60°C anneal temperature. OnlyCNVK linked strands will amplify during PCR. FIG. 8, for example shows the illustrative specific binding location of the bridging primer when strands 3 and 4 are hybridized to each other.

[0182] The data in the experiment show that proteins can be detected through proximity antibody binding which bringsCNVK modified oligos in close proximity to allow for their hybridization. Once subjected to 366nm UV light, the proximity binding is locked in, which can then be detected in PCR. The Proximity UV Locking Assay showed positivity down to 1 OOpg / mL compared to when no target was present.

[0183] Materials And Methods

[0184] Human IL-1 beta / IL-lF2 Samples and antibodies

[0185] Recombinant Human IL- 1 beta / IL- 1 F2 Protein was obtained from RnD Systems (201-LB) and reconstituted in PBS pH 7.4 (ThermoFisher) to .100 mg / mL. The IL1-B protein was further diluted to 100,000 pg / mL in PBS-TBN (Phosphate buffered saline, pH 7.4, 0.02% Tween 20, 1 mg / mL BSA, and .05% NaN3) and aliquoted in single use tubes and stored at - 80oC. For this experimental setup the IL-1 beta sample bank was diluted in PBS-TBN to 10000 pg / mL, 1000 pg / mL, 1000 pg / mL and 10 pg / mL. The antibodies used as proximity pairs wereanti-Human IL-1 beta / IL-lF2 polyclonal goat IgG purchased from RnD Systems (AF-201-NA) reconstituted in PBS to Img / mL.

[0186] Antibody Proximity Capture Oligos and Detection Probes

[0187] All oligos were purchased from Integrated DNA Technologies (IDT). The proximity antibodies were coupled to their capture oligos using copper free click chemistry.The proximity capture oligos were purchased with either an Azide modification on the 3’ (SL1- 3Z) or 5’ (SL2-5Z) end. SL1-3Z is a 40-mer and SL2-5Z is a 46-mer oligonucleotide each containing complementary sequences to signal detection probes. The signal detection probe RO_SL3 CNVK has 40 bases complementary to SL1-3Z and contains a Cy-3 modification on the 5’end and a CNVK modification 4 bases in from the 3’end. RO_SL3 CNVK also contains a 9 base complementary hybe region to detection probe SL4-H2-3b containing the CNVK for UV covalent binding. The signal detection probe SL4-H2-3b also has 21 bases complementary to SL2-5Z and contains a 3’ Biotin modification. All sequences are shown in Table 1.Table 1

[0188] SL1 3N (SEQ ID NO: 8) comprises a nucleic acid sequence with a first region that hybridizes to SL4H23b (SEQ ID NO: 11) and a binding moiety on the 3’end which is attached to a first target protein specific antibody.

[0189] SL25N (SEQ ID NO: 9) comprises a nucleic acid sequence with a binding moiety on the 5’ end which is attached to a second target protein specific antibody.

[0190] RO_SL3CNVK (SEQ ID NO: 10) comprises a nucleic acid sequence with a fluorochrome at the 5 ’end, followed by a first region that is the same sequence as the forward primer SL3, a second region that is the same sequence as probeSL3, the first and second regions may also be complementary to the first region of SL1 3N a third region that is the reverse complement of the 3’ region of reverse primer SL1_RP-AFM2, a fourth region that is the reverse complement of the first 5’ region of SL4H23b (SEQ ID NO: 11), which fourth region comprises one or more photoreactive moieties, such asCNVK orCNVD.

[0191] SL4 H2 3b (SEQ ID NO: 11) comprises from 5’ to 3’ a nucleic acid sequence with a first region that is the reverse complement to the fourth region of RO_SL3 CNVK (SEQ ID NO: 10), a second region that hybridizes to the first region of SL1 3N (SEQ ID NO: 8) and a ligand (biotin) at the 3 ’ end.

[0192] SLl_RP-AFm2 is a bridging primer comprising a nucleic acid sequence from 5’ to 3’ a first region which hybridizes to the second region of SL4 H2 3b (SEQ ID NO: 11) and a second region which provides a spacer, and a third region which hybridizes to the third region of RO SL3CNVK (SEQ ID NO: 10).

[0193] Antibody Crosslinker Modification

[0194] The proximity antibodies were coupled to their capture oligos using copper free click chemistry. One lot of polyclonal goat anti-ILl-beta IgG was split into lOOug aliquots. Dibenzocyclooctyne-PEG4-N-hydroxysuccinimidyl ester (NHS-PEG4-DBCO) (SigmaAldrich) was rehydrated in DMSO to 5mM. 1.3uL of NHS-PEG4-DBC0 was added to each batch of antibody resulting in a 10: 1 NHS-PEG4-DBCO Antibody ratio. The antibodies were mixed and incubated for 1.5hr at room temperature. Following the incubation, the excess NHS- PEG4-DEBCO was removed using a 7K Zeba (Thermo Fisher) size exclusion column. The antibody concentrations and degree of labeling were calculated using a Nanodrop2000 A280 / A309 using the following formula.

[0195] Protein Concentration(M) = ((A280 - 0.9(A309))*Dilution factor) / 203,000

[0196] Protein Concentration (mg / mL) = Protein Concentration (M) * 150000

[0197] Degree of labeling (DOL) = (A309*Dilution Factor) / (12000*Protein Concentration)

[0198] The molar extinction coefficient in cm-lM-1 of a typical IgG at 208nm is 203000. The correction for the DBCO contribution to the A2800 is 0.9. The molecular weight of a typical IgG is 150000(g / L). The approximate molar extinction coefficient in cm-lM-1 of the DBCO group is 12000.

[0019] Antibody-Oligo Conjugation

[0200] Conjugation of SL1-3Z and SL2-5Z was performed by directly adding the Azide modified oligos to the DBCO modified antibodies. The oligos were rehydrated in molecular grade water (Invitrogen) at lOOuM. The oligo inputs into conjugation were calculated based off the calculated protein concentration from the previous step for a 3:1 Oligo Antibody ratio. The Antibody: Oligo mix was incubated overnight at 4°C. Post conjugation, the mix was concentrated and cleaned up for HPLC purification using a 50K Amicon filter (Sigma Aldrich) and a IX wash with 500uL PBS spun down at 14000g for lOmin. Approximately 20uL were remaining and the volume was brought up to 50uL with 30uL of PBS.

[0201] HPLC Antibody-Oligo Purification

[0202] The Antibody-oligo conjugations were purified using Ion-Exchange HPLC chromatography (Agilent 1100 Series). The analytical IEX column was purchased from Agilent (5190-2463 Bio SAX, NP3, SS). The column was heated to 30°C during purification. The buffer for elution was 50mM Phosphate Buffer Solution pH 7.4 (Sigma-Aldrich). The saltgradient for elution was started with 100% buffer A (50mM Na2HPO4 / NaH2PO4 lOOmM NaCl) and over the course of 16min was changed to 15% buffer A and 85% buffer B (50mM Na2HPO4 / NaH2PO4 ImM NaCl). The flow rate used on the analytical column was 0.8 ml / min. FIG. 9 is an example of the HPLC chromatograph of the oligo conjugated anti-IL- Ibeta antibody and the peaks fractionated. The collected fractions of Antibody- Oligonucleotide conjugates were concentrated using an Amicon 50K spin column and brought up to 40uL. The concentrations were determined using the bicinchoninic acid assay (BCA) on the nano-drop200 and building a standard curve with polyclonal goat IgG (Sigma-Aldrich).

[0203] Streptavidin Binding Beads

[0204] Biotin binding beads were purchased from ThermoFisher (Dynabeads MyOne Streptavidin Tl). The beads were washed 3X in 400uL PBS-TBN and diluted to 2ug / mL. The input into the assay for biotin binding and wash was lOug per well.

[0205] Proximity CNVK Locking Assay

[0206] Ten microliters of sample dilution buffer [PBS-TBN, .Img / mL sheared salmon sperm DNA (Invitrogen)] was added to all wells. Ten microliters of antigen sample were added to their respective wells and PBS-TBN was added to negative well. Proximity antibodies were mixed in PBS-TBN to a concentration of .5nM and lOuL was added to all wells except no antibody blanks. Signal detection probes were diluted in TE pH 8.0 (Invitrogen) to a concentration of .5nM and lOuL was added to all wells. The reaction was incubated at 37°C for Ihr and then incubated at room temperature for Ihr both incubations shaking at 900 RPM. After incubation, 1 plate was exposed to UV for 4min and the other plate received no UV treatment. Both plates were combined into a new plate for the remainder of the experiment. 5 microliters of biotin binding beads were added to all wells and incubated for Ihr at room temperature shaking at 900 RPM. After biotin strand pull down, the biotin binding beads were washed on a plate bar magnet 4X with 150uL of PBS-TBN resuspending beads up and down. The beads were resuspended in lOOuL and transferred to a new PCR plate. The beads were then washed 2X with PBS-TBN. 5uL of TE was added to all wells in the final step to keep the beads wet.

[0207] Detection by Real Time PCR

[0208] For the real time PCR detection, all wells were prepped by mixing the washed and resuspended biotin binding beads with 20uL of PCR master mix; lOmM Tris pH 8.0, 2.5mM MgCl, 50mM potassium chloride (Invitrogen), 200uM each dNTP’s (NEB), 200nM of each primer (forward: 5’- GCACGTCGTGCGAGAGTAT-3’ (SEQ ID NO: 15) and reverse: 5’-CATGCAGACAAAGTGCTACAATCGCAG-3’ (SEQ ID NO: 16), 300nM Taqman probe ( / 5TexRd-XN / TCGCTTGCACCTGATGCTAC / 3BHQ_2 / (SEQ ID NO: 17)), and ,2U / uL Taq polymerase (Diasorin). The PCR plate was sealed and spun down at 2000G for 30sec. A two- step PCR protocol was run on an ABI7500 with an initial denaturation at 95°C for 2min 20 sec, followed by lOsec denaturation at 95°C; and 30sec annealing at 60oC for 45 cycles.

[0209] Results

[0210] When no antibody and no protein target are present, there is a low level of nonspecific interaction of strand 3 and 4 in solution. The data in FIG. 10 shows that when the assay is subjected to UV treatment, a small amount of strands 3 and 4 are linking through theirCNVK bond compared to when no UV treatment is performed.

[0211] When antibodies containing strand 1 and 2 are present with strands 3 and 4 but no IL-lbeta target is present, a low level nonspecific antibody: antibody interaction is occurring in solution. The data in FIG. 11 show that with antibodies present compared to not being present results in earlier Cts after the UV treatment. The no UV treatment still shows very minimal signal.

[0212] The protein target was diluted to 10000 pg / mL (.59nM), lOOO pg / mL (,059nM), lOOpg / mL (.0059nM) and lOpg / mL (.00059nM) and were tested in duplicate. There is clear separation down to 100 pg / mL compared to when no target is present. This can be seen in FIG. 12. FIG. 13 shows the average Ct for all samples subjected to UV treatment.

[0213] Conclusion

[0214] The data in the experiment show that proteins can be detected through proximity antibody binding which bringsCNVK modified oligos in close proximity to allow for their hybridization. Once subjected to 366nm UV light the proximity binding is locked in, which can then be detected in PCR. The Proximity UV Locking Assay showed positivity down lOOpg / mL compared to when no target was present.Example 4: Bead-Based Detection by Covalently Linking Oligos to Dye Complexes

[0215] 25uL of plasma is diluted in PBS-TBN 1 :3 for 1 hour with antibodies and oligonucleotide pairs. Below is an example of a single target reaction. A first IL-6 specific antibody is coupled with Oligo 1 (FIG. 14C): 5’-GGCTCCCATGTTGGAATTATTCGGCGCATCTGTTATCTAGTT / Azide / (SEQ ID NO: 18) by reacting the azide at the 3’end with antibody that has been activated with DBCO activated antibody. A second IL-6 specific antibody is coupled with Oligo 2 (FIG. 14C): 5’Azide / TCGCTCGCAGTATAAATATTCGAAGGCTAGTTCCAAATTGTCC / 3SpC3 / (SEQ ID NO: 19).

[0216] An encoded particle (Luminex magbead) is coupled with a bead linking oligo. The bead linking oligo contains one or more CNVK modifications and is linked to carboxy groups on the bead surface via an EDC reaction to the amino modified 3 ’ end of the oligo. Yjr bead linking oligo: 5'-TGCGA(CNVK)ACGTAATAACAAAAAACAAAAAA / 3’AmMC12 / (SEQ ID NO: 20). One of the oligos (oligo 3, FIG. 14C) comprises a first, second, and third binding region. Oligo 3: 5'-AATCTTACGTTTCGCAAGATAATTCCAACATGGGAGCCGACGAGGTCGCTACGC A / i3Cyan / GTAT / 3SpC3 / (SEQ ID NO: 21).

[0217] From 5’ to 3’, the first region hybridizes to the bead linking oligo, which is capable of forming a covalent bond between a thymine base and the CNVK modification. The second region hybridizes to a portion of Oligo 1, which is coupled to the first IL-1 reactive antibody. The third downstream region, which is closest to the 3’ end, hybridizes to oligonucleotide 4, when held in close proximity via a target protein which is bound by the pair of antibodies. The regions described above may be in a different order, for example, the second region and the third region may switch places, or the fourth region may precede the first region.

[0218] Oligonucleotide 4, FIG. 14C also comprises 3 regions from 5’ to 3’ respectively. The first region is capable of hybridization to the 3rd region of oligo 3 when held in close proximity via a target protein that is bound to the first and second antibodies. The second region hybridizes to a portion of Oligo 2, which is coupled to the second IL-6 specific antibody. The third region may hybridize to a circular oligonucleotide or plasmid and act as a primer in a signal generating rolling circle amplification reaction. The priming region must be at the 3’end but the other regions may be configured in a different order. The 5’ end of the oligo ismodified with a desthiobiotin ligand in order to bind, wash and then release the oligo in order to remove excess Oligo 3 which is not bound covalently to Oligo 4, ahead of Oligo 3 hybridization to the encoded particle surface bound oligos. Release of desthiobiotin after pull down to an avidin coated solid substrate which may be magnetic, is achieved by including an excess of biotin which has a higher affinity for the avidin or streptavidin.

[0219] Oligo 4: 5'ATACTTGCGGGACAATTTGGAACTAGCCTTGACATCTTCAAGTAATCCAGGATAG GCT / 5deSBioTEG / (SEQ ID NO: 22).

[0220] . For this experimental setup the IL-1 beta sample bank was diluted in PBS- TBN to 10000 pg / mL, 1000 pg / mL, 1000 pg / mL and 10 pg / mL. The antibodies used as proximity pairs were anti-Human IL-1 beta / IL-lF2 polyclonal goat IgG purchased from RnD Systems (AF-201-NA) reconstituted in PBS to Img / mL. Both antibody pairs are incubated at 0.2nM concentration along with all 4 oligos at 0.2nM concentration in a 96 well microwell plate for 1 hour at 37°C. Next, 10,000 encoded particles with bead linking oligos attached, are added and incubated at 37°C for another 30 min. UV light at 366nm wavelength illuminates the 96well plate for 5 minutes after 30 min. incubation at room temperature. Washing with 150uL of PBS-TBN 4X, followed by a plate transfer, a final wash and suspension in 60uL of hybridization buffer (0.05% tween 20 in 2xSCC, pH 8.0 (2X SCC: 0.3M NaCl, ).03 M sodium citrate, pH 8.0). A circularized padlock probe (circular template) with 3 probe binding sites is added to the RCA mix at 30nM.

[0221] Circular template: 5'-phosphate-GATTACTTGAAAGACAAAGAA CAT GCG CAG TAC ACT CAAAGAA CAT GCG CAG TAC ACT CAAAGAA CAT GCG CAG TAC ACT CATAAACAAAA AGCCTATCCTG-3' -ligated at the 5’and 3’ ends (SEQ ID NO: 23).

[0222] After hybridization at 37°C for 30 min. the remaining circular template that is unbound is washed 2X with hybridization buffer, followed by addition of RCA mixture. The RCA mixture consists of 0.5mM deoxynucleotide mix (New England Biolabs), 0.33 U / ul phi29 DNA polymerase (Lucigen), 0.2mg / mL bovine serum albumin (BSA, New England Biolabs), 20nM fluorescently labeled DNA probe (IDT) and 0.1% Tween- 20 in 50mM Tris-HCl (pH 7.5), WmM (NH4)2SO4, and 10 mM MgC12.

[0223] Fluorescently labeled probe: 5'-Cy3-AGCCTATCCTGGATTACTTGAA -3' (SEQ ID NO: 24).

[0224] After RCA reaction incubation at 37°C for 2 hours, the beads are washed in lx PBS-TBN twice, and read on a Luminex flow cytometer instrument.

[0225] Other workflow embodiments may include, light induced linking, followed by a sequence specific capture of a second probe and wash, followed by a sequence specific capture of a first probe and wash, followed by amplification of the second probe or amplification of the combined first and second probe. Other forms of amplification may include isothermal amplification techniques, or HCR. In yet other derivations of the method described in FIG. 14, Oligos 1 and 2 may be eliminated such that oligos 3 and 4 are attached directly to the antibodies, can form a covalent bond with each other, and the 3’ end of oligo 4 may still form an extension product or otherwise bind to a fluorochrome complex.

[0226] Circular Template Preparation

[0227] A linear padlock probe with 3 probe binding sites is added to the RCA mix at lOnM. Linear padlock probe: 5'-phosphate-GATTACTTGAAAGACAAAGAA CAT GCG CAG TAC ACT CAAAGAA CAT GCG CAG TAC ACT CAAAGAA CAT GCG CAG TAC ACT CATAAACAAAA AGCCTATCCTG-3' (SEQ ID NO: 25). The linear padlock probe was combined with a bridging oligo: 5’- TTCAAGTAATC CAGGATAGGCT (SEQ ID NO: 26), which is similar to the primer region of oligo 4, during the ligation reaction.

[0228] The circular template for RCA was prepared from the linear single- stranded padlock probe by t4 ligase-catalyzed ligation process. Ligation process was carried out at 37°C for 120 min. with the reaction mixture containing 0.6 nmol of ligation probe, 1.2 nmol of linear padlock probe, and 200U T4 ligase in the lx reaction buffer provided by the manufacturer. After the deactivation of the T4 ligase at 65°C for 10 min., the exonucleases (400U Exol and 2000 U ExoIII) were applied to digest the linear DNA residue at 37°C for Ih. The enzymes were then removed by phenol-chloroform extraction, and the circularization products were desalted with a Biospin-6 column. The purity of the resulted circular template was verified by denatured 10% PAGE gel electrophoreses. The circular template was stored at -20°C.

[0229] DBCO Antibody Activation

[0230] Reconstitute DBCO-PEG4-NHS in DMSO to 5mM by adding 308uL to Img. Reconstitute Antibody to Img / mL in lOmM PBS pH 7.4 Add a molar ratio of 10 mmol DBCO / 1 mmol IgG by combining lOOuL (lOOug) of antibody to 1.5 mL PCR tube, adding in DBCO and incubating on ice for 2 hours. Remove excess DBCO and N-hydroxysuccinimide by-product and spec on Nanodrop. Follow instructions on 0.5mL Zeba 7k spin column to buffer exchange in PBS pH 7.2. Spec, the protein using a nanodrop instrument: Protein Concentration (M) = { [A280 - 0.90(A309)] * Dilution Factor} / 203,000. Degree of Labeling (DOL) = Moles of DBCO / Moles of Protein = (A309 * Dilution Factor) / (12000 * Protein Concentration)

[0231] DBCO Antibody Oligo Conjugation

[0232] Reconstitute Oligo in H2O to lOOuM. Add lOOuL (lOOug) of activated by DBCO antibody to 1.5mL PCR tube. Add Oligo amount to activated DBCO antibody at a ratio of 3 / 1 oligo to antibody respectively. Incubate overnight at 4°C, use 50k Amicon filter for concentration and clean up ahead of HPLC purification.Example 5: UV-Linkage Associated Ribocleavage Resulting in PCR Amplification Readout

[0233] As an example, the following oligos (ordered from IDT) are used to quantify target proteins in a reaction mix.

[0234] A 3’ linked oligo 1 (2SL 3N: 5’-GGCTCCCATGTTGGAATTATTCGGCGCATCTGTTATCTAGTT / 3AmMC6T / (SEQ ID NO: 27)) is coupled to a first antibody, and a 5’ linked oligo 2 (2SL5N: 5’- / 5AmMC6 / TCGCTCGCAGTATAAATATTCGAAGGCTAGTTCCAAATTGTCC / 3SpC3 / (SEQ ID NO: 28)) is coupled to a second antibody. In the reaction mix, the first antibody linked oligo 1 hybridizes to oligo 3, a 5’ biotinylated oligo comprising a first region that hybridizes to oligo 1 , a second region that hybridizes to a first region of oligo 4. This second region of oligo 3 comprises a ribobase and a modified base capable of forming a covalent bond upon UV irradiation (CNVK). Oligo 3 ( / 5’-5BiodT / GCTAATTCCAACATGGGAGCCAATATCTCGAGAATGAGGTCGCTACGrCA GTA / i3Cyan / T / 3sPC3 / (SEQ ID NO: 29)). Oligo 4 (5’-AATACTGCGTGGACAATTTGGAACTAGCCTTCGCTCGA / 3SpC3 / (SEQ ID NO: 30)) comprises a first region that will hybridize to the second region of oligo 3 only when held in close proximity via binding of the first and second antibodies to the target protein. Afterincubation in buffer, the reaction mix is exposed to UV light at 365nm wavelength for 4 minutes. The temperature of the solution can then be raised and RNAseHII added such that only oligos that have been covalently bound by the UV activated linker will remain bound at said temperature. The RNAse HII can subsequently be deactivated if it is a heat labile RNAseHII, or by addition of a stop reagent such as a chelator (e.g., EDTA). The biotin may also bind to avidin beads at elevated temperatures and the RNAseHII washed away. After biotin recovery and washes, the cleaved and uncleaved oligo 3 attached to the avidin particle can be added to a PCR reaction mix, where it may bind to the Rcut template. The cleaved oligo 3 ribo cut primers will extend on the Rcut template and the non-cleaved oligo 3 sequences will not extend on the Rcut Template. The number of cleaved oligo 3 sequences is proportional to the quantity of target protein in the reaction, and the quantity of cleaved oligo 3 sequences is determined by the cycle threshold (CT) value in PCR, or poisson calculated quantity in digital PCR, or by the number of reads in a sequencing reaction. Some of the regions described above may be configured in a different order.

[0235] The rcut Template is as follows: 5’-CGCTCGAGACTACACTGCAGCCTGGTGGATAGTCTCCGATCCTTGCCGTAGCGAC CTCATTCTCGAG (SEQ ID NO: 31).

[0236] This comprises a first region that is the same sequence as rprime, a second region that hybridizes to a taqman probe, and a third region that hybridizes to the 3 ’ end of the cleaved oligo 3. Two primers are used in the assay forward primer (5’- GCTAATTCCAACATGGGAGCCA (SEQ ID NO: 32)) which is the same sequence as the first region of oligo 3. The reverse primer (5’-CGCTCGAGACTACACTGCA (SEQ ID NO: 33)) is the same sequence as the first region of the rcut Template. The taqman probe sequence is 5’- / fluorophore / GATCGGAGACTATCCACCAGGC / quencher / (SEQ ID NO: 34).

[0237] In yet other derivations of the method described in FIG. 15, Oligos 1 and 2 may be eliminated such that oligos 3 and 4 are attached directly to the antibodies, can form a covalent bond with each other, and the 3 ’ end of oligo 3 may still form an extension product after cleavage. Other forms of oligo 3 cleavage may include restriction enzyme or nicking enzyme cleavage or USER enzyme mix (NEB) with a uracil base or others known in the art.

[0238] Proximity CNVK Locking Assay

[0239] After antibody / oligo conjugation and purification using standard techniques known in the art. Ten microliters of sample dilution buffer [PBS-TBN, .Img / mL sheared salmon sperm DNA (Invitrogen)] is added to all wells. Ten microliters of antigen sample were added to their respective wells and PBS-TBN was added to negative well. Proximity antibodies were mixed in PBS-TBN to a concentration of .5nM and lOuL was added to all wells except no antibody blanks. Oligos 3 and 4 were diluted in TE pH 8.0 (Invitrogen) to a concentration of .5nM and lOuL was added to all wells. The reaction was incubated at 37°C for Ihr and then incubated at room temperature for Ihr both incubations shaking at 900 RPM. After incubation, the plate is exposed to UV for 4min. Plate transfer of the reaction mix is used to further reduce unbound reagents that may have non-specifically bound to the side-walls of the wells. 5 microliters of biotin binding beads were added to all wells and incubated for Ihr at room temperature shaking at 900 RPM. After biotin strand pull down, the biotin binding beads were washed on a plate bar magnet 4X with 150uL of PBS-TBN resuspending beads up and down. The beads were resuspended in lOOuL and transferred to a new PCR plate. The beads were then washed 2X with PBS-TBN. 5uL of TE was added to all wells in the final step to keep the beads wet.

[0240] Detection by Real Time PCR

[0241] For the real time PCR detection, all wells were prepped by mixing the washed and resuspended biotin binding beads with 20uL of PCR master mix; lOmM Tris pH 8.0, 2.5mM MgCl, 50mM potassium chloride (Invitrogen), 200uM each dNTP’s (NEB), 200nM of each, 300nM Taqman probe, 2nM template, and .2U / uL Taq polymerase (Diasorin). The PCR plate is sealed and spun down at 2000G for 30sec. A two-step PCR protocol was run on an ABI7500 with an initial denaturation at 95°C for 2min 20 sec, followed by lOsec denaturation at 95°C; and 30sec annealing at 60°C for 45 cycles.Example 6: UV-Linkage Associated Ribocleavage with Encoded Particle Readout

[0242] Examplary oligos which may be used in a manner illustrated in FIG. 16, include the following:

[0243] Oligo 1:GGCTCCCATGTTGGAATTATTCGGCGCATCTGTTATCTAGTT / 3AmMC6T / (SEQ ID NO: 35)

[0244] Oligo 2: / 5AmMC6 / TCGCTCGCAGTATAAATATTCGAAGGCTAGTTCCAAATTGTCC / 3SpC3 / (SEQ ID NO: 36)

[0245] Oligo 3: 5’-GTTATTACGTTTCGCAAGATAATTCCAACATGGGAGCCGACGAGGTCGCTACGrC AGTA / i3Cyan / TA / 3SpC3 / (SEQ ID NO: 37)

[0246] Oligo 4:AATACTGCGTGGACAATTTGGAACTAGCCTTCGCTCGA / biotin / (SEQ ID NO: 38)

[0247] Encoded Particle surface oligo: 5'-TGCGA(CNVK)ACGTAATAACAAAAAACAAAAAA / 3’AmMC12 / (SEQ ID NO: 39)

[0248] The antibody pairs along with oligos 1 ,2, 3, and 4 are incubated with the sample which may contain the target protein in PBS-TBN overnight at room temperature. Next the 96 well plate is exposed to 365nm UV light for 4 minutes to covalently bind oligos 3 and 4 that are in close proximity via the protein binding to the antibody pairs. Avidin magnetic beads are mixed into the reaction mix for 4 hours at room temperature, and the sample is washed 2x to oligo 3 that is non-covalently bound to oligo 4. A 3rd wash removes the PBS-TBN wash buffer and replaces it with RnaseHII reaction buffer. After incubation with RnaseHII enzyme at 50C, the supernatant is removed (containing the cut Oligo 3 priming strands) and mixed with the encoded particles using spiked hybridization buffer (1.5xTMAC / 10mM MgC12) at room temperature overnight. The particle solution is then exposed to 365 nm UV light for 4 minutes to covalently bind the priming oligo (oligo 3) to the Encoded Particle Surface Oligo. Next the magnetic encoded particles (Luminex MagBeads) are washed 2x in PBS-TBN, and then resuspended in RCA reaction mix including a plasmid template. RCA incubation occurs at 37C for 3 hours, followed by probe addition (30 min.) and then 3X washes in PBS-TBN at room temp. The Luminex beads are then analyzed on a Luminex bead reader (Intelliflex). The beads are analyzed by recording the fluorescent intensity of each bead in a given classification region. Up to 500 bead regions can be analyzed on the Luminex Intelliflex or FM3D analyzers, such that the multiplex of the assay can analyze 500 different protein targets per well. Other optically encoded particles may achieve a higher than 500 plex.Example 7: DNA Tether UV Linkage of Fluorochrome Constructs to Encoded Particles For Protein Detection

[0249] An issue with multiplexing immune-assays is non-specific interactions between antibodies and microsphere surfaces. This non-specific interaction of detection antibodies with other assays increases non-specific background signal. In this embodiment CNVK is used to lock on specific target capture oligos that are linked to antibody / oligo coupled microspheres and oligo coupled detection antibodies. The covalent UV linking of the oligos enable the use of a stringent wash step to remove non-specifically bound detection antibodies reducing multiplexing background signal. In FIG. 25, a target specific capture antibody and an oligo labeled 101-Oligo are directly coupled to the surface of a microsphere. The 101-Oligo contains a unique amino acid sequence that is complementary to a linker oligo labeled 103. The detection antibody in FIG. 25 has oligo labeled 102-Oligo covalently coupled to it. The 102- Oligo contains two unique nucleic acid sequences, one sequence is complementary to 103- Oligo and the other sequence is complementary to a signal oligo labeled 104-Oligo. The 104- Oligo contains four complementary binding domains for biotinylated signal probes which can bind to streptavidin phycoerythrin to generate a fluorescent signal.

[0250] When there is specific capture of a target molecule with both capture and detection antibody, 102-Oligo and 101-Oligo will be in close proximity to each other. With the addition of 103-Oligo after washing, 101-Oligo and 102-Oligo will become linked. The 103- Oligo contains a CNVK modification in the complementary region for both 101 -Oligo and 102-Oligo. In this embodiment, 104-Oligo also contains a CNVK modification in its complementary region to 102-Oligo. After all oligos are connected, UV light is applied to covalently link them together through the CNVK modification. If a non-target specific detection antibody containing its own unique 102-Oligo binds non-specifically to this assay, it will not be able to hybridize with 103-Oligo and be covalently linked. If specific oligos are now linked, a stringent wash can be performed to destroy all protein binding leaving behind only specific signal.

[0251] Human IL-1 beta / IL-lF2 samples and antibodies

[0252] Recombinant Human IL-1 beta / IL-lF2 Protein was obtained from RnD Systems (201-LB) and reconstituted in PBS pH 7.4 (ThermoFisher) to .100 mg / mL. The IL1-B protein was further diluted to 100,000 pg / mL in PBS-TBN (Phosphate buffered saline, pH 7.4, 0.02% Tween 20, 1 mg / mL BSA, and .05% NaN3) and aliquoted in single use tubes and stored at - 80°C. For this experimental setup the IL-1 beta sample bank was diluted in PBS-TBN to 10 pg / mL (.59 pM), 1 pg / mL (.059pM), and .5 pg / mL (.029pM). The capture antibody coupled tothe Luminex microsphere was anti-Human IL-1 beta / IL-lF2 Monoclonal Mouse IgGl Clone # 8516 purchased from RnD Systems (MAB201) reconstituted in PBS to .5mg / mL. The detection antibody coupled to oligo 102-2 was anti-Human IL-1 beta / IL-lF2 polyclonal goat IgG purchased from RnD Systems (AF-201-NA) reconstituted in PBS to Img / mL. The detection antibody used for the comparative Luminex assay anti-Human IL-1 beta / IL-lF2 polyclonal goat IgG purchased from RnD Systems (BAF201) reconstituted in PBS to .2mg / mL.

[0253] Human IFN-gamma samples and antibodies

[0254] Recombinant IFN-gamma protein was obtained from RnD Systems (285-IF- 100 / CF) and reconstituted in Nuclease- Free Water (Ambion) to .200 mg / mL. The 1L1-B protein was further diluted to 10,000 pg / mL in PBS-TBN (Phosphate buffered saline, pH 7.4, 0.02% Tween 20, 1 mg / mL BSA, and .05% NaN3) and aliquoted in single use tubes and stored at -80°C. For this experimental setup the INF-gamma sample bank was diluted in PBS-TBN to 10 pg / mL (.59 pM), 5 pg / mL (.29pM), and 1 pg / mL (.059pM). The capture antibody coupled to the Luminex microsphere was purified anti-human IFN-y Antibody Monoclonal Mouse IgGl, K Clone MD-1 purchased from BioLegend (507502). The detection antibody coupled to oligo 102-3 was anti-human IFN-y Antibody Monoclonal Mouse IgG2A Clone # 25718 purchased from RnD Systems (MAB285) reconstituted in PBS to Img / mL. The detection antibody used for the comparative Luminex assay was the same detection antibody but was biotinylated in house.

[0255] Human IL-21 samples and antibodies

[0256] Recombinant Human IL-21 protein was obtained from RnD Systems (8879-IL- 010 / CF) and reconstituted in PBS pH 7.4 (ThermoFisher) to .100 mg / mL. The IL-21 protein was further diluted to 100,000 pg / mL in PBS-TBN (Phosphate buffered saline, pH 7.4, 0.02% Tween 20, 1 mg / mL BSA, and .05% NaN3) and aliquoted in single use tubes and stored at - 80°C. For this experimental setup the IL-1 beta sample bank was diluted in PBS-TBN to 10 pg / mL (.59 pM), 5 pg / mL (.29pM), and 1 pg / mL (.059pM). The capture antibody coupled to the Luminex microsphere was anti-Human IL-21 Monoclonal Mouse IgGl Clone # 148002 purchased from RnD Systems (MAB 1500-100) reconstituted in PBS to ,5mg / mL. The detection antibody coupled to oligo 102-1 was anti-Human IL-21 polyclonal goat IgG purchased from RnD Systems (AF15001-100) reconstituted in PBS to Img / mL. The detectionantibody used for the comparative Luminex assay was the same detection antibody but was biotinylated in house.

[0257] Human IL-6 samples and antibodies

[0258] Recombinant Human IL-6 was obtained from RnD Systems (206-IL-010) and reconstituted in PBS pH 7.4 (ThermoFisher) to .100 mg / mL. The IL1-B protein was further diluted to 100,000 pg / mL in PBS-TBN (Phosphate buffered saline, pH 7.4, 0.02% Tween 20, 1 mg / mL BSA, and .05% NaN3) and aliquoted in single use tubes and stored at -80oC. For this experimental setup the IL-1 beta sample bank was diluted in PBS-TBN to 10 pg / mL (.48 pM), 1 pg / mL (,048pM), and .5 pg / mL (,024pM). The capture antibody coupled to the Luminex microsphere was anti-Human IL-6 Monoclonal Mouse IgGl Clone # 6708 purchased from RnD Systems (MAB206-100) reconstituted in PBS to .5mg / mL. The detection antibody coupled to oligo 102-1 was anti-Human IL-6 polyclonal goat IgG purchased from RnD Systems (AF-206-NA) reconstituted in PBS to 1 mg / mL. The detection antibody used for the comparative Luminex assay anti-Human IL- 1 beta / IL- 1 F2 polyclonal goat IgG purchased from RnD Systems (BAF206) reconstituted in PBS to .2mg / mL.

[0259] Target Linking Oligos

[0260] All oligos were purchased from Integrated DNA Technologies (IDT). All sequences are shown in Table 2.

[0261] 101-1, 101-2, and 101-3 Oligos: Each are comprised of a nucleic acid sequence that have a 5’ Amine with a 6 carbon spacer and a 3’ Azide modification. The amine functional group is used to attach the oligo to the microsphere surface. The Azide modification is unused in this embodiment. The nucleic acid sequence for each 101 contains the same non-specific sequence for the first 28 bases, a specific sequence for its 103-Oligo partner, followed by the same 12 non-specific bases.

[0262] 102-1, 102-2, 102-3 Oligos: Each are comprised of a nucleic acid sequence with a 5 ’Biotin and a 3 ’Azide. The 3 ’Azide is used to conjugate the 102-Oligo to the detection antibody. The 5 ’Biotin is used for additional signal or can be used for signal without 104-Oligo. The nucleic acid sequence for each 102 contains a unique specific sequence for its 103-Oligo partner starting at the 5’ end, the same non-specific 38 bases separating the 104 bindingdomain, the same specific binding sequence for 104-Oligo, and a stretch of the same 15 nonspecific bases.

[0263] 103-1, 103-2, 103-3 Oligos: Each are comprised of a nucleic acid sequence with a 5’ complementary region to its 101-Oligo partner and a 3’ complementary region to its 102- Oligo partner. Within each of those complementary binding regions there is a CNVK modification. Each contain the same 31 bases separating the two complementary binding regions.

[0264] 104-Oligo and Biotin-probe: The 104-Oligo is comprised of a nucleic acid sequence with a 3 ’Amine modification. The 3 ’Amine modification is not used in this embodiment. At the 5’ end is the location of the 102-Oligo binding sequence which contains a CNVK modification for locking on to 102-Oligo. Following the 102-Oligo binding region is four repeat sequences complementary to the Biotin Probe. The Biotin-Probe contains a complementary nucleic acid sequence to 104-Oligo and a 3’Biotin. The 3’Biotin can bind to streptavidin phycoerythrin for signal generation. Table 2.

[0265] Capture Antibody and 101 -Oligo Microsphere Conjugation

[0266] The microspheres for conjugation were obtained from Luminex Corporation. The microspheres used are magnetic polystyrene with a carboxyl modified surface. The regions used for each assay; Region 12 - IL-21, Region 13 - IL-6, Region 17 - IL-1B, and Region 24 - INFy. The conjugation is performed using a carbodiimide crosslinker chemistry, specifically l-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC). The conjugation protocol was performed as such. 5 million microspheres of each region were diluted in 300uL of MES pH 4.5 coupling buffer. The microspheres were washed 2 times with 300uL of MES pH 4.5 buffer, by pulling microspheres down with a magnet and removing the supernatant. The microspheres were resuspended in 80uL of the MES pH 4.5 conjugation buffer. 20uL of EDC at 50 mg / mL were added to each microsphere region. The microspheres were mixed and incubated on a rotator for 20min covered from light. After the incubation the microspheres were washed 3X with 500uL of MES pH 4.5 conjugation buffer. The capture antibodies were premixed with their specific 101 -Oligo at a 1 :2 antibody to oligo molar ratio and brought up to 65uL with MES pH 4.5 buffer. 135uL of MES pH 4.5 conjugation buffer was added to the washed microspheres and the 65uL antibody oligo mix was added to the microspheres. The microspheres were mixed and incubated for 2hrs on a rotator protected from light. After the incubation, the microspheres were washed 3X with 500uL of PBS-TBN. After conjugation the microspheres were counted and brought to 5 million microspheres per milliliter.

[0267] Detection Antibody and 102-Oligo Conjugation

[0268] The detection antibody oligo conjugation used copper free click chemistry and a proprietary antibody conjugation chemistry from Alpha Thera Corporation. oYo-Link DBCO (AT3003) was purchased from Alpha Thera and rehydrated with lOuL of nuclease free water to 330uM. 102-Oligo was rehydrated in water to 495uM. lOuL of 102-Oligo was added directly to lOuL of the oYo-Link DBCO for a 1.5:1 ratio. The tube was mixed, covered from light, and incubate at 4°C for 48hrs. The detection antibodies were rehydrated in PBS pH 7.4 to Img / mL. IOOUL (lOOug) of detection antibody was added directly to the oYo-Link DBCO / 102-Oligo mix for a 1 :5 antibody: oYo-102- Oligo ratio. The mix was incubated on Ice under (365nM) UV light for 2hrs.

[0269] HPLC Antibody-102-Oligo Purification

[0270] The Antibody-oligo conjugations were purified using Ion- Exchange HPLC chromatography (Agilent). The column was heated to 30°C during purification. The buffer for elution was 50mM Phosphate Buffer Solution pH 7.4 (Sigma-Aldrich). The salt gradient for elution was started with 100% buffer A (50mM Na2HPO4 / NaH2PO4 lOOmM NaCl) and over the course of 25min was changed to 0% buffer A and 100% buffer B (50mM Na2HPO4 / NaH2PO4 ImM NaCl). The flow rate used on the analytical column was 0.8 ml / min. Figure 2 and 3 is an example of the HPLC chromatograph of the oligo conjugated anti- IL-lbeta antibody and INFy antibody and the peaks fractionated. The collected fractions of Antibody-Oligonucleotide conjugates were concentrated using an Amicon 10K spin column and brought up to 40uL. The concentrations were determined using the bicinchoninic acid assay (BCA) on the nano-drop200 and building a standard curve with polyclonal goat IgG (Sigma-Aldrich)

[0271] Assay Protocol with Elution Step

[0272] All reagents were diluted to assay working concentrations in a multiplex mix. The conjugated antibody: 101 -Oligo microspheres were diluted in PBS-TBN 50 bd / uL. The conjugated detection antibody: 102-Oligo was diluted in PBS-TBN to a final concentration of ,5ug / mL. The 103-Oligos and 104-Oligo were diluted to 20nM in PBS-TBN containing ,5M NaCl. The Biotin-Probe were diluted to 80nM in PBS-TBN containing .5M NaCl. The streptavidin phycoerythrin (SA-PE) was diluted to 2ug / mL in PBS-TBN. The targetconcentrations and dilution buffer are stated above in the sample sections. The stringent elution buffer formulation contains IX PBS pH 7.4, 1% SDS, and 20mM TCEP.

[0273] In this experiment, two assay plates were tested: One assay plate had no stringent wash and the other plate was stringent washed. Each plate had the comparative assay performed and also was subjected to stringent wash vs. no stringent wash. The assay protocol was performed as such. 50uL of diluted microspheres are added to a microtiter plate and 50uL of sample is added to the same well. The assay plate was incubated at room temperature for Ihr shaking at 900RPM. The assay plate was washed 3X with 150uL of PBS-TBN. 50uL of detection antibody- 102-Oligo was added and incubated at room temperature for Ihr shaking at 900RPM. The assay plate was washed 3X with 150uL of PBS-TBN. 50uL of the 103- 01igo / 104-01igo dilution was added to the assay plate and incubated at room temperature for Ihr shaking at 900RPM. The assay plate was subjected to UV (365nM) for 4min or no UV. The elution wells were placed on a magnet and the supernatant removed. During the stringent wash procedure, lOOuL of elution buffer (Luminex corp.) was added to the stringent wash wells, the microspheres resuspended, and the liquid transferred to a PCR plate. The plate was sealed and heated to 95°C for 8min. The elution liquid and microspheres were transferred to a new assay plate and washed 3X with 150uL of PBS-TBN. A non-stringent wash plate was just washed 3X with 150uL of PBS-TBN. 50uL of the Biotin-Probe was added to all wells and incubated at room temperature for Ihr shaking at 900RPM. The assay plate was washed 3X with 150uL of PBS-TBN. 50uL of SA-PE was added to all wells and incubated at room temperature for Ihr shaking at 900RPM. The assay plate was washed 2X with 150uL of PBS- TBN. lOOuL of PBS-TBN was added to all wells and the plate was analyzed on a Luminex Flex-Map instrument.

[0274] Assay Results for Elution vs No Elution and UV vs No UV

[0275] The assay results in FIG. 26A show the results of the comparative assay (an assay using standard capture and detection antibodies with no oligos or CNVK attached) with and without Stringent wash, designated as ‘No Elution’ for the non-stringent wash procedure, and ‘with elution’ for the stringent wash procedure. The no elution data are the comparative assay results under non-stringent wash conditions. The no elution results show the No Target protein Control (NTC) background that is the result of non-specific detection antibody binding. The comparative assay with elution shows a significant drop in signal, demonstrating that thestringent wash procedure will remove non-specific detection antibody signal within the multiplex reaction.

[0276] In FIG. 26B, the capture sandwich immunoassay uses antibodies that have been pre-coupled with oligos and cnvk as described in FIG. 25. The yellow highlighted data are conditions where a single target protein (indicated at the top of each column) was added the multiplex bead reaction. The no target protein controls (NTC) for IL1B and INFy signals dramatically decrease in the stringent wash (‘with elution’) procedure compared to the IL1B and INFy NTC signals of the no-stringent wash (‘No Elution’) procedure from FIG. 26A. This indicates that the stringent wash procedure is able to remove non-specific detection antibody signal when the DNA of the 102 oligo is not linked to the 101 oligo of the bead, via the 103 tether oligo. Specific signal is still present for the beads wherein the specific target was added in each column or well, despite the stringent wash, because the cnvk oligo tether was covalently linked. In FIG. 26A, all the specific signal was lost, because those beads did not have covalently tethered oligos on the antibodies.Example 8: microRNA detection via UV inducible covalent bonds in DNA probes

[0277] miRNA Test Plan Singleplex and 3Plex Validation

[0278] The experiment below was used to prove the ability of the Starlink beads and biotin-labeled Starlink complementary probes to hybridize and form a t-junction in the presence of a target miRNA. The t-junction is crosslinked in the presence of UV light (366 nm) using a reversible photocrosslinker 3-cyanovinylcarbazole nucleoside (CNVK). The presence of the target is detected by fluorescence of streptavidin R-phycoerythrin (SAPE).

[0279] Beads were first coupled using a standard EDC nucleic acid coupling protocol, which coupled the carboxyl groups on the MagBeads to the amino group ( / 5AmMC12 / ) on the Bead Tags . The experimental reaction mixture contained 2,500 Luminex magnetic beads per microwell (Bead tag 1: Region 12, Bead tag 2: Region 13, Bead tag 3: Region 24; either 2,500 of a single bead for singleplex experiments or 2,500 of each bead in a mixture for 3plex experiments) for each of the 3 beads coupled to Bead tag 1, Bead tag 2, and Bead tag 3, 5 nM of each complementary probe, and 750 femtomoles to 50 attomoles of each of the blocked DNA target mimics (either alone or in a mixture containing all 3 targets), all prepared in IX TMAC buffer (3M TMAC, 0.1% Sarkosyl solution, 50 mM Tris-HCL, 4 mM EDTA (pH 8.0)) in a total volume of 50 pL. The mixture was incubated at room temperature overnight while shaking at 900 RPM in a Costar 96-well untreated white polystyrene round bottom assay plate (Ref. 3789 A). The following morning, the plate was placed under a UV light at 366 nm wavelength for 4 minutes. The magnetic beads were then washed three times with 150 L IX TMAC buffer before the addition of 50 pL 2 pg / mL SAPE. After one hour of incubation with SAPE, magnetic beads were washed 2 times with PBS-TBN, then resuspended in a total volume of 100 pL PBS-TBN. 75 pL of beads were analyzed on a Luminex Flexmap 3D utilizing high PMT and median fluorescence intensities (MFI) were compared across samples.

[0280] Results

[0281] In singleplex, each of the targets was detected down to a total of 50 attomoles with signal at least 3X over background (no target control) signal, with MFI values ranging from 27 (miRNA 1, 50 attomoles total) to 78,079 (miRNA 2, 750 femtomoles total) and background MFI values ranging from 7 (miRNA 1) to 60 (miRNA 2).

[0282] In 3plex, each of the targets was assayed in a mix of 750 femtomoles total of each target (see Row 2 of table below) with MFI values ranging from 18,590.5 (miRNA 1) to 81,728 (miRNA 2), well over background no target MFI values (see Row 1 of table below) which ranged from 11.5 (miRNA 1) to 131 (miRNA 2). Importantly, individual targets were also detectable at 750 femtomoles total with minimal effect on the background MFI of the other 2 beads in the reaction mixture (see Rows 3-5 in the table below).

[0283] miRNA Test Plan UV and Hybridization Specificity Validation

[0284] The experiment below was used to test whether UV crosslinking of the CNVK moiety was functional with these experimental components. After exposure to UV light, the reaction mixtures were washed at 80° C in order to disrupt any hybridization that did not include a covalent bond. All oligos used were the same as those in Table 1, except that complementary probe 2 was replaced with a shorter complementary probe, complementary probe 2b.

[0285] The method used was the same as described above, except that the three washes with IX TMAC buffer were performed after incubating the plate for 5 minutes at 80° C. UV crosslinking was only tested in singleplex conditions.

[0286] Representative Results

[0287] While there was little change in signal between UV-treated wells and those that did not receive UV treatment using a standard room temperature wash, -90-99% of signal is lost in wells not treated with UV when treated with a hot wash at 80° C, indicating that UV crosslinking results in non-meltable hybridization of the bead tag and the complementaryprobe. Importantly, treatment with a hot wash has only minor effects on the sensitivity and dynamic range of detection.* * *

[0288] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.REFERENCESThe following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.Yoshimura, Yoshinaga and Fujimoto, Kenzo, Ultrafast Reversible Photo-Cross-Linking Reaction: Toward in Situ DNA manipulation. Org. Lett., Vol. 10, No. 15, 2008.Kishi, et. al., Light-Seq: light-directed in situ barcoding of biomolecules in fixed cells and tissues for spatially indexed sequencing. Nature Methods; Vol. 19, Iss. 11, Nov 2022.Fujimoto, K., CNVK and CNVD - ultrafast reversible photo-cross-linkers for DNA or RNA. The Glen Report Newsletter Volume 30.2 Dec. 2018,

Claims

CLAIMS1. A method of detecting the presence of an analyte target in a sample, comprising contacting the sample with (i) a first moiety, which comprises a first binding domain and a first nucleic acid, and (ii) a second moiety, which comprises a second binding domain and a second nucleic acid, wherein the first binding domain and the second binding domain specifically bind to the analyte target when the analyte target is present in the sample, and wherein the first nucleic acid and / or the second nucleic acid comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid and the second nucleic acid upon exposure to a light energy.

2. The method of claim 1 , wherein the first moiety further comprises a third nucleic acid, wherein the first binding domain is attached to the third nucleic acid, and wherein the third nucleic acid hybridizes to the first nucleic acid; and wherein the second moiety further comprises a fourth nucleic acid wherein the second binding domain is attached to the fourth nucleic acid, and wherein the fourth nucleic acid hybridizes to the second nucleic acid.

3. The method of claim 1, wherein the detecting comprises quantifying an amount of the analyte target present in the sample.

4. The method of any one of claims 1 to 3, wherein the first binding domain and the second binding domain bind to the analyte target via direct binding or indirect binding.

5. The method of any one of claims 1 to 4, wherein the analyte target comprises a nucleic acid target, a protein target, or both.

6. The method of any one of claims 1 to 5, wherein the first binding domain and / or the second binding domain comprises a nucleic acid, an antibody, an antibody-nucleic acid complex, an aptamer, or any combination thereof.

7. The method of any one of claims 1 to 6, wherein the sample comprises multiple analyte targets.

8. The method of claim 7, wherein each of the multiple analyte targets is different.

9. The method of claim 7 or 8, wherein the multiple analyte targets comprise at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, at least about 1,000, or at least about 10,000 analyte targets.

10. A method of detecting the presence of a nucleic acid target in a sample, comprising contacting the sample with (i) a first moiety, which comprises a first nucleic acid domain, and (ii) a second moiety, which comprises a second nucleic acid domain, wherein the first moiety and the second moiety specifically hybridize to the nucleic acid target when the nucleic acid target is present in the sample, and wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy and when both the first moiety and the second moiety are hybridized to the nucleic acid target.

11. The method of claim 10, wherein the detecting comprises quantifying an amount of the nucleic acid target present in the sample.

12. The method of claim 10 or 11, wherein the nucleic acid target comprises a DNA, RNA, or both.

13. The method of claim 12, wherein the RNA comprises a microRNA (miRNA), a long noncoding RNA (IncRNA), a circular RNA (circRNA), a small nucleolar RNA (snoRNA), a messenger RNA (mRNA), or any combination thereof.

14. The method of any one of claims 10 to 13, wherein the sample comprises multiple nucleic acid targets.

15. The method of claim 14, wherein each of the multiple nucleic acid targets is different.

16. The method of claim 14 or 15, wherein the multiple nucleic acid targets comprise at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, at least about 1,000, or at least about 10,000 nucleic acid targets.

17. A method of detecting the presence of a protein target in a sample, comprising contacting the sample with (i) a first moiety, which comprises a first binding domain and a first nucleic acid domain, and (ii) a second moiety, which comprises a second binding domain and a second nucleic acid domain, wherein the first binding domain and the second binding domain specifically bind to the protein target when the protein target is present in the sample, and wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy and when both the first moiety and the second moiety are bound to the protein target.

18. The method of claim 17, wherein the first moiety further comprises a third nucleic acid, wherein the first binding domain is attached to the third nucleic acid, and wherein the third nucleic acid hybridizes to the first nucleic acid; and wherein the second moiety further comprises a fourth nucleic acid wherein the second binding domain is attached to the fourth nucleic acid, and wherein the fourth nucleic acid hybridizes to the second nucleic acid.

19. The method of claim 17 or 18 wherein the detecting comprises quantifying an amount of the protein target present in the sample.

20. The method of any one of claims 17 to 19, wherein the first binding domain and the second binding domain bind to the protein target via direct binding or indirect binding.

21. The method of any one of claims 17 to 20, wherein the sample comprises multiple protein targets.

22. The method of claim 21 , wherein each of the multiple protein targets is different.

23. The method of claim 21 or 22, wherein the multiple protein targets comprise at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, at least about 1,000, or at least about 10,000 protein targets.

24. The method of any one of claims 17 to 23, wherein the first binding domain and / or the second binding domain comprises an antibody, aptamer, or both.

25. The method of any one of claims 1 to 24, comprising exposing the sample to the light energy and allowing the covalent bond to form between the first nucleic acid domain and the second nucleic acid domain.

26. The method of any one of claims 1 to 25, wherein the first moiety further comprises an additional element (first additional element) and / or the second moiety further comprises an additional element (second additional element).

27. The method of claim 26, wherein the second additional element comprises a detectable agent.

28. The method of claim 27, further comprising detecting the presence of the detectable agent.

29. The method of claim 27 or 28, wherein the detectable agent comprises a fluorescent marker, a bead, a nanosphere, a catalyst, an enzyme, a chemiluminescent reagent, a particle, a polymer, a fluorochrome, or any combination thereof.

30. The method of claim 28 or 29, wherein the detecting comprises a microarray, a polymerase chain reaction (PCR), a flow cytometry, a microscopy, a fluorimeter, a sequencing, or any combination thereof.

31. The method of claim 30, wherein the PCR comprises a digital PCR, reverse transcription polymerase chain reaction (RT-PCR), or both.

32. The method of claim 25, further comprising detecting the covalent bond formed between the first nucleic acid domain and the second nucleic acid domain wherein the detecting comprises a Polymerase Chain Reaction (PCR), and wherein the PCR uses a forward primer and a reverse primer at each proximal end of the first or second nucleic acid domain.

33. The method of claim 25, further comprising detecting the covalent bond formed between the first nucleic acid domain and the second nucleic acid domain wherein the detecting comprises a Polymerase Chain Reaction (PCR), and wherein the PCR uses a bridging primer that bridges the photo-reactive linker region, spanning from the first or second nucleic acid domain at its 5’ end to the first or second nucleic acid domain at its 3’ end, and wherein the bridging primer has at least some sequence complementarity to the first and second nucleic acid domains.

34. The method of claim 25, further comprising detecting the covalent bond formed between the first nucleic acid domain and the second nucleic acid domain wherein the detecting comprises a Polymerase Chain Reaction (PCR), and wherein the PCR uses a migrating primer, wherein the migrating primer migrates from either the first or second nucleic acid domain to the second or first nucleic acid domain through branch migration.

35. The method of claim 25, further comprising detecting the covalent bond formed between the first nucleic acid domain and the second nucleic acid domain wherein the detecting uses the first and / or second nucleic acid domain to prime a plasmid, creating a rolling circle amplification product.

36. The method of claim 35, further comprising a second detecting the rolling circle amplification product by hybridization of the rolling circle amplification product to a complimentary oligomer attached to a bead or solid surface.

37. The method of claim 35, wherein the rolling circle amplification product is labelled with a labelled complementary oligomer.

38. The method of claim 25, further comprising detecting the covalent bond formed between the first nucleic acid domain and the second nucleic acid domain wherein the detecting comprises adding a preformed nanoball, wherein the preformed nanoball is capable of hybridizing to a segment of the first and / or second nucleic acid domain.

39. The method of claim 38, wherein the preformed nanoball is a preformed rolling circle amplification product comprising at least one label.

40. The method of claim 38, wherein the preformed nanoball is a viral capsid comprising at least one label.

41. The method of claim 38, wherein the preformed nanoball is a biological polymer comprising at least one label.

42. The method of claim 38, wherein the preformed nanoball comprises at least one nanoparticle comprising at least one label.

43. The method of claim 42, wherein the preformed nanoball further comprises at least one oligonucleotide attached to the at least one nanoparticle, and wherein the at least one oligonucleotide hybridizes to the first and / or second nucleic acid domain.

44. The method of claim 38, wherein the preformed nanoball comprises at least one branched DNA structure.

45. The method of claim 38, wherein the preformed nanoball comprises at least one branched DNA structure, wherein the at least one branched DNA structure hybridizes to the first and / or second nucleic acid domain.

46. The method of claim 45, wherein the branched DNA structure further comprises at least one fluorochrome.

47. The method of claim 25, wherein the first and / or second nucleic acid domain further comprises at least one ribobase.

48. The method of claim 25, wherein the first and / or second nucleic acid domain further comprises at least one extension blocker.

49. The method of claim 48, wherein the extension blocker comprises a Carbon3 spacer, or an inverted dT.

50. The method of any one of claims 47-49, further comprising incubating at a reaction temperature capable of melting apart all hybridization reactions between the first and second nucleic acid domains, except those that are covalently linked.

51. The method of any one of claims 47-49, further comprising adding an endoribonuclease, wherein the endoribonuclease cleaves the ribobases that are in a double stranded configuration with DNA in the opposing strand.

52. The method of claim 51 , wherein the endoribonuclease is RNaseHII.

53. The method of claim 51 , further comprising the cleavage happening in a position such that a cleaved product acts as a primer for a subsequent PCR reaction, and wherein the uncleaved first and / or second nucleic acid domain cannot act as a primer for a subsequent PCR reaction.

54. The method of claim 53, further comprising detecting the cleaved product.

55. The method of claim 54, further comprising the detecting of the cleaved product comprises PCR, dPCR, or sequencing.

56. The method of claim 54, wherein the detecting comprises priming a plasmid, creating a rolling circle amplification product.

57. The method of claim 56, further comprising a second detecting the rolling circle amplification product by hybridization of the rolling circle amplification product to a complimentary oligomer attached to a bead or solid surface.

58. The method of claim 56, wherein the rolling circle amplification product is labelled with a labelled complementary oligomer.

59. The method of claim 54, further comprising the detecting of the cleaved product comprises a PCR reaction, wherein the cleaved product acts as a primer to a PCR template comprising a barcode, and wherein after extension the barcode is not incorporated.

60. The method of claim 59, wherein the barcode hybridizes to a labelled oligomer.

61. The method of claim 60, wherein the labelled oligomer comprises a fluorochrome, dyed nanosphere, or other polymeric dye structure.

62. The method of claim 30, wherein the microarray comprises a bead-based microarray.

63. The method of any one of claims 28 to 62, comprising amplifying the second moiety prior to the detecting.

64. The method of any one of claims 26-63, wherein the first additional element comprises a ligand.

65. The method of claim 64, further comprising a wash step, wherein a ligand-binding moiety is added to the sample, and wherein the ligand-binding moiety binds to the ligand, and wherein the second nucleic acid domain is removed when the second nucleic acid domain has not formed a covalent bond to the first nucleic acid domain.

66. The method of claim 64, wherein the ligand is biotin, desthiobiotin, or an oligonucleotide sequence.

67. The method of claim 65, wherein the ligand-binding moiety is a biotin-binding bead.

68. The method of any one of claims 1 to 67, further comprising an encoded particle, wherein the encoded particle is a solid substrate.

69. The method of claim 68, wherein the encoded particle may further comprise a capture sequence attached to the encoded particle, wherein the capture sequence hybridizes to the first nucleic acid domain and / or the second nucleic acid domain.

70. The method of claim 69, wherein the capture sequence comprises a photo-reactive linker, wherein the photo-reactive linker is configured to form a covalent bond between the first nucleic acid domain and / or the second nucleic acid domain and the capture sequence upon exposure to a light energy.

71. The method of claim 69, further comprising washing, and wherein the washing leaves the first and second nucleic acid domains bound to the encoded particle when the first and second nucleic acid domains have formed a covalent bond.

72. The method of any one of claims 26 to 71, wherein the first additional element comprises a tag, a barcode, a unique molecular identifier (UMI), or any combination thereof.

73. The method of claim 72, further comprising sequencing the tag, barcode, UMI, or any combination thereof.

74. The method of claim 73 , comprising amplifying the first moiety prior to the sequencing.

75. The method of any one of claims 1- to 4, further comprising adding an exonuclease, wherein the exonuclease removes the first and / or second nucleic acid domains that have not been covalently linked.

76. The method of any one of claims 1 to 75, wherein the sensitivity and / or accuracy of detecting the presence of the analyte target, nucleic acid target, or protein target is increased as compared to a corresponding method that does not comprise a photo-reactive linker.

77. A method of detecting the presence of a nucleic acid target in a sample, comprising: (i) contacting the sample with a chimeric probe comprising DNA / RNA / DNA; (ii) digesting the chimeric probe with an RNase, wherein the digesting chimeric probe is digested if not hybridized to the nucleic acid target.

78. The method of claim 77, further comprising second detecting the non-digested chimeric probe.

79. The method of claim 78, wherein the second detecting comprises contacting the nondigested chimeric probe with a first nucleic acid domain, wherein the first nucleic acid domain can hybridize to the non-digested chimeric probe.

80. The method of claim 79, wherein the first nucleic acid domain further comprises a spectrally distinct particle.

81. The method of claim 78, wherein the second detecting comprises contacting the nondigested chimeric probe with a second nucleic acid domain, wherein the second nucleic acid domain can hybridize to the non-digested chimeric probe.

82. The method of claim 81, wherein the second labelled oligomer further comprises a fluorochrome, branched DNA, dyed nanospheres, plasmids, RCA extension products, or any combination thereof.

83. The method of any one of claims 79 to 82, wherein the first and / or second labelled oligomer further comprises a photo-reactive linker, which is configured to form a covalent bond between the first and / or second labelled oligomer and the chimeric probe upon exposure to a light energy.

84. The method of claim 77, wherein the detecting comprises quantifying an amount of the nucleic acid target present in the sample.

85. The method of any one of claims 77 to 84, wherein the nucleic acid target comprises a DNA, RNA, or both.

86. The method of claim 85, wherein the RNA comprises a microRNA (miRNA), a long noncoding RNA (IncRNA), a circular RNA (circRNA), a small nucleolar RNA (snoRNA), a messenger RNA (mRNA), or any combination thereof.

87. The method of any one of claims 77 to 86, wherein the sample comprises multiple nucleic acid targets.

88. The method of claim 87, wherein each of the multiple nucleic acid targets is different.

89. The method of claim 87 or 88, wherein the multiple nucleic acid targets comprise at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about90. at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, at least about 1,000, or at least about 10,000 nucleic acid targets.

90. The method of any one of claims 78 to 83, wherein the detecting comprises a microarray, a polymerase chain reaction (PCR), a flow cytometry, a microscopy, a fluorimeter, a sequencing, or any combination thereof.

91. The method of claim 90, wherein the PCR comprises a digital PCR, reverse transcription polymerase chain reaction (RT-PCR), or both.

92. A method of isolating an analyte target present in a sample, comprising:(a) contacting the sample with a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, wherein the first binding domain is capable of specifically binding to the analyte target and the first nucleic acid domain is capable of specifically binding to a capturing agent, wherein the first nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the analyte target upon exposure to a light energy;(b) exposing the sample to the light energy; and(c) contacting the sample with the capturing agent to isolate the analyte target from the sample (isolated analyte target).

93. The method of claim 92, wherein the first binding domain binds to the analyte target via direct binding or indirect binding.

94. The method of claim 92 or 93, further comprising amplifying the isolated analyte.

95. The method of any one of claims 92 to 94, further comprising separating the isolated analyte from the capturing agent.

96. The method of claim 95, wherein the separating occurs prior to the amplifying.

97. A method of increasing a concentration of an analyte target in a sample, comprising:(a) contacting the sample with a first moiety, which comprises a first binding domain attached to a first nucleic acid domain,wherein the first binding domain is capable of specifically binding to the analyte target and the first nucleic acid domain is capable of specifically binding to a capturing agent, wherein the first nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the analyte target upon exposure to a light energy;(b) exposing the sample to the light energy;(c) contacting the sample with the capturing agent; and(d) collecting the first moiety from the capturing agent, wherein the concentration of the analyte target is directly correlated with the concentration of the first moiety collected.

98. The method of claim 97, wherein the first binding domain binds to the analyte target via direct binding or indirect binding.

99. The method of claim 97 or 98, wherein the first nucleic acid domain binds to the capturing agent via direct binding or indirect binding.

100. A method of removing an impurity in a sample comprising an analyte target, comprising:(a) contacting the sample with (i) a first moiety, which comprises a first binding domain attached to a first nucleic acid domain, and (ii) a second moiety, which comprises a second binding domain attached to a second nucleic acid domain, wherein the first binding domain is capable of specifically binding to the impurity and the second binding domain is capable of specifically binding to a capturing agent, wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photo-reactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy;(b) exposing the sample to the light energy;(c) contacting the sample with the capturing agent; and(d) removing the impurity from the sample.

101. The method of claim 100, wherein the first binding domain binds to the impurity via direct binding or indirect binding.

102. The method of claim 100 or 101, wherein the second binding domain binds to the capturing agent via direct binding or indirect binding.

103. The method of any one of claims 92 to 102, wherein the analyte target comprise a nucleic acid target, a protein target, or both.

104. The method of claim 103, wherein the analyte target is a protein target.

105. The method of claim 104, wherein the first binding domain and / or the second binding domain comprises an antibody, aptamer, or both.

106. The method of any one of claims 103 to 105, wherein the nucleic acid target comprises a DNA, RNA, or both.

107. The method of claim 106, wherein the RNA comprises a microRNA (miRNA), a long noncoding RNA (IncRNA), a circular RNA (circRNA), a small nucleolar RNA (snoRNA), a messenger RNA (mRNA), or any combination thereof.

108. The method of any one of claims 92 to 107, wherein the sample comprises multiple analyte targets.

109. The method of claim 108, wherein each of the multiple analyte targets is different.

110. The method of claim 108 or 109, wherein the multiple analyte targets comprise at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, at least about 1,000, or at least about 10,000 analyte targets.

111. The method of any one of claims 1 to 110, wherein the photo-reactive linker comprises 3-cyanovinylcarbazole nucleoside (CNVK), D-threoninol (CNVD), benzophenone, phenyl azide, tetrafluorophenyl azide, hydroxyphenyl azide, diazirine, trifluoromethylphenyl diazirine, psoralen, phenoxyl radical trapper, or any combination thereof.

112. The method of any one of claims 1 to 111, wherein an interaction between the first moiety and the second moiety does not require an enzyme.

113. The method of any one of claims 1 to 112, wherein the light energy comprises a photoirradiation at a wavelength of about 365 nm.

114. The method of any one of claims 1 to 113, wherein the sample is not diluted prior to contacting the sample with the first moiety and / or the second moiety.

115. A light induced assay with enhanced sensitivity in detecting a presence of an analyte target in a sample, comprising (i) a first moiety, which comprises a first binding domain and a first nucleic acid domain, and (ii) a second moiety, which comprises a second binding domain and a second nucleic acid domain, wherein the first binding domain and / or the second binding domain is capable of specifically binding to the analyte target when the analyte target is present in the sample, wherein the first nucleic acid domain and / or the second nucleic acid domain comprises a photoreactive linker, which is configured to form a covalent bond between the first nucleic acid domain and the second nucleic acid domain upon exposure to a light energy, wherein the sensitivity of the light induced assay is enhanced as compared to a corresponding assay without the photoreactive linker.

116. The light induced assay of claim 115, wherein the first moiety further comprises a third nucleic acid, wherein the first binding domain is attached to the third nucleic acid, and wherein the third nucleic acid hybridizes to the first nucleic acid; and wherein the second moiety further comprises a fourth nucleic acid, wherein the second binding domain is attached to the fourth nucleic acid, and wherein the fourth nucleic acid hybridizes to the second nucleic acid.

117. The light induced assay of claim 115, wherein the first binding domain and / or the second binding domain binds to the analyte target via direct binding or indirect binding.

118. The light induced assay of any one of claims 115-117, wherein the first binding domain and / or the second binding domain comprises a nucleic acid, an antibody, an antibody-nucleic acid complex, an aptamer, or any combination thereof.

119. The light induced assay of any one of claims 115 to 118, wherein the first moiety further comprises an additional element (first additional element) and / or the second moiety further comprises an additional element (second additional element).

120. The light induced assay of claim 119, wherein the first additional element and / or the second additional element comprises a detectable agent, a tag, a barcode, a unique molecular identifier (UMI), a ligand, an encoded particle, at least one ribobase, or any combination thereof.

121. The light induced assay of claim 120, wherein the detectable agent comprises a fluorescent marker, a bead, a nanosphere, a catalyst, an enzyme, a chemiluminescent reagent, a particle, a polymer, a fluorochrome, or any combination thereof.

122. The light induced assay of claim 120, wherein the ligand comprises biotin.

123. The light induced assay of claim 115, wherein the first moiety further comprises a third nucleic acid, wherein the first binding domain is attached to the third nucleic acid, and wherein the third nucleic acid hybridizes to the first nucleic acid; wherein the second moiety further comprises a fourth nucleic acid, and a fifth nucleic acid, wherein the second binding domain is attached to the fourth nucleic acid, and the third binding domain is attached to the fifth nucleic acid, wherein the fourth and fifth nucleic acid hybridizes to the second nucleic acid.

124. The light induced assay of claim 123, wherein the detecting comprises at least two detection methods comprising: (1) hybridizing at least one of the nucleic acids to an encoded particle and at least one label hybridizing to at least one of the nucleic acids; and (2) a Polymerase Chain Reaction (PCR), wherein the PCR uses a first bridging primer that bridges the photo-reactive linker region, spanning at least two nucleic acids, and wherein the first bridging primer has at least some sequence complementarity to at least two nucleic acids, anda second bridging primer that at least partially hybridizes to one of the nucleic acids, and to an extension product of the first bridging primer.

125. A kit comprising the light induced assay of any one of claims 115 to 124, and instructions for use.

126. A composition comprising an analyte detected or isolated according to the methods of any one of claims 1 to 96 and 103 to 114.

127. The composition of claim 126, which further comprises a carrier.

128. A method of using an analyte detected or isolated according to the methods of any one of claims 1 to 96 and 103 to 114.

129. A method of treating a disease or disorder in a subject in need thereof comprising administering to the subject the composition of claim 126 or 127.

130. A method of signal amplification comprising at least two covalently bound nucleic acids linked as part of a proximity hybridization pair in a proximity linking assay as in any of the preceding claims, and wherein the at least two covalently bound nucleic acids hybridize to a third nucleic acid attached to an encoded particle, and forming a t-junction with the third nucleic acid attached to the encoded particle, and wherein a fourth nucleic acid hybridizes to the at least two covalently bound nucleic acids and the third nucleic acid, and wherein the fourth nucleic acid comprises at least one label and wherein at least one of the nucleic acids comprise a UV inducible linking moiety, and wherein subsequent covalently bound nucleic acids are hybridized to subsequent third and fourth nucleic acids through cycles of denaturation and hybridization of nucleic acids to form t-junctions and covalent bonds.

131. The method of claim 130, further comprising detecting covalently bound nucleic acids by PCR, bridge priming, or sequencing.

Citation Information

Patent Citations

  • Process for amplifying, detecting, and / or-cloning nucleic acid sequences

    US4683195A

  • Systematic evolution of ligands by exponential enrichment: photoselection of nucleic acid ligands and solution selex

    EP1889910A2

  • Homogeneous analyte detection

    WO2006137932A2

  • A NOVEL IMMUNO-PCR METHOD USING cDNA DISPLAY

    WO2020171236A1

  • Spatial characterisation of target structures in a sample

    WO2020254672A1