Manufacture of LSD1 inhibitor

A mutated IRED enzyme from Rhizobium sullae catalyzes reductive amination to produce high-purity chiral amines efficiently, addressing the inefficiencies and hazards of traditional chemical synthesis by eliminating costly separation steps and harsh chemicals.

WO2025158128A1PCT designated stage expired Publication Date: 2025-07-31IMPERAGEN LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/GB2024/053208
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-22
Filing Date
2024-12-31
Publication Date
2025-07-31

AI Technical Summary

Technical Problem

The chemical synthesis of chiral amines, such as N1-((1,2S)-2 phenyl cyclopropyl)cyclohexane-1,4-diamine, results in racemic mixtures that require costly and inefficient separation methods like chromatography and harsh chemical conditions, leading to product loss and safety hazards.

Method used

Employing a mutated IRED enzyme from Rhizobium sullae, specifically with mutations at positions 35, 61, 93, 98, 136, 164, 199, 205, 209, 216, 231, and 233, to catalyze a reductive amination reaction that selectively produces high-purity chiral amines under mild conditions, eliminating the need for costly separation and harsh chemicals.

Benefits of technology

The enzyme-based method achieves high-purity chiral amine production in a single step, reducing energy and solvent waste while avoiding the need for Boc protection/deprotection, and enabling a more sustainable and efficient synthesis process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GB2024053208_31072025_PF_FP_ABST
    Figure GB2024053208_31072025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to novel reductive aminase (RedAm) enzymes and methods of producing chiral amines, achiral amines or a N1-((1R,2S)-2 phenyl cyclopropyl)cyclohexane-1,4-diamine compound and derivatives thereof by a reductive amination reaction catalysed by an enzyme of the invention. Also provided are nucleic acid molecules encoding the novel enzymes, expression vectors comprising said nucleic acid molecule and host cells comprising said nucleic acid molecules or said expression vectors. The present invention also provides a solid support upon which an enzyme of the invention is immobilised, and a reaction chamber comprising an enzyme of the invention, for example for use in a reductive amination method.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Manufacture of LSD1 inhibitor

[0002] The present invention relates to an I RED (Imine REDuctase) enzyme catalysed reductive amination reaction for the production of N1-((1 ,2S)-2 phenyl cyclopropyl)cyclohexane-1,4- diamine compound and derivatives thereof. Also provided are novel enzymes, nucleic acid molecules encoding the novel enzymes, and a host cell comprising a nucleic acid molecule of the present invention. Also provided is a method for recombinant production of an enzyme of the invention. The present invention also provides a solid support upon which an enzyme of the invention is immobilised, and a reaction chamber comprising an enzyme of the invention, for example for use in a reductive amination method.

[0003] BACKGROUND

[0004] The pharmaceutical industry is constantly striving to develop new drug compounds to target ever increasingly complex disease mechanisms. Synthesis of chiral amines is a very valuable and a common chemical reaction in the manufacture of pharmaceutical and fine chemicals with over half of all drugs developed and in development containing chiral amine stereo-centres. Chemical synthesis of chiral amines at industrial scale results in impure mixtures of stereoisomers which require scarce transition metal catalysts or careful and resource intensive separation using chromatography columns to ensure the highest product quality and safety profiles.

[0005] Phenylcyclopropanamine containing compounds such as N1-((1 ,2S)-2 phenyl cyclopropyl)cyclohexane-1,4-diamine (ladademstat™) are a promising class of LSD1 inhibitor drugs indicated for treatment for leukemia and CNS disorders. Due to the racemic nature of the starting substrate phenylcyclopropanamine, chemical synthesis of these compounds results in a chiral mixture (racemic mixture) end product which requires careful and expensive separation on an industrial scale as described.

[0006] The chemical synthesis route of trans-N1-((1 ,2S)-2 phenylcyclopropyl))cyclohexane1,4 diamine was originally described in WO2013057322A1. Chemical synthesis of the compound requires several key steps, as follows:

[0007] 1. Chemical resolution of racemic amine phenylcyclopropanamine (rac-trans-1), to the (1 ,2S)-2-phenylcyclopropanamine enantiomer. This requires harsh and inefficient steps to separate and recrystallise the product, with a loss of desired product expected. Alternatively, the enantiopure (1 ,2S)-2-phenylcyclopropanamine is accessed through chromatographic separation, which is expensive and time consuming, non-scalable and often results in significant loss of product. 2. Reductive amination: The isolated product is then reacted with the tert-butyl (4- oxocyclohexyl)carbamate, using pyrophoric reducing agents such as sodium borohydride / sodium triacetoxyborohydride. Carcinogenic solvents such as dichloromethane / dichloroethane or methanol are often necessary.

[0008] 3. Deprotection. The Boc group is then removed by acid treatment and final product trans-N1-((1 ,2S)-2 phenylcyclopropyl))cyclohexane1,4 diamine is crystallised as the dihydrochloride salt. This represents a potential overpressure hazard on scale due to gas evolution.

[0009] Imine reductases (IREDs) are a class of biocatalysts which catalyse the reductive amination of carbonyl compounds with amines to produce chiral amines. These enzymes are of interest in the manufacture of fine chemicals and API’s. A variant form of an I RED enzyme IR46 has been identified and shown to be useful in the production of an LSD1 inhibitor, GSK28779552 (Schober et al., 2019, Nature Catalysis 2: 909-915). A subfamily of IREDs, the reductive aminases (RedAms), have been shown to catalyse imine formation as well as imine reduction (France et al., 2018, Chem. Cat. Chem. 10: 510-514), including a new panel of RedAms from bacteria, such as Rhizobium sullae WP_027512056.1 herein referred to as SEQ ID NO. 1.

[0010] The present invention aims to overcome or ameliorate problems associated with methods of production of chiral amines in the art.

[0011] BRIEF SUMMARY OF THE DISCLOSURE

[0012] The present invention provides, in a first aspect, an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at one or more positions selected from 35, 61,93, 98, 136, 164, 199, 205, 209, 216, 231 , 233 and 241. Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a residue substitution at one or more positions selected from 35, 61, 93, 98, 136, 164, 199, 205209, 216, 231 , 233 and 241. Suitably, the IRED enzyme with SEQ ID NO. 1 originates from Rhizobium sullae.

[0013] The present invention provides, in a second aspect, a method of producing a chiral or achiral amine by a reductive amination reaction, wherein the method is catalysed by an enzyme of the first aspect. Also provided is the use of an enzyme of the first aspect as a catalyst in a method of producing a chiral or achiral amine by a reductive amination reaction.

[0014] The present invention also provides, in a third aspect, a method of forming a compound of formula (I) or a salt thereof, the method comprising reacting a compound of formula (II), or a salt thereof, with an aldehyde or ketone in the presence of a RedAm enzyme to form the compound of formula (I): wherein

[0015] X is -CH2R or -CH(R’)2;

[0016] R Is a side chain of the reacted aldehyde each R’ is a side chain of the reacted ketone, optionally wherein the two R’ groups together form a ring comprising the two R’ groups and the -CH- of X; wherein R or one R’ group is optionally substituted with halo, OR1or NR2R3, wherein:

[0017] R1is H or C1.4 alkyl, and

[0018] R2and R3are independently selected from H and C1.4 alkyl; and bonds labelled with * are in the trans configuration.

[0019] Suitably, in a method of the third aspect, the enzyme is an I RED enzyme of Rhizobium sullae, suitably an enzyme which has the sequence of SEQ ID NO. 1. Suitably, the enzyme is a variant of the enzyme of SEQ I D NO. 1 , for example as enzyme as defined in the first aspect.

[0020] Suitably, in a method of the third aspect, the method comprises reacting a compound of Formula II with an aldehyde.

[0021] Suitably, in a method of the third aspect, the method comprises reacting a compound of Formula II with a ketone.

[0022] Suitably, in a method of the third aspect, the method comprises reacting a compound of Formula II with 4-aminocylcohexanone HCI salt (Formula III). Suitably, the method comprises reductive amination of Formula II and III, 4-amino cyclohexanone.

[0023] NH2"

[0024] O Formula III In a fourth aspect of the invention, there is provided a nucleic acid molecule encoding an enzyme of the first aspect.

[0025] In a fifth aspect of the invention, there is provided a host cell comprising nucleic acid molecule of the fourth aspect.

[0026] In a sixth aspect of the invention, there is provided a solid support upon which an IRED enzyme is immobilised. The enzyme is an IRED enzyme of Rhizobium sullae, suitably an enzyme which has the sequence of SEQ I D NO. 1. Suitably, the enzyme is a variant of the enzyme of SEQ ID NO. 1 , for example an enzyme as defined in the first aspect. The solid support may be used in a method of the invention.

[0027] In a seventh aspect there is provided a reaction chamber comprising an IRED enzyme of Rhizobium sullae, suitably an enzyme which has the sequence of SEQ ID NO. 1. Suitably, the enzyme is a variant of the enzyme of SEQ ID NO. 1, for example as defined in the first aspect. The solid support may be used in a method of the invention.

[0028] BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which:

[0030] Figure 1 is a schematic showing the reaction scheme for ladademstat production using an IRED to produce “1” ladademstat, from “2” racemic trans-phenylcyclopropanamine and “3” 4- amino cyclohexanone.

[0031] Figure 2 shows an IRED panel screen for activity with “2” + “3”. Enzymes were purified and assayed for consumption of NADPH, indicating a successful reductive amination, through a decrease in absorbance at 340 nm. Lines are the average of three experiments.

[0032] Figure 3: HPLC-MS analysis of biotransformation product. (A) Product “1” was identified by comparison to the retention time of a compound “1” chemical standard. Compound “2” peak is residual, unconverted phenylcyclopropylamine. A DMSO solvent peak is also shown. (B) MS analysis of biotransformation product peak highlighted in (A). The compound “1” product peak identified by HPLC-MS was shown to be identical to a compound “1” chemical standard (m / z 231.18). The species with m / z= 117 refers to a compound “1” fragment generated by ionisation. Figure 4: UPLC analysis data of enantioselectivity biotransformations. Biotransformations were performed using either 1 .2S-2 (A), 1 S.2 -2 (B) and racemic-2 (C) and analysed for the production of 1 .2S-1

[0033] Figure 5: Mutants were screened in biotransformations with 2 g / L substrate at pH 7. Error bars show standard deviation and significance was calculated using ANOVA compared to the I RED enzyme of SEQ ID. NO. 1 (n = 3; **** p<0.0001)

[0034] Figure 6: Mutants were screened in biotransformations with 10 g / L substrate at pH 7. Error bars show standard deviation and significance was calculated using ANOVA compared to the IRED enzyme of SEQ ID. NO. 1 (n = 4; **** p<0.0001).

[0035] Figure 7: Confirmation of active hits. Biotransformation reactions were performed at pH 7 with

[0036] 10 g / L substrate. Error bars show standard deviation and significance was calculated using ANOVA compared to the IRED enzyme of SEQ ID. NO. 1 (n = 2; * p<0.05, ** p<0.01 , *** p<0.001 , **** p<0.0001).

[0037] Figure 8. Comparison of variants screened at different pHs with 10 g / L substrate. Error bars show standard deviation and significance was calculated using ANOVA compared to the IRED enzyme of SEQ ID. NO. 1 (n = 2; * p<0.05, ** p<0.01 , *** p<0.001 , **** p<0.0001).

[0038] Figure 9: Effect of combining mutations. Variants were screened with 10 g / L substrate at pH 8 and 9. Error bars show standard deviation and significance was calculated using ANOVA compared to the relevant parental enzyme (n = 3; * p<0.05, ** p<0.01 , *** p<0.001 , **** p<0.0001). Parent strains are I61T,L216Y,D233S, L216Y.D233S and IRED enzyme of SEQ ID NO. 1.

[0039] DETAILED DESCRIPTION

[0040] The present invention is based upon the identification of an enzyme which is capable of catalysing a reductive amination reaction between two starting substrates, to produce a compound of Formula I (and related phenylcyclopropanamine containing compounds). The enzyme has been surprisingly shown to be capable of accepting an aromatic chiral amine, phenylcyclopropanamine, in order to catalyse such a reaction. Furthermore, the enzyme has surprisingly been shown by the inventors to be capable of chiral resolution, and thereby favouring the introduction of one isomer from a racemic mixture of the substrate of Formula

[0041] 11 to result in a high purity product of Formula I. This has the advantage of avoiding the need for costly and / or inefficient resolution of the racemic mixture of Formula II. Furthermore, the selective presentation of one chiral isomer by the enzyme also reduces or eliminates the need for a Boc protecting group or subsequent deprotection. Enzymes as biological catalysts, with potential high chiral selectivity and mild operating conditions offer an attractive and sustainable alternative to carrying out chiral-selective chemistry compared to non- selective organic synthesis of chemicals.

[0042] The enzyme-based method of the present invention has the advantage of enabling the reductive amination reaction to take place under aqueous conditions. The enzyme-based method of the present invention also has the advantage of eliminating the need for chemical reduction, which typically requires harsh conditions such as the use of carcinogenic solvents such as dichloromethane / dichloroethane or methanol. Rather, the method of the present invention can be carried out under milder conditions, for example at 30°C, and pH7.

[0043] The use of the enzyme as described herein enables the synthesis of a compound of Formula I in a single step, as opposed to the three step chemical process using the same starting materials, as described in WO2013057322A1.

[0044] The use of the enzyme in the manufacture of a compound of Formula I and related phenylcyclopropanamine containing compounds according to a method as described herein therefore enables a biological and more sustainable route of manufacture.

[0045] The invention as described herein is significantly different to the manufacture process of the art, and is an enzymatic method that can be performed in one single reaction to synthesize a compound of Formula 1 or a derivative thereof, thereby saving energy and solvent waste and without the requirement for Boc protection / deprotection of the free amine.

[0046] Definitions

[0047] The term “carbonyl compound” refers to a chemical compound comprising a -C(=O)- functional group. Exemplary types of carbonyl compounds include aldehydes, ketones, carboxylic acids, esters, amides, acyl halides, acid anhydrides, enones, and imides.

[0048] An “aldehyde” is an organic chemical compound or functional group in which a carbonyl group is bonded to a hydrogen atom and one R group, where R is hydrogen or a carbon- containing side chain, e.g. a hydrocarbon side chain. For the avoidance of doubt, where R is a carbon-containing side chain, the carbonyl group is attached to a carbon atom of the R group. Thus, aldehydes have the general structure R-C(=O)H. A “ketone” is an organic chemical compound or functional group in which a carbonyl group is bonded to one R group and one R’ group, where each of R and R’ is independently a carbon-containing substituent. For the avoidance of doubt, the carbonyl group of the ketone is attached to two carbon atoms of the R and R’ groups respectively. Thus, ketones have the general structure R-C(=O)-R’.

[0049] The chemical terms used in the specification have their generally accepted meanings in the art.

[0050] Where substituent groups are specified by their conventional chemical formulae, written from left to right, they equally encompass the chemically identical substituents that would result from writing the structure from right to left, e.g., -CH2O- is equivalent to -OCH2-.

[0051] The term “enantiomer” refers to one of two stereoisomers that are non-superimposable mirror images of one another. Enantiomers have the same physical properties as one another (e.g. melting point, solubility, etc), but different optical rotation properties. In particular, two enantiomers have an equal but opposite rotational effect on plane-polarised light.

[0052] In the present disclosure, each enantiomer is differentiated from the other by reference to their R / S configuration. As the skilled person would appreciate, the R / S system is based on a molecule’s geometry with respect to a chiral centre. Each chiral centre is assigned R or S based on the Cahn- Ingold- Prelog priority rules (Angewandte Chemie International Edition, 1966, Volume 5, Issue 4, p. 385-415).

[0053] The term “racemic mixture” refers to a 50:50 mixture of two enantiomers. Thus, in a racemic mixture, the two enantiomers are present in equal amounts.

[0054] The term “enantiomeric excess” refers to the difference between the relative abundance of two enantiomers in a mixture. For example, if a mixture contains 75% of the first enantiomer and 25% of the second enantiomer, the enantiomeric excess of 50% of the first enantiomer. In a racemic mixture, the enantiomeric excess is 0%. In a mixture comprising a single enantiomer only, the enantiomeric excess is 100%. Thus, enantiomeric excess represents a measure of the enantiopurity of a reactant or product.

[0055] Conventional techniques for the preparation / isolation of individual enantiomers when necessary include chiral synthesis from a suitable optically pure precursor or resolution of the racemate (or the racemate of a salt or derivative) using, for example, chiral high pressure liquid chromatography (HPLC). Indeed, general methods for the determination of stereochemistry and the separation of stereoisomers are well known in the art (see discussion in “Advanced Organic Chemistry”, 7th edition J. March, John Wiley and Sons, New York, 2013). In contrast, the methods of the invention are highly selective, favouring the formation of one enantiomer over the other, thereby avoiding the need for costly chiral resolution of the product.

[0056] The term “protecting group” as used herein is given its ordinary meaning which is readily understandable to those of skill in the art. It is used herein to refer to a group suitable for protecting a nitrogen or oxygen. Exemplary protecting groups suitable for protecting a nitrogen include tert-butyloxycarbonyl group (Boc group), benzyloxycarbonyl group (Cbz), terf-butyl group Bu), para-methoxybenzyl (PMB) and phthalimide. Exemplary protecting groups suitable for protecting an oxygen include benzyl group (Bn) and terf-butyl group Bu).

[0057] An “amine” is an organic chemical compound or functional group that comprises a basic nitrogen atom with a lone pair. Amines are derivatives of ammonia (NH3) wherein one or more hydrogen atoms have been replaced by another substituent, e.g. an alkyl or aryl group. Where one of the three hydrogen atoms in ammonia is replaced by another substituent, the amine may be referred to as a primary amine. Where two of the three hydrogen atoms in ammonia are replaced by other substituents, the amine may be referred to as a secondary amine. Where all three hydrogen atoms in ammonia are replaced by other substituents, the amine may be referred to as a tertiary amine.

[0058] An “imine” is an organic chemical compound or functional group that comprises a carbonnitrogen double bond. Thus, imines have the general structure R-C(=NR”)-R, where each of R, R’ and R” is independent selected from H and a carbon-containing substituent (e.g. alkyl or aryl). When R” is H, the imine may be referred to as a primary imine. When R” is a carbon-containing substituent, the imine may be referred to as a secondary imine.

[0059] A “reductive amination reaction” is a chemical reaction that involves conversion of a carbonyl group to an amine. In particular, a reductive amination involves the steps of (i) reacting a carbonyl compound (e.g. an aldehyde or ketone) with an amine to form an imine intermediate, and (ii) treating the imine intermediate with a reducing agent to form the amine product. In this regard, the reducing agent may be said to act as a “hydride donor”. Exemplary reducing agents that may be employed in known reductive amination reactions include: NaBHsCN, NaBH4 and NaBH(OAc)s. Such reducing agents are toxic and / or pyrophoric, and thus require additional care during handling. In a method of the present invention, the reductive amination reaction may be catalysed by an enzyme of the invention with NADPH / NADH as the reducing agent. The reaction scheme below provides a generalised reductive amination reaction between a primary amine and an aldehyde:

[0060] The terms “reduction”, “reduced” and “reducing agent” have their generally accepted meanings in the art. In a method of the present invention, the reducing agent acts to reduce the imine intermediate to generate the amine product, acting as a hydride donor to convert the imine functional group into an amine functional group.

[0061] The term “derivative” refers to a chemical compound that is the result of a structural modification to a similar compound by at least one chemical transformation such that the derivative differs from said similar compound in the replacement of one or more atoms or groups of atoms with one or more other atoms or groups of atoms.

[0062] Compounds employed and produced in a method of the invention may be obtained, stored and / or used in the form of a salt. Suitable salts include, but are not limited to, salts of acceptable inorganic acids such as hydrochloric, sulfuric, phosphoric, nitric, carbonic, boric, sulfamic, and hydrobromic acids, or salts of agronomically acceptable organic acids such as acetic, propionic, butyric, tartaric, maleic, hydroxymaleic, fumaric, malic, citric, lactic, mucic, gluconic, benzoic, succinic, oxalic, phenylacetic, methanesulfonic, toluenesulfonic, benzenesulfonic, salicylic, sulfanilic, aspartic, glutamic, edetic, stearic, palmitic, oleic, lauric, pantothenic, tannic, ascorbic and valeric acids. Suitable salts also include salts of inorganic and organic bases, e.g. counterions such as Na, Ca, K, Li, Mg, ammonium, trimethylsulfonium. The compounds may also be obtained, stored and / or used in the form of an N-oxide. Also included are acid addition salts or base salts wherein the counter ion is optically active; for example, D-lactate or L-lysine, or racemic; for example, DL-tartrate or DL- arginine.

[0063] A salt of a compound employed and / or produced in a method of the invention may be prepared by for example, one or more of the following methods:

[0064] (i) by reacting the compound with the desired acid or base; (ii) by removing an acid- or base-labile protecting group from a suitable precursor of a compound of the invention or by ring-opening a suitable cyclic precursor, for example, a lactone or lactam, using the desired acid or base; or

[0065] (iii) by converting one salt of the compound to another by reaction with an appropriate acid or base or by means of a suitable ion exchange column.

[0066] These methods are typically carried out in solution. A resulting salt may precipitate out and be collected by filtration or may be recovered by evaporation of the solvent. The degree of ionisation in the resulting salt may vary from completely ionised to almost non-ionised.

[0067] A “catalyst” is a compound which is capable of accelerating the rate of a reaction, without itself undergoing any permanent change. A catalyst may be, for example and without limitation, a chemical, or may be an enzyme.

[0068] A “protein” (used interchangeably with the terms “polypeptide,” and “peptide”) is a polymer of at least two amino acids covalently linked by an amide bond. A protein may be any suitable length, and may comprise post-translational modification, for example glycosylation, phosphorylation, lipidation, myristilation, ubiquitination, etc. A protein may comprise D- and L-amino acids, and mixtures of D- and L-amino acids.

[0069] A ’’nucleic acid molecule” as referred to herein refers to two or more nucleosides that are covalently linked together. The nucleosides may be ribonucleosides (such that the molecule is RNA), deoxyribonucleotides (such that the molecule is DNA) or a mixture of ribo- and deoxyribonucleosides. The nucleosides may be linked together by standard phosphodiester linkages or non-standard linkages, or a combination thereof. A nucleic acids molecule may be single-stranded or double-stranded, or may include both single-stranded regions and double-stranded regions. A nucleic acid molecule may comprise naturally occurring bases (i.e., adenine, guanine, uracil, thymine and cytosine), and may optionally include one or more modified and / or synthetic bases, such as, for example, inosine, xanthine, hypoxanthine, etc.

[0070] “Wild type”, which may be used interchangeably with the term “naturally-occurring” refers to the form found in nature. Therefore, a wild type protein or nucleic acid molecule is the form that can be isolated from a source in nature and which has not been intentionally modified by human manipulation. The term “recombinant” (or “engineered” or “non-naturally occurring”) refers to a form of a molecule (such as a protein, or nucleic acid molecule or cell) which has been modified in a manner that would not otherwise exist in nature, or has been produced or derived from a form which has been modified. A recombinant protein may be identical to a wild type protein, but may have been produced using recombinant techniques.

[0071] “IRED Imine reductase” or “IRED,” as used herein, refers to an enzyme having imine reductase activity. Such an enzyme is capable of carrying out a reaction as shown in Figure 1.

[0072] “Percentage of sequence identity” refers to comparisons of two or more nucleic acid or protein sequences, where the degree of sequence identity is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the sequence in the comparison window may comprise additions or deletions (i.e. , gaps) as compared to the reference sequence for optimal alignment of the two sequences. Methods of calculating sequence identity are known and available in the art. The percentage may be calculated by determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.

[0073] Examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., 1990, J. Mol. Biol. 215: 403-410 and Altschul et al., 1977, Nucleic Acids Res. 3389-3402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website. Exemplary determination of sequence alignment and % sequence identity can employ the BESTFIT or GAP programs in the GCG Wisconsin Software package (Accelrys, Madison Wl), using default parameters provided.

[0074] A “reference sequence” refers to a defined sequence used as a basis for a sequence comparison. Two sequences to be compared may include a portion that is similar between the two sequences, and a sequence that is divergent. For this reason, sequence comparison may be performed over a “comparison window” to identify and compare local regions of sequence similarity. A “comparison window” is therefore a conceptual segment of at least about 20 contiguous nucleotides or amino acid residues wherein a sequence may be compared to a reference sequence of at least 20 contiguous nucleotides or amino acids and wherein the portion of the sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The comparison window can be longer than 20 contiguous residues, and includes, optionally 30, 40, 50, 100, or longer windows.

[0075] A “variant” sequence may comprise one or more amino acid differences compared to a reference or wild type sequence. A “residue difference” or “mutation” refers to a change in the amino acid at a position of a sequence relative to the amino acid residue at a corresponding position in a reference sequence. Such positions may be referred to in a sequence as “Xn,” where n refers to the corresponding position in the reference sequence upon which the residue difference is based, and X refers to the residue of the reference sequence. If the specific amino acid residue difference at a position is indicated as “XnY” where “Xn” specified the corresponding position as described above, and “Y” is the single letter identifier of the amino acid found in the variant polypeptide. In some embodiments, more than one amino acid can appear in a specified residue position, the alternative amino acids can be listed in the form XnY / Z, where Y and Z represent alternate amino acid residues. In some instances, a variant sequence can include one or more amino acid residue differences relative to a reference sequence, which is indicated by a list of the specified positions where changes are made relative to the reference sequence.

[0076] A difference may be a conservative or non-conservative amino acid substitution.

[0077] A “conservative amino acid substitution” is a substitution of a residue with a different residue having a similar side chain, and thus typically involves substitution of the amino acid in the polypeptide with amino acids within the same or similar defined class of amino acids.

[0078] A “non-conservative substitution” is a substitution of an amino acid in the polypeptide with an amino acid with significantly differing side chain properties.

[0079] An amino acid / residue difference may be a “deletion”, which is the removal of one or more amino acids from the reference sequence. A deletion can be removal of 1 or more amino acids, 2 or more amino acids, 5 or more amino acids, 10 or more amino acids, 15 or more amino acids, or 20 or more amino acids, up to 10% of the total number of amino acids, or up to 20% of the total number of amino acids making up the reference enzyme while retaining enzymatic activity and / or retaining the improved properties of an engineered imine reductase enzyme. Deletions can be directed to the internal portions and / or terminal portions of the enzyme. In various embodiments, the deletion can comprise a continuous segment or can be discontinuous.

[0080] An “insertion” refers to the addition of one or more amino acids in a variant enzyme compared to the wild type or reference enzyme. An insertion may be in the internal portion of the enzyme, or to the carboxy or amino terminus. Therefore, an insertion as used herein includes the generation of a fusion protein, comprising an enzyme as described herein. An insertion can be a contiguous segment of amino acids or separated by one or more of the amino acids in the wild type enzyme.

[0081] A “fragment” of an enzyme refers to a protein that has an amino-terminal and / or carboxyterminal deletion, but where the remaining amino acid sequence is identical to the corresponding positions in the sequence. Suitably, a fragment has the desired enzyme activity, for example as described herein. A fragment may be at least 150, 170, 190, 210, 230, 250, 260, 270, or 280 amino acids long, or up to 70%, 80%, 90%, 95%, 98%, and 99% of the full-length enzyme as described herein, for example the enzyme of SEQ ID NO. 1.

[0082] “Codon optimized” refers to changes in the codons of the polynucleotide encoding a protein to those preferentially used in a particular organism such that the encoded protein is efficiently expressed in the organism of interest. Although the genetic code is degenerate in that most amino acids are represented by several codons, called “synonyms” or “synonymous” codons, it is well known that codon usage by particular organisms is nonrandom and biased towards particular codon triplets. This codon usage bias may be higher in reference to a given gene, genes of common function or ancestral origin, highly expressed proteins versus low copy number proteins, and the aggregate protein coding regions of an organism's genome. Suitably, the polynucleotides encoding the enzymes described herein may be codon optimized for optimal production from the host organism selected for expression.

[0083] A “control sequence” as referred to herein includes any components which may be required for or useful in the expression of a polynucleotide and / or polypeptide. A control sequence may be native or foreign to the nucleic acid sequence encoding the enzyme. Examples of control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, enhancer, promoter, signal peptide sequence, and transcription terminator. Typically, a promoter, and transcriptional and translational stop signals may be operably linked to a nucleic acid molecule, for expression thereof.

[0084] A “promoter sequence” refers to a nucleic acid sequence that is recognized by a host cell for expression of a polynucleotide of interest, such as a coding sequence. The promoter sequence contains transcriptional control sequences, which mediate the expression of a polynucleotide of interest. The promoter may be any nucleic acid sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.

[0085] By “operably linked” is meant that a sequence is placed in a functional relationship with a nucleic acid molecule to be expressed, to enable the sequence to direct or regulate the expression of the nucleic acid molecule.

[0086] An “enzyme” is defined as a biological catalyst, capable of accelerating a reaction between one or more substrates to produce a product.

[0087] Suitable reaction conditions refer to those conditions in the biocatalytic reaction solution (e.g., ranges of enzyme loading, substrate loading, cofactor loading, temperature, pH, buffers, co-solvents, etc.) under which a reductive amination reaction takes place, i.e in which an I RED enzyme of SEQ ID NO. 1 or a variant thereof as described herein is capable of catalysing the conversion of a substrate of Formula II and Formula III to a product of Formula I.

[0088] Herein, an “improved enzyme property” refers to a reductive amination enzyme that exhibits an improvement in any enzyme property as compared to a reference reductive amination enzyme. For a variant (mutant) enzyme as described herein, the comparison is generally made to the wild-type enzyme, for example an enzyme having the sequence of SEQ ID NO. 1. Enzyme properties for which improvement is desirable include, but are not limited to, enzymatic activity (which can be expressed in terms of percent conversion of the substrate), thermo stability, solvent stability, pH activity profile, cofactor requirements, refractoriness to inhibitors (e.g., substrate or product inhibition), stereospecificity, and stereoselectivity (including enantioselectivity).

[0089] Increased enzymatic activity” refers to an improved property of a variant enzyme, which can be represented by an increase in specific activity (e.g., product produced / time / weight protein) or an increase in percent conversion of the substrate to the product (e.g., percent conversion of starting amount of substrate to product in a specified time period using a specified amount of imine reductase) as compared to the reference enzyme. Exemplary methods to determine enzyme activity are provided in the Examples. Any property relating to enzyme activity may be affected, including the classical enzyme properties of Km (concentration of enzyme needed to achieve half Vmax), Vmax (maximum rate of reaction) or kcat, (number of substrate molecules turned into product per enzyme site per minute) changes of which can lead to increased enzymatic activity. Improvements in enzyme activity can be from about 1.2 to 10,000 fold the enzymatic activity of the corresponding wild-type enzyme, suitably 1.2, 1.5, 2, 2.5, 3, 4, 5, 10, 20, 25, 50, 100, 500, 1000, 5000 or 10,000 fold enzymatic activity of the corresponding wild-type enzyme or another I RED enzyme. Enzyme activity can be measured by any one of standard assays, such as by monitoring changes in properties of substrates, cofactors, or products. In some embodiments, the amount of products generated can be measured by Liquid Chromatography-Mass Spectrometry (LC-MS). Comparisons of enzyme activities are made using a defined preparation of enzyme, a defined assay under a set condition, and one or more defined substrates, as further described in detail herein. Generally, when lysates are compared, the numbers of cells and the amount of protein assayed are determined as well as use of identical expression systems and identical host cells to minimize variations in amount of enzyme produced by the host cells and present in the lysates.

[0090] The present invention provides a method, as described herein, for the production of a chiral amine.

[0091] Suitably, the chiral amine product may be a compound of formula (I) or a salt thereof, where Formula I is:

[0092] 0)

[0093] Formula I wherein X is -CH2R or -CH(R’)2;

[0094] R is a side chain of the reacted aldehyde; each R’ is a side chain of the reacted ketone, optionally wherein the two R’ groups together form a ring comprising the two R’ groups and the -CH- of X; wherein R or one R’ group is optionally substituted with halo, OR1or NR2R3, wherein:

[0095] R1is H or C1.4 alkyl, and

[0096] R2and R3are independently selected from H and C1.4 alkyl; and bonds labelled with * are in the trans configuration.

[0097] The compound of Formula I may be a compound of Formula la: Formula la wherein

[0098] Y is selected from H, halo, OR1or NR2R3;

[0099] R1is H or C1.4 alkyl, and

[0100] R2and R3are independently selected from H and C1.4 alkyl.

[0101] Suitably, a compound of Formula I is trans- N1-((1 ,2S)-2 phenyl cyclopropyl)cyclohexane- 1 ,4-diamine dihydrochloride compound (Formula lb) (also known as ladademstat ™, or ORY1001).

[0102] Formula lb

[0103] Included within the scope of the present invention are all geometric isomers and tautomeric forms of the compounds produced in methods of the invention, including compounds exhibiting more than one type of isomerism, and mixtures of one or more thereof. The compound of formula (I) may have an enantiomeric excess of at least about 80%. The compound of formula (I) may have an enantiomeric excess of at least about 85%. The compound of formula (I) may have an enantiomeric excess of at least about 90%. The compound of formula (I) may have an enantiomeric excess of at least about 92%. The compound of formula (I) may have an enantiomeric excess of at least about 95%. The compound of formula (I) may have an enantiomeric excess of at least about 99%. For example, the compound of formula (I) may have an enantiomeric excess in the range of from about 95% to about 99%.

[0104] The present invention also encompasses a compound produced in a method of the invention as defined herein which comprise one or more isotopic substitutions. For example, H may be in any isotopic form, including1H,2H(D), and3H (T); C may be in any isotopic form, including12C,13C, and14C; and O may be in any isotopic form, including16O and18O; and the like. Similarly, isotopic variants of N, S and P may be utilised.

[0105] The present invention also includes a derivative of the product of Formula I.

[0106] The present invention provides an enzyme catalysed reductive amination reaction, suitably for the production of a compound of Formula I. Such a method may comprise reacting an aldehyde or a ketone with a precursor chiral amine. The precursor chiral amine may be a compound of formula (II) or a salt thereof.

[0107] Formula II:

[0108] The precursor chiral amine may comprise a mixture of two enantiomers of the chiral amine. For example, the precursor chiral amine may be a racemic mixture.

[0109] The compound of formula (II) or a salt thereof may be a racemic mixture of the (1F?, 2S)- enantiomer formula (II) and the (1 S, 2 ?)-enantiomer of formula (II). Thus, the compound of formula (II) may have an enantiomeric excess of 0%.

[0110] Alternatively, the compound of formula (II) or a salt thereof may comprise each enantiomer in different amounts. The compound of formula (II) may comprise the (1 , 2S)-enantiomer in an enantiomeric excess of at least about 10%. The compound of formula (II) may comprise the (1 , 2S)- enantiomer in an enantiomeric excess of at least about 20%. The compound of formula (II) may comprise the (1 , 2S)-enantiomer in an enantiomeric excess of at least about 50%. The compound of formula (II) may comprise the (1 , 2S)-enantiomer in an enantiomeric excess of at least about 75%. The compound of formula (II) may comprise the (1 , 2S)-enantiomer in an enantiomeric excess of at least about 90%. The compound of formula (II) may comprise the (1 , 2S)-enantiomer in an enantiomeric excess of at least about 95%. The compound of formula (II) may comprise the (1 , 2S)-enantiomer in an enantiomeric excess of at least about 99%. The compound of formula (II) may comprise the (1 , 2S)-enantiomer in an enantiomeric excess of 100%, i.e. in the absence of the (1 S, 2 )-enantiomer.

[0111] Suitably, a compound of Formula II is phenylcyclopropanamine HCI salt (rac-trans-1), for example as shown below (Formula Ila)

[0112] Formula Ila

[0113] The (1 , 2S)-enantiomer of formula (II) is:

[0114] Accordingly, R may be substituted or unsubstituted cyclopropane, cyclobutane, cyclopentane, cyclohexane, cycloheptane or cyclooctane. It may be that R is substituted or unsubstituted cyclohexane. For example, R may be unsubstituted cyclohexane or 4- substituted cyclohexane, wherein, when substituted, R is substituted with halo, OR1or NR2R3; wherein R1is H or C1.4 alkyl; and R2and R3are independently selected from H and C1.4 alkyl.

[0115] The aldehyde may be 4-aminocyclohexanecarbaldehyde, or a salt thereof. For example, the aldehyde may be 4-aminocyclohexanecarbaldehyde hydrochloride:

[0116] The ketone may be a cyclic ketone. For example, the ketone may be selected from a substituted or unsubstituted cyclopropanone, cyclobutanone, cyclopentanone, cyclohexanone, cycloheptanone, and cyclooctanone.

[0117] It may be that the ketone is a substituted or unsubstituted cyclohexanone. For example, the ketone may be selected from cyclohexanone, aminocyclohexanone, hydroxycyclohexanone, chlorocyclohexanone, fluorocyclohexanone and Boc-aminocyclohexanone.

[0118] It may be that the ketone is an unsubstituted or 4-substituted cyclohexanone. For example, the ketone may be selected from cyclohexanone, 4-aminocyclohexanone, 4- hydroxycyclohexanone, 4-chlorocyclohexanone, 4-fluorocyclohexanone or 4-Boc- aminocyclohexanone. It may be that the ketone is cyclohexanone or 4-aminocyclohexanone.

[0119] Accordingly, each R’ may be independently selected from the group comprising substituted or unsubstituted C1.4 alkylene, e.g. substituted or unsubstituted methyl, ethyl, propyl or butyl. Additionally, each R’ group may be bonded to one another to form a ring comprising the two R’ groups and the -CH- of X.

[0120] The ketone may be 4-aminocyclohexanone or a salt thereof. For example, the ketone may be 4-aminocyclohexanone hydrochloride:

[0121] Enzyme The present invention is based upon the use of an I RED enzyme, suitably a RedAm enzyme for the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof.

[0122] Suitably, the enzyme is capable of catalysing reductive amination reaction. Suitably, the enzyme is capable of catalysing reductive amination reaction and reduction of pre-formed cyclic imines. Suitably, an enzyme of the present invention has the activity as shown in reaction scheme of Figure 1. Suitably, an enzyme of the invention catalyses the production of trans-N1-1 2S-2 phenylcyclopropyl))cyclohexane-1,4-diamine dihydrochloride compound (or a related phenylcyclopropanamine containing compound) or from a carbonyl compound, suitably a ketone, and a phenylcyclopropanamine HCI salt.

[0123] Suitably, the enzyme is a bacterial enzyme. Suitably, the bacteria is a proteobacteria, suitably rhizobiaceae, most suitably Rhizobium sullae. Most suitably, the enzyme is derived from Rhizobium sullae strain WSM1592, and comprises an NAD(P) binding domain.

[0124] Suitably, the enzyme is an I RED enzyme derived from Rhizobium sullae, suitably an enzyme which has the sequence of SEQ ID NO. 1. The I RED enzyme of Rhizobium sullae is the enzyme of UNIPROT ID WP_027512056.1. The enzyme may consist of or comprise a sequence of 294 amino acids.

[0125] A sequence of the I RED enzyme of Rhizobium sullae is provided herein as SEQ ID NO. 1. Herein, this sequence may be referred to as the “wild-type” or “reference” sequence.

[0126] Suitably, the enzyme for use in a method of the present invention as described herein is an enzyme having the sequence of SEQ ID NO. 1. Suitably, the enzyme comprises the sequence of SEQ ID NO. 1. Suitably, the enzyme consists of the sequence of SEQ ID NO.

[0127] 1. The enzyme may be a variant, or mutant form, of the enzyme of SEQ ID NO. 1. Suitably, the enzyme is encoded by a nucleic acid sequence of SEQ ID NO. 2, or a codon optimised version thereof.

[0128] Herein, reference to the enzyme of the invention, as represented by the Rhizobium sullae enzyme of SEQ ID NO. 1 also includes homologous enzymes having the same or similar function, from any other organism, including plant, microbial, mammal or non-mammal. Suitably, the enzyme is a bacterial enzyme. The degree of structural and functional similarity between imine reductase from different sources is high, for example an enzyme from a source other than rhizobium sullae may share 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more sequence identity with the I RED enzyme sequence of SEQ ID NO. 1. Therefore, such an enzyme may in certain circumstances be used interchangeably with the I RED enzyme of SEQ I D NO. 1.

[0129] Also provided in the present invention is a variant (or mutant) of an I RED enzyme. A variant of the enzyme sequence of SEQ ID NO. 1 may comprise one or more amino acid substitutions compared to the sequence of SEQ ID NO. 1. Therefore, a variant may be an enzyme sequence which shares at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence of SEQ ID NO. 1. Suitably, sequence identity is measured across a continuous window of at least 280 amino acids. The sequence identity over the defined window may be at least 90% or 95%. Suitably, a sequence variant of the I RED enzyme sequence of SEQ ID NO. 1 retains at least or about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% of the reductive amination activity of the enzyme of SEQ ID NO. 1 . The enzyme activity may be measured using any suitable method, for example UHPLC-MS to detect formation of the desired product.

[0130] A variant enzyme of the present invention may be a fragment of the full length I RED enzyme of SEQ ID NO. 1. Such a fragment may comprise one or more amino acid deletions compared to the enzyme of SEQ ID NO. 1. A fragment may be 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the sequence of SEQ ID NO. 1. A fragment is suitably enzymatically active and retains the ability to conduct a reductive amination reaction, as described herein. Suitably, a fragment retains at least or about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% of the activity of the enzyme of SEQ ID NO. 1 , when measured using an a suitable enzyme activity test, for example UHPLC-MS. A fragment of an enzyme of SEQ ID NO. 1 may be a mature form of the enzyme, whereby the N terminal methionine residue has been cleaved (removed) by prost-translational processing. A native enzyme may be in the “precursor” form where the enzyme comprises the N terminal methionine residue. Therefore, by way of example, an enzyme for use in the present invention may comprise a sequence which is the protein of SEQ ID NO. 1 , or which is the sequence of SEQ ID NO. 1 which lacks the N terminal methionine residue.

[0131] The present invention provides an enzyme of SEQ ID NO. 1 , wherein the enzyme comprises a mutation at one or more positions selected from 35, 61 , 93, 98, 136, 164, 164, 199, 205, 209, 216, 231 , 233 and 241. Suitably, there is provided an enzyme of SEQ ID NO. 1 , wherein the enzyme comprises a residue substitution at one or more positions selected from 35, 61 , 93, 98, 136, 164, 164, 199, 205, 209, 216, 231 , 233 and 241. A variant, or mutant, enzyme as described herein and described in the first aspect may be referred to as an engineered variant of an enzyme of SEQ ID NO. 1.

[0132] Suitably, the enzyme is derived from Rhizobium sullae.

[0133] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 35. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type I (lie) residue with a S (Ser) residue (referred to herein as I35S). Thus, the present invention provides an I RED enzyme of SEQ ID NO. 3. This variant enzyme has been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, the variant enzyme may improve enzyme activity at pH 8.5 to pH 9, or above.

[0134] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 61. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type I (lie) residue with a F (Phe) residue (referred to herein as 161 F). Thus, the present invention provides an I RED enzyme of SEQ ID NO. 4.

[0135] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 61. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type I (lie) residue with a Q (Gin) residue (referred to herein as 161 Q). Thus, the present invention provides an I RED enzyme of SEQ ID NO. 5.

[0136] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 61. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type I (lie) residue with a T (Thr) residue (referred to herein as 161 T). Thus, the present invention provides an I RED enzyme of SEQ ID NO. 6. This variant enzyme has been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, the variant enzyme may improve enzyme activity at pH 8.5 to pH 9, or above. Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 93. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type L (Leu) residue with a T (Thr) residue (referred to herein as L93T). Thus, the present invention provides an I RED enzyme of SEQ ID NO. 7.

[0137] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 98. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type P (Pro) residue with a K (Lys) residue (referred to herein as P98K). Thus, the present invention provides an I RED enzyme of SEQ ID NO. 8.

[0138] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 136. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type V (Vai) residue with a C (Cys) residue (referred to herein as V136C). Thus, the present invention provides an IRED enzyme of SEQ ID NO. 9.

[0139] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 164. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type S (Ser) residue with an A (Ala) residue (referred to herein as S164A). Thus, the present invention provides an IRED enzyme of SEQ ID NO. 10. This variant enzyme has been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, the variant enzyme may improve enzyme activity at pH 8.5 to pH 9, or above.

[0140] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 164. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type S (Ser) residue with an I (lie) residue (referred to herein as S164I). Thus, the present invention provides an IRED enzyme of SEQ ID NO. 11.

[0141] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 164. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type S (Ser) residue with an L (Leu) residue (referred to herein as S164L). Thus, the present invention provides an IRED enzyme of SEQ ID NO. 12. This variant enzyme has been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, the variant enzyme may improve enzyme activity at pH 7 to pH 9 or above.

[0142] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 199. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type L (Leu) residue with an M (Met) residue (referred to herein as L199M). Thus, the present invention provides an IRED enzyme of SEQ ID NO. 13.

[0143] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 205. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type Q (Gin) residue with an C (Cys) residue (referred to herein as Q205C). Thus, the present invention provides an IRED enzyme of SEQ ID NO. 14.

[0144] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 209. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type T (Thr) residue with a V (Vai) residue (referred to herein as T209V) Thus, the present invention provides an IRED enzyme of SEQ ID NO. 15. This variant enzyme has been shown to have about 110% or more (e.g. 1.09- 1.1 fold) of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, the variant enzyme may improve enzyme activity at pH 7 or above.

[0145] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 216. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type L (Leu) residue with a Y (Tyr) residue (referred to herein as L216Y). Thus, the present invention provides an IRED enzyme of SEQ ID NO. 16. This variant enzyme has been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, the variant enzyme may improve enzyme activity at pH 7 to pH 9, or above.

[0146] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 231. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type S (Ser) residue with a I (lie) residue (referred to herein as S2311) Thus, the present invention provides an I RED enzyme of SEQ ID NO. 17.

[0147] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 231. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type S (Ser) residue with a Q (Gin) residue (referred to herein as S231Q) Thus, the present invention provides an I RED enzyme of SEQ ID NO. 18.

[0148] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 233. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type D (Asp) residue with a S (Ser) residue (referred to herein as D233S) Thus, the present invention provides an I RED enzyme of SEQ ID NO. 19.

[0149] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 233. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type D (Asp) residue with a E (Glu) residue (referred to herein as D233E) Thus, the present invention provides an I RED enzyme of SEQ ID NO. 20. This variant enzyme has been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, the variant enzyme may improve enzyme activity at pH 8 to pH 9 or above.

[0150] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 233. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type D (Asp) residue with a G (Gly) residue (referred to herein as D233G) Thus, the present invention provides an IRED enzyme of SEQ ID NO. 21.

[0151] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 241. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type A (Ala) residue with a R (Arg) residue (referred to herein as A241 R). Thus, the present invention provides an IRED enzyme of SEQ ID NO. 22. This variant enzyme has been shown to have 110% or more (e.g. 2.5-3 fold) of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, the variant enzyme may improve enzyme activity at pH 9 or above.

[0152] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at position 241. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type A (Ala) residue with a T (Thr) residue (referred to herein as A241T). Thus, the present invention provides an IRED enzyme of SEQ ID NO. 23. This variant enzyme has been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1.

[0153] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at positions 35 and 205. Suitably, the mutations are each an amino acid substitution. Suitably, the mutation at position 35 is a substitution of the wild type I (lie) residue with a S (Ser) residue (referred to herein as I35S). Suitably, the mutation at position 205 is a substitution of the wild type Q (Gin) residue with an C (Cys) residue (referred to herein as Q205C). Thus, the present invention provides an IRED enzyme of SEQ ID NO. 24. This variant enzymes has been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, a variant enzyme having the mutations I35S and Q205C (for example an enzyme of the sequence SEQ ID NO. 24) may improve enzyme activity at pH 8 to pH 9, most suitably pH 8 to pH 8.5, or up to pH 9, or most suitably at about pH 8.5. Suitably, there is provided an I RED enzyme of SEQ ID NO. 1 , wherein the enzyme comprises a mutation at positions 61 and 216. Suitably, the mutations are each an amino acid substitution. Suitably, the mutation at position 61 is an amino acid substitution. Suitably, the mutation is a substitution of the wild type I (lie) residue with a F (Phe) residue (referred to herein as 161 F). Suitably, the mutation is a substitution of the wild type I (lie) residue with a Q (Gin) residue (referred to herein as 161 Q). Suitably, the mutation at position 216 is an amino acid substitution. Suitably, the mutation is a substitution of the wild type L (Leu) residue with a Y (Tyr) residue (referred to herein as L216Y). Thus, the present invention provides an I RED enzyme of SEQ ID NOs. 25 or 26. These variant enzymes have each been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, a variant enzyme having the mutations 161 F and L216Y (for example an enzyme of the sequence SEQ ID NO. 25) may improve enzyme activity at pH 7 to pH 9 or above, most suitably at pH 7 to pH 8.5 or up to pH 9. Most suitably, a variant enzyme having the mutations 161 Q and L216Y (for example an enzyme of the sequence SEQ ID NO. 26) may improve enzyme activity at pH 7 to pH 9, most suitably pH 7.5 to pH 8.5 or up to pH 9.

[0154] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1 , wherein the enzyme comprises a mutation at positions 98 and 199. Suitably, the mutations are each an amino acid substitution. Suitably, the mutation at position 98 is an amino acid substitution. Suitably, the mutation is a substitution of the wild type P (Pro) residue with a K (Lys) residue (referred to herein as P98K). Suitably, the mutation at position 199 is an amino acid substitution. Suitably, the mutation is a substitution of the wild type L (Leu) residue with an M (Met) residue (referred to herein as L199M). Thus, the present invention provides an I RED enzyme of SEQ ID NO. 27. This variant enzyme has been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, a variant enzyme having the mutations P98K and L199M (for example an enzyme of the sequence SEQ ID NO. 27) may improve enzyme activity at pH 7 to pH 8 or above, suitably at pH 7 up to pH 8.5.

[0155] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1 , wherein the enzyme comprises a mutation at positions 93 and 164. Suitably, the mutations are each an amino acid substitution. Suitably, the mutation at position 93 is an amino acid substitution.

[0156] Suitably, the mutation is a substitution of the wild type L (Leu) residue with a T (Thr) residue (referred to herein as L93T). Suitably, the mutation at position 164 is a substitution of the wild type S (Ser) residue with an I (lie) residue or a L (Leu) residue (referred to herein as S164I or S164L). Thus, the present invention provides an IRED enzyme of any one of SEQ ID NOs. 28 or 29. These variant enzymes have each been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, a variant enzyme having the mutations L93T and S164I or S164L (for example an enzyme of the sequence SEQ ID NO. 28 or 29) may improve enzyme activity at pH 7 to pH 9 or above.

[0157] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at positions 93, 136 and 164. Suitably, the mutations are each an amino acid substitution. Suitably, the mutation at position 93 is an amino acid substitution. Suitably, the mutation is a substitution of the wild type L (leu) residue with a T (Thr) residue (referred to herein as L93T). Suitably, the mutation at position 136 is a substitution of the wild type V (Vai) residue with a C (Cys) residue (referred to herein as V136C). Suitably, the mutation at position 164 is a substitution of the wild type S (Ser) residue with an A (Ala) residue or a L (Leu) residue (referred to herein as S164A or S164L). Suitably, the enzyme comprises an L93T, V136C and one of S164A or S164L mutations. Thus, the present invention provides an IRED enzyme of any one of SEQ ID NOs. 30 to 31 . These variant enzymes have each been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, a variant enzyme having the mutations L93T, V136C and S164A (for example an enzyme of the sequence SEQ ID NO. 30) may improve enzyme activity at pH 8 to pH 9 or above. Most suitably, a variant enzyme having the mutations L93T, V136C and S164L (for example an enzyme of the sequence SEQ ID NO. 31) may improve enzyme activity at pH 7 to 8 or above.

[0158] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at positions 136 and 164. Suitably, the mutations are each an amino acid substitution. Suitably, the mutation at position 136 is an amino acid substitution. Suitably, the mutation at position 136 is a substitution of the wild type V (Vai) residue with a C (Cys) residue (referred to herein as V136C). Suitably, the mutation at position 164 is an amino acid substitution. Suitably, the mutation at position 164 is a substitution of the wild type S (Ser) residue with an I (lie) residue or a L (Leu) residue (referred to herein as S164I or S164L). Thus, the present invention provides an I RED enzyme of any one of SEQ ID NOs. 32 to 33. These variant enzymes have each been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, a variant enzyme having the mutations V136C and S164I (for example an enzyme of the sequence SEQ ID NO. 32) may improve enzyme activity at pH 8 to pH 9 or above. Most suitably, a variant enzyme having the mutations V136C and S164L (for example an enzyme of the sequence SEQ ID NO. 33) may improve enzyme activity at pH 7 to pH 9 or above.

[0159] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at positions 164 and 231. Suitably, the mutations are each an amino acid substitution. Suitably, the mutation at position 164 is an amino acid substitution. Suitably, the mutation is an amino acid substitution. Suitably, the mutation is a substitution of the wild type S (Ser) residue with an L (Leu) residue (referred to herein as S164L). Suitably, the mutation at position 231 is an amino acid substitution. Suitably, the mutation is a substitution of the wild type S (Ser) residue with a I (lie) residue or with a Q residue (referred to herein as S231 I or S231Q). Thus, the present invention provides an IRED enzyme of SEQ ID NOs. 34 or 35. These variant enzymes have each been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, a variant enzyme having the mutations S164L and S231Q (for example an enzyme of the sequence SEQ ID NO. 35) may improve enzyme activity at pH 7 to pH 9 or above. Most suitably, a variant enzyme having the mutations S164L and S231I (for example an enzyme of the sequence SEQ ID NO. 34) may improve enzyme activity at pH 7 or pH 8 to pH 9 or above.

[0160] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at positions 209 and 241. Suitably, the mutations are each an amino acid substitution. Suitably, the mutation at position 209 is a substitution of the wild type T (Thr) residue with a V (Vai) residue (referred to herein as T209V). Suitably, the mutation at position 241 is a substitution of the wild type A (Ala) residue with a R (Arg) residue (referred to herein as A241 R) or with a T residue (referred to herein as (A241T). Thus, the present invention provides an I RED enzyme of SEQ ID NO. 36 or SEQ ID NO. 47. These variant enzymes have been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, the variant enzyme may improve enzyme activity at pH 7 to pH 9 or above. A variant enzyme having a T209V and A241 R mutation (for example an enzyme of SEQ ID NO. 36) may have 2.5 fold or more enzyme activity compared to the wild type enzyme at pH 7, suitably when the substrate is provided in excess. A variant enzyme having a T209V and A241T mutation (for example an enzyme of SEQ ID NO. 47) may have 3 fold or more enzyme activity compared to the wild type enzyme at pH 7, suitably when the substrate is provided in excess.

[0161] Suitably, the enzyme comprises a mutation at positions 209, 241 , 216 and 233, wherein the mutations are each independently as described herein. Most suitably, the enzyme comprises the mutations T209V, A241R, L216Y and D233S. Thus, the present invention provides an I RED enzyme of SEQ ID NO. 37. A variant enzyme comprising the mutations T209V, L216Y, D233S, and A241R (for example an enzyme of the sequence SEQ ID NO. 37) has been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, the variant enzyme may improve enzyme activity at pH 7 to pH 9 or above. A variant enzyme comprising the mutations T209V, L216Y, D233S, and A241R (for example an enzyme of the sequence SEQ ID NO. 37) may have 1.8 fold or more, suitably 1.8-3 fold, suitably 2.5-3.5 fold enzyme activity compared to the wild type enzyme at pH 8 to 9, suitably when the substrate is provided in excess.

[0162] Suitably, the enzyme comprises a mutation at positions 209, 241 , 61, 216 and 233, wherein the mutations are each independently as described herein. Most suitably, the enzyme comprises the mutations T209V, A241R, 161 T, L216Y and D233S. Thus, the present invention provides an I RED enzyme of SEQ ID NO. 38. A variant enzyme comprising the mutations I61T, T209V, L216Y, D233S, and A241 R (for example an enzyme of the sequence SEQ ID NO. 38) has been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, the variant enzyme may improve enzyme activity at pH 7 to pH 9 or above. A variant enzyme comprising the mutations 161 T, T209V, L216Y, D233S, and A241 R (for example an enzyme of the sequence SEQ ID NO. 38) may have 1.6 fold or more, suitably 1.6-2.5 fold enzyme activity compared to the wild type enzyme at pH 8-9, suitably when the substrate is provided in excess.

[0163] Suitably, there is provided an I RED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at positions 216 and 233. Suitably, the mutations are each an amino acid substitution. Suitably, the mutation at position 216 is a substitution of the wild type L (Leu) residue with a Y (Tyr) residue (referred to herein as L216Y). Suitably, the mutation at position 233 is a substitution of the wild type D (Asp) residue with a S (Ser) residue (referred to herein as D233S). Suitably, the enzyme comprises a L216Y and one of D233S, D233E or D233G. Thus, the present invention provides an IRED enzyme of any one of SEQ ID NOs. 39 to 41. These variant enzymes have each been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, a variant enzyme having the mutations L216Y and D233E (for example an enzyme of the sequence SEQ ID NO. 39) may improve enzyme activity at pH 7 to pH 9. Most suitably, a variant enzyme having the mutations L216Y and D233G / S (for example an enzyme of the sequence SEQ ID NO. 40 or 41) may improve enzyme activity at pH 8 to pH 9. A variant enzyme comprising the mutations L216Y and D233G / S (for example an enzyme of the sequence SEQ ID NO. 40 or 41) may have 1.3 fold or more, suitably 1.3 to 1.6 fold enzyme activity compared to the wild type enzyme at pH 8-9, suitably when the substrate is provided in excess.

[0164] Suitably, there is provided an IRED enzyme of SEQ ID NO. 1, wherein the enzyme comprises a mutation at positions 61, 216 and 233. Suitably, the mutations are each an amino acid substitution. Suitably, the mutation at position 61 is an amino acid substitution. Suitably, the mutation is a substitution of the wild type I (lie) residue with a T (Thr) residue, an F (Phe) residue or a Q (Gin) residue (referred to herein as I61T, 161 F or 161 Q). Suitably, the mutation at position 216 is a substitution of the wild type L (Leu) residue with a Y (Tyr) residue (referred to herein as L216Y). Suitably, the mutation at position 233 is a substitution of the wild type D (Asp) residue with a S (Ser) residue, an E residue (Glu) or a G residue (Gly) (referred to herein as D233S, D233E or D233G). Suitably, the enzyme comprises a 161 F, L216Y and a D233E or D233S mutation. Thus, the present invention provides an IRED enzyme of SEQ ID NOs. 42 or 43. Suitably, the enzyme comprises a 161 Q, L216Y and a D233G mutation. Thus, the present invention provides an IRED enzyme of SEQ ID NOs. 44. Suitably, the enzyme comprises a 161 T, L216Y and a D233G or D233S mutation. Thus, the present invention provides an I RED enzyme of SEQ ID NOs. 45 or 46. These variant enzymes have each been shown to have 110% or more of the activity of the wild type enzyme of SEQ ID NO. 1 in the catalysis of an amine reductase reaction in the production of a compound of Formula 1 or a derivative thereof as described herein, suitably in the reaction scheme of Figure 1. Most suitably, a variant enzyme having the mutations 161 F, L216Y and D233E (for example an enzyme of the sequence SEQ ID NO. 42) may improve enzyme activity at pH 7 to pH 8, suitably pH 7.5 to pH 8. Most suitably, a variant enzyme having the mutations 161 F, L216Y and D233S (for example an enzyme of the sequence SEQ ID NO. 43) may improve enzyme activity at pH 7 to pH 8, suitably pH 7.5 to pH 8. Most suitably, a variant enzyme having the mutations 161 Q, L216Y and D233G (for example an enzyme of the sequence SEQ ID NO. 44) may improve enzyme activity at pH 7 to pH 8.5, suitably pH 8.5. Most suitably, a variant enzyme having the mutations 161 T, L216Y and D233G (for example an enzyme of the sequence SEQ ID NO. 45) may improve enzyme activity at pH 7 to pH 9. Most suitably, a variant enzyme having the mutations 161 T, L216Y and D233S (for example an enzyme of the sequence SEQ ID NO. 46) may improve enzyme activity at pH 8 to pH 9. A variant enzyme comprising the mutations 161 T, L216Y and D233S (for example an enzyme of the sequence SEQ ID NO. 46) may have 1.2 fold or more, suitably 1.2 to 1.6 fold enzyme activity compared to the wild type enzyme at pH 8-9, suitably when the substrate is provided in excess.

[0165] A variant enzyme of the invention suitably has reductive amination activity. Suitably, a variant enzyme of the invention is capable of catalysing reductive amination and reduction of pre-formed cyclic imines. A variant enzyme as described herein, for example as set forth in any one of SEQ ID NOs. 3 to 47, may suitably exhibit improved reaction activity, and conversion of substrate to product. A variant enzyme as described herein, for example as set forth in any one of SEQ ID NO. s 3 to 47, may have, or may have at least, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1 , 2.2, 2.3, 2.4, 2.4, 2.6, 2.7, 2.8, fold activity compared to the wild type enzyme of SEQ ID NO. 1.

[0166] Also provided is a fragment of a variant enzyme of the present invention as described herein, for example a fragment of a full length enzyme of any one of SEQ ID NO s 3 to 47. Such a fragment will comprise at least one of the above mentioned mutations, and suitably exhibits the improved activity. A fragment may comprise one or more amino acid deletions compared to the enzyme of any one of SEQ ID NOs. 3 to 47. A fragment may be 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the sequence of any one of SEQ ID NOs 3 to 47. A fragment is suitably enzymatically active and retains the ability to conduct a reductive amination reaction, as described herein. A fragment of a variant of the present invention suitably retains the improvements of the variant over the wild type enzyme. Suitably, a fragment retains at least or about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% of the activity of the enzyme of any one of SEQ ID NO s 3 to 47, when measured using an a suitable enzyme activity test, for example UHPLC- MS. A fragment of an enzyme of any one of SEQ ID NOs. 3 to 47 may be a mature form of the enzyme, whereby the N terminal methionine residue has been cleaved (removed) by post-translational processing. A native enzyme may be in the “precursor” form where the enzyme comprises the N terminal methionine residue. Therefore, by way of example, an enzyme for use in the present invention may comprise a sequence which is the protein of any one of SEQ ID NO s 3 to 47, or which is the sequence of any one of SEQ ID NOs. 3 to 47 which lacks the N terminal methionine residue.

[0167] Also included are variants of the mutant enzymes, which may share at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence of any one of SEQ ID NO. 3 to 47. Suitably, sequence identity is measured across a continuous window of at least 280 amino acids. The sequence identity over the defined window is at least 90% or 95%. Suitably, a sequence variant of a mutant enzyme of any one of SEQ ID NOs. 3 to 47 retains at least one of the mutant residues as defined above, and at least or about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% of the reductive amination activity of the reference enzyme of SEQ ID NO. 3 to 47. The enzyme activity may be measured using any suitable method, for example UHPLC-MS to detect formation of the desired product.

[0168] The enzyme may also be pegylated, glycosylated, phosphorylated, or may be modified by lipidation, myristilation, ubiquitination, etc. A protein may comprise D- and L-amino acids, and mixtures of D- and L-amino acids.

[0169] It is well within the capabilities of a skilled person to modify an enzyme, such as that set forth in SEQ ID NO. 1 or 3 to 47 to generate enzymatically-active variants for use in the methods provided herein. For example, a person skilled in the art would understand that modifications at positions involved in substrate binding, or in the active site, are less likely to be tolerated than modifications at positions outside these critical regions. Any enzyme can be tested using methods well known in the art, such as those described in the Examples below, to assess the ability of the enzyme to catalyze the reductive amination reaction. The wild type enzyme may be isolated, or it may be recombinant. A variant enzyme, for example as set forth in any one of SEQ ID NO s 3 to 47 may be recombinant.

[0170] A enzyme as described herein, for example the wild type SEQ ID NO. 1 enzyme or a variant thereof for example as set forth in any one of SEQ ID NOs. 3 to 47 may comprise an insertion of 1, 5, 10, 15 or 20 or more amino acids. Suitably, the functional activity and / or improved properties of the enzyme as described herein is maintained. The insertions can be to amino or carboxy terminus, or internal portions of the imine reductase polypeptide. An insertion may be a tag. A tag may be an internal tag, an N terminal tag, a C terminal tag, or a combination thereof. Suitably, the tag may be at the N terminus of the enzyme. The tag may be for example a signal peptide, an affinity tag (for example to assist with purification from a biological source), a solubilisation tag (to assist in folding), a chromatography tag, a fluorescent tag (e.g. for labelling). An affinity tag may any suitable affinity tag, including for example a poly-His tag, chitin binding protein (CBP), maltose binding protein (MBP), strep- tag, or glutathione-S-transferase (GST) tag. A solubilisation tag may be any suitable solubilisation tag, for example, thioredoxin or poly(NANP), or MBP or GST. A chromatography tag may be FLAG or polyglutamate. A fluorescent tag may be green fluorescent protein, or a variant thereof. Other suitable tags will be known and available to persons skilled in the art.

[0171] An insertion may also be a signal peptide, which is an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway. Effective signal peptide coding regions for bacterial host cells are the signal peptide coding regions obtained from the genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus stearothermophilus alpha-amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase, Bacillus stearothermophilus neutral proteases (NprT, NprS, NprM), and Bacillus subtilis PrsA. Effective signal peptide coding regions for filamentous fungal host cells can be the signal peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, and Humicola lanuginosa lipase. Useful signal peptides for yeast host cells can be from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase.

[0172] An insertion may be a secretion peptide, to direct the protein for export from the cell into the media. Suitable secretion peptides will be known to persons skilled in the art, and include for example a signal peptide for the SEC or TAT secretion systems. Nucleic acid sequences

[0173] The present invention provides a nucleic acid sequence which encodes an enzyme of the present invention, suitably a variant of an enzyme of the present invention. A suitable variant may be an enzyme of any one of SEQ ID NOs. 3 to 47.

[0174] The nucleic acid sequence may be a DNA, RNA, or cDNA sequence. A nucleic acid sequence may be codon optimized for expression in a particular system, for example for expression in a bacterial cell, for example E. coli or Bacillus subtilis, a fungal cell, for example Aspergillus niger, A. oryzae or Trichoderma reesei.

[0175] The nucleic acid of the wild type I RED enzyme is provided as SEQ ID NO. 2. The skilled person can generate a nucleic acid sequence encoding any one of the variants of any one of SEQ ID NOs. 3 to 47. Suitably, the nucleic acid sequences may be codon optimized to fit the host cell in which the protein is being produced. For example, preferred codons used in bacteria are used to express the gene in bacteria; preferred codons used in yeast are used for expression in yeast; and preferred codons used in mammals are used for expression in mammalian cells. In some embodiments, all codons need not be replaced to optimize the codon usage of the enzyme since the wild type sequence will comprise preferred codons and because use of preferred codons may not be required for all amino acid residues. Consequently, codon optimized polynucleotides encoding the enzymes may contain preferred codons at about 40%, 50%, 60%, 70%, 80%, or greater than 90% of codon positions of the full length coding region.

[0176] A nucleic acid molecule encoding an enzyme of the present invention may be modified to take account of any additional sequence modifications to the variant sequence, such as a nucleic acid sequence insertion, deletion or substitution in addition to the defined variations at amino acid positions 35, 61, 93, 98, 136, 164, 205, 209, 216, 231, 233 and / or 241 as set forth above.

[0177] A nucleic acid sequence coding for an enzyme of the present invention may be cloned into an expression vector, suitable for an expression system of choice. The present invention therefore provides an expression vector, comprising a nucleic acid sequence encoding an enzyme of the present invention, for example as set forth in any one of SEQ ID NOs. 1 or 3 to 47. A nucleic acid sequence encoding an enzyme of the present invention may be operably linked to one or more regulatory (or control) sequences that facilitate expression of the enzyme. A regulatory sequence may be a transcriptional promoter, enhancer, propeptide, translational signal, replication origin, or transcriptional and translational termination signal.

[0178] Suitable promoters can be selected based on the host cells used. For bacterial host cells, suitable promoters for directing transcription of a nucleic acid molecule of the present invention include the promoters obtained from the E. coli lac operon, Streptomyces coelicolor agarase gene (dag A), Bacillus subtilis levansucrase gene (sacB), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, and prokaryotic betalactamase gene (Villa-Kamaroff et al., 1978, Proc. Natl Acad. Sci. USA 75: 3727-3731), as well as the tac promoter (DeBoer et al., 1983, Proc. Natl Acad. Sci. USA 80: 21-25) or phage derived T7 promoter.

[0179] A propeptide coding region codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The propeptide is typically cleaved from the expressed protein. The propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Saccharomyces cerevisiae alphafactor, Rhizomucor miehei aspartic proteinase, and Myceliophthora thermophila lactase (WO 95 / 33836). Where both signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.

[0180] The various nucleic acid and control sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleic acid sequence encoding the enzyme at such sites. Alternatively, a nucleic acid sequence of the present disclosure may be expressed by inserting the nucleic acid sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.

[0181] An expression vector of the present invention suitably contains one or more selectable markers, which permit easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like. Examples of bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis, or markers, which confer antibiotic resistance such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance. Suitable markers for yeast host cells are ADE2, HIS3, LELI2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Embodiments for use in an Aspergillus cell include the amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus.

[0182] The choice of expression vector is influenced by the choice of host expression system. Many expression vectors suitable for the expression of an enzyme as described herein are available and known to those of skill in the art. Such selection is well within the level of skill of the skilled artisan. Expression vectors that are used for stable transformation typically have a selectable marker which allows selection and maintenance of the transformed cells. In some cases, an origin of replication can be used to amplify the copy number of the vectors in the cells.

[0183] Suitably, an expression vector viral or non-viral. By way of example, a suitable viral expression vector may be derived from a virus selected from the group consisting of paramyxovirus, retrovirus, adenovirus, lentivirus, pox virus, alphavirus, and herpes virus. Other suitable viral vectors will be known to those skilled in the art. Suitable non-viral expression vectors may be selected from the group consisting of inorganic particle expression vectors (such as calcium phosphate, silica, and gold), lipid based particle expression vectors (for example cationic lipids, lipid nano emulsions, and solid lipid nanoparticles) and polymer based particle expression vectors (for example peptides, polyethylenimine, chitosan, and dendimers). Other suitable non-viral expression vectors will be known to those skilled in the art.

[0184] A suitable expression vector may be one suitable for expression in E. coli. It may be pBbE7k.

[0185] Host cells The present invention provides a host cell comprising a nucleic acid encoding an enzyme of the invention, suitably a nucleic acid sequence encoding a variant enzyme as defined in any one of SEQ ID NOs. 3 to 47. Suitably, a host cell may comprise an expression vector comprising a nucleic acid encoding a variant enzyme as defined in any one of SEQ ID NOs. 3 to 47as described herein.

[0186] A host cell may be recombinant. A population of host cells may be provided, for recombinant manufacture of an enzyme of the invention.

[0187] The enzyme may be produced using any suitable expression system. Prokaryotes, especially E. coli, Bacillus subtilis, Streptomyces and Salmonella typhimurium cells provide systems for producing large amounts of recombinant protein. Suitably, a host cell is E. coli. Transformation of E. coli is a simple and rapid technique well known to those of skill in the art. Expression vectors for E. coli can contain inducible promoters that are useful for inducing high levels of protein expression and for expressing proteins that exhibit some toxicity to the host cells. Examples of inducible promoters include the lac promoter, the trp promoter, the hybrid tac promoter, the T7 and SP6 RNA promoters and the temperature regulated APL promoter.

[0188] In other examples, eukaryotic expression systems are used to produce the enzyme, such as baculovirus expression systems. Typically, expression vectors use a promoter such as the polyhedrin promoter of baculovirus for high level expression. Commonly used baculovirus systems include baculoviruses such as Autographa californica nuclear polyhedrosis virus (AcNPV), and the Bombyx mori nuclear polyhedrosis virus (BmNPV) and an insect cell line such as Sf9 derived from Spodoptera frugiperda, Pseudaletia unipuncta (A7S), Drosophila S2 and Danaus plexippus (DpNI). For high level expression, the nucleotide sequence encoding the fusion protein is fused immediately downstream of the polyhedrin initiation codon of the virus. Animal cells such as CHO, COS, BHK, 293, and Bowes melanoma cells may also be useful host cells.

[0189] Yeasts such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Kluyveromyces lactis, and Pichia pastoris can also be used expression hosts for expression of a nucleic acid encoding a variant enzyme of the invention, for example as defined in any one of SEQ ID NOs. 3 to 47. Yeast can be transformed with episomal replicating vectors or by stable chromosomal integration by homologous recombination. Typically, inducible promoters, such as include GALI, GAL7, and GAL5, are used to regulate gene expression. Yeast expression vectors often include a selectable marker such as LELI2, TRPI, HIS3, and LIRA3 for selection and maintenance of the transformed DNA.

[0190] A nucleic acid molecule and / or an expression vector may be introduced into a suitable host cell by any suitable method available in the art. Techniques include but are not limited to electroporation, biolistic particle bombardment, liposome mediated transfection, calcium chloride transfection, and protoplast fusion.

[0191] A suitable host cell is E. coli. The present invention provides a recombinant E. coli cell which has been transformed with a nucleic acid molecule encoding an I RED enzyme comprising a mutation as described herein, for example a mutation at position 35, 61 , 93, 98, 136, 164, 205, 209, 216, 231 , 233, and / or 241 as described herein. Suitably, the IRED enzyme is SEQ ID NO. 1 of Rhizobium sullae. Suitably, there is provided an E. coli host cell comprising a nucleic acid molecule which encodes a variant enzyme of the invention, for example as defined in any one of SEQ ID NOs. 3 to 47.

[0192] Recombinant production of the enzyme

[0193] The present invention provides a method of production of an enzyme of the present invention, wherein the method comprises: a) providing a nucleic acid molecule encoding the enzyme in a host cell or a cell free system; b) maintaining the host cell or cell free system under conditions to allow expression of the nucleic acid molecule; c) Optionally isolating the expressed enzyme from the host cell or cell free system d) Optionally, purifying the enzyme.

[0194] Suitably, the host cell is E.coli. as been transformed with a nucleic acid molecule encoding an IRED enzyme comprising a mutation as described herein, for example a mutation at position 35, 61, 93, 98, 136, 164, 205, 209, 216, 231, 233 and / or 241 as set forth above. Suitably, the IRED enzyme is SEQ ID NO. 1 of Rhizobium Sullae, as shown in SEQ ID NO.

[0195] 1. Suitably, there is provided an E. coli host cell comprising a nucleic acid molecule which encodes an enzyme of any one of SEQ ID NO. 3 to 47. Suitably, there is provided an E. coli host cell comprising a nucleic acid molecule encoding an enzyme of any one of SEQ ID NO. 3 to 47.

[0196] Following expression in a host cell, an enzyme of the present invention may be purified, using any suitable method available to those of skill in the art including, but not limited to, SDS-PAGE, size fraction and size exclusion chromatography, ammonium sulfate precipitation, chelate chromatography, ionic exchange chromatography and affinity chromatography. Affinity purification techniques can be used to improve the efficiency and purity of the preparations. For example, antibodies and other molecules that bind the enzyme can be used in affinity purification. As discussed above, expression constructs can be engineered to add an affinity tag such as a His, Myc, FLAG or HA tag or GST moiety to the enzyme, which can then be affinity purified with Ni-resin, Myc antibody, HA antibody, FLAG antibody or glutathione resin, respectively. Purity can be assessed by any method known in the art including gel electrophoresis and staining and spectrophotometric techniques, such as SDS page and Size Exclusion Chromatography (SEC).

[0197] An affinity tag and / or linker sequence may be removed prior to use of the enzyme. In certain conditions, it may be preferable to leave the tag in place and use the enzyme with a tag and / or linker attached.

[0198] Any suitable media and other culture conditions may be used. Suitably, the host cell is cultured in a conventional medium containing appropriate carbon sources, nitrogen sources, amino acids, vitamins, etc. under aerobic conditions while controlling temperature, pH, and the like. The medium may include glucose, pyruvate, etc. as a carbon source, and sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, and the like may be used as an inorganic compound. In addition, amino acids, vitamins, appropriate precursors, and the like may be included. These media or precursors may be added to a culture solution in a batch or continuous manner.

[0199] During culture of a host cell, any suitable compound may be added to adjust the pH of the culture, for example a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid. In addition, during the culture, production of foam may be inhibited by using an anti-foaming agent such as fatty acid polyglycol ester. To maintain an aerobic state of the culture solution, oxygen or oxygen-containing gases may be injected into the culture solution, and in order to maintain anaerobic and aerobic states, gases are not injected or nitrogen, hydrogen, or carbon dioxide gas may be injected.

[0200] A host cell culture may be maintained at a suitable temperature, for example for E. coli cells the culture may be maintained at 20° C to 45° C, suitably 30° C to 37° C. The culturing period may be continued until a desired production amount of the desired enzyme is obtained, suitably 10 to 100 hours.

[0201] The method may further comprise a step of extracting the recombinant enzyme from the host cell culture. Such methods are well known in the art, and include lysis of the host cells, followed by centrifugation, filtration, anion exchange chromatography, crystallization, and / or HPLC, but is not limited to these examples.

[0202] The extracted enzyme may be purified. Any suitable protein purification method may be used, for example UHPLC-MS.

[0203] Composition comprising the enzyme

[0204] The present invention also provides a composition comprising an enzyme of the invention.

[0205] The enzyme may be an enzyme as defined in SEQ ID NO. 1 or a variant thereof, for example an I RED enzyme comprising a mutation as described herein, for example a mutation at position 35, 61, 93, 98, 136, 164, 199, 205, 209, 216, 231, 233, and / or 241 as described herein. Suitably, the I RED enzyme is SEQ ID NO. 1 of Rhizobium sullae. A variant may be an enzyme of any one of SEQ ID NO. 3 to 47.

[0206] A composition may comprise one or more carriers or excipients. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle. A carrier or excipient may be any suitable carrier or excipient available to the skilled person, for example amino acids, sugars and sugar alcohols and surfactants.

[0207] A composition may be a dry composition. A dry composition may be produced by any suitable technique, including air-drying, spray-drying, vacuum-drying or lyophilisation (freeze- drying), of a solution comprising the enzyme. A suitable excipient in a dried composition may be trehalose. A dry composition may be a powder or lyophilizate.

[0208] A composition may be a liquid. A liquid may be formed by placing the purified enzyme in a suitable solution, for example a buffer solution, or by reconstitution of a dry composition as described herein. A liquid composition is suitably aqueous, but may be non-aqueous. Therefore, the present invention may also provide a method of producing the enzyme, comprising adding the dry composition comprising the enzyme a buffer. The buffer is typically aqueous and may in some embodiments be water. The present invention also provides a kit, wherein the kit comprises a composition comprising an enzyme of the invention, and one or more buffers. The composition may be in dry form, and a buffer may be a reconstitution buffer. A buffer may be an aqueous buffer. A kit may further include reagents for carrying out the enzymatic reactions, substrates for assessing the activity of enzymes, as well as reagents for detecting the products. The kits can also include reagent dispensers and instructions for use of the kits.

[0209] A composition of the present invention may comprise the enzyme in any suitable concentration. For example, a composition may comprise the enzyme at a concentration of 0.01 g / L to 20 g / L.

[0210] Solid support

[0211] The present invention also provides a solid support having immobilized thereon an enzyme as described herein.

[0212] A solid support may be a membrane, resin, solid carrier, or other solid phase material. A solid support can be composed of organic polymers such as polystyrene, polyethylene, polypropylene, polyfluoroethylene, polyethyleneoxy, and polyacrylamide, as well as copolymers and grafts thereof. A solid support can also be inorganic, such as glass, silica, controlled pore glass (CPG), reverse phase silica or metal, such as gold or platinum. The configuration of a solid support can be in the form of beads, spheres, particles, granules, a gel, a membrane or a surface. Surfaces can be planar, substantially planar, or non-planar. Solid supports can be porous or non-porous, and can have swelling or non-swelling characteristics. A solid support can be configured in the form of a well, depression, or other container, vessel, feature, or location.

[0213] The enzyme may be a wild type I RED enzyme, for example the enzyme of SEQ ID NO. 1 or a variant of the wild type enzyme comprising a mutation as described herein, for example a mutation at position 35, 61, 93, 98, 136, 164, 199, 205, 209, 216, 231, 233, and / or 241 as described herein. Suitably, the I RED enzyme is SEQ ID NO. 1 of Rhizobium sullae .

[0214] Suitably, an enzyme as described herein is immobilized on a solid support in a manner such that it retains its activity, ands suitably in relation to a variant it retains its improved properties relative to the wild type IRED SEQ ID NO. 1 enzyme. By immobilizing an enzyme on a solid support, the enzyme can be more easily retained, recycled and / or reused in subsequent reactions after a reaction cycle has taken place. Therefore, immobilization of an enzyme may further improve efficiency and reduce costs.

[0215] The immobilized enzyme may be in dry form, e.g. lyophilised, for example as described above.

[0216] An enzyme may be bound to a support non-covalently or covalently. Various methods for conjugation and immobilization of enzymes to solid supports (e.g., resins, membranes, beads, glass, etc.) are well known in the art and described in the art.

[0217] The present invention provides a method of immobilizing an enzyme on a solid substrate, the method comprising i) incubating a solid support with an enzyme as described herein; and ii) covalently or non-covalently linking the enzyme to the support.

[0218] The enzyme may be a wild type I RED enzyme, for example the enzyme of SEQ ID NO. 1 or a variant of the wild type enzyme comprising a mutation as described herein, for example a mutation at position 35, 61, 93, 98, 136, 164, 199, 209, 216, 231, 233, and / or 241 as described herein. Suitably, the IRED enzyme with SEQ ID NO. 1 of Rhizobium sullae. The variant may be an enzyme of any one of SEQ ID NO. 3 to 47.

[0219] The enzyme may be pure or impure. An impure enzyme may be provided as a cell lysate. Thus, the enzyme can be immobilised onto the bead by expressing the protein in a cell culture, lysing the cell culture and contacting the bead with the lysate.

[0220] A pure source typically does not include other biological molecules, for example other proteins, or nucleic acids, lipids or carbohydrates, which may become immobilized to the solid support. The enzyme to be immobilised may form more than 95% by dry weight of the pure source.

[0221] Suitably, there may be provided a population of solid supports (for example beads), wherein at least some of the individual members of the population have immobilized an enzyme as described herein. The enzyme on the different members of the population may all be the same, or may be different. The enzymes on each member of the population may be individually selected from a wild type IRED enzyme, for example the enzyme of SEQ ID NO. 1 , a variant of the wild type enzyme a mutation as described herein, for example a mutation at position 35, 61, 93, 98, 136, 164, 199, 205, 209, 216, 231, 233, and / or 241 as described herein. The variant may be an enzyme of SEQ ID NO. 3 to 47. A solid support as described herein may additionally comprise one or more co-factors. A cofactor may be immobilized on the support or may be provided on a different support or elsewhere in the reaction. A co-factor may be selected from NADH, NAD+, NADPH, NADP+. Suitably, a co-factor is NADP.

[0222] Method of reaction

[0223] The present invention provides, in a second aspect, the use of an enzyme of the first aspect as a catalyst in an reductive amination reaction. Also provided is a method for the preparation of an amine, wherein the method comprises reacting a carbonyl compound with an amine in an reductive amination reaction, in the presence of a variant enzyme as described in the first aspect.

[0224] The present invention also provides, in a third aspect, a method for the preparation of a compound of N1-((1 ,2S)-2 phenyl cyclopropyl)cyclohexane-1,4-diamine, or a derivative thereof wherein the method comprises reacting a compound of Formula II with a carbonyl compound in the presence of an I RED enzyme. The carbonyl compound may be an aldehyde or a ketone,

[0225] The compound of formula (I) may have an enantiomeric excess of at least about 80%. The compound of formula (I) may have an enantiomeric excess of at least about 85%. The compound of formula (I) may have an enantiomeric excess of at least about 90%. The compound of formula (I) may have an enantiomeric excess of at least about 92%. The compound of formula (I) may have an enantiomeric excess of at least about 95%. The compound of formula (I) may have an enantiomeric excess of at least about 99%. For example, the compound of formula (I) may have an enantiomeric excess in the range of from about 95% to about 99%.

[0226] The compound of Formula II may be as described herein.

[0227] The I RED enzyme may be any suitable enzyme which is capable of conducting a reductive amination reaction, suitable at a large scale. Suitably, the enzyme may be the enzyme of SEQ ID NO. 1. Suitably, the enzyme may be a variant enzyme thereof, as described herein. Most suitably, the enzyme is a variant of SEQ ID NO. 1 , for example as defined in any one of SEQ ID NOs. 3 to 47. Where the enzyme is an enzyme as described in the first aspect, it is provided for use as a catalyst in a method of reacting an amine and a carbonyl compound to provide an amine compound.

[0228] Suitably, such a mutant enzyme can accept a wide range of substrates.

[0229] The carbonyl compound may be a ketone. Where the carbonyl compound is a ketone, it may be a cyclic ketone. For example, the ketone may be selected from a substituted or unsubstituted cyclopropanone, cyclobutanone, cyclopentanone, cyclohexanone, cycloheptanone, and cyclooctenone.

[0230] It may be that the ketone is a substituted or unsubstituted cyclohexanone. For example, the ketone may be selected from cyclohexanone, aminocyclohexanone and Boc- aminocyclohexanone.

[0231] It may be that the ketone is a 4-substituted cyclohexanone. For example, the ketone may be 4-aminocyclohexanone or 4-Boc-aminocyclohexanone.

[0232] Suitably, a carbonyl compound may be sterically the same or similar to the carbonyl compound of Formula III.

[0233] The method may be conducted in the presence of a reducing agent suitable for a reductive amination reaction. As the skilled person would appreciate, in a reductive amination reaction, an aldehyde or ketone and an amine (e.g. compound of formula (II)) react to form an imine intermediate. The imine intermediate is then reduced as a result of hydride donation by a reducing agent to form the new amine product (e.g. compound of formula (I)). In embodiments of the invention, suitable reducing agents include: nicotinamide adenine dinucleotide phosphate (NADPH) and nicotinamide adenine dinucleotide (NADH). Preferably, the reducing agent is nicotinamide adenine dinucleotide phosphate (NADPH).

[0234] The method may comprise providing a cofactor regeneration system capable of converting NADP+ to NADPH, or NAD+ to NADH. A cofactor recycling system may comprise formate and formate dehydrogenase (FDH), glucose and glucose dehydrogenase (GDH), glucose-6- phosphate and glucose-6-phosphate dehydrogenase, a secondary alcohol and alcohol dehydrogenase, or phosphite and phosphite dehydrogenase.

[0235] The reducing agent may be present in a concentration in the range of from about 0.1% to about 10% by weight of the compound of formula (II).

[0236] The method may be conducted in the presence of a buffer solution. The buffer solution may be an alkaline buffer having a pH in the range of from about 7 to about 9. The buffer solution may be selected from: phosphate buffer (e.g. a potassium phosphate buffer) and Tris buffer (e.g. Tris HCI buffer). The buffer solution may be phosphate buffer (e.g. potassium phosphate buffer).

[0237] The buffer solution may have a concentration of about 0.01 M to about 1M.

[0238] The method may be conducted at a pH in the range of from about 5 to about 10. The method may be conducted at a pH in the range of from about 6 to about 9. The method may be conducted at a pH in the range of from about 6.5 to about 8. The method may be conducted at a pH in the range of from about 6.8 to about 8. The method may be conducted at a pH in the range of from about 7 to about 8.

[0239] The method may be conducted in a polar organic solvent. The polar organic solvent may be a non-halogenated polar organic solvent. For example, the non-halogenated polar organic solvent may be selected from: dimethyl sulfoxide (DMSO), / V, / V-dimethyl formamide (DMF), acetone and acetonitrile. Preferably, the solvent is DMSO.

[0240] The method may be conducted at a temperature of no more than about 40 °C. The method may be conducted at a temperature in the range of from about 20 °C to about 40 °C. The method may be conducted at a temperature of about 30 °C.

[0241] The method may be performed for a time period of at least about 12 hours. The method may be performed for a time period of from about 1 hour to about 48 hours.

[0242] An enzyme as described herein may be capable of producing an amine, for example an amine of Formula I as described herein, at a substrate loading concentration of at least about 1 g / L with a percent conversion of at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%, in a reaction time of about 24 h or less, under suitable reaction conditions.

[0243] A method of the invention may comprise one or more additional steps, for example extracting the product from the reaction, and processing the product of the reaction, for example by providing it in the form of a composition with one or more excipients or carriers.

[0244] Exemplary “suitable reaction conditions” are provided in the present disclosure and illustrated by the Examples. Suitable reaction conditions with respect to concentration or amount of substrate, enzyme, cofactor, any coenzyme, buffer, co-solvent, pH, temperature, reaction time, and condition of the enzyme (for example on a support) may be determined by a skilled person, and may be based upon the information provided herein and the Examples. Reactor

[0245] The present invention also provides a chemical reactor comprising an enzyme as described herein. The enzyme may be provided on a support, for example as described above.

[0246] The enzyme may be a wild type I RED of SEQ ID NO. 1 or a variant enzyme as described herein, for example an enzyme of any one of SEQ ID NO. 3 to 47.

[0247] A chemical reactor may comprise a reaction chamber in which the reductive amination reaction takes place. The chemical reactor may be a bioreactor, a flow reactor, a continuous stirred tank reactor, a continuous flow reactor, or a batch reactor or a fed-batch reactor. These reactors typically convert substrates to products, in particular chemical products of commercial value. These reactors are typically large-scale for industrial biocatalysis.

[0248] The continuous flow reactor may be a fluidised bed flow reactor. A flow reactor typically comprises an inlet for one or more substrates into the flow reactor and an outlet from the flow reactor for one or more reaction products. The flow reactor may also comprise means to propel the movement of substrates into and products out of the flow reactor. Such means may comprise, for example, a pump.

[0249] An I RED enzyme, for example as described herein, may be immobilized in a reactor, for example on a solid substrate. An immobilised enzyme may be useful in a flow reactor because the support may be easily retained in a reaction chamber, and controlled, for example by controlling the flow across or through the support.

[0250] A suitable chemical reactor is typically one for use at an industrial scale. This will depend on the nature of the chemical reaction, but will typically use litres, tens of litres or hundreds of litres of reagents per day and produce grams, hundreds of grams or kilograms of product per reactor per day. Suitably, kilograms of enzyme (complete dry weight of bead plus enzyme) may be present in the reactor.

[0251] An aspect of the invention may comprise a method of carrying out an enzyme-catalysed reductive amination reaction as described herein, comprising the steps of: contacting one or more reaction substrates with an AmRed enzyme as described herein, wherein the enzyme is immobilised on a solid support, introducing one or more reaction substrates into a chemical reactor; and optionally collecting one or more reaction products from the reactor. Suitably, a substrate may be provided with one or more buffers, solvents, cofactors, enzymes, and non-biological catalysts.

[0252] Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of them mean “including but not limited to”, and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

[0253] Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and / or steps are mutually exclusive. The invention is not restricted to the details of any foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.

[0254] The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

[0255] Examples

[0256] Materials and Methods

[0257] All chemicals and biological materials were obtained from commercial suppliers. Compound “2” and compound “3” from enamine, compound “1” from. NADPH from Melford, Glucose dehydrogenase from Prozomix. Escherichia coli T7 express, NEBuilder HIFI, NEBridge Golden Gate Assembly, NEB KLD mix from New England Biolabs. LB agar, LB medium and TB medium from Foremedium, oligonucleotides) and codon optimised genes (amino acid sequences in Table 4) from Integrated DNA Technologies. CloneAmp polymerase from Takara bio. All other chemicals were purchased from Sigma Aldrich.

[0258] Below, reference is made to the following compounds, as shown in Figure 1

[0259] • Compound “1” N1-((1 ,2S)-2-phenylcyclopropyl)cyclohexane-1 ,4-diamine

[0260] • Compound “2” racemic trans-phenylcyclopropanamine

[0261] • Compound “3” 4-amino cyclohexanone

[0262] Growth Media

[0263] Escherichia coli strains were grown in either LB or TB autoinduction media. Where applicable, media were supplemented with the appropriate antibiotic.

[0264] Cloning of reductive aminase sequence SEQ ID NO. 1

[0265] The DNA sequences encoding reductive aminase enzyme sequence SEQ ID NO. 1 , IRED-At, IRED-Pc, IRED-Ss, IRED-Se, IRED-Nf and IRED-Ea were codon optimised, synthesised and cloned into an E. coli expression vector pBbE7k using golden gate assembly. Assembled expression vector was used to transform chemically competent E. coli T7 express by heat shock and transformants were selected on LB agar containing a selective antibiotic Kanamycin. E.coli cells were pelleted using centrifugation and lysed using sonication to release recombinant enzyme. Enzyme was separated from lysate by nickel-NTA chromatography. Either crude lysate or purified enzyme was used in the biotransformation reaction. All constructs were verified by sanger sequencing.

[0266] Mutagenesis of reductive aminase sequence SEQ ID NO. 1

[0267] Active site library was generated by inverse PCR using cloneAmp polymerase and SEQ ID No. 1 as template. NNK codons were introduced in the forward primer and circularised using NEB KLD mix. Mutants were constructed by amplifying DNA fragments containing the desired mutations from the wild type gene (SEQ ID NO. 2) using cloneAMP polymerase. Forward primers encoded the desired mutation and introduced a 20 bp overhang complimentary to the fragment it was assembled with. Fragments were cloned into pBbE7k previously linearized by PCR using NEBuilder HIFI assembly. Assembled vectors were used to transform chemically competent E. coli T7 express by heat shock. Transformants were selected on LB agar containing kanamycin (50 pg / mL).

[0268] Purification and assay of reductive aminases Inocula for flask cultures were developed by inoculating the relevant strain into LB medium (5 mL) supplemented with kanamycin (50 pg / mL) and incubating overnight (250 rpm, 37 °C). The cultures were used to inoculate TB autoinduction medium (400 mL) supplemented with kanamycin (50pg / mL) and the cultures incubated (250 rpm, 30 °C, 24 h). Cultures were harvested by centrifugation (4000 rpm, 10 min). Cell pellets were resuspended in lysis buffer (0.1 M KPi, 0.3 M NaCI, pH7, 40 mL) supplemented with lysozyme (5 mg / mL) and incubated (30 °C, 250 rpm, 30 min). Pellets were lysed further by sonication (10s on, 20 s off) and pelleted by centrifugation (12,000 rpm, 1 h). Enzymes were purified on Ni-NTA column preequilibrated with lysis buffer. Cell lysate was flowed through the column followed by two washes with 5 column volumes of wash buffer (0.1 M KPi, 0.3 M NaCI, pH7, 20 mM imidazole). Proteins were eluted with 5 column volumes elution buffer (0.1 M KPi, 0.3 M NaCI, pH7, 500 mM imidazole). Proteins were concentrated and buffer exchanged to KPi (0.1 M, pH 7) in a vivaspin column (6000 rpm, 10 °C). Proteins were stored (-80 °C) at a concentration of 1 mg / mL.

[0269] Enzyme panel screen

[0270] Assay reaction mixes (50 uL) contained Formula III (aminocyclohexanone HCI) (20 mM), Formula II rac-Phenylcyclopropylamine HCI (40 mM) and NADPH (0.3 mM) in KPi (0.1 M, pH7) and 10% DMSO. The reaction was initiated by adding purified enzyme (50 uL) and the absorbance measured automatically every 30 s at 340 nM by a Vantastar plate reader (BMG, Germany).

[0271] Small scale biotransformation with reductive aminase SEQ ID NO. 1 and variants

[0272] Inocula for microtiter plates were developed by inoculating the relevant strain into LB medium (180 pL) supplemented with kanamycin (50pg / mL) using a Qpix colony picker. Cultures were incubated overnight (250 rpm, 30 °C). The cultures (2.5 pL) were used to inoculate TB autoinduction medium (150 pL) supplemented with kanamycin (50pg / mL) and the cultures incubated (850 rpm, 30 °C, 24 h). Cultures were harvested by centrifugation (4000 rpm, 10 min). Cell pellets were resuspended in lysis buffer 2 (0.1 M KPi, pH 7, 80 pL, 5 mg / mL lysozyme) and incubated (30 °C, 250 rpm, 15 min). Cells were pelleted by centrifugation (4000 rpm, 30 min) and the lysate (50 uL) transferred to a separate microtiter plate. To the lysate was added NADPH (1 mg / ml), a compound of Formula III (2 mg / ml), D-glucose (5 mg / ml), glucose dehydrogenase (2.5 mg / ml) and a compound of Formula II (4 mg / ml). All compounds were added from a 10x concentrate made up in KPi (pH 7.0, 0.1M) apart from compound of Formula II HCI 10x concentrate that was made up in DMSO. The microtiter plate was sealed before being incubated (30 °C, 18 h, 850 rpm). The reaction was quenched with aqueous HCI solution (100 pL, 1M) before being resealed and centrifuged (4000 rpm, 30 min). The supernatant was transferred to a separate 96 well microtiter plate and sealed before analysis by UHPLC-MS.

[0273] A product peak of Formula I N1-((1 ,2S )-2-phenylcyclopropyl)cyclohexane-1 ,4-diamine was identified by UPLC (Figure 3) and shown to have identical molecular weight to a Formula I standard by mass spectrometry (Figure 3).

[0274] Computational identification of mutagenesis hot spots

[0275] Potential active site residues were identified by producing an enzyme structure of IRED of SEQ ID NO. 1 with the substrate and co factor bound. 12 residues were identified with close proximity to the bound substrates.

[0276] A list of amino acid residues of SEQ ID NO. 1 identified as key active site positions is shown in Table 1.

[0277] Table 1

[0278] The methodology described in WO2022254192 (Methods for enzyme engineering) was used to identify hotspots in the IRED enzyme of SEQ ID NO. 1 for mutation to stabilise the transition state and improve enzyme performance. 15 residues were identified.

[0279] List of amino acid residues of SEQ ID NO. 1 enzyme identified as key positions to mutate: V64, P98, F126, L199, V136, L182, L216, S164, Q205, D233, S231 , D259

[0280] Analytical methods

[0281] Biotransformation reactions were analysed using an Agilent 1290 LIHPLC system equipped with both UV detector and an Infinity Lab LC / MSD iQ. Separation was achieved using a poroshell 120 EC-C18 column with H2O buffered with 0.1% formic acid and MeOH buffered with 0.1% formic acid as the mobile phase. A starting gradient of 99% to 95% aqueous over 1 minute was followed by a 0.1-minute hold, followed by a 95% to 5% aq gradient over 0.3 minutes and a 0.1-minute hold. Finally, a 5% to 99% aq gradient over 0.1 minutes was followed by a 0.4-minute hold. Products were identified by comparing the retention times with authentic, commercial standards, and concentrations were determined from calibration curves.

[0282] Panel screen

[0283] A panel of IREDs were synthesized and cloned into E. coli T7 express. Following protein expression, each I RED was purified and the activity with a compound “2” (of the reaction scheme of Figure 1) and “3” (of the reaction scheme of Figure 1) was tested in enzyme assays (Fig. 2). Wild type I RED of SEQ ID NO. 1 was shown to be the most active with low activity also observed with IR-Ea. To confirm the product was “1” (of the reaction scheme of Figure 1) and the enantiomer produced, a small-scale biotransformation was performed and the product analysed by HPLC-MS (Fig. 3). A peak with the same retention time as the authentic standard was observed (Fig. 3A) and the molecular weight corresponded to that of “1” (Fig. 3B) confirmed that the correct product had been made at a conversion efficiency of 23% with 2 g / L of substrate. To confirm that the bioactive enantiomer, 1 ,2S-“1” was produced, biotransformations were performed with enantiopure 1 S,2 - “2”, 1 ,2S- “2” and racemic-“2” and analysed by HPLC. When 1 ,2S- “2” was used as substrate (Fig.4A), a peak for the production of 1 ,2S-“1” was observed with 83% conversion. There was negligible formation (<1%) of the undesired enantiomer, 1 S.2 -1 when enantiopure 1 S,2 - “2” was used as the substrate (Fig. 4B). With racemic-“2”, 45% conversion to compund-“1” was observed (Fig. 4C) indicating that SEQ ID NO. 1 had a strong preference for 1 ,2S - “2”. Production of 1 ,2S- “1” showed that SEQ ID NO. 1 was an excellent start point for enzyme engineering to improve activity.

[0284] 12 residues were identified that were within 10A of the bound substrate (See Table 1). These residues were mutated using NNK codons, which encodes 32 codons covering all 20 proteinogenic amino acids. 95 colonies were picked for each mutated residue and assayed for production of compound “1” in small scale biotransformations. After comparing activity to IRED with SEQ ID NO.Icontrol, three mutations, T209V, A241 R and A241T, were shown to have >110% activity (Fig. 5). These two site mutations were combined in a second active site library where T209V was fixed and A241 mutated with an NNK library and A241 R fixed and T209 mutated with an NNK library (Fig. 6). To increase the selection pressure, the substrate concentration was increased from 2 g / L to 10 g / L. Mutations were shown to be additive with T209V.A241 R (290 %) and T209V, A241T (326 %) having slightly higher activity than the A241 R (267 %) parent. Mutations within the active site were shown to improve the activity of the wild type I RED enzyme (SEQ ID NO.1). To try and improve enzyme fitness for bioprocess needs, 15 sites were predicted that stabilised the transition states during the production of compound “1” . These sites were combined into 4 libraries each containing 4 residues which could be mutated to one of four amino acids, one of which was a silent mutation to act as a control. In total this gave 256 possible variants per library and 1024 total variants (Table 2). For each library, 950 colonies were picked and assayed in small scale biotransformations using 2 g / L of substrate.

[0285] Table 2: mutagenic libraries predicted by to improve production of Compound “1”.

[0286] 71 colonies had >110% activity compared to the wild type enzyme. All were sequenced revealing 44 independent variants containing from one to four mutations. The activity was confirmed in a second biotransformation with substrate concentration increased to 10 g / L (Fig.

[0287] 7).

[0288] 26 variants were shown to have activity equal to or greater than the wild type (SEQ ID NO. 1 ; Fig. 7). These 26 variants were retested at higher pH which favours reductive amination (Fig.

[0289] 8). The highest activity was observed at pH 9 with 67% conversion to the product, a twofold improvement over the wild type.

[0290] Combining library with active site hits

[0291] Two of the most active variants at pH 9 from library 2 contained the mutations L216Y,D233S and I61T,L216Y,D233S. These mutations were combined with the most active mutants from the active site screen (T209V.A241 R) and screened with 10 g / L substrate at pH 8 and 9 (Fig.

[0292] 9). In both cases, inclusion of the active site mutations improved activity further resulting in a strain showing conversion 2.8 fold higher at pH 8 and 1.8 fold higher at pH 9 than the wild type strain (SEQ ID NO. 1 ;Table 3).

[0293] Table 3: Conversion by each variant at (pH 8 and pH 9)

[0294] Table 4: Amino acid sequences of the IREDs used in this study

[0295] SEQUENCE ID N0.1

[0296] ORGANISM: Rhizobium sullae

[0297] UNIPROT ID / DATABASE ENTRY: WP_027512056.1

[0298] 1 MKRSITVLGT GRMGSALARA LLHAGHRTTV WNRTIQKAEP LAALGATVAP SVLEAVNAAE

[0299] 61 IIIVNVSDYQ ATAAIMRNDA IASAVRGKLI VELTSGTPHG AREAAEFWAE HGASYLDGAI

[0300] 121 MATPDFIGTD AGTILVSGSS QAFDANEDMF RALGGNVQHI GEESGRANAL DSALLALMWG

[0301] 181 ALFGTLHAIA VCQAEEIDLG ELAQQWNATA PWEGLVADL IKRTNAGRFA SDDETLSSIS

[0302] 241 AHYGAFQHLL ELMEAREIDR SWLGYDAIF QRAIAAGQLH EDFAALSQFL GKSA

[0303] SEQUENCE ID NO.2 NZ_CP104143.1:c3485897-3485013 NAD(P)-binding domain-containing protein [protein_accession=WP_027512056.1] [organism=Rhizobium sullae] [name=NAD(P)-binding domain-containing protein]

[0304] ATGAAGCGTTCAATCACAGTTTTGGGAACCGGCCGTATGGGATCGGCACTCGCCCGGG CCCTGCTTCATG

[0305] CGGGTCATCGGACGACGGTCTGGAACAGGACGATACAAAAGGCCGAACCACTAGCCG CGCTCGGCGCGAC

[0306] TGTCGCGCCATCCGTGCTGGAAGCTGTAAATGCGGCAGAGATTATCATCGTGAATGTA AGCGACTATCAG

[0307] GCAACAGCAGCAATTATGCGCAACGATGCTATTGCTTCAGCCGTTCGCGGCAAACTGA

[0308] TCGTGGAACTGA

[0309] CCTCGGGAACGCCGCATGGCGCACGCGAAGCAGCTGAATTTTGGGCTGAGCACGGAG CCAGCTATCTCGA

[0310] TGGCGCGATCATGGCCACGCCCGATTTCATCGGCACAGATGCGGGGACGATCCTGGT CTCGGGGTCAAGT

[0311] CAGGCTTTCGACGCGAACGAGGACATGTTCCGTGCCTTGGGCGGCAATGTCCAGCATA TCGGGGAGGAAT

[0312] CGGGACGCGCGAACGCGCTTGATAGCGCGCTGCTTGCACTGATGTGGGGCGCACTTT

[0313] TTGGAACGCTCCA

[0314] TGCGATCGCTGTGTGTCAGGCCGAAGAGATCGACCTCGGCGAATTGGCGCAGCAGTG GAACGCAACAGCG

[0315] CCTGTGGTCGAGGGACTTGTCGCTGACCTCATCAAGCGGACGAATGCTGGCCGTTTTG CCAGCGACGACG

[0316] AGACGCTCTCGTCAATTTCTGCACACTACGGCGCATTCCAGCATCTCTTGGAACTGATG GAGGCGCGTGA

[0317] AATCGACCGCTCCGTGGTCCTCGGTTACGACGCAATCTTCCAACGGGCGATTGCAGCT GGCCAGCTACAT

[0318] GAAGATTTCGCGGCGTTATCACAATTTCTCGGAAAGTCCGCATAA

[0319] Table 5

[0320]

[0321] 47 | SEQ ID NO. 1 with TA / substitution at position 209 and A / T substitution at position 241 T209V, A241T

Claims

CLAIMS1. A RedAm enzyme of SEQ ID NO. 1 , wherein the enzyme comprises a mutation at one or more positions selected from 35, 61, 93, 98, 136, 164, 199, 205, 209, 216, 233 and 241.

2. A RedAm enzyme of SEQ ID NO. 1 , wherein the enzyme comprises a residue substitution at one or more positions selected from 35, 61, 93, 98, 136, 164, 199, 205, 209, 216, 233 and 241.

3. A RedAm enzyme according to claim 2, wherein the enzyme comprises an I35S, 161 F, I61Q, I61T, L93T, P98K, V136C, , S164A, S164I, S164L, L199M, Q205C, T209V, L216Y, S231 I, S231Q, D233E, D233S, D233G, A241T or A241 R mutation.

4. A RedAm enzyme according to any one of claims 1 to 3, wherein the enzyme comprises a T209V and a A241R substitution; a T209V and a A241T substitution an L216Y and D233S substitution; an I61T.L216Y and D233S substitution; an I61T,L216Y,D233S,T2O9V and A241 R substitution; or an L216Y.D233S, T209V and A241R substitution.

5. A RedAm enzyme according to any one of claims 1 to 3, wherein the enzyme comprises a combination of mutations as set forth in Table 5.

6. A RedAm enzyme according to any one of claims 1 to 3, wherein the enzyme comprises a sequence of any one of SEQ ID NO. 3 to 47.

7. A RedAm enzyme according to any one of claims 1 to 6 wherein the RedAM enzyme has reductive amination activity at 1.1 or more fold activity of the enzyme of SEQ ID NO. 1 in the same reaction.

8. A method of producing a chiral or achiral amine by a reductive amination reaction, wherein the method is catalysed by an enzyme according to any one of claims 1 to 7.

9. A method of forming a compound of formula (I) or a salt thereof, the method comprising reacting a compound of formula (II), or a salt thereof, with an aldehyde or ketone in the presence of a RedAm enzyme to form the compound of formula (I):whereinX is -CH2R or -CH(R’)2;R is a side chain of the reacted aldehyde; each R’ is a side chain of the reacted ketone, optionally wherein the two R’ groups together form a ring comprising the two R’ groups and the -CH- of X; wherein R or one R’ group is optionally substituted with halo, OR1or NR2R3, wherein:R1is H or Ci-4 alkyl, andR2and R3are independently selected from H and C1.4 alkyl; and bonds labelled with * are in the trans configuration.

10. A method according to claim 9, wherein the enzyme has the sequence of SEQ ID NO. 1.

11. A method according to claim 9 wherein the enzyme is a variant enzyme of any one of claims 1 to 7.

12. A method according to any one of claims 8 to 11 , wherein the method comprises reacting a compound of Formula II with an aldehyde.

13. A method according to any one of claims 8 to 12, wherein the method comprises reacting a compound of Formula II with a ketone.

14. A method according to any one of claims 8 to 13, wherein the method comprises reacting a compound of Formula II with 4-aminocylcohexanone HCI salt (Formula III).

15. A method according to claim 14, wherein the method comprises reductive amination of Formula II and 3, 4-amino cyclohexanone of Formula III.NH2"O Formula III16. A method according to any one of claims 8 to 15, wherein the reaction is performed at pH 7 to 9.

17. A nucleic acid molecule encoding a RedAm enzyme of any one of claims 1 to 7.

18. An expression vector comprising a nucleic acid molecule according to claim 18.

19. A host cell comprising nucleic acid molecule or expression vector according to claim 17 or 18.

20. A solid support comprising immobilised thereon an enzyme of any one of SEQ ID NOs. 1 or 3 to 47, or a combination thereof.

21. A reaction chamber comprising an enzyme of any one of SEQ ID NO. 1 or 3 to 47, or a combination thereof.

22. A reaction chamber according to claim 21 for carrying out a method according to any one of claims 8 to 16.

Citation Information

Patent Citations

  • Phosphonyldipeptides useful in the treatment of cardiovascular diseases

    WO1995033836A1

  • (hetero)ARYL cyclopropylamine compounds as LSD1 inhibitors

    WO2013057322A1

  • Methods for enzyme engineering

    WO2022254192A1

  • Method for producing ephedrine through imine reductase

    CN110564788A

  • Method for preparing hydrazine compound

    CN117070576A