Genetically engineered fungi having enhanced production of recalcitrant carbon polymers

Genetically engineered fungi produce recalcitrant polymers like melanin, addressing the economic and scalability issues of current carbon capture technologies by enhancing soil organic carbon content and promoting plant health through slow-degrading carbon sequestration.

WO2025155900A1PCT designated stage expired Publication Date: 2025-07-24IVU BIO INC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/012166
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-18
Filing Date
2025-01-17
Publication Date
2025-07-24

AI Technical Summary

Technical Problem

Current carbon capture and storage technologies are not economically viable or scalable enough to meet the demands of climate change mitigation, and there is a need for cost-effective and sustainable methods to sequester carbon in soils to enhance soil organic carbon content.

Method used

Genetically engineer fungi such as Piriformospora indica and Trichoderma to produce recalcitrant polymers like melanin, which are incorporated into their cell walls, allowing them to sequester carbon in soils over hundreds to thousands of years, enhancing soil organic carbon content and promoting plant health.

Benefits of technology

The engineered fungi effectively sequester carbon in soils, improving soil health, crop resilience, and reducing the carbon footprint of agriculture by producing recalcitrant polymers that degrade slowly, thus providing a long-term carbon sink.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025012166_24072025_PF_FP_ABST
    Figure US2025012166_24072025_PF_FP_ABST
Patent Text Reader

Abstract

A modified fungus, which is genetically engineered to produce an elevated level of one or more recalcitrant polymers as compared with its native counterpart; wherein the modified fungus is a mycorrhizal fungus, an endophytic fungus, a deuteromycota, an ascomycota, or a marine fungus.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] GENETICALLY ENGINEERED FUNGI HAVING ENHANCED PRODUCTION OF RECALCITRANT CARBON POLYMERS

[0002] CROSS REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of the filing date of U.S. Provisional Application No. 63 / 622,234, filed January 18, 2024, the entire contents of which is incorporated by reference herein.

[0004] SEQUENCE LISTING

[0005] The instant application contains a Sequence Listing which has been filed electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on January 17, 2025, is named “060842-50100 lWO_Seq-Listing_ST26. xml” and is 35,417 bytes in size.

[0006] BACKGROUND

[0007] Atmospheric concentrations of greenhouse gases continue to rise due to human activities, and are set to hit new historic highs.5Despite worldwide attempts to slow down warming with various mitigation policies, warming is still occurring at approximately 0.2°C per decade and is currently near 1°C above preindustrial levels.5Experts suggest that reducing the emission of greenhouse gases will not be sufficient for limiting global warming to 1.5°C — a predicted threshold for a major ecological tipping point.5,6There is an urgent need for additional strategies to be applied in combination with reducing emissions, such as active carbon capture, sequestration, and utilization (CCSU) via cooperation between nations and industries in order to reach net-zero sustainability goals by 2050.7

[0008] Although some technologies for CO2 capture and storage are well established,8they have yet to become economically viable. Given the scale and rate of CO2 production compared to utilization allowing long-term sequestration, estimates indicate that chemical conversion of CO2 is unlikely to account for more than 1% of the mitigation needed, while a scaled-up enhanced oil recovery (EOR)-CCS industry would likely only account for 4-8%.9As such, despite serving as economic incentives, current technologies for Carbon (C) capture are not up to the task of climate change mitigation.

[0009] There is growing interest on CCSU biotechnologies as possible venues for the creation of viable value chains that offset costs.9,10Yet, the current CCSU biotechnologies are still limited by economics, human capacity, and constraints related to the need to retrofit large-scale industrial equipment..9 10

[0010] SUMMARY

[0011] The present disclosure relates, at least in part, to engineering of soil microbes, for example, fungi such as those provided herein, such that, unlike their native parent microbes, the resultant modified soil microbes can produce recalcitrant polymers in their fungi cell walls to produce recalcitrant polymers. Such recalcitrant polymers may degrade over 100s- 1000s of years. In a specific example, melanin is an exemplary recalcitrant polymer to produce in the modified soil microbes.

[0012] The present disclosure aims at synthetically enhance the biological production of recalcitrant carbon polymers, thus ensuring the permanence of soil carbon with its slow degradation — a major challenge in climate change mitigation as well as in sustainable agriculture, for example, development of modified soil microbes (e.g., those provided herein) for biological production of melanin in the fungi cell walls of fungi that colonize the roots of major crop species. Since melanin is produced inside the fungi cell wall, soil, plant, and fungal interactions can be effective as a cost-effective and scalable Carbon Dioxide removal pathway. The modified soil microbes provided herein can enhance carbon capture and sequestration into the vast lands currently used for agricultural production of major row crops.

[0013] In some aspects, provided herein is a modified fungus, which is genetically engineered to produce an elevated level of one or more recalcitrant polymers as compared with its native counterpart; wherein the modified fungus is a mycorrhizal fungus, an endophytic fungus, a deuteromycota, an ascomycota, or a marine fungus. In some instances, the native counterpart thereof does not produce the one or more recalcitrant polymers.,

[0014] In some embodiments, the recalcitrate polymer is melanin, sporopollenin, algaenan, lignin, or suberin. In one example, the recalcitrate polymer is melanin.

[0015] In some embodiments, the modified fungus is a modified endophytic fugus, for example, a Piriformospora. In one example, the modified fugus is a modified Piriformospora indica. In other embodiments, the modified fungus is a modified ascomycota, for example, a modified Trichoderma. In one example, the modified fungus is Trichoderma reesei.

[0016] In some embodiments, the modified fungus comprises one or more exogenous nucleic acids encoding one or more enzymes involved in the biosynthesis pathways of the one or more recalcitrant polymers. In some examples, the one or more exogenous nucleic acids are incorporated into the genome of the fungus. In some instances, the coding sequences in the one or more exogenous nucleic acids are in operable linkage to one or more exogenous promoters. Alternatively, the coding sequences in the one or more exogenous nucleic acids are in operable linkage to one or more endogenous promoters.

[0017] When the recalcitrant is melanin, the modified fungus can be genetically engineered to express scytalone dehydratase (SCD), 1,3,8-trihydroxynaphthalene reductase (THR), and polyketide synthase (PKS). In some instances, the modified fungus comprises one or more exogenous nucleic acids encoding the SCD, THR, and PKS.

[0018] In other aspects, the present disclosure features a method for producing any of the modified fungi provided herein, the method comprising:

[0019] (i) introducing one or more nucleic acids encoding enzymes involved in the biosynthesis pathways of the one or more recalcitrant polymers into an unmodified counterpart of the modified fungus; and

[0020] (ii) identifying modified endophyte fungus expressing the one or more enzymes, thereby producing the one or more recalcitrant polymers.

[0021] In some embodiments, step (i) may be performed by incubating one or more agrobacteria carrying one or more binary vectors with a cell or a part of the unmodified counterpart of the modified fungus. The one or more binary vectors comprises the one or more nucleic acids encoding the one or more enzymes involved in the biosynthesis pathways of the one or more recalcitrant polymers.

[0022] In some examples, the agrobacteria are A. tumefaciens.

[0023] In some examples, the cell or the part of the native counterpart is a spore, a germinating conidia, a protoplast, a mycelium, or a fungi colony.

[0024] In addition, the present disclosure features a method for enhancing soil organic carbon, comprising colonizing any of the modified fungi provided herein a plant, for example, a crop. The modified fungus produces the one or more recalcitrant polymers, which are disseminated into the soil where the plant grows. In some embodiments, the plant is a crop, which is an agriculture crop, optionally maize, soybean, wheat, rice, or cotton. In some embodiments, the modified fungus is colonized on the root of the plant.

[0025] The engineered soil microbes such as modified fungi are expected to have proven benefits to plant health, for example, as a beneficial soil amendment, supporting crop health and resilience; improved yields from healthier, keeping carbon in the soil increases soil health, helping prevent losses from soil degradation, etc. Capture of carbon into recalcitrant forms (e.g., melanin) can preventing it from being released into the atmosphere during tilling, thereby lowering the carbon footprint of agriculture. The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the present invention will be apparent from the following drawings and detailed description of several embodiments, and also from the appended claims.

[0026] BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to the drawing in combination with the detailed description of specific embodiments presented herein.

[0028] FIG. 1 is a photo showing phenotype of P. indica in potato dextrose-containing media.

[0029] FIGs. 2A-2C include diagrams showing representative agarose gel electrophoresis showing PCR products of amplified SCD, PKS, and THR genes flanked with fungi promoter and terminator sequences before and after gel purification. FIG. 2A: a schematic of PCR amplification strategy for PKS genes. FIG. 2B: photos showing agarose gel electrophoresis of PKS PCR before and after gel purification of PKS gene fragments. Left panel'. PCR amplification of PKS fragments as indicated. Middle panel and right panel: overlap PCR products of PKS fragments as indicated. FIG. 2C: photos showing agarose gel electrophoresis before (left panel) and after gel purification (right panel) of SCD, THR, Hygromycin fragments and the plasmid backbone.

[0030] FIGs. 3A-3C include photos showing representative agarose gel electrophoresis confirming pCAMBlA-SCD (FIG. 3A), pCAMBlA-THR (FIG. 3B), and pCAMBIA-PKS (FIG. 3C) clones transformed into an E. coli DH10B strain. Highlighted clones were chosen for subsequent transformation. NC: negative control.

[0031] FIGs. 4A-4C include photos showing representative agarose gel electrophoresis confirming pCAMBIA-SCD (FIG. 4A, FIG. 4B), pCAMBIA-THR (FIG. 4B), and pCAMBIA-PKS (FIG. 4C) clones into Agrobacterium tumefaciens strains AGL-1 or EHA105. Highlighted clones were chosen for subsequent transformation. NC: negative control, PC: positive, control.

[0032] FIGs. 5A-5B include photos showing representative images of P. indica transformants on PDA medium 6 days (FIG. 5A) and 12 days (FIG. 5B) after selection under increasing hygromycin concentrations of 0, 5, 7, 10, 15, 20, 15, and 30 (pg / ml).

[0033] FIGs. 6A-6B include photos showing representative images of P. indica transformed mycelium on selection media after 3 weeks. FIG. 6A: front view. FIG. 6B: back view.

[0034] FIGs. 7A-7B include representative images showing melanin production by the transformed P. indica clones compared to wild type. FIG. 7A: front view and back view of P. indica transformants and the wild-type control on selection media. FIG. 7B: representative images of chlamydospores of P. indica transformants and the wild-type control one month on selection media.

[0035] DETAILED DESCRIPTION

[0036] Momentum for action on soil organic carbon is growing in political, financial and technical circles to address multiple sustainability goals.11Soils are the foundation for almost all biological processes on the Earth’s land surface. Soils store vast C reservoirs, estimated at near 3,400 Pg (1 petagram = 1 trillion kg), including soil organic carbon (SOC) stored in permafrost.12, 13 This major carbon pool is nearly five times the current atmospheric pool of CO2.14 The global C pool in soils to a depth of 2 m has been estimated to be 3 times triple that of the atmosphere (-3,000 Gt C compared to -830 Gt C).1S

[0037] In addition to climate change mitigation and adaptation, soils rich in organic C are associated with enhanced biodiversity, water cycling, agricultural productivity.16 17In this context, increases in soil organic C and protection against losses from this pool are both important strategies for environmental and human well-being.11Management practices that raise soil organic C levels are largely low in cost compared to alternative greenhouse gas abatement. Such practices benefit both the environment and the farm, increasing crop productivity and resilience and restoring soil health while sequestering C.

[0038] The biome of the rhizosphere (i.e., the zone of soil surrounding a plant root where the biology and chemistry of the soil are influenced by the root) functions as a C pump, pulling atmospheric CO2 captured by plants below ground and storing it in the rhizosphere, where plants interact with soil bacteria and fungi via exchanges of SOC.7This SOC can be either stored or respired back into the atmosphere, depending on various ecological and geochemical factors. Degradation of SOC is regulated by microorganisms that transform plant debris and organic matter into nutrients that can be taken back up by plants. During this process some of the C remains in soil, creating a CO2 sink. The potential to store C depends on the soil structure, which affects binding and stabilization of organic material, in addition to fluxes of gases and water. Labile C consists mainly of microbial biomass, dissolved organic C, and organic matter that can be easily oxidized. On the other hand, recalcitrant C refers to the component of SOM that is resistant to microbial decomposition or protected by mineral-soil particles.7Interactions between soil geochemistry, microbiomes, and root biochemistry determine the C sink capacity of rhizosphere biomes. There is an untapped opportunity to manipulate the rhizosphere biome for carbon sequestration by engineering microbes that contribute to recalcitrant carbon pools in soil.

[0039] While most fungi species act as decomposers, eliciting the release of CO2 to the atmosphere, mycorrhizal fungi are a notable exception.19Because mycorrhizal fungi help plants uptake nutrients from soil, plants that are colonized by these fungi show improved and faster growth,20which in turn increases their capacity to remove atmospheric CO2. A portion of that C is then allocated to the fungi, which use it to build hyphae that extend into the soil.21Recent studies indicates that fungi and other microbes, and not plants, are responsible for the production of most C compounds that remain in the soil long-term.22These diverse, microbially derived compounds are difficult for decomposers to break down,23including cell wall remains, such as chitin, glucans, peptidoglycans, or polysaccharides.24

[0040] The present disclosure provides modified fungi that are engineered (e.g., genetically) to produce recalcitrant polymers, methods for producing such, and methods of using such to enhance soil organic carbon.

[0041] I. Genetically Modified Soil Microbes

[0042] In some embodiments, provided herein are modified soil microbes such as modified fungi, which can be genetically engineered to produce an elevated level of one or more recalcitrant polymers as compared with its native (or unmodified) counterpart.

[0043] A. Soil Microbes

[0044] In some instances, the modified fungus can be a mycorrhizal fungus, an endophytic fungus, a deuteromycota, an ascomycota, or a marine fungus. In some embodiments, the native or unmodified counterpart fungus does not produce such recalcitrant polymers.

[0045] A mycorrhizal fungus can colonize a host plant’s root tissues, either intracellularly as in arbuscular mycorrhizal fungi, or extracellularly as in ectomycorrhizal fungi. The host plant makes organic molecules such as sugars and lipids and supplies them to the fungus. On the other hand, the fungus supplies the plant with water and mineral nutrients, such as phosphorus, taken from the soil. There are two types of mycorrhizal fungus, ectomycorrhizas and endomycorrhizas, depending on whether the fungus would penetrate plant root cells. Endomycorrhiza includes arbuscular, ericoid, and orchid mycorrhiza. Ectoendomycorrhiza includes arbutoid mycorrhizas. Endophytic fungi refer to fungus that colonize the intercellular or intracellular spaces of tissues (e.g., roots, stems, leaves, flowers, and / or seed) of their host plants. They live in plant tissues throughout the entire or partial life cycle by establishing a mutually beneficial symbiotic relationship with its host plant. For example, endophytic fungi can uptake nutrients from the soil and supply them to the host plant. One example of endophytic fungi is Piriformospora, e.g., Piriformospora indica. In specific examples, the modified fungus provided herein is a modified P. indica.

[0046] P. indica is compatible with a wide range of crop plants, for example, com and soy. Industrialized agricultural systems degrade soil through management practices and have a particular need to sequester carbon for soil formation and erosion prevention. Given the vast acreage planted in corn-soy rotation (on average, U.S. farmers plant about 90 million acres of com and 87 million acres of soybean each year,82 83even a modest boost in the carbon sequestration ability of these agroecosystems, when amplified across 177 million acres, would yield enormous climate benefits and improve the sustainability of the major cropping systems.

[0047] Deuteromycota and Ascomycota are two major groups of soil fungus. Deuteromycota include the lichens and the mycorrhizal fungus (Biological Diversity: Fungus, n. d.; Lavelle & Spain, 2005). Ascomycetes are mostly yeasts used in baking. In some examples, the modified fungus is an ascomycota, for example, Trichoderma. In specific examples, the modified fungus is a modified Trichoderma re esei.

[0048] Marine fungi species of fungi that live in marine or estuarine environments. Based on their living environment, marine fungi can be categories as obligate marine fungi, which grow exclusively in the marine habitat, and facultative marine fungi, which normally live in terrestrial or freshwater habitats.

[0049] In some embodiments, the modified soil microbes may be organisms that behave in similar manners as fungi, for example, lichen.

[0050] Any of the modified fungi provided herein may comprise one or more exogenous nucleic acids encoding one or more enzymes involved in the biosynthesis pathways of the one or more recalcitrant polymers. “Exogenous nucleic acids” refer to nucleic acids that are not native nucleic acids of the unmodified fungus counterpart and are delivered into the unmodified counterpart to produce the modified fungus. B. Recalcitrant Polymers

[0051] Recalcitrant polymers are long polymers, the degradation of which often requires multiple enzymatic activities over a long period of time. Examples include, but are not limited to, melanin, sporopollenin, algaenan, lignin, and suberin.

[0052] The modified soil microbes provided herein may be engineered to express enzymes involved in the biosynthesis of such recalcitrant polymers, which are known in the art. Provided below is an example.

[0053] C. Melanin Biosynthesis Pathways

[0054] There are two main melanin synthesis pathways in fungi, 1,8 -dihydroxy naphthalene (DHN) and 1-3,4-dihyroxyphenylalanine (L-DOPA).63In the DHN pathway, fungi synthesize melanin from an endogenous substrate (acetyl coA or malonyl coA). Polyketide synthase (PKS) converts acetyl coA or malonyl coA into 1,3,6,8-tetrahydroxynaphthalene (1,3,6,8-THN) in the first step. Following, 1,3,8-trihydroxynaphthalene reductase (THR) reduces 1,3,6,8-THN to produce scytalone. Next, scytalone is dehydrated to 1,3,8-trihydroxynaphthalene (1,3,8- THN) via Scytalone dehydratase (SCD), then reduced by a second THR to vermelone. Further dehydration of vermelone by SCD produces the melanin precursor 1,8-dihydroxynaphthalene (1,8-DHN). Oxidation and polymerization of 1,8-DHN then lead to melanin.

[0055] Many genes encoding these enzymes have been discovered. A cluster of three genes has been identified in Alternaria alternata: ALM (PKS), BRMl(SCD) and BRM2 (THR);64 introducing these genes was proven successful in inducing melanin production in nonproducing fungi.65Homologues of these genes have been identified in other fungi but are distributed throughout the genome. For example, PKS I,66THR1,67SCD1 of P grisea WdPKSl of W dermatitidis;69ALB 1,70 4HNR,713HNR,72and sdh of P. grisea In the L- DOPA pathway,63fungi produce melanin from L-3,4-dihydroxyphenylalanine (L-DOPA) or tyrosine via Tyrosinase Laccase, similar to mammalian melanin biosynthesis. Melanin production via tyrosinase has also been reported in bacteria such as Bacillus,74Rhizobium,75-76and Streptomyces.77The tyrosinase gene has been heterologously expressed in Escherichia colili’19and Vibrio natriegens30to produce melanin.

[0056] Genes encoding the enzymes involved in the synthesis pathways for recalcitrant polymers such as melanin (e.g., SCD, PKS, and THR) are well known in the art. Any suitable ones can be used for making the genetically engineered fungus strains disclosed herein. Exemplary SCD genes include those disclosed in GenBank under Accession Numbers HM486908. Exemplary PKS genes include those disclosed in GenBank under Accession Numbers HM486910. Exemplary THR genes include those disclosed in GenBank under Accession Numbers HM486909. Sequences disclosed under these GenBank Accession Numbers are incorporated by reference in the entirty.

[0057] Melanogenesis via the DOPA-pathway is a mechanism microorganisms use to neutralize toxic phenolic compounds from the environment. This pathway is more suitable for high-yield melanin production for industrial applications because L-DOPA melanin is produced extracellularly, facilitating melanin extraction. On the other hand, in the DHN pathway, the DHN pigment is synthesized endogenously from malonyl-coenzyme A and is tightly attached to the inner side of the cell wall, which is a source of storage C in the soil.

[0058] IL Application of Modified Soil Microbes

[0059] The modified soil microbes provided herein can be used as a soil amendment or seed coating that can be applied to agricultural soils (and potentially grasslands). They can be products that fits into current agricultural practices, thus lowering the bar for adoption. The approach can be used on any plant and farming process — importantly, it will be compatible with both till or non-till agriculture (although we expect non-till agriculture will lead to even higher amounts of carbon captured over time, as the soil ecosystem is not disturbed).

[0060] In some examples, seeds can be coated with modified soil microbes such as the modified fungi provided herein (e.g., application post-planting, as a soil amendment, is also a possibility). The modified microbes can colonize crop seedlings and, during the growth stage, access resources from plants and the soil microbiome. The modified microbes such as modified fungi can turn resources into recalcitrant carbon (e.g., melanin), which degrades slowly over hundreds of years, therefore locking carbon in soil. The modified microbes such as modified fungi can continue growing until they create microbial (e.g., fungal) soil networks. Since carbon would be stored in a recalcitrant state in fungal cell walls, when decay happens, carbon would not be released — similarly to soils that have non recalcitrant carbon.61,62

[0061] III. Methods for Making Modified Soil Microbes

[0062] The modified soil microbes such as modified fungi can be made following methods known in the art or provided herein. See, e.g., Examples 1 and 2 below. Examples include Agrobacterium tumefaciens , treatment of protoplast with polyethylene glycol (PEG), electroporation, and biolistic methods.

[0063] In some examples, A. tumefaciens-mediated transformation can be used for making the modified fungi as provided herein. This technique has been successfully applied to many fungi species.35Other agrobacteria species can be used to mediate the delivery of genetic materials into host fungal cells for making the genetically modified fungi as disclosed herein.

[0064] Methods for expressing heterologous enzymes in fungal host cells and inserting exogenous nucleic acids into the genome of the fungal host cells are also known in the art. In some instances, a selection marker gene such as an antibiotic resistant gene can be cointroduced into the host cells and the corresponding antibiotic can be used to select transformed host cells carrying the genes of interest. The intended genetic modification of a target fungal host cell can be verified by routine practice, for example, by detecting the exogenous gene via, e.g. , PCR, or by detecting transcripts of the target gene. Alternatively or in addition, the protein product can be detected by conventional technology.

[0065] The resultant genetically modified fungal host cells or fungus can be cultured in a suitable medium and production of the target recalcitrant polymer such as melanin can be detected via conventional technology. See also the Examples below.

[0066] General techniques

[0067] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (M. J. Gait, ed. 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J. E. Cellis, ed., 1989) Academic Press; Animal Cell Culture (R. I. Freshney, ed. 1987); Introduction to Cell and Tissue Culture (J. P. Mather and P. E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J. B. Griffiths, and D. G. Newell, eds. 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir and C. C. Blackwell, eds.): Gene Transfer Vectors for Mammalian Cells (J. M. Miller and M. P. Calos, eds., 1987); Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds. 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds. 1994); Current Protocols in Immunology (J. E. Coligan et al., eds., 1991 ); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C. A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds. Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and II (D.N. Glover ed. 1985); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds.(1985»; Transcription and Translation (B.D. Hames & S.J. Higgins, eds. (1984»; Animal Cell Culture (R.I. Freshney, ed. (1986»; Immobilized Cells and Enzymes (1RL Press, (1986»; and B. Perbal, A practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.).

[0068] Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein.

[0069] EXAMPLES

[0070] Example 1: A Novel Carbon Sequestration Platform Based on Soil Fungi

[0071] This example aims to synthetically enhance the biological production of recalcitrant polymers, thus ensuring the permanence of soil carbon with its slow degradation, a current challenge in soil carbon storage for climate change. Nature-based solutions present a unique opportunity to sequester carbon due to their scale and low cost.36,37Enhancement of natural C sinks may take a variety of forms and implicates a diverse set of community and ecological cobenefits, including protecting water resources, soil resilience, biodiversity, and boosting farmer livelihoods. Nature-based solutions can involve different strategic pathways, like afforestation and regenerative agriculture. In our approach, we will engineer fungi to store C in cell walls as melanin (i.e. , synthetically enhancing the biological production of recalcitrant polymers) ensuring the permanence of soil C with its slow degradation, a current challenge in soil carbon storage for climate change.

[0072] A NOVEL CARBON CAPTURE APPROACH INSPIRED BY NATURE

[0073] The approach provided herein is bioinspired by ectomycorrhizal fungi (EMF) that associate with trees and produce melanin pigment. Melanin is a large class of pigment molecules that is stored in the fungal cell wall and has a wide variety of functions; it can confer resilience to pathogens, protection from UV light, and tolerance to desiccation and osmotic stress.38,39Because of its recalcitrance, fungal melanin is expected to have a positive effect on soil C storage.38Melanin polymers are remarkable in that they have a stable population of organic free radicals. Melanin is widely distributed in living organisms such as bacteria, fungi, plants, animals, and human beings: eumelanins, pheomelanins, allomelanins, and pyomelanins.40

[0074] Microbes impact C in soil by acting as decomposers and plant root associates, as well as by sequestering fixed C in their biomass. In high-latitude ecosystems, much of soil C could be fungal in nature.18Soil is one of Earth's largest C sinks, and the diverse community of fungi it houses may affect soil C storage through the biosynthesis of recalcitrant cell wall polymers like melanin.41

[0075] In soil, the majority of melanin producing fungi are found in forestry systems. Most trees form symbioses with EMF, and this association enables access to growth-limiting soil resources.42The present disclosure leverages the power of melanin-producing fungi to significant increase the ability of cultivated soils to sequester and hold C in the long-term. This example describes genetic engineering of Piriformospora indica, a beneficial fungus that colonizes a diverse group of crops, but does not produce melanin, to produce melanin.

[0076] PIRIFORMOSPORA INDIA AS A PRIMARY FUNGAL TARGET FOR SOIL CARBON SEQUESTRATION

[0077] Microbial populations are a key component of terrestrial ecosystems, and carry out important ecosystem functions such as nutrient cycling and biogeochemical transformations that sustain plant growth. Plant growth-promoting fungi (PGPF) persist in the rhizosphere and benefit plant health. PGPF can stimulate plant growth and development, alleviate plant stress, and prime plant defense mechanisms.4445Plant growth-promoting microbes are an innovative solution for increasing crop yields while also conferring resilience. Layering these inherent plant growth-promoting capabilities with carbon-sequestration traits (i.e., melanin production, along with increased root biomass from PGPF colonization) will amplify the benefits and increase the ecosystem services provided by agroecosystems.

[0078] The beneficial endophytic fungus Piriformospora indica fP. indica) as the initial target due to its many advantages. P. indica is a fungal mutualist capable of colonizing many crop plants to enhance growth through direct and indirect mechanisms.46Direct benefits of P. indica include supply of nutrients, such as nitrate and phosphorus acquisition.4749Enhancing plant tolerance to stressors such as drought through multiple mechanisms is another potential benefit of PGPF such as P. indica.46Indirect plant growth promotion involves mechanisms such as pathogen suppression through niche exclusion, nutrient competition, or antimicrobial compound production. PGPF, and specifically P. indica, can also prime plants for pathogen and pest defense by inducing systemic resistance by upregulating ethylene and jasmonic acid production.50

[0079] P. indica can to be grown on artificial media without plant roots and complete its life cycle.51This is a valuable trait for genetic engineering as well as industrial scale up. In addition, because it also brings substantial benefits to the crop plants, our products based on this fungus will serve a dual purpose: plant growth and health promotion in addition to carbon sequestration. Exemplary advantageous features include:

[0080] • Presents an exceptionally wide host range, including not only monocot and eudicot plants but also gymnosperms, or even bryophytes, pteridophytes.52

[0081] • Promotes seed germination, plant growth, development and yield.46For example, H. vulgare (bean) seeds inoculated with P. indica had higher viability under adverse conditions; germinated seedlings showed higher survival rate when immersed in P. z zca-homogenate;53root colonization of bryophytes, pteridophytes, gymnosperms and angiosperms with P. indica was shown to lead to higher seed yields.54

[0082] • Improves crop tolerance to a number of abiotic stresses including salinity,55drought,56low temperature and heavy metal toxicity.57

[0083] • Protects plants against a range of biotic stresses, such as pathogenic fungi, bacteria, and virus.58-60

[0084] BIOENGINEERING THE DHN MELANIN BIOSYNTHESIS PATHWAY INTO P. INDICA

[0085] P. indica is genetically engineered to synthesize DHN melanin by expressing the Altemaria alternata melanin pathway genes ALM (PKS), BRMl(SCD) and BRM2 (THR). As one example, the glyceraldehyde-3-phosphate dehydrogenase (gpd) promoter from Aspergillus nidulans is to be used as the promoter for regulation of these genes to ensure DHN melanin constitutively expressing in P. indica.

[0086] The target genes were cloned into the transformation vector pCAMBIA, flanked by the gpd promoter upstream and the 35S terminator sequence downstream. Clones were transformed into E. coli, then confirmed via sequencing. Clones were then successfully transformed into Agrobacterium. Table 1: Summary of Bacterial Transformation with pCAMBIA Vectors

[0087] A P. indica strain was obtained from a commercial source. This P. indica strain grows well on PDA medium, producing pear-shaped chlamydospores after 1 month at 28 °C.

[0088] A procedure to select transformants under hygromycin selection was established. Mycelia pieces of P. indica were inoculated on PDA plates containing hygromycin with a series of concentrations: 0, 5, 7, 10, 15, 20, 25, and 30 pg / ml. The growth rate and colony morphology were used to determine the optimal concentration of hygromycin. Experiments were conducted in three replicates. At hygromycin concentrations of 25 or 30 pg / ml, the vegetative growth of P. indica was completely inhibited and aerial hyphae were not observed (results not shown). Thus 25 - 30 pg / ml hygromycin can be used to screen P. indica transformants. FIG. 1 shows the wild-type phenotype of P. indica, which was important for us to characterize as it will help with the identification of future transformants.

[0089] GENERATION OF P. INDICA STRAINS ENGINEERED FOR MELANIN PRODUCTION

[0090] Transformation Approach: As an example, the tumefaciens-m&diated transformation method is used to incorporate the genes encoding the enzymes involved in the melanin biosynthesis pathway into the genome of P. indica. Compared with other techniques generally used for delivering genes into fungi’s genomes: A. tumefaciens-mediat&d transformation is easier, faster and has higher efficiency than others.35

[0091] A. tumefaciens-mediated transformation consists of three steps: induction of A. tumefaciens containing a binary vector, co-incubation of A. tumefaciens with fungal spores, and selection of transformants. This technique has been successfully applied to many fungi including Ascomycetes (58 species), Basidiomycetes (15 species), Zygomycetes (4 species) and Oomycetes (3 species).86A specific protocol for P. indica transformation is to be established. Each parameter is to be optimized. Agrobacterium strains: There are several A. tumefaciens strains has been used successfully for fungi transformation such as LBA4404,87LBA1100,88EHA105,89GV3101, C58C1,90and AGL1.91Among them, AGL1 achieved the best result in transformation efficiency than EHA 105 and LBA4404.92Thus, we use two different A. tumefaciens strains, AGL1 and EHA105 for our transformation.

[0092] Starting materials: A. tumefaciens can transfer genes to different cell types: spores, germinating conidia, protoplast, mycelium, and fungi colonies.9 ,94However, the transformation efficiency depends on type of fungi species. For example, in Agaricus bisporus, a higher transformation efficiency was obtained when using vegetative and fruiting body mycelia than germinated conidia.88,95,96While transformation of G. roseum and L. maculans can be successful when using fresh spores,97transformation of Rhizopus oryzae is only successful when using protoplast.98,99The effect of using different cell types: spores, geminating spore, or mycelium on the transformation efficiency of P. indica is unknown. All of them are to be examined.

[0093] Agrobacterium induction: Acetosyringone is a critical component to increase vir genes induction in Agrobacterium.100The activity of vir genes controls the process of transferring T-DNA into the host genome.101,102Pre-treatment of A. tumefaciens cells with acetosyringone often improves transformation frequencies.103 105There are several ways to induce Agrobacterium; in some studies, Agrobacterium cells were washed and diluted with induction medium (IM) containing acetosyringone for induction until an OD600 of 0.6-0.8.88,97In others, Agrobacterium cells were diluted with IM containing acetosyringone without washing.106Alternatively, Agrobacterium cells could be induced directly with acetosyringone without dilution for 2-3 hours and then adjusted to OD600 = 0.7.

[0094] Co-cultivation of Agrobacterium and fungi: The co-cultivation temperature and time have a great influence on the transformation frequency.107The effect of various co-cultivation temperatures and times are to be tested to determine the optimal conditions for the transformation. Also, the ratio of A. tumefaciens to fungal cells is to be tested to determine the best ratio.

[0095] Confirming melanin production in engineered P. indica. Once a minimum of 3 independent transformed strains is obtained, it is to be verified that they are producing melanin. Melanin will be extracted and purified according to published methods.108The chemical properties of the purified melanin will be verified by UV-visible light (UV-Vis) and Fourier transfer infrared (FTIR) spectrometry as well as by electron paramagnetic resonance (EPR), using A. alternate DHN melanin and DOPA melanin (Sigma) as standards. For melanin precursor determination, we will follow the method of Wheeler and Klich (1995).109

[0096] Goals to Achieve

[0097] In this example, the following goals are expected to achieve:

[0098] 1) Establishing a robust transformation protocol for P. indica using Agrobacterium.

[0099] 2) Using this newly established protocol, generate at least 3 P. indica transformants containing all 3 melanin constructs (pSCD, pTHR, and pPKS). The position of the inserted genes can have a significant impact on the efficiency of protein production.110 111The genes should be inserted at fungi genome locations that ensure the expression of genes, the stability of the mRNA transcript, the efficiency of translation, and the folding and stability of the protein properly. If the genes are inserted into chromosomal regions that are not favorite for transcription, the genes may not be expressed, which can lead to no protein production. If the mRNA transcripts are generated in a region of genome that is highly accessible to nucleases, the transcripts would be degraded, which leads to reduce the amount of produced protein. Or if the genes are inserted at the locations where the ribosomes are unable to bind to the mRNA transcripts efficiently, the proteins will not be produced as efficiently. And finally, if the proteins are unable to fold properly, they will be degraded easily, which can also lead to a smaller number of produced proteins. Therefore, to mitigate the risk of having a transformant with inadequate protein production due to positional effects, we aim to generate at least 3 transformants containing all 3 melanin genes to ensure we have one P. indica transformant producing the best amount of melanin.

[0100] 3) Melanin production.

[0101] DEMONSTRATION OF THE ENGINEERED STRAIN’S ABILITY TO COLONIZE PLANTS

[0102] Overview. After and generating candidate engineered strains, we will perform benchtop, plate-based assays to demonstrate that the engineered strains maintain their ability to colonize plants. This will demonstrate that the genetic modifications do not disturb fungi colonization / infection mechanisms. To do this, the engineered strains will be tested side-by- side with wild type P. indica. At least two different crop species are to be tested to show broad colonization efficacy. Approach. Soybean seeds will be surface-sterilized, and eighteen seeds of equal size will be selected and pre-germinated. P. indica will be propagated in potato dextrose broth as described previously.49For inoculation of plants with P. indica, 2 g of mycelium will be thoroughly mixed with 100 g of sterilized soil in peat pots before sowing, this will be done for engineered and non-engineered strains. The control treatment will contain no inoculum. Plants will be grown. Three different treatments including an uninoculated control, non-engineered P. indica inoculated treatment and engineered P. indica inoculated treatment will be employed. Each treatment will consist of three biological replicate plants grown in separate peat pots. Plants will be harvested 60 days after sowing. The roots will be thoroughly washed.

[0103] Staining of Roots and Percent Colonization. Washed roots will be cleaned by soaking in 10% KOH for 4 days, acidified with 1 N HC1 for 5 minutes, and then stained with lacto-phenol cotton blue. The roots will be observed under 630X with an optical light mi •croscope.1 12

[0104] Success Metrics. Comparable mean colonization rate as non-engineered strain. This will be measured by comparing the efficiency of colonization of the three seeds the fungi will try to colonize.

[0105] DEMONSTRATION OF FEASIBILITY IN A GREENHOUSE-BASED PILOT STUDY

[0106] Overview. To evaluate the capabilities of engineered P. indica to enhance crop growth and soil carbon sequestration, we will perform greenhouse experiments to evaluate colonization rates, melanin production and / or total soil carbon, and plant performance metrics. For both corn and soy, we will select agronomically relevant hybrids as our seed stock. The treatments will be: uninoculated, inoculated with unmodified P. indica (WT), and inoculated with engineered P. indica (GMO). Comparison of uninoculated and WT treatments will allow us to evaluate the impact of P. indica alone, and comparison of WT and GMO inoculants will reveal the additional benefits of the melanin production traits engineered into P. indica. The experiment will be housed in a greenhouse setting on the UIUC campus designed for biological containment of GMOs. Plants will be grown under standard conditions and management practices (e.g., light, watering, fertilizer) for each crop species, using cultivation practices commonly employed in the greenhouse facilities. The planting medium will be live soil (i.e., typical field soil with a living soil microbiome) in order to evaluate the colonization and performance of the inoculant in the presence of a typical microbial community. Each crop will receive the fungal inoculant treatment (no fungi, WT, or GMO) at the time of planting, in accordance with the inoculant delivery practices developed by Ivu Bio. For each crop (corn or soybean), 20 replicate plants of each treatment will be grown for 30 days. Following harvest, we will evaluate a) plant biomass (aboveground and belowground); b) P. indica colonization rates; c) Carbon capture, assessed through: melanin detection polyphenol oxidase activity, or elemental analysis to determine soil total C. Root biomass is also an element of carbon capture.

[0107] Plant performance. Plant biomass (aboveground and belowground) will be oven-dried and weighed for comparison among treatments.

[0108] P. indica colonization. To evaluate colonization of plant roots by P. indica, genomic DNA will be extracted from plant root tissue of all plants and used as template for speciesspecific PCR targeting the P. indica transcription elongation factor (PITEF). Primers for this PCR have been described.113This PCR yields a 250-bp product from roots colonized by P. indica-, data will be collected on the proportion of colonized plants. To visually confirm colonization, root samples will be stained with trypan blue using techniques developed for arbuscular mycorrhizal fungi.114 115Root colonization will be assessed as % of segments colonized, as described.50,116

[0109] Detection of melanin via PPO detection. Melanin production involves the activity of polyphenol oxidase (PPO), an oxidoreductase enzyme, thus the activity of PPO can be considered a proxy for melanin production. The activity of soil polyphenol oxidase can be determined by a standard colorimetric method (Zhan et al., 2010; Zhou, 1987) which uses pyrogallic acid as substrate. A mixture of 1 g soil and 10 mL of 1% pyrogallic acid is incubated at 30°C for 2 hours, acidified, and the purpurigallin product is extracted by ether and measured spectrophotometrically at 430 nm. Production of purpurigauin is a measure of polyphenol oxidase activity in the sample.

[0110] Soil carbon. Since the ultimate objective is to enhance soil organic carbon through production of melanin by P. indica, we will compare soil carbon in the corn and soy rhizosphere soils using a CostechECS 4010 Combustion Analyzer (Costech Analytical Instruments, Valencia, CA) for elemental analyses of C and N in plant and soil samples. This will be assessed separately from root biomass, although it is important to note that carbon sequestration can be accomplished through a combination of recalcitrant C (melanin) production as well as increasing root biomass.

[0111] Statistical analysis: All plant and inoculant metrics (e.g., root and shoot biomass, colonization by P. indica, various indicators of melanin production) will be compared among treatments and statistically assessed using ANOVA. Statistical analyses will be performed in the R statistical environment.

[0112] Example 2: Generation of Engineered Melanin-Producing P Indica Transformants

[0113] This example describes the generation of exemplary P. indica transformants expressing the DHN melanin pathway genes (including PKS, SCD, and THR) and demonstrates their ability to produce melanin.

[0114] The PKS, SCD, and THR target genes (purchased from IDT) flanked by the gpd promoter upstream and the 35S terminator sequence downstream were amplified using primers described in Table 2 and were subsequently gel purified. FIG. 2A illustrates the PCR amplification of the PKS gene flanked by the Pgpd and T35S sequences as an example. Amplification of the PKS gene is shown in FIG. 2B and amplification of the SCD and THR genes are shown in FIG. 2C.

[0115] The purified gene fragments were cloned into the transformation vector pCAMBIA. The following is an exemplary protocol describing the cloning strategy utilized in this example. To clone SCD (SEQ ID NO: 1), THR (SEQ ID NO: 2) and PKS (SEQ ID NOs: 4-6) gene fragments into pCAMBIA vector, the fragment comprising of the Left Border (LB), T35S, hph (hygromycin) gene fragment (SEQ ID NO: 3), and GPD promoter were amplified using PCR primers gctgttggctggctggtggc (SEQ ID NO: 7) and gctcctccgcggtggcggcc (SEQ ID NO: 8). The fragment containing the T35S, SCD gene (SEQ ID NO: 1), GPD promoter and the Right Border (RB) and the fragment containing T35S, THR gene (SEQ ID NO: 2), GPD promoter, Right Border were amplified using were amplified using primers agagcggccgccaccgcgg (SEQ ID NO: 9) and aaaacacgcgacaagaaaacgc (SEQ ID NO: 10). The PKS gene was amplified as 3 fragments (SEQ ID NO: 4-6) using PCR primer pairs SEQ ID NO: 9 and 15, SEQ ID NO: 16 and 17, and SEQ ID NO: 10 and 18 respectively, and ligated into a full-length gene fragment using a two-step overlap PCR. In the first step, PKS Fragments 1 and 2 were annealed using PCR primers corresponding to SEQ ID NO: 9 and 17. In the second step, the full length PKS gene was produced by annealing the fragment produced in the first step with PKS Fragment 3 using the primer pair of SEQ ID NO: 19 and 10. PKS fragment was screened using primer pairs of SEQ ID NO: 21 and 22. A graphical summary of PKS overlap PCR is shown in FIG. 2A.

[0116] The pCAMBIA vector backbones were amplified as two fragments using PCR primer pairs comprising of SEQ ID NO: 11 and 12, or SEQ ID NO: 13 and 14. Finally, the SCD, THR and PKS gene fragments and vector backbones were ligated into the final vector pCAMBIA- SCD, pCAMBIA-THR, or pCAMBIA-PKS using Chewback Reaction Method.

[0117] Next, resultant pCAMBIA-PKS, pCAMBIA-SCD, and pCAMBIA-THR clones were transformed into E. coli DH10B strain, then confirmed via PCR and gel electroporation. The results are shown in FIG. 3A-3C. Selected clones showing no mutations in the PCR fragments were then transformed into Agrobacterium tumefaciens strains EHA105 or AGL-1 and confirmed by PCR (FIG. 4A-4C).

[0118] Table 2: Primers Used for PCR Amplification and Screening of SCD, PKS, and THR Gene Fragments

[0119] *Fw: Forward Orientation, Rv: Reverse Orientation.

[0120] P. indica cells were transformed using the selected transformed Agrobacterium tumefaciens strains and transformants were selected using hygromycin. Briefly, mycelia pieces of P. indica transformants were inoculated on Potato Dextrose Agar (PDA) plates containing hygromycin with a series of concentrations: 0, 5, 7, 10, 15, 20, 25, and 30 pg / ml (FIG. 5A and 5B) A dose-dependent inhibition in growth rate and changes in colony morphology were noted upon exposure to increasing doses of hygromycin. At 30 pg / ml hygromycin, the vegetative growth of P. indica transformants was completely inhibited at 6 and 12 days on the PDA medium (FIG. 5A and 5B) and aerial hyphae were not observed. FIG. 1 shows the wild-type phenotype of P. indica, and FIG. 6A and FIG. 6B show P. indica transformed mycelium on selection media after 3 weeks.

[0121] Finally, melanin production was verified in four P. indica transformants A-D following the method provided in Example 1. As shown in FIG. 7A, the four transformants successfully produced melanin when cultured on selection medium, while the wild-type control does not. The P. indica transformants also exhibited fewer pear-shaped chlamydospores after 1 month at 28 °C as compared with the wild- type control. FIG. 7B.

[0122] In sum, this study demonstrates the successful generation of genetically engineered P. indica transformants that are capable of producing melanin.

[0123] Sequences References Cited

[0124] 1. Bossio DA, Cook-Patton SC, Ellis PW, et al. The role of soil carbon in natural climate solutions. Nature Sustainability 2020;3:391-8.

[0125] 2. Liu S, Youngchim S, Zamith-Miranda D, Nosanchuk JD. Fungal Melanin and the Mammalian Immune System. J Fungi (Basel) 2021;7.

[0126] 3. Yan Q, Fong SS. Challenges and Advances for Genetic Engineering of Nonmodel Bacteria and Uses in Consolidated Bioprocessing. Frontiers in Microbiology 2017;8.

[0127] 4. Lu L, Shen X, Sun X, Yan Y, Wang J, Yuan Q. CRISPR-based metabolic engineering in non-model microorganisms. Current Opinion in Biotechnology 2022:75: 102698.

[0128] 5. Summary for Policymakers. In: Masson-Delmotte V, P. Zhai, H.-O. Portner, D. Roberts, J. Skea, P.R. Shukla, A. Pirani, W. Moufouma-Okia, C. Pean, R. Pidcock, S. Connors, J.B.R. Matthews, Y. Chen, X. Zhou, M.I. Gomis, E. Lonnoy, T. Maycock, M. Tignor, and T. Waterfield ed. Global Warming of 15 °C An IPCC Special Report on the impacts of global warming of 15°C above pre-industrial levels and related global greenhouse gas emission pathways, in the context of strengthening the global response to the threat of climate change, sustainable development, and efforts to eradicate poverty Cambridge, UK and New York, NY, USA2022:l-24.

[0129] 6. Rieke K, Millar R, MacMartin DG. Constraints on global temperature target overshoot. Scientific reports 2017;7: 14743.

[0130] 7. Schweitzer H, Aalto NJ, Busch W, et al. Innovating carbon-capture biotechnologies through ecosystem-inspired solutions. One Earth 2021;4:49-59.

[0131] 8. Boot-Handford ME, Abanades JC, Anthony EJ, et al. Carbon capture and storage update. Energy' & Environmental Science 2014;7:130-89.

[0132] 9. Mac Dowell N, Fennell PS, Shah N, Maitland GC. The role of CO2 capture and utilization in mitigating climate change. Nature Climate Change 2017;7:243-9.

[0133] 10. Hepburn C, Adlen E, Beddington J, et al. The technological and economic prospects for CO2 utilization and removal. Nature 2019;575:87-97.

[0134] 11. Vermeulen S, Bossio D, Lehmann J, et al. A global agenda for collective action on soil carbon. Nature Sustainability 2019;2:2-4.

[0135] 12. Jansson JK, Hofmockel KS. Soil microbiomes and climate change. Nature Reviews Microbiology72020;18:35-46. 13. USGCRP. Executive summary. In Second State of the Carbon Cycle Report (SOCCR2): A Sustained Assessment Report. Washington, DC: US Global Change Research Program; 2018.

[0136] 14. Schuur EAG, McGuire AD, Schadel C, et al. Climate change and the permafrost carbon feedback. Nature 2015;520: 171-9.

[0137] 15. Sanderman J, Hengl T, Fiske GJ. Soil carbon debt of 12,000 years of human land use. Proceedings of the National Academy of Sciences 2017;114:9575-80.

[0138] 16. Chen S, Wang W, Xu W, et al. Plant diversity enhances productivity and soil carbon storage. Proceedings of the National Academy of Sciences 2018;115:4027-32.

[0139] 17. Paustian K, Lehmann J, Ogle S, Reay D, Robertson GP, Smith P. Climate-smart soils. Nature 2016:532:49-57.

[0140] 18. Clemmensen KE, Bahr A, Ovaskainen O, et al. Roots and Associated Fungi Drive Long-Term Carbon Sequestration in Boreal Forest. Science 2013;339: 1615-8.

[0141] 19. Treseder KK, Holden SR. Fungal Carbon Sequestration. Science 2013;339: 1528-9.

[0142] 20. Hoeksema JD, Chaudhary VB, Gehring CA, et al. A meta-analysis of contextdependency in plant response to inoculation with mycorrhizal fungi. Ecology letters 2010;13:394-407.

[0143] 21. Godbold DL, Hoosbeek MR, Lukac M, et al. Mycorrhizal hyphal turnover as a dominant process for carbon input into soil organic matter. Plant and Soil 2006;281: 15-24.

[0144] 22. Prescott CE. Litter decomposition: what controls it and how can we alter it to sequester more carbon in forest soils? Biogeochemistry 2010;101 : 133-49.

[0145] 23. Allison SD. Brown ground: a soil carbon analogue for the green world hypothesis? The American Naturalist 2006; 167:619-27.

[0146] 24. Paul E. Soil microbiology, ecology, and biochemistry in perspective. Soil microbiology ecology7and biochemistry': Elsevier; 2007:3-24.

[0147] 25. Carbon Capture, Utilization, and Storage (CCUS) Market by Service (Capture, Transportation, Utilization, and Storage), Technology (Pre-Combustion Capture, Oxy-Fuel Combustion Capture, and Post-Combustion Capture), and End-Use Industry (Oil & Gas, Power Generation, Iron & Steel, Chemical & Petrochemical, Cement, and Others): Global Opportunity Analysis and Industry Forecast, 2021-2030. Allied Market Research, 2021. (Accessed October 15, 2023, at https: / / www.alliedmarketresearch.com / carbon-capture-and- utilization-market-A12116.) 26. Onyeaka H, Miri T, Obileke K, Hart A, Anumudu C, Al-Sharify ZT. Minimizing carbon footprint via microalgae as a biological capture. Carbon Capture Science & Technology 2021; 1:100007.

[0148] 27. Raza A, Gholami R, Rezaee R, Rasouli V, Rabiei M. Significant aspects of carbon capture and storage-A review. Petroleum 2019;5:335-40.

[0149] 28. Choi YY, Patel AK, Hong ME, Chang WS, Sim SJ. Microalgae Bioenergy with Carbon Capture and Storage (BECCS): An emerging sustainable bioprocess for reduced CO2 emission and biofuel production. Bioresource Technology Reports 2019;7: 100270.

[0150] 29. Davies J. The business case for soil. Nature 2017;543:309-11.

[0151] 30. Carbon Abatement Contract table. Australian Government Clean Energy Regulator. (Accessed October 16, 2023, at https: / / www.cleanenergyregulator.gov.au / DocumentAssets / Pages / Carbon-Abatement-Contract- table.aspx.)

[0152] 31. ESG Scorecard. Cargill, 2022. (Accessed October 24, 2023, at https: / / www.cargill.com / sustainability / esg-scorecard.)

[0153] 32. Climate Change. Pepsico, 2023. (Accessed October 24, 2023, at https: / / www.pepsico.com / our-impact / esg-topics-a-z / climate-change.)

[0154] 33. More Countries Are Pricing Carbon, but Emissions Are Still Too Cheap. International Monetary Fund (IMF), 2022. (Accessed October 25, 2023, at https: / / www.imf.org / en / Blogs / Articles / 2022 / 07 / 21 / blog-more-countries-are-pricing-carbon- but-emissions-are-still-too- cheap#:~:text=So%20far%2C%2046%20countries%20are,(in%20the%20European%20Union) •)

[0155] 34. Which countries have put a price on carbon? Our World In Data, 2022. (Accessed October 25, 2023, at https: / / ourworldindata.org / carbon-pricing.)

[0156] 35. Michielse CB, Hooykaas PJ, van den Hondel CA, Ram AF. Agrobacterium- mediated transformation as a tool for functional genomics in fungi. Curr Genet 2005;48: 1-17.

[0157] 36. Seddon N, Chausson A, Berry P, Girardin CA, Smith A, Turner B. Understanding the value and limits of nature-based solutions to climate change and other global challenges. Philosophical Transactions of the Royal Society B 2020;375:20190120.

[0158] 37. Griscom BW, Adams J, Ellis PW, et al. Natural climate solutions. Proceedings of the National Academy of Sciences 2017;114: 11645-50.

[0159] 38. Bell AA, Wheeler MH. Biosynthesis and functions of fungal melanins. Annual review of phytopathology 1986;24:411-51. 39. Khajo A, Bryan RA, Friedman M, et al. Protection of melanized Cryptococcus neoformans from lethal dose gamma irradiation involves changes in melanin's chemical structure and paramagnetism. PLoS One 2011;6:e25092.

[0160] 40. Joshi MH, Patil AA, Adivarekar RV. Characterization of brown-black pigment isolated from soil bacteria, Beijerinckia fluminensis. BioRxiv 2021:2021.07. 21.453201.

[0161] 41. Siletti CE, Zeiner CA, Bhatnagar JM. Distributions of fungal melanin across species and soils. Soil Biology and Biochemistry 2017;113:285-93.

[0162] 42. Anthony MA, Crowther TW, van der Linde S, et al. Forest tree growth is linked to mycorrhizal fungal composition and function across Europe. The ISME Journal 2022;16: 1327-36.

[0163] 43. Martinez LM, Martinez A, Gosset G. Production of Melanins With Recombinant Microorganisms. Frontiers in Bioengineering and Biotechnology 2019;7.

[0164] 44. Adedayo AA, Babalola OO. Fungi That Promote Plant Growth in the Rhizosphere Boost Crop Grow th. Journal of Fungi 2023;9.

[0165] 45. Malgioglio G, Rizzo GF, Nigro S, et al. Plant- Microbe Interaction in Sustainable Agriculture: The Factors That May Influence the Efficacy of PGPM Application. Sustainability 2022; 14.

[0166] 46. Gill SS, Gill R, Trivedi DK, et al. Piriformospora indica: Potential and Significance in Plant Stress Tolerance. Frontiers in Microbiology 2016:7.

[0167] 47. Shahollari B, Vadassery J, Varma A, Oelmiiller R. A leucine-rich repeat protein is required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis thaliana. The Plant Journal 2007;50: 1-13.

[0168] 48. Yadav V, Kumar M, Deep DK, et al. A phosphate transporter from the root endophytic fungus Piriformospora indica plays a role in phosphate transport to the host plant. Journal of Biological Chemistry 2010;285:26532-44.

[0169] 49. Bajaj R, Agarwal A, Rajpal K, et al. Co-cultivation of Curcuma longa with Piriformospora indica enhances the yield and active ingredients. American Journal of Current Microbiolog)’ 2014;2:6-17.

[0170] 50. Roberts EL. Plant growth promotion by rhizosphere dwelling microbes. Rhizosphere Engineering: Elsevier; 2022: 1-17.

[0171] 51. Varma A, Savita V, Sudha, Sahay N, Butehorn B, Franken P. Piriformospora indica, a cultivable plant-growth-promoting root endophyte. Appl Environ Microbiol 1999;65:2741-4. 52. Qiang X, Weiss M, Kogel KH, Schafer P. Piriformospora indica-a mutualistic basidiomycete with an exceptionally large plant host range. Mol Plant Pathol 2012;13:508-18.

[0172] 53. Harrach BD, Baltruschat H, Barna B, Fodor J, Kogel KH. The mutualistic fungus Piriformospora indica protects barley roots from a loss of antioxidant capacity caused by the necrotrophic pathogen Fusarium culmorum. Mol Plant Microbe Interact 2013:26:599- 605.

[0173] 54. Varma A, Sherameti 1, Tripathi S, et al. The Symbiotic Fungus Piriformospora indica: Review. 2012:231-54.

[0174] 55. Baltruschat H, Fodor J, Harrach BD, et al. Salt tolerance of barley induced by the root endophyte Piriformospora indica is associated with a strong increase in antioxidants. New Phytol 2008; 180:501-10.

[0175] 56. Sun C, Johnson JM, Cai D, Sherameti I, Oelmiiller R, Lou B. Piriformospora indica confers drought tolerance in Chinese cabbage leaves by stimulating antioxidant enzymes, the expression of drought-related genes and the plastid-localized CAS protein. J Plant Physiol 2010;167: 1009-17.

[0176] 57. Nanda R, Agrawal V. Piriformospora indica, an excellent system for heavy metal sequestration and amelioration of oxidative stress and DNA damage in Cassia angustifolia Vahl under copper stress. Ecotoxicol Environ Saf 2018;156:409-19.

[0177] 58. Molitor A, Zajic D, Voll LM, et al. Barley leaf transcriptome and metabolite analysis reveals new aspects of compatibility and Piriformospora indica-mediated systemic induced resistance to powdery mildew. Mol Plant Microbe Interact 2011;24: 1427-39.

[0178] 59. Serfling A, Wirsel SG, Lind V, Deising HB. Performance of the Biocontrol Fungus Piriformospora indica on Wheat Under Greenhouse and Field Conditions. Phytopathology 2007;97:523-31.

[0179] 60. Stupar RM. Into the wild: The soybean genome meets its undomesticated relative. Proceedings of the National Academy of Sciences 2010;107:21947-8.

[0180] 61. Faber MD. Microbial degradation of recalcitrant compounds and synthetic aromatic polymers. Enzyme and Microbial Technology 1979:1 :226-32.

[0181] 62. Cai Z, Li M, Zhu Z, et al. Biological Degradation of Plastics and Microplastics: A Recent Perspective on Associated Mechanisms and Influencing Factors. Microorganisms 2023;ll.

[0182] 63. Lapenda JC, Silva PA, Vicalvi MC, Sena KX, Nascimento SC. Antimicrobial activity of prodigiosin isolated from Serratia marcescens UFPEDA 398. World J Microbiol Biotechnol 2015;31 :399-406. 64. Kimura N, Tsuge T. Gene cluster involved in melanin biosynthesis of the filamentous fungus Altemaria altemata. J Bacteriol 1993;175:4427-35.

[0183] 65. Tseng MN, Chung PC, Tzean SS. Enhancing the stress tolerance and virulence of an entomopathogen by metabolic engineering of dihydroxynaphthalene melanin biosynthesis genes. Appl Environ Microbiol 2011;77:4508-19.

[0184] 66. Takano Y, Kubo Y, Shimizu K, Mise K, Okuno T, Furusawa I. Structural analysis of PKS1, a polyketide synthase gene involved in melanin biosynthesis in Colletotrichum lagenarium. Mol Gen Genet 1995;249: 162-7.

[0185] 67. Perpetua NS, Kubo Y, Yasuda N, Takano Y, Furusawa I. Cloning and characterization of a melanin biosynthetic THR1 reductase gene essential for appressorial penetration of Colletotrichum lagenarium. Mol Plant Microbe Interact 1996;9:323-9.

[0186] 68. Kubo Y, Takano Y, Endo N, Yasuda N, Tajima S, Furusawa I. Cloning and structural analysis of the melanin biosynthesis gene SCD1 encoding scytalone dehydratase in Colletotrichum lagenarium. Appl Environ Microbiol 1996;62:4340-4.

[0187] 69. Feng B, Wang X, Hauser M, et al. Molecular cloning and characterization of WdPKSl, a gene involved in dihydroxynaphthalene melanin biosynthesis and virulence in Wangiella (Exophiala) dermatitidis. Infect Immun 2001;69: 1781-94.

[0188] 70. Howard RJ, Valent B. Breaking and entering: host penetration by the fungal rice blast pathogen Magnaporthe grisea. Annu Rev Microbiol 1996;50:491-512.

[0189] 71. Thompson JE, Fahnestock S, Farrall L, Liao DI, Valent B, Jordan DB. The second naphthol reductase of fungal melanin biosynthesis in Magnaporthe grisea: tetrahydroxynaphthalene reductase. J Biol Chem 2000;275:34867-72.

[0190] 72. Vidal-Cros A, Viviani F, Labesse G, Boccara M, Gaudry M. Polyhydroxynaphthalene reductase involved in melanin biosynthesis in Magnaporthe grisea. Purification, cDNA cloning and sequencing. Eur J Biochem 1994;219:985-92.

[0191] 73. Lundqvist T, Weber PC, Hodge CN, Braswell EH, Rice J, Pierce J. Preliminary crystallographic studies on scytalone dehydratase from Magnaporthe grisea. J Mol Biol 1993;232:999-1002.

[0192] 74. Aghajanyan AE, Hambardzumyan AA, Hovsepyan AS, Asaturian RA, Vardanyan AA, Saghiyan AA. Isolation, purification and physicochemical characterization of water-soluble Bacillus thuringiensis melanin. Pigment Cell Res 2005;18: 130-5.

[0193] 75. Cabrera- Valladares N, Martinez A, Pinero S, et al. Expression of the melA gene from Rhizobium etli CFN42 in Escherichia coli and characterization of the encoded tyrosinase. Enzyme and Microbial Technology 2006;38:772-9. 76. Cubo MT, Buendia-Claveria AM, Beringer JE, Ruiz-Sainz JE. Melanin production by Rhizobium strains. Appl Environ Microbiol 1988;54: 1812-7.

[0194] 77. El-Naggar NE-A, El-Ewasy SM. Bioproduction, characterization, anticancer and antioxidant activities of extracellular melanin pigment produced by newly isolated microbial cell factories Streptomyces glaucescens NEAE-H. Scientific Reports 2017;7:42129.

[0195] 78. Gustavsson M, Hbrnstrbm D, Lundh S, Belotserkovsky J, Larsson G. Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior. Scientific Reports 2016;6:36117.

[0196] 79. Lagunas-Munoz VH, Cabrera- Valladares N, Bolivar F, Gosset G, Martinez A. Optimum melanin production using recombinant Escherichia coli. J Appl Microbiol 2006; 101 : 1002-8.

[0197] 80. Wang Z, Tschirhart T, Schultzhaus Z, et al. Melanin Produced by the Fast- Growing Marine Bacterium Vibrio natriegens through Heterologous Biosynthesis: Characterization and Application. Appl Environ Microbiol 2020;86.

[0198] 81. Liao X-g, Fang W-g, Zhang Y-j, et al. Characterization of a Highly Active Promoter, PBbgpd, in Beauveria bassiana. Current Microbiology 2008;57: 121-6.

[0199] 82. Feed Grains Sector at a Glance. USDA Economic Research Service, 2023. (Accessed October 31, 2023, at https: / / www.ers.usda.gov / topics / crops / corn-and-other-feed- grains / feed-grains-sector-at-a-glance / .)

[0200] 83. Vaiknoras K, Hubbs T. Characteristics and Trends of US Soybean Production Practices, Costs, and Returns Since 2002. 2023.

[0201] 84. Helber N, Requena N. Expression of the fluorescence markers DsRed and GFP fused to a nuclear localization signal in the arbuscular mycorrhizal fungus Glomus intraradices. New Phytol 2008; 177:537-48.

[0202] 85. Meyer V, Mueller D, Strowig T, Stahl U. Comparison of different transformation methods for Aspergillus giganteus. Curr Genet 2003;43:371-7.

[0203] 86. Utermark J, & Karlovsky, P. Genetic transformation of filamentous fungi by Agrobacterium tumefaciens. Protocol Exchange 2008.

[0204] 87. Sun C-B, Kong Q-L, Xu W-S. Efficient transformation of Penicillium chrysogenum mediated by Agrobacterium tumefaciens LBA4404 for cloning of Vitreoscilla hemoglobin gene. Electronic Journal of Biotechnology 2002;5:9-10.

[0205] 88. De Groot MJ, Bundock P, Hooykaas PJ, Beijersbergen AG. Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nature biotechnology 1998; 16: 839- 42. 89. Zhang T, Qi Z, Wang Y, et al. Agrobacterium tumefaciens-mediated transformation of Penicillium expansum PE- 12 and its application in molecular breeding. Microbiological research 2013;168: 130-7.

[0206] 90. Ando A, Sumida Y, Negoro H, et al. Establishment of Agrobacterium tumefaciens-mediated transformation of an oleaginous fungus, Mortierella alpina 1S-4, and its application for eicosapentaenoic acid producer breeding. Appl Environ Microbiol 2009;75:5529-35.

[0207] 91. Staats CC, Junges A, Fitarelli M, Furlaneto MC, Vainstein MH, Schrank A. Gene inactivation mediated by Agrobacterium tumefaciens in the filamentous fungi Metarhizium anisopliae. Applied microbiology and biotechnology 2007;76:945-50.

[0208] 92. Zhang Y, Li G, He D, Yu B, Yokoyama K, Wang L. Efficient insertional mutagenesis system for the dimorphic pathogenic fungus Sporothrix schenckii using Agrobacterium tumefaciens. Journal of microbiological methods 2011;84:418-22.

[0209] 93. Michielse CB, Hooykaas PJ, van den Hondel CA, Ram AF. Agrobacterium- mediated transformation as a tool for functional genomics in fungi. Current genetics 2005;48: 1-17.

[0210] 94. Pardo AG, Hanif M, Raudaskoski M, Gorfer M. Genetic transformation of ectomycorrhizal fungi mediated by Agrobacterium tumefaciens. Mycological Research 2002;106: 132-7.

[0211] 95. Chen X, Stone M, Schlagnhaufer C, Romaine CP. A fruiting body tissue method for efficient Agrobacterium-mediated transformation of Agaricus bisporus. Applied and Environmental Microbiology 2000;66:4510-3.

[0212] 96. Mikosch TS, Lavrijssen B, Sonnenberg AS, van Griensven LJ. Transformation of the cultivated mushroom Agaricus bisporus (Lange) using T-DNA from Agrobacterium tumefaciens. Current Genetics 2001 ;39:35-9.

[0213] 97. Utermark J, Karlovsky P. Genetic transformation of filamentous fungi by Agrobacterium tumefaciens. 2008.

[0214] 98. Michielse C, Ram A, Hooykaas P, Van den Hondel C. Role of bacterial virulence proteins in Agrobacterium-mediated transformation of Aspergillus awamori. Fungal Genetics and Biology 2004;41:571-8.

[0215] 99. Michielse C, Salim K, Ragas P, et al. Development of a system for integrative and stable transformation of the zygomycete Rhizopus oryzae by Agrobacterium-mediated DNA transfer. Molecular Genetics and Genomics 2004;271:499-510. 100. Hiei Y, Ohta S, Komari T, Kumashiro T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. The Plant Journal 1994;6:271-82.

[0216] 101. Veluthambi K, Krishnan M, Gould J, Smith R, Gelvin S. Opines stimulate induction of the vir genes of the Agrobacterium tumefaciens Ti plasmid. Journal of bacteriology 1989;171:3696-703.

[0217] 102. Stachel SE, Zambryski PC. virA and virG control the plant-induced activation of the T-DNA transfer process of A. tumefaciens. Cell 1986;46:325-33.

[0218] 103. Rogowsky P, Close T, Chimera J, Shaw J, Kado C. Regulation of the vir genes of Agrobacterium tumefaciens plasmid pTiC58. Journal of Bacteriology 1987;169:5101-12.

[0219] 104. Stachel SE, Nester EW, Zambryski PC. A plant cell factor induces Agrobacterium tumefaciens vir gene expression. Proceedings of the National Academy of Sciences 1986;83:379-83.

[0220] 105. Wydro M, Kozubek E, Lehmann P. Optimization of transient Agrobacterium- mediated gene expression system in leaves of Nicotiana benthamiana. Acta biochimica polonica 2006;53:289-98.

[0221] 106. Khang CH, Park S-Y, Rho H-S, Lee Y-H, Kang S. Filamentous fungi (Magnaporthe grisea and Fusarium oxysporum). Agrobacterium Protocols Volume 2 2007:403- 20.

[0222] 107. D’spain S, Andrade PI, Brockman NE, Fu J, Wickes BL. Agrobacterium tumefaciens-Mediated Transformation of Candida glabrata. Journal of Fungi 2022;8:596.

[0223] 108. Selvakumar P, Rajasekar S, Periasamy K, Raaman N. Isolation and characterization of melanin pigment from Pleurotus cystidiosus (telomorph of Antromycopsis macrocarpa). World Journal of Microbiology and Biotechnology 2008;24:2125-31.

[0224] 109. Wheeler MH, Klich MA. The effects of tricyclazole, pyroquilon, phthalide, and related fungicides on the production of conidial wall pigments by Penicillium and Aspergillus species. Pesticide Biochemistry' and Physiology 1995;52: 125-36.

[0225] 110. Chen X, Zhang J. The Genomic Landscape of Position Effects on Protein Expression Level and Noise in Yeast. Cell Systems 2016;2:347-54.

[0226] 111. Grigliatti T, Mottus RC. Position Effects. Brenner's Encyclopedia of Genetics2013:418-20.

[0227] 112. McGonigle TP, Miller MH, Evans DG, Fairchild GL, Swan JA. A new method which gives an objective measure of colonization of roots by vesicular — arbuscular mycorrhizal fungi. New Phytologist 2006;115:495-501. 113. Satheesan J, Narayanan AK, Sakunthala M. Induction of root colonization by

[0228] Piriformospora indica leads to enhanced asiaticoside production in Centella asiatica. Mycorrhiza 2012;22: 195-202.

[0229] 114. Phillips J, Hayman D. Improved procedures for clearing roots and staining parasitic and vesicular- arbuscular mycorrhizal fungi for rapid assessment of infection. Transactions of the British mycological Society 1970:55: 158-IN18.

[0230] 115. Dickson S, Smith S. Evaluation of vesicular-arbuscular mycorrhizal colonisation by staining. Mycorrhiza manual: Springer; 1998:77-83.

[0231] 116. Giovannetti M, Mosse B. An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots. New phytologist 1980:489-500.

[0232] 117. Guo L, Li W, Gu Z, et al. Recent Advances and Progress on Melanin: From Source to Application. International Journal of Molecular Sciences 2023;24:4360.

[0233] 118. Sansinenea E, Ortiz A. Melanin: a photoprotection for Bacillus thuringiensis based biopesticides. Biotechnology letters 2015;37:483-90.

[0234] 119. Ag and Food Sectors of the Economy. USDA Economic Research Service, 2023. at https: / / www.ers.usda.gov / data-products / ag-and-food-statistics-charting-the- essentials / ag-and-food-sectors-and-the-economy / .)

[0235] 120. Team RC. Carbon Market Year in Review 2022. 2023.

[0236] 121. Chen S, Marbouh D, Moore S, Stern K. Voluntary carbon offsets: an empirical market study. Available at SSRN 3981914 2021.

[0237] 122. Blaufelder C, Levy C, Mannion P, Pinner D. A blueprint for scaling voluntary carbon markets to meet the climate challenge. McKinsey, viewed 2021;5.

[0238] 123. Organization WH. COP26 special report on climate change and health: the health argument for climate action. 2021.

[0239] 124. Rising JA, Taylor C, Ives MC, Ward RE. Challenges and innovations in the economic evaluation of the risks of climate change. Ecological Economics 2022;197: 107437.

[0240] 125. DeFries RS, Edenhofer O, Halliday AN, et al. The missing economic risks in assessments of climate change impacts. 2019.

[0241] OTHER EMBODIMENTS

[0242] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features. From the above description, one skilled in the art can easily ascertain the essential characteristics of the present invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.

[0243] EQUIVALENTS

[0244] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.

[0245] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0246] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.

[0247] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

[0248] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0249] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and / or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0250] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A modified fungus, which is genetically engineered to produce an elevated level of one or more recalcitrant polymers as compared with its native counterpart; wherein the modified fungus is a mycorrhizal fungus, an endophytic fungus, a deuteromycota, an ascomycota, or a marine fungus.

2. The modified fungus of claim 1, wherein the recalcitrate polymer is selected from the group consisting of melanin, sporopollenin, algaenan, lignin, and suberin; optionally wherein the recalcitrate polymer is melanin.

3. The modified fungus of claim 1 or claim 2, wherein the native counterpart thereof does not produce the one or more recalcitrant polymers.

4. The modified fungus of any one of claims 1-3, which is a modified endophytic fungus, optionally wherein the modified endophytic fungus is a Piriformospora, preferably a modified Piriformospora indica.

5. The modified fugus of any one of claims 1-3, which is a modified ascomycota; optionally wherein the modified ascomycota is a modified Trichoderma, preferably a modified Trichoderma reesei.

6. The modified fungus of any one of claims 1-5, wherein the modified fungus comprises one or more exogenous nucleic acids encoding one or more enzymes involved in the biosynthesis pathways of the one or more recalcitrant polymers.

7. The modified fungus of any one of claims 1-6, wherein the recalcitrant is melanin.

8. The modified fungus of claim 7, wherein the modified fungus is genetically engineered to express scytalone dehydratase (SCD), 1,3,8-trihydroxynaphthalene reductase (THR), and Polyketide synthase (PKS).

9. The modified fungus of claim 8, wherein the modified fungus comprises one or more exogenous nucleic acids encoding the SCD, THR, and PKS.

10. The modified fungus of claim 9, wherein the one or more exogenous nucleic acids are incorporated into the genome of the fungus.

11. The modified fungus of claim 9 or claim 10, wherein the coding sequences in the one or more exogenous nucleic acids are in operable linkage to one or more exogenous promoters.

12. The modified fungus of claim 9 or claim 10, wherein the coding sequences in the one or more exogenous nucleic acids are in operable linkage to one or more endogenous promoters.

13. A method for producing the modified fungus set forth in any one of claims 1- 12, the method comprising:(iii) introducing one or more nucleic acids encoding enzymes involved in the biosynthesis pathways of the one or more recalcitrant polymers into an unmodified counterpart of the modified fungus; and(iv) identifying modified endophyte fungus expressing the one or more enzymes, thereby producing the one or more recalcitrant polymers.

14. The method of claim 13, wherein step (i) is performed by incubating one or more agrobacteria carrying one or more binary vectors with a cell or a part of the unmodified counterpart of the modified fungus, wherein the one or more binary vectors comprises the one or more nucleic acids encoding the one or more enzymes involved in the biosynthesis pathways of the one or more recalcitrant polymers.

15. The method of claim 14, wherein the agrobacteria are A. tumefaciens.

16. The method of claim 14 or claim 15, wherein the cell or the part of the native counterpart is a spore, a germinating conidia, a protoplast, a mycelium, or a fungi colony.

17. The method of any one of claims 13-16, wherein the recalcitrant is melanin; and wherein the enzymes involved in the biosynthesis pathway of melanin comprise scytalone dehydratase (SCD), 1,3,8-trihydroxynaphthalene reductase (THR), and / or Polyketide synthase (PKS).

18. A method for enhancing soil organic carbon, comprising colonizing the modified fungus set forth in any one of claims 1-12 on a plant, which optionally is a crop, wherein the modified fungus produces the one or more recalcitrant polymers, which are disseminated into the soil where the plant grows.

19. The method of claim 18, wherein the plant is a crop, which is an agriculture crop, optionally maize, soybean, wheat, rice, or cotton.

20. The method of any one of claims 18-19, wherein the modified fungus is colonized on the root of the plant.

Citation Information

Patent Citations

  • Fungal strains and methods of use

    US20180037919A1

  • Bio-Manufacturing Process

    US20190322997A1

  • Genetically modified mycelium for producing psychotropic alkaloids

    WO2023130078A2